Reduction of chickens use to perform in vitro... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research <input type="hidden" id="meta-article-title" value="Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model" /> { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/11-1135" }, "headline": "Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and...", "datePublished": "2022-10-04T16:14:32", "dateModified": "2024-10-01T10:42:43", "author": [ { "@type": "Person", "name": "Sara Arias-Maroto" }, { "@type": "Person", "name": "Kelsilandia Aguiar-Martins" }, { "@type": "Person", "name": "Javier Regidor-Cerrillo" }, { "@type": "Person", "name": "Luis Ortega-Mora" }, { "@type": "Person", "name": "Virginia Marugan-Hernandez" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "We have developed an in vitro model for the evaluation of potential anticoccidial properties of novel compounds aimed to control chicken coccidiosis, a costly disease for the poultry industry. This disease is caused by protozoan parasites of the genus Eimeria (Apicomplexa), and it is mainly controlled by chemoprophylaxis with ionophores and chemical anticoccidials; however, there is an overall agreement about the limitation of these traditional drugs and the need to improve current methods of control. Anticoccidial activities of novel compounds is currently evaluated by expensive experiments that involve large numbers of chickens. The use of our in vitro model for the pre-screening of essential oils led to a reduction of 67% of the chickens used in the in vivo trials for validation. Eimeria parasites can only complete their life cycle in their animal host, therefore chickens are required for their propagation as they cannot be propagated in vitro. In this study, we describe how further optimisation of this in vitro model by miniaturisation can have an additional impact in reduction of the number of chickens used for the generation of parasite stocks for provision of the in vitro model. We have estimated that the use of one chicken could support the evaluation of 10 compounds with a 96-well plate format versus only two compounds with a 24-well plate format, which means an 80% reduction in chicken use. In this study we have proved that the miniaturisation into a 96-well plate format perfectly mimics the invasion and replication observed before in the 24-well plate format. In addition, the 96-well plate format has allowed the simultaneous pre-screening of higher numbers of anticoccidial drugs at different concentrations following streamlined protocols in a more cost-effective way, factors that are beneficial for a wider uptake of the model by other researchers investigating anticoccidial compounds." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/11-1135", "name": "Reduction of chickens use to perform in vitro pre-screening of novel..." } } ] } Home Browse Reduction of chickens use to perform in vitro pre-screening of novel... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Arias-Maroto S, Aguiar-Martins K, Regidor-Cerrillo J et al. Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.12688/f1000research.123102.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Brief Report Revised Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] Sara Arias-Maroto 1 , Kelsilandia Aguiar-Martins 1 , Javier Regidor-Cerrillo 2 , Luis Ortega-Mora https://orcid.org/0000-0002-4986-6783 2 , Virginia Marugan-Hernandez https://orcid.org/0000-0003-1512-4682 1 Sara Arias-Maroto 1 , Kelsilandia Aguiar-Martins 1 , [...] Javier Regidor-Cerrillo 2 , Luis Ortega-Mora https://orcid.org/0000-0002-4986-6783 2 , Virginia Marugan-Hernandez https://orcid.org/0000-0003-1512-4682 1 PUBLISHED 01 Oct 2024 Author details Author details 1 Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, Hertfordshire, AL8 7TA, UK 2 SALUVET-Innova S.L, Madrid, Madrid, 28040, Spain Sara Arias-Maroto Roles: Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation Kelsilandia Aguiar-Martins Roles: Investigation, Methodology, Validation, Writing – Review & Editing Javier Regidor-Cerrillo Roles: Conceptualization, Methodology, Writing – Review & Editing Luis Ortega-Mora Roles: Conceptualization, Writing – Review & Editing Virginia Marugan-Hernandez Roles: Conceptualization, Formal Analysis, Funding Acquisition, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the NC3Rs gateway. Abstract We have developed an in vitro model for the evaluation of potential anticoccidial properties of novel compounds aimed to control chicken coccidiosis, a costly disease for the poultry industry. This disease is caused by protozoan parasites of the genus Eimeria (Apicomplexa), and it is mainly controlled by chemoprophylaxis with ionophores and chemical anticoccidials; however, there is an overall agreement about the limitation of these traditional drugs and the need to improve current methods of control. Anticoccidial activities of novel compounds is currently evaluated by expensive experiments that involve large numbers of chickens. The use of our in vitro model for the pre-screening of essential oils led to a reduction of 67% of the chickens used in the in vivo trials for validation. Eimeria parasites can only complete their life cycle in their animal host, therefore chickens are required for their propagation as they cannot be propagated in vitro. In this study, we describe how further optimisation of this in vitro model by miniaturisation can have an additional impact in reduction of the number of chickens used for the generation of parasite stocks for provision of the in vitro model. We have estimated that the use of one chicken could support the evaluation of 10 compounds with a 96-well plate format versus only two compounds with a 24-well plate format, which means an 80% reduction in chicken use. In this study we have proved that the miniaturisation into a 96-well plate format perfectly mimics the invasion and replication observed before in the 24-well plate format. In addition, the 96-well plate format has allowed the simultaneous pre-screening of higher numbers of anticoccidial drugs at different concentrations following streamlined protocols in a more cost-effective way, factors that are beneficial for a wider uptake of the model by other researchers investigating anticoccidial compounds. READ ALL READ LESS Keywords in vitro model, miniaturisation, animal reduction, high throughput, anticoccidial compounds, chicken coccidiosis, Eimeria species Corresponding Author(s) Virginia Marugan-Hernandez ( [email protected] ) Close Corresponding author: Virginia Marugan-Hernandez Competing interests: No competing interests were disclosed. Grant information: This work was funded by an NC3Rs Skills and Knowledge transfer grant – reference NC/W000881/1. Copyright: © 2024 Arias-Maroto S et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Arias-Maroto S, Aguiar-Martins K, Regidor-Cerrillo J et al. Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.12688/f1000research.123102.2 ) First published: 04 Oct 2022, 11 :1135 ( https://doi.org/10.12688/f1000research.123102.1 ) Latest published: 01 Oct 2024, 11 :1135 ( https://doi.org/10.12688/f1000research.123102.2 ) Revised Amendments from Version 1 The new version of the manuscript has included all the recommendations done by the reviewers. It also provides new material (including two new figures) and new statistical analysis to support authors’ new findings and claims. The new version of the manuscript has included all the recommendations done by the reviewers. It also provides new material (including two new figures) and new statistical analysis to support authors’ new findings and claims. See the authors' detailed response to the review by Benjamin Adjei-Mensah See the authors' detailed response to the review by Joseph D. Turner READ REVIEWER RESPONSES Research highlights Scientific benefit: • Increased throughput for the evaluation of new compounds aimed to control chicken coccidiosis by miniaturising the previous in vitro compound-screening model 3Rs benefit: • Evaluation of novel anticoccidial compounds will require fewer chickens for the generation of parasite stocks Practical benefits: • Reduced variability: simultaneous evaluation of a larger number of anticoccidial compounds • Cost effectiveness: less materials and reagents are necessary per evaluated compounds • Streamlined protocols: 96-well plate format is used through the whole process (cell culture, DNA isolation and qPCR analysis) Current application: • High-throughput screening of potential anticoccidial compounds under investigation by commercial companies and/or public research organisations Potential applications: • Adaptation of equivalent in vitro models for other Eimeria species causing disease in poultry or livestock Introduction The use of in vitro models in biosciences and biomedical research has supported many scientific advances and has emerged as a suitable alternative to reduce time and cost associated to in vivo models by replacing and/or reducing the use of experimental animals in many areas. The implementation of in vitro models for anticoccidial drugs pre-screening as an alternative to in vivo tests has led to the replacement and reduction of an important number of chickens used in research in coccidiosis control ( Thabet et al. , 2017 ). Chicken coccidiosis is an enteric disease caused by different species of the genus Eimeria (Apicomplexa) ( Burrell et al. , 2020 ), characterized by malabsorption, diarrhoea and haemorrhage with an important impact on chicken meat and egg production worldwide, estimated in >£10 billion per annum losses ( Blake et al. , 2020 ). Coccidiosis has also impact on the ‘Five Freedoms’ of animal welfare, more in particular affecting the ‘freedom from discomfort’ and ‘freedom from pain, injury’ (Webster, 2001). Resistance against current anticoccidial drugs, as well as the near-prohibition of ionophores antibiotics in some parts of the world and public concerns about the use of drugs in animals for human consumption, has led to an increased research in new substitute compounds, evidenced by the high number of new publications in the area in recent years (>70 in vivo studies within the past two years involving >32,000 chickens). We previously published an in vitro model to evaluate anticoccidial compounds effects in Eimeria tenella ( Marugan-Hernandez et al. , 2020 ); its use for the pre-screening of two essential oils (garlic and oregano) ( Sidiropoulou et al. , 2020 ) led to the reduction of the number of chickens used for in vivo testing. The results obtained by the use of the in vitro model showed that each of the essential oils exhibited antiparasitic effects at all the different tested concentrations. This supported the selection of a single experimental group (90 animals + control group) to evaluate a combined treatment of both essential oils at a single dose, excluding the evaluation of the compounds separately, since the in vitro model had already proved their dose-independent individual effects . The in vivo experiment was reduced from six experimental groups to only two (test and control), resulting on a reduction of 90×4=360 chickens in a single study (67%). This in vitro model was standardised and applied using a 24-well plate format ( Marugan-Hernandez et al. , 2020 ). In this new study, we aimed to transfer the model to a 96-well plate format. This miniaturisation will reduce the number of parasites needed for compound testing, and therefore the number of chickens used to generate parasites stocks. Additionally, this 96-well plate format will allow the evaluation of a higher number of compounds simultaneously. Eimeria spp. cannot complete their life cycle in vitro , therefore, the natural host (chicken) is necessary to produce stocks for in vitro experimental procedures. The use of one chicken can generate enough parasite material (oocysts) for the pre-screening of two compounds in the 24-well plate format. The use of the 96-well plate format will allow the pre-screening of 10 compounds per animal, this has the potential to reduce local animal use for the study of anticoccidial compounds by 80%. Methods Ethical statement This study was carried out in strict accordance with the Animals (Scientific Procedures) Act 1986 (United Kingdom Parliament Act). All animal studies and protocols were approved by the Royal Veterinary College Animal Welfare and Ethical Review Board (AWERB) and performed under the United Kingdom Government Home Office under specific project licence (PDAAD5C9D). Parasites and chickens Eimeria tenella Wisconsin (Wis) strain ( McDougald & Jeffers, 1976 ) was propagated in ten four-week-old White Leghorn chickens reared under specific pathogen-free conditions. Each chicken was inoculated with 4,000 oocysts to obtain sufficient oocysts for all the in vitro experimental procedures. Table 1 summarises the detailed information of the experiment and used animals following ARRIVE guidelines. Table 1. Experimental condition of chickens (ARRIVE guidelines). Study design • Single group of chickens for standard amplification of Eimeria tenella Wis parasites Sample size • Ten chickens were caged in two groups of 5 animals • Stocking density of 5 kg/m 2 (Defra maximum legal stocking density is 39 kg/m 2 ) Inclusion/exclusion criteria • All animals included Randomisation • All animals were used, randomisation does not apply Blinding • All animals were used, blinding does not apply Outcome measures • Optimal output of Eimeria tenella Wis oocysts (~40 million/chicken) at the given dose (4,000/chicken) Statistical methods • n/a Experimental animals • Breed: White Leghorn – specific pathogen free (from APHA) • Sex: mixed sex • Age: 3-week-old (arrival)/5-week-old (end) Experimental procedures • Placed in cages at arrival (no further change will be done) • Acclimation for 1 week • Oral gavage with 4,000 oocysts suspended in 1 ml of distilled water at 4-week-old • Expected severity: Mild • Schedule 1 at 5-weeks-old Results • Sufficient oocysts were obtained for provision of the in vitro experiments (~400 million) Pastor-Fernandez et al. (2019) provides detailed protocols for oocysts isolation and excystation as well as for sporozoite purification. Sporulated oocysts were stored in water at 4 °C for up to six months, the moment from which they start to lose viability for in vitro tests. Freshly purified sporozoites were used to infect cell monolayers immediately. Cell culture Standard protocols for cell culture maintenance used here were the same described for the standardisation of the in vitro model for compound-screening ( Marugan-Hernandez et al. , 2020 ). Briefly, Madin-Darby bovine kidney (MDBK) cells (NBL-1; ECACC-Sigma-Aldrich) were used as host cell cultures and maintained in a 37 °C humidified incubator with 5% CO 2 atmosphere. Cells were cultured in Advanced Dulbecco’s modified Eagle’s Medium (AdDMEM; Gibco) supplemented with 2% heat-inactivated foetal bovine serum (FBS; Sigma) and 100 U/mL penicillin/streptomycin (Fisher, Leicestershire, UK). Confluent cell monolayers (100%) were passaged twice a week to a new confluence of 70-80% by washing them in Ca 2+ - and Mg 2+ -free PBS and released with 3 mL 0.25% Trypsin/EDTA (Gibco), incubated for three minutes, followed by neutralisation with 5 mL volume of complete medium. The cell suspension was centrifuged at 1,500 g for 10 minutes at room temperature after which the pellet was suspended in 5 mL of fresh medium. Cells were counted and seeded on T75 flasks (Thermo Fisher Scientific) at a density of 10×10 6 cells with AdDMEM at a final volume of 15 ml or seeded on flat bottom 96-well microtiter plates (Thermo Fisher Scientific Nunc) at a cell density of 0.05×10 6 cells in each well in 100 μl of AdDMEM culture media for subsequent infection with sporozoites (see Optimisation of infection ratios section). Optimisation of infection ratios Based on the amount of 0.3×10 6 per well in 500 μl, previously optimised for the 24-well plates format to confer a confluence of 100% without excess of cells (where the surface of each well is four time larger than in the 96-well plate format; 0.3×10 6 /4 = 0.075×10 6 ), we tested 0.1×10 6 and 0.05×10 6 cells per well for the 96-well plate format (just above and below to the equivalent figure). Cells were seeded on flat bottom 96-well microtiter plates (Thermo Fisher Scientific Nunc) at a cell density of 0.1×10 6 or 0.05×10 6 cells in each well in 100 μl of AdDMEM culture media for subsequent infection after two hours with sporozoites at different sporozoites:cells ratios (1:1, 2:1, 4:1; Table 2 ). Three wells were used per conditions (A, B, C) and incubated at 41 °C, 5% CO 2 . This temperature is necessary for parasite development, as chicken Eimeria parasites develop in the intestine of chickens, whose internal temperature is 41 °C, higher than mammalian hosts. MDBK cells can support this increased temperature for up to six/seven days, longer than the required time for in vitro parasite replication. After 4 hours, infected monolayers were detached with 3 mL 0.25% Trypsin/EDTA (Gibco) and cells counted in a Fuchs-Rosenthal counting chamber. Empty cells were recorded as non-infected, cells with the presence of at least one sporozoites were recorded as infected. Two counts were done per well ( Table 2 ). Table 2. Optimisation of conditions for achieving high rates of sporozoite infection of MDBK cells. Ratio sporozoites:cells (no. sporozoites) Wells Non-infected cells Infected cells % Infected cells/count % Infected cells/well % Infected cells (average) tStandard deviation 0.05×10 6 cells/well 1:1 (0.05×10 6 ) A 21 16 43.2 36.1 39.0 7.6 27 11 28.9 B 26 18 40.9 47.6 21 25 54.3 C 26 13 33.3 33.3 22 11 33.3 2:1 (0.1×10 6 ) A 12 23 65.7 60.2 60.7 7.2 19 23 54.8 B 7 21 75.0 68.1 12 19 61.3 C 22 21 48.8 53.8 14 20 58.8 4:1 (0.2×10 6 ) A 7 14 66.7 68.1 73.2 5.2 7 16 69.6 B 10 26 72.2 73.0 16 45 73.8 C 11 35 76.1 78.5 9 38 80.9 0.1×10 6 cells/well 1:1 (0.1×10 6 ) A 22 30 57.7 59.5 57.3 2.0 22 35 61.4 B 21 29 58.0 56.6 22 27 55.1 C 26 34 56.7 55.7 34 41 54.7 2:1 (0.2×10 6 ) A 17 43 71.7 63.5 61.1 7.3 17 21 55.3 B 21 51 70.8 66.9 17 29 63.0 C 22 34 60.7 52.9 33 27 45.0 4:1 (0.4×10 6 ) A 15 33 68.8 75.8 80.0 a) 4.3 10 48 82.8 B 6 28 82.4 79.9 7 24 77.4 C 8 28 77.8 84.3 3 30 90.9 a) Cells were infected with multiple sporozoites which will compromise cell monolayer stability. Anticoccidial drugs Analytical standard preparations of the classical anticoccidial drugs amprolium hydrochloride (AMP), robenidine hydrochloride (ROB) and salinomycin monosodium hydrate (SAL) were purchased from Sigma (Sigma-Aldrich). Drugs were prepared at 10 mg/mL stock in dimethyl sulfoxide (DMSO; Merck) and dilutions for final working concentrations of 50 μg/ml, 20 μg/mL, 5 μg/mL, and 1 μg/mL were prepared freshly from the stock in AdDMEM just before incubation with sporozoites. Invasion and replication inhibition assays A schematic representation of the experimental design is shown in Figure 1 . MDBK cells were seeded in four different 96-well plates (one for each time point to be harvested) at a density of 0.05×10 6 cells per well and left to settle for two to four hours at 37 °C, 5% CO 2 . Meanwhile, freshly-purified sporozoites (0.2×10 6 per well) of E. tenella Wis strain were pre-incubated for 1 h at 41 °C, 5% CO 2 with each anticoccidial compound at different concentrations. Untreated pre-incubated sporozoites were used as controls for invasion and replication. After pre-incubation, sporozoites were centrifuged at 1,500 g for 10 minutes at room temperature and washed with PBS to rinse them free of drugs, then resuspended in 300 μl of AdDMEM (to plate 100 μl per well in triplicate). Sporozoites were then added to MDBK monolayers seeded in 96-well plates and incubated at 41 °C, 5% CO 2 . After two hours, all the wells were washed twice in AdDMEM to remove extracellular sporozoites. The first time point was harvested at two hours post infection (hpi) by washing twice with PBS, then adding RTL buffer (Qiagen) and storing the plate at -20 °C until used for genomic DNA isolation. The same process was done at 24, 44 and 52 hpi. Three wells were used per condition (for untreated and treated sporozoites and for each drug concentration at each time point). Two different biological replicated were performed in different weeks. Figure 1. Flow chart of sporozoite invasion and replication inhibition assays. 1. MDBK cells were seeded into 96-well plates to form a confluent monolayer (0.05 × 10 6 cells/well); 2. Sporozoites were purified from oocysts using DE-52 columns ( Pastor-Fernandez et al., 2019 ); 3. Sporozoites were pre-incubated with anticoccidial drugs at four different concentrations (or without drugs for controls) for 1 hour at 4°C; 4. Sporozoites were centrifuged, resuspended in AdDMEM and added to MDBK monolayers to allow invasion. 5. Infected cell monolayers were lysed and collected; 6. Genomic DNA was extracted from collected infected cell monolayers; 7. Real time qPCR was used to evaluate the number of parasite genomes for each sample. Isolation of nucleic acids Genomic DNA (gDNA) was isolated from the samples stored in RTL buffer (Qiagen) using the AllPrep DNA/RNA 96 Kit (Qiagen) coupled to the QIAvac 96 (Qiagen) following manufacturer’s instructions. Real-time quantitative PCR (qPCR) CFX96 Touch R Real-Time PCR Detection System (Bio-Rad) was used to perform the quantitative PCR following the procedures described previously, using DNA-binding dye SsoFastTM EvaGreen Supermix (Bio-Rad) ( Marugan-Hernandez et al. , 2016 ). For parasite quantification, the number of haploid genomes (equivalent to individual sporozoites or merozoites) per well (three wells/sample, technical replicates) was determined for each condition using gDNA specific primers for E. tenella 5S rDNA (Fw_5S: TCATCACCCAAAGGGATT, Rv_5S: TTCATACTGCGTCTAATGCAC) ( Clark et al. , 2008 ) and a standard curve of sporozoite gDNA extracted by the same methods (gDNA equivalent to 10 7 followed by serial dilution to 10 2 ). Once the run was completed, a baseline was calculated by Bio-Rad CFX Manager software (Bio-Rad) and applied to each sample to compare the quantification cycles (Cq values) obtained from different wells. Data analysis The number of genomes (sporozoites) for each data point analysed by qPCR, was automatically determined by regression analysis using Bio-Rad CFX Manager software (Bio-Rad). Three experimental replicates were included per sample to allow single points showing a standard deviation of more than 0.5 to be excluded from the analysis without affecting the quantification, if all three curves were out of this range, qPCR was repeated for this sample. Correlation (r) between sporozoite quantification between the 24 and 96-well plate format cultures was determined using the nonparametric Spearman's rank test using GraphPad Prism version 6.00 (GraphPad Software, La Jolla, California, USA). Comparison of groups evaluating differences in ‘number of zoites’ after anticoccidial drug treatment vs. controls was performed using non-parametric Kruskal-Wallis test. The analysis was followed by Dunnett’s multiple comparisons as a post-hoc test. Statistically significant differences were established using a p<0.05. All analyses were performed using GraphPad Prism version 6.00. The average inhibition percentage for each anticoccidial drug and concentration was calculated following the equation implemented by Thabet et al. (2017) : % of Inhibition = 100 × 1 − number of E. tenella gene copies in treated sample number of E. tenella gene copies in non − treated control Comparison of replication rates after drug treatment were done by calculating slopes of the regression line ( m ) between 24 and 44 hpi, which were calculated following the universal formula: m slope = y 44 hpi − y 24 hpi 20 time lag Results Sporozoites of E. tenella invaded and replicated at equivalent rates when transferred to a 96-well plate format For the miniaturisation of the model to a 96-well plate format, we screened out the optimal combination of MDBK cells and E. tenella sporozoites. Best monolayer confluences (100% without excess of cells) were achieved with 0.05×10 6 cells/well. An optimal rate of invasion and development without causing multiple sporozoite infection per cell was obtained with a 4:1 sporozoites:cell ratio (0.2×10 6 sporozoites/well). Parasite invasion and development was evaluated in a time course experiment followed by qPCR ( Figure 2 ). Increasing amounts of parasite DNA were detected from 24 hpi onwards as described for the 24-well format, indicative of nuclear replication. The linear rate of replication showed a very strong correlation between the 96 and the 24-well plate format models (r=1; 95% confidence interval; Figure 2 ), validating in this way the suitability of a 96-well plate format to track and evaluate sporozoites invasion and replication. Higher variability was found for the latest time point (52 hpi) which was explained by the rupture of schizonts which will release merozoites as has been observed before ( Marugan-Hernandez et al ., 2020 ); these merozoites are washed from the monolayers and therefore not contributing to the parasite numbers when analysed by qPCR. Fewer parasite number were detected for the 96-well plate format along the time course, which correlated with the lower initial numbers of sporozoites used for monolayers infection (0.2 million/well versus 1 million/well). Figure 2. Evaluation of E. tenella invasion and endogenous development by qPCR. The continuous line represents the number of zoites quantified by qPCR in samples collected at 2, 24, 44 and 52 hpi as the average of the two different replicated experiments performed in separated weeks in a 96-well plate format. Discontinuous line represents data extracted from Marugan-Hernandez et al. (2020) equivalent to the number of zoites quantified by qPCR at the same time points as the average of the three different replicated experiments performed in separated weeks in a 24-well plate format. Error bars represent the standard deviation between repeated experiments for each plate format. Both types of plate format show an equivalent linear fashion growth after 24 hpi (r=1). Eimeria tenella 96-well plate format in vitro model is suitable to evaluate inhibition of invasion and development after treatment with traditional anticoccidials Pre-treatment of sporozoites with different concentrations of AMP, ROB and SAL, three drugs with reported anticoccidial activity, showed a relative dose dependant effect ( Figure 3 ). There were no significant differences in the number of sporozoites able to invade host cells after the pre-treated groups vs. the controls at either 2 and 24 hpi ( Figure 3A and B ). However, treatment with the highest dose of AMP (50 μg/ml) show a significant reduction in replication at both 44 and 52 hpi. Similarly, treatment with ROB (50 μg/ml) exhibited a significant reduction in parasite numbers at 52 hpi ( Figure 3C and D ). Figure 3. Effects of anticoccidial drugs in intracellular numbers of parasites. A and B. Graphs shows the number of parasites by qPCR after invasion at 2 and 24 hpi, respectively (before nuclear division has started, see Figure 2 ); C and D. Graphs shows the number of parasites by qPCR after nuclear replication at 44 and 52 hpi, respectively. X-axis numbers represent the specific drug dilution used in μg/ml. Asterisks indicate significant differences with the DMEM/DMSO controls (Dunnett’s multiple comparison test p<0.05). Average inhibition of invasion and replication were calculated for each pre-treatment ( Table 3 ). The pre-treatment with AMP at any concentration caused a moderate inhibition of invasion at 2 and 24 hpi (10-45%; average of 22%); however, those sporozoites which were successful at invasion then developed at the same rate as the untreated controls (slope of the regression curve was parallel to that exhibited by the untreated control). Pre-treatment with ROB had little effects on invasion (inhibition of 0-20%, average 5.6%); nevertheless, sporozoites did not replicate well once intracellularly (slope decreased compared with untreated controls, with sporozoite numbers decreasing for the highest concentration, 50 μg/mL). Pre-treatment with SAL exhibited effects in both invasion and development. Invasion was inhibited at higher levels than for AMP (10-60%; average 27%) and intracellular replication was severely impaired for the higher concentrations (50 and 20 μg/mL). In general, for every drug, higher inhibition of invasion and replication was observed for the higher concentration, although some variations were observed. Table 3. Percentages of inhibition of invasion (2-24 hpi) and replication (44-52 hpi) and replication rate (slope between 24-44 hpi) of E. tenella sporozoites after pre-treatment with anticoccidial dugs amprolium hydrochloride (AMP), robenidine hydrochloride (ROB) and salinomycin monosodium hydrate (SAL) at different concentrations (50, 20, 5, 1 μg/ml). Each value represents the average of the percentage of inhibition±standard deviation or slope of two different experiments including each three wells per condition, calculated using the equations displayed in Data analysis section. Anticoccidial drugs Concentration (μg/ml) 2 hpi 24 hpi 44 hpi 52 hpi Slope (24-44 hpi) * AMP 50 22.05±14.18 7.17±7.17 12.88±12.88 23.54±23.54 282486 20 17.34±10.96 10.19±10.19 0±0 14.11±6.08 264669 5 22.89±4.85 24.45±24.45 1.96±1.96 0±0 227343 1 46.78±5.45 25.71±25.71 5.13±5.13 6.05±6.05 227636 ROB 50 9.13±9.13 7.91±7.91 97.81±0.07 48.49±48.49 -9013 20 0±0 9.07±9.07 45.43±23.7 40.99±31.24 100536 5 0±0 0±0 5.42±3.62 0±0 194893 1 0±0 19.02±19.02 52.34±13.91 18.23±18.23 89050 SAL 50 62.42±1.79 7.94±7.94 98.4±0.4 99.23±0.09 -3380 20 16.47±16.47 13.5±13.5 94.19±0.04 87.87±0.94 4664 5 40.02±6.5 31.35±14.43 73.66±6.83 49.41±20.62 55507 1 44.18±21.42 0±0 26.1±13.58 42.16±7.4 152050 * Slope average value for untreated sporozoites: 309,189. Discussion In this study, a model developed to evaluate anticoccidial effects of compounds in vitro , has been successfully miniaturised from a 24-well plate format to a 96-well format. Conditions were refined to create an optimal confluence of the monolayer, supporting invasion rates of >70% in the new format. These conditions have proved to support schizonts and merozoite development as described before in the original model ( Marugan-Hernandez et al. , 2020 ). The levels of sporozoites invasion and replication by qPCR in time course experiments in the miniaturised format have shown the same linear growth fashion than described before, and the evaluation of traditional anticoccidial drugs to validate the model has also proved the suitability of this model to detect different levels of inhibition of invasion and/or replication. When the same anticoccidial drugs (AMP, ROB and SAL) were evaluated in the 24-well plate format, only concentrations of 5 μg/ml were tested ( Marugan-Hernandez et al ., 2020 ). Comparing this same concentration in the 96-well plate format, AMP and SAL showed equivalent effects in parasite numbers in invasion and replication for both models. AMP did not show any significant change regarding the controls at any point, whereas SAL did not show differences in invasion, but replication was significantly reduced at 44 hpi (Two-way ANOVA, followed by Dunnett’s post-hoc test). ROB at 5 μg/ml did not correlate with previous results from the 24-well plate model where strong effects were found in both invasion and replication. In the 96-well plate format, ROB did not show any effect in invasion or replication at 5 μg/ml. Interestingly, this concentration has shown inhibitory effects in subsequent studies ( Felici et al ., 2023 ) performed in the 96-well plate format, that were equivalent to the 24-well plate format described before. We attributed the lack of significant effects from ROB at 5 μg/ml in the current study to a loss of effect due to continue use of the drug (where stock has gone several freeze-thaw rounds), which we have observed after using it as inhibition control in further studies. This 96-well plate model has already supported the evaluation of essential oils and their main active compounds ( Felici et al ., 2023 ), where the formers have shown similar effects on invasion and replication than ROB and SAL. This is important as research in natural compounds it is essential to replace current anticoccidials for which several resistances have been developed in field strains threatening their efficacy. These latest results evidence the suitability of the miniaturised model to detect inhibition of invasion and/or replication of natural compounds in addition to classical anticoccidal drugs. Eimeria parasites are self-limited, monoxenous (single-host) parasites, and despite many efforts, there are no efficient in vitro systems supporting continuous replication or the completion of its life cycle; in consequence, research on this species depends on the use of animals. Examination of the literature shows that testing of novel anticoccidial compounds, primarily natural products, is in expansion. Publications in this area have increase from 91 in 2017 to 157 in 2023, and between 2017 and 2023 a total of 57,170 chickens (>8,000 per annum) were used to evaluate anticoccidial effects of novel compounds. In addition to these chickens already mentioned, there are chickens used in unpublished studies from pharmaceutical/nutrition companies or those only providing negative results, numbers of which are harder to discover. Looking specifically at some 2021 publications, if pre-screening with in vitro models had been used by Fu et al. (2021) , concentrations could have been adjusted to reduce animals from 630 to 480 (23.8%). Similarly, the use of in vitro models could have excluded one testing group for both Lima et al. (2021) and Herrero-Encinas et al. (2021) , reducing animals from 900 to 720 (20%) and 400 to 320 (20%), respectively. If we extrapolate these data (an average of 20% reduction) to the studies published in 2023, the use of our in vitro model could have avoided the experimental use of 4,070 chickens (out of 20,352) globally, or 11,434 (out of 57,170) in the past 7 years. Nevertheless, chickens are still needed to generate parasite materials to perform in vitro pre-screenings. Therefore, the miniaturisation of our in vitro model will have a direct impact on the reduction of animal use. Testing one compound at four different concentrations (excluding untreated controls) requires 12 million of sporozoites in the 24-well plate format (4 concentrations × 3 wells × 1 million/well) whereas only 2.4 million are necessary in the 96-well plate one (4 concentrations × 3 wells x 0.2 million/well); this means the miniaturised model requires 5 times less parasite material. Efficiency of sporozoite excystation and purification from oocysts is set at 1:1 in our experimental settings. A single chicken can produce an average of 30 million oocysts without causing clinical symptoms. Therefore, with the use of one chicken, we could test at least ten compounds (2.4 million/compound × 10 = 24 million oocysts, plus untreated compounds) with the 96-well format, whereas only two compounds (12 million/compound × 2 = 24 million oocysts, plus controls) could be tested in the 24-well plate format. This supposes a direct 80% reduction in animal use (testing 10 compounds would require 5 chickens in the 24-well plate format versus only 1 in the 96-well plate format, which means 4 less chickens out of 5), for the evaluation of anticoccidial compounds locally. In our laboratory we use an average of 100 chickens per year to maintain parasites stocks with the purposes of evaluating anticoccidial compounds, this number could be reduced to 20 once the miniaturised model is implemented. I addition to this, we also provide parasite materials to collaborators in research institutions and commercial companies at different locations worldwide, this miniaturised model will also have a significant global impact on the number of chickens undergoing a mild severity procedure for the generation of E. tenella oocysts. Another advantage of this miniaturisation is the high-throughput capacity to test many compounds simultaneously, while reducing materials, reagents and time to perform them. Up to seven compounds could be tested on a single plate per time point (including controls) using 20 mL per plate in the 24-well plate format. Time is also significantly reduced by a streamlined protocol using 96-well plates and multichannel pipettes throughout the whole experiment, from cell culture to DNA isolation and qPCR analysis. These added benefits will also impact positively in the wider uptake of the model by other researchers since costs and time to achieved results will be significantly reduced. Data availability Underlying data DRYAD: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model, https://doi.org/10.5061/dryad.mw6m90605 ( Marugan-Hernandez & Arias, 2022 ). This project contains the following files: • Experiment_1.xlsx • Experiment_2.xlsx • 1st_EXPERIMENT_-_2hpi_DMSO_-_ROB_20.pcrd • 1st_EXPERIMENT_-_2hpi_ROB_5_-_24hpi_AMP_20.pcrd • 1st_EXPERIMENT_-_24hpi_AMP_5_-_SAL_20.pcrd • 1st_EXPERIMENT_-_24hpi_SAL_5_-_44hpi_ROB_20.pcrd • 1st_EXPERIMENT_-_44hpi_ROB_5_-_52hpi_AMP_20.pcrd • 1st_EXPERIMENT_-_52hpi_AMP_5_-_SAL_20.pcrd • 1st_EXPERIMENT_-_52hpi_SAL_5-1___Controls.pcrd • EXP_2._2hpi_DMSO-ROB_20.pcrd • EXP_2._2hpi_ROB_5_-_24hpi_DMEM.pcrd • EXP_2._24hpi_AMP_50_-_ROB_1.pcrd • EXP_2._24hpi_SAL_50_-_44hpi_AMP_20.pcrd • EXP_2._44hpi_AMP_5_-_SAL_20.pcrd • EXP_2._44hpi_SAL_5_-_52hpi_AMP_1.pcrd • EXP_2._52hpi_ROB_50_-_SAL_1.pcrd • README.txt Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication). Acknowledgments The authors wish to thank Aimee Holland for her excellent technical assistance. This work was funded by the NC3R Skills and Knowledge Transfer grant NC/W000881/1. References Blake DP, Knox J, Dehaeck B, et al. : Re-calculating the cost of coccidiosis in chickens. Vet. Res. 2020; 51 : 115. PubMed Abstract | Publisher Full Text Burrell A, Tomley FM, Vaughan S, et al. : Life cycle stages, specific organelles and invasion mechanisms of Eimeria species. Parasitology. 2020; 147 : 263–278. PubMed Abstract | Publisher Full Text Clark JD, Billington K, Bumstead JM, et al. : A toolbox facilitating stable transfection of Eimeria species. Mol. Biochem. Parasitol. 2008; 162 : 77–86. PubMed Abstract | Publisher Full Text Felici M, Tugnoli B, De Hoest-Thompson C, et al. : Thyme, Oregano, and Garlic Essential Oils and Their Main Active Compounds Influence Eimeria tenella Intracellular Development. Animals (Basel). 2023; 14 (1): 77. PubMed Abstract | Publisher Full Text | Free Full Text Fu Y, Zhou J, Zhang L, et al. : Pharmacokinetics and anticoccidial activity of ethanamizuril in broiler chickens. Vet. Parasitol. 2021; 289 : 109318. PubMed Abstract | Publisher Full Text Herrero-Encinas J, Menoyo D, Blanch M, et al. : Response of broiler chickens fed diets supplemented with a bioactive olive pomace extract from Olea europaea to an experimental coccidial vaccine challenge. Poult. Sci. 2021; 100 : 575–584. PubMed Abstract | Publisher Full Text Lima GA, Barbosa BFS, Araujo R, et al. : Agaricus subrufescens and Pleurotus ostreatus mushrooms as alternative additives to antibiotics in diets for broilers challenged with Eimeria spp. Br. Poult. Sci. 2021; 62 : 251–260. Publisher Full Text Marugan-Hernandez V, Arias S: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model, Dryad, [Dataset].2022. Publisher Full Text Marugan-Hernandez V, Cockle C, Macdonald S, et al. : Viral proteins expressed in the protozoan parasite Eimeria tenella are detected by the chicken immune system. Parasit. Vectors. 2016; 9 : 463. Publisher Full Text Marugan-Hernandez V, Jeremiah G, Aguiar-Martins K, et al. : The Growth of Eimeria tenella : Characterization and Application of Quantitative Methods to Assess Sporozoite Invasion and Endogenous Development in Cell Culture. Front. Cell. Infect. Microbiol. 2020; 10 : 579833. PubMed Abstract | Publisher Full Text McDougald LR, Jeffers TK: Comparative in vitro development of precocious and normal strains of Eimeria tenella (Coccidia). J. Protozool. 1976; 23 : 530–534. PubMed Abstract | Publisher Full Text Pastor-Fernandez I, Pegg E, Macdonald SE, et al. : Laboratory Growth and Genetic Manipulation of Eimeria tenella . Curr. Protoc. Microbiol. 2019; 53 : e81. PubMed Abstract | Publisher Full Text Sidiropoulou E, Skoufos I, Marugan-Hernandez V, et al. : In vitro Anticoccidial Study of Oregano and Garlic Essential Oils and Effects on Growth Performance, Fecal Oocyst Output, and Intestinal Microbiota in vivo. Front. Vet. Sci. 2020; 7 : 420. PubMed Abstract | Publisher Full Text Thabet A, Zhang R, Alnassan AA, et al. : Anticoccidial efficacy testing: in vitro Eimeria tenella assays as replacement for animal experiments. Vet. Parasitol. 2017; 233 : 86–96. PubMed Abstract | Publisher Full Text Webster AJ: Farm animal welfare: the five freedoms and the free market. Vet. J. 2001; 161 : 229–237. PubMed Abstract | Publisher Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 04 Oct 2022 ADD YOUR COMMENT Comment Author details Author details 1 Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, Hertfordshire, AL8 7TA, UK 2 SALUVET-Innova S.L, Madrid, Madrid, 28040, Spain Sara Arias-Maroto Roles: Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation Kelsilandia Aguiar-Martins Roles: Investigation, Methodology, Validation, Writing – Review & Editing Javier Regidor-Cerrillo Roles: Conceptualization, Methodology, Writing – Review & Editing Luis Ortega-Mora Roles: Conceptualization, Writing – Review & Editing Virginia Marugan-Hernandez Roles: Conceptualization, Formal Analysis, Funding Acquisition, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This work was funded by an NC3Rs Skills and Knowledge transfer grant – reference NC/W000881/1. Article Versions (2) version 2 Revised Published: 01 Oct 2024, 11:1135 https://doi.org/10.12688/f1000research.123102.2 version 1 Published: 04 Oct 2022, 11:1135 https://doi.org/10.12688/f1000research.123102.1 Copyright © 2024 Arias-Maroto S et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Arias-Maroto S, Aguiar-Martins K, Regidor-Cerrillo J et al. Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.12688/f1000research.123102.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 01 Oct 2024 Revised Views 0 Cite How to cite this report: Adjei-Mensah B. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.172468.r356737 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v2#referee-response-356737 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 07 Feb 2025 Benjamin Adjei-Mensah , Department of Animal Science, University of Ghana School of Agriculture (Ringgold ID: 356390), Accra, Greater Accra Region, Ghana Approved VIEWS 0 https://doi.org/10.5256/f1000research.172468.r356737 I would like to appreciate the author for addressing all the comments ... Continue reading READ ALL I would like to appreciate the author for addressing all the comments I suggested. The article report is in good shape for indexing. Thanks. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Nutrition, Gut physiology, Poultry science I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Adjei-Mensah B. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.172468.r356737 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v2#referee-response-356737 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Song X. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.172468.r340270 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v2#referee-response-340270 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 23 Dec 2024 Xiaokai Song , Nanjing Agricultural University, Nanjing, China Approved VIEWS 0 https://doi.org/10.5256/f1000research.172468.r340270 In this manuscript, the author provides a detailed description of the miniaturization of the experimental model for the invasion of Eimeria tenella sporozoite in MDBK cells. The miniaturized model was proven by in vitro experiments to allow for simultaneous ... Continue reading READ ALL In this manuscript, the author provides a detailed description of the miniaturization of the experimental model for the invasion of Eimeria tenella sporozoite in MDBK cells. The miniaturized model was proven by in vitro experiments to allow for simultaneous pre-screening of a greater number of different concentrations of anti-coccidial drugs, which will further reduce the number of infected chickens required for these drugs to be tested experimentally. Overall, this study presents a valuable contribution to the field of anticoccidial drug research. The authors’ efforts to reduce animal usage and improve the efficiency of drug screening are commendable. I have the following comments: Conduct a more comprehensive statistical analysis, including: Comparison of drug efficacy between the 24-well and 96-well plate formats at each time point and overall inhibition rate. Analysis of the reproducibility of the 96-well plate model across multiple experiments. Expand the discussion to address the limitations of the 96-well plate model compared to the 24-well plate model. Provide more details on the logistics and potential challenges of the pooled resource approach for oocyst amplification. Consider including a section on the potential for adapting the 96-well plate model for other Eimeria species. The title of Table 3 is too lengthy; it is suggested to be more concise. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: The Mechanism of Invasion by Chicken Coccidia I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Song X. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.172468.r340270 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v2#referee-response-340270 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 04 Oct 2022 Views 0 Cite How to cite this report: Turner JD. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.135172.r173894 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v1#referee-response-173894 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 13 Nov 2023 Joseph D. Turner , Centre for Drugs and Diagnostics, Department of Parasitology, Liverpool School of Tropical Medicine, Liverpool, UK Not Approved VIEWS 0 https://doi.org/10.5256/f1000research.135172.r173894 The work of Arias-Maroto et al., details miniaturisation of an Eimeria tenella sporozoite invasion and replication assay in immortalised bovine kidney epithelial cells. The in vitro assay, if successful in emulating the larger plate system, would further cut down the number of experimentally infected ... Continue reading READ ALL The work of Arias-Maroto et al., details miniaturisation of an Eimeria tenella sporozoite invasion and replication assay in immortalised bovine kidney epithelial cells. The in vitro assay, if successful in emulating the larger plate system, would further cut down the number of experimentally infected chickens required to generate parasites for these drug assays. 3Rs statement When stating the 80% reduction metric of use of chickens for generation of parasites due to miniaturisation, it would be informative if the authors could estimate numbers of chickens used for this purpose per annum in their lab, in the UK or globally that may be reduced via adoption of a miniaturised assay, as they have done in the discussion. Methods Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. Results and conclusions I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Suggest revisions before considering the work fully valid: Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? Are the 3Rs implications of the work described accurately? Partly Are a suitable application and appropriate end-users identified? Yes Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? No Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: Parasitology, drug discovery & development, infection biology, immunobiology. Referee suggested by the NC3Rs for their scientific expertise and experience in assessing 3Rs impact. I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Turner JD. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.135172.r173894 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v1#referee-response-173894 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 01 Oct 2024 Virginia Marugan-Hernandez , Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, AL8 7TA, UK 01 Oct 2024 Author Response We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale ... Continue reading We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? The two densities were derived of the previously optimised number for the 24-well plate format that was conferring a 100% confluence without an excess of cells (Marugan-Hernandez et al., 2020). This has been now detailed in ‘Optimisation of infection ratios’ section: ‘ Based on the amount of 0.3×10 6 per well in 500 μ l, previously optimised for the 24-well plates format to confer a confluence of 100% without excess of cells (where the surface of each well is four time larger than in the 96-well plate format; 0.3×10 6 / 4 = 0.075×10 6 ), we tested 0.1×10 6 and 0.05×10 6 cells per well for the 96-well plate format (just above and below to the equivalent figure) .’ Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. The temperature in the chicken intestine is 41 o C and this is the optimal temperature for Eimeria tenella development, if the temperature is lower, the parasite will not replicate. This has been clarified in ‘Optimisation of infection ratios’ section: ‘ This temperature is necessary for parasite development, as chicken Eimeria parasites develop in the intestine of chickens, whose internal temperature is 41 o C, higher than mammalian hosts. MDBK cells can support this increased temperature for up to six/seven days, longer than the required time for in vitro parasite replication. ’ A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. A flow chart has been included (Figure 1) aimed to clarify the experimental design of the invasion and replication assays. ‘Figure 1. Flow chart of sporozoite i nvasion and replication inhibition assays. 1. MDBK cells were seeded into 96-well plates to form a confluent monolayer (0.05x10 6 cells/well); 2. Sporozoites were purified from oocysts using DE-52 columns (Pastor-Fernandez et al., 2019); 3. Sporozoites were pre-incubated with anticoccidial drugs at four different concentrations (or without drugs for controls) for 1 hour at 4 o C; 4. Sporozoites were centrifuged, resuspended in AdDMEM and added to MDBK monolayers to allow invasion. 5. Infected cell monolayers were lysed and collected; 6. Genomic DNA was extracted from collected infected cell monolayers; 7. Real time qPCR was used to evaluate the number of parasite genomes for each sample.’ I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. A statistical comparison using the non-parametric Spearman's rank test has been included. This has shown a high degree of correlation with r=1. All this has been detailed in ‘Data analysis’ and ‘Sporozoites of E. tenella invaded and replicated at equivalent rates when transferred to a 96-well plate format’ sections: ‘ Correlation (r) between sporozoite quantification between the 24 and 96-well plate format cultures was determined using the nonparametric Spearman's rank test using GraphPad Prism version 6.00 (GraphPad Software, La Jolla, California, USA) .’ ‘ The linear rate of replication showed a very strong correlation between the 96 and the 24-well plate format models (r=1; 95% confidence interval; Figure 2) ’ Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Statistical analysis have been included to evaluate differences in the ‘number of zoites’ between the different groups. This has now been detailed in ‘Data analysis’ and ‘ Eimeria tenella 96-well plate format in vitro model is suitable to evaluate inhibition of invasion and development after treatment with traditional anticoccidials’ sections. A new figures (Figure 3) has been added. ‘Comparison of groups evaluating differences in ‘number of zoites’ after anticoccidial drug treatment vs. controls was performed using non-parametric Kruskal-Wallis test. The analysis was followed by Dunnett’s multiple comparisons as a post-hoc test. Statistically significant differences were established using a p<0.05. All analyses were performed using GraphPad Prism version 6.00.’ ‘Pre-treatment of sporozoites with different concentrations of AMP, ROB and SAL, three drugs with reported anticoccidial activity, showed a relative dose dependant effect ( Figure 3). There were no significant differences in the number of sporozoites able to invade host cells after the pre-treated groups vs. the controls at either 2 and 24 hpi ( Figure 3, A and B). However, treatment with the highest dose of AMP (50 μ g/ml) show a significant reduction in replication at both 44 and 52 hpi. Similarly, treatment with ROB (50 μ g/ml) exhibited a significant reduction in parasite numbers at 52 hpi ( Figure 3, C and D).’ ‘ Figure 3. Effects of anticoccidial drugs in intracellular numbers of parasites. A and B. Graphs shows the number of parasites by qPCR after invasion at 2 and 24 hpi, respectively (before nuclear division has started, see Figure 2); C and D. Graphs shows the number of parasites by qPCR after nuclear replication at 44 and 52 hpi, respectively. X-axis numbers represent the specific drug dilution used in μ g/ml. Asterisks indicate significant differences with the DMEM/DMSO controls (Dunnett’s multiple comparison test p<0.05).’ Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. We have included the comparison of anticoccidial drugs pre-treatment between the 24 and 96-well plate format in the ‘Discussion’ section: ‘When the same anticoccidial drugs (AMP, ROB and SAL) were evaluated in the 24-well plate format, only concentrations of 5 μ g/ml were tested ( Marugan-Hernandez et al., 2020). Comparing this same concentration in the 96-well plate format, AMP and SAL showed equivalent effects in parasite numbers in invasion and replication for both models. AMP did not show any significant change regarding the controls at any point, whereas SAL did not show differences in invasion, but replication was significantly reduced at 44 hpi (Two-way ANOVA, followed by Dunnett’s post-hoc test). ROB at 5 μ g/ml did not correlate with previous results from the 24-well plate model where strong effects were found in both invasion and replication. In the 96-well plate format, ROB did not show any effect in invasion or replication at 5 μ g/ml. Interestingly, this concentration has shown inhibitory effects in subsequent studies ( Felici et al., 2023) performed in the 96-well plate format, that were equivalent to the 24-well plate format described before. We attributed the lack of significant effects from ROB at 5 μ g/ml in the current study to a loss of effect due to continue use of the drug (where stock has gone several freeze-thaw rounds), which we have observed after using it as inhibition control in further studies.’ Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? All these points have been now included in the new version of the manuscript. Detailed responses can be seen above. We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? The two densities were derived of the previously optimised number for the 24-well plate format that was conferring a 100% confluence without an excess of cells (Marugan-Hernandez et al., 2020). This has been now detailed in ‘Optimisation of infection ratios’ section: ‘ Based on the amount of 0.3×10 6 per well in 500 μ l, previously optimised for the 24-well plates format to confer a confluence of 100% without excess of cells (where the surface of each well is four time larger than in the 96-well plate format; 0.3×10 6 / 4 = 0.075×10 6 ), we tested 0.1×10 6 and 0.05×10 6 cells per well for the 96-well plate format (just above and below to the equivalent figure) .’ Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. The temperature in the chicken intestine is 41 o C and this is the optimal temperature for Eimeria tenella development, if the temperature is lower, the parasite will not replicate. This has been clarified in ‘Optimisation of infection ratios’ section: ‘ This temperature is necessary for parasite development, as chicken Eimeria parasites develop in the intestine of chickens, whose internal temperature is 41 o C, higher than mammalian hosts. MDBK cells can support this increased temperature for up to six/seven days, longer than the required time for in vitro parasite replication. ’ A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. A flow chart has been included (Figure 1) aimed to clarify the experimental design of the invasion and replication assays. ‘Figure 1. Flow chart of sporozoite i nvasion and replication inhibition assays. 1. MDBK cells were seeded into 96-well plates to form a confluent monolayer (0.05x10 6 cells/well); 2. Sporozoites were purified from oocysts using DE-52 columns (Pastor-Fernandez et al., 2019); 3. Sporozoites were pre-incubated with anticoccidial drugs at four different concentrations (or without drugs for controls) for 1 hour at 4 o C; 4. Sporozoites were centrifuged, resuspended in AdDMEM and added to MDBK monolayers to allow invasion. 5. Infected cell monolayers were lysed and collected; 6. Genomic DNA was extracted from collected infected cell monolayers; 7. Real time qPCR was used to evaluate the number of parasite genomes for each sample.’ I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. A statistical comparison using the non-parametric Spearman's rank test has been included. This has shown a high degree of correlation with r=1. All this has been detailed in ‘Data analysis’ and ‘Sporozoites of E. tenella invaded and replicated at equivalent rates when transferred to a 96-well plate format’ sections: ‘ Correlation (r) between sporozoite quantification between the 24 and 96-well plate format cultures was determined using the nonparametric Spearman's rank test using GraphPad Prism version 6.00 (GraphPad Software, La Jolla, California, USA) .’ ‘ The linear rate of replication showed a very strong correlation between the 96 and the 24-well plate format models (r=1; 95% confidence interval; Figure 2) ’ Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Statistical analysis have been included to evaluate differences in the ‘number of zoites’ between the different groups. This has now been detailed in ‘Data analysis’ and ‘ Eimeria tenella 96-well plate format in vitro model is suitable to evaluate inhibition of invasion and development after treatment with traditional anticoccidials’ sections. A new figures (Figure 3) has been added. ‘Comparison of groups evaluating differences in ‘number of zoites’ after anticoccidial drug treatment vs. controls was performed using non-parametric Kruskal-Wallis test. The analysis was followed by Dunnett’s multiple comparisons as a post-hoc test. Statistically significant differences were established using a p<0.05. All analyses were performed using GraphPad Prism version 6.00.’ ‘Pre-treatment of sporozoites with different concentrations of AMP, ROB and SAL, three drugs with reported anticoccidial activity, showed a relative dose dependant effect ( Figure 3). There were no significant differences in the number of sporozoites able to invade host cells after the pre-treated groups vs. the controls at either 2 and 24 hpi ( Figure 3, A and B). However, treatment with the highest dose of AMP (50 μ g/ml) show a significant reduction in replication at both 44 and 52 hpi. Similarly, treatment with ROB (50 μ g/ml) exhibited a significant reduction in parasite numbers at 52 hpi ( Figure 3, C and D).’ ‘ Figure 3. Effects of anticoccidial drugs in intracellular numbers of parasites. A and B. Graphs shows the number of parasites by qPCR after invasion at 2 and 24 hpi, respectively (before nuclear division has started, see Figure 2); C and D. Graphs shows the number of parasites by qPCR after nuclear replication at 44 and 52 hpi, respectively. X-axis numbers represent the specific drug dilution used in μ g/ml. Asterisks indicate significant differences with the DMEM/DMSO controls (Dunnett’s multiple comparison test p<0.05).’ Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. We have included the comparison of anticoccidial drugs pre-treatment between the 24 and 96-well plate format in the ‘Discussion’ section: ‘When the same anticoccidial drugs (AMP, ROB and SAL) were evaluated in the 24-well plate format, only concentrations of 5 μ g/ml were tested ( Marugan-Hernandez et al., 2020). Comparing this same concentration in the 96-well plate format, AMP and SAL showed equivalent effects in parasite numbers in invasion and replication for both models. AMP did not show any significant change regarding the controls at any point, whereas SAL did not show differences in invasion, but replication was significantly reduced at 44 hpi (Two-way ANOVA, followed by Dunnett’s post-hoc test). ROB at 5 μ g/ml did not correlate with previous results from the 24-well plate model where strong effects were found in both invasion and replication. In the 96-well plate format, ROB did not show any effect in invasion or replication at 5 μ g/ml. Interestingly, this concentration has shown inhibitory effects in subsequent studies ( Felici et al., 2023) performed in the 96-well plate format, that were equivalent to the 24-well plate format described before. We attributed the lack of significant effects from ROB at 5 μ g/ml in the current study to a loss of effect due to continue use of the drug (where stock has gone several freeze-thaw rounds), which we have observed after using it as inhibition control in further studies.’ Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? All these points have been now included in the new version of the manuscript. Detailed responses can be seen above. Competing Interests: n/a Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 01 Oct 2024 Virginia Marugan-Hernandez , Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, AL8 7TA, UK 01 Oct 2024 Author Response We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale ... Continue reading We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? The two densities were derived of the previously optimised number for the 24-well plate format that was conferring a 100% confluence without an excess of cells (Marugan-Hernandez et al., 2020). This has been now detailed in ‘Optimisation of infection ratios’ section: ‘ Based on the amount of 0.3×10 6 per well in 500 μ l, previously optimised for the 24-well plates format to confer a confluence of 100% without excess of cells (where the surface of each well is four time larger than in the 96-well plate format; 0.3×10 6 / 4 = 0.075×10 6 ), we tested 0.1×10 6 and 0.05×10 6 cells per well for the 96-well plate format (just above and below to the equivalent figure) .’ Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. The temperature in the chicken intestine is 41 o C and this is the optimal temperature for Eimeria tenella development, if the temperature is lower, the parasite will not replicate. This has been clarified in ‘Optimisation of infection ratios’ section: ‘ This temperature is necessary for parasite development, as chicken Eimeria parasites develop in the intestine of chickens, whose internal temperature is 41 o C, higher than mammalian hosts. MDBK cells can support this increased temperature for up to six/seven days, longer than the required time for in vitro parasite replication. ’ A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. A flow chart has been included (Figure 1) aimed to clarify the experimental design of the invasion and replication assays. ‘Figure 1. Flow chart of sporozoite i nvasion and replication inhibition assays. 1. MDBK cells were seeded into 96-well plates to form a confluent monolayer (0.05x10 6 cells/well); 2. Sporozoites were purified from oocysts using DE-52 columns (Pastor-Fernandez et al., 2019); 3. Sporozoites were pre-incubated with anticoccidial drugs at four different concentrations (or without drugs for controls) for 1 hour at 4 o C; 4. Sporozoites were centrifuged, resuspended in AdDMEM and added to MDBK monolayers to allow invasion. 5. Infected cell monolayers were lysed and collected; 6. Genomic DNA was extracted from collected infected cell monolayers; 7. Real time qPCR was used to evaluate the number of parasite genomes for each sample.’ I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. A statistical comparison using the non-parametric Spearman's rank test has been included. This has shown a high degree of correlation with r=1. All this has been detailed in ‘Data analysis’ and ‘Sporozoites of E. tenella invaded and replicated at equivalent rates when transferred to a 96-well plate format’ sections: ‘ Correlation (r) between sporozoite quantification between the 24 and 96-well plate format cultures was determined using the nonparametric Spearman's rank test using GraphPad Prism version 6.00 (GraphPad Software, La Jolla, California, USA) .’ ‘ The linear rate of replication showed a very strong correlation between the 96 and the 24-well plate format models (r=1; 95% confidence interval; Figure 2) ’ Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Statistical analysis have been included to evaluate differences in the ‘number of zoites’ between the different groups. This has now been detailed in ‘Data analysis’ and ‘ Eimeria tenella 96-well plate format in vitro model is suitable to evaluate inhibition of invasion and development after treatment with traditional anticoccidials’ sections. A new figures (Figure 3) has been added. ‘Comparison of groups evaluating differences in ‘number of zoites’ after anticoccidial drug treatment vs. controls was performed using non-parametric Kruskal-Wallis test. The analysis was followed by Dunnett’s multiple comparisons as a post-hoc test. Statistically significant differences were established using a p<0.05. All analyses were performed using GraphPad Prism version 6.00.’ ‘Pre-treatment of sporozoites with different concentrations of AMP, ROB and SAL, three drugs with reported anticoccidial activity, showed a relative dose dependant effect ( Figure 3). There were no significant differences in the number of sporozoites able to invade host cells after the pre-treated groups vs. the controls at either 2 and 24 hpi ( Figure 3, A and B). However, treatment with the highest dose of AMP (50 μ g/ml) show a significant reduction in replication at both 44 and 52 hpi. Similarly, treatment with ROB (50 μ g/ml) exhibited a significant reduction in parasite numbers at 52 hpi ( Figure 3, C and D).’ ‘ Figure 3. Effects of anticoccidial drugs in intracellular numbers of parasites. A and B. Graphs shows the number of parasites by qPCR after invasion at 2 and 24 hpi, respectively (before nuclear division has started, see Figure 2); C and D. Graphs shows the number of parasites by qPCR after nuclear replication at 44 and 52 hpi, respectively. X-axis numbers represent the specific drug dilution used in μ g/ml. Asterisks indicate significant differences with the DMEM/DMSO controls (Dunnett’s multiple comparison test p<0.05).’ Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. We have included the comparison of anticoccidial drugs pre-treatment between the 24 and 96-well plate format in the ‘Discussion’ section: ‘When the same anticoccidial drugs (AMP, ROB and SAL) were evaluated in the 24-well plate format, only concentrations of 5 μ g/ml were tested ( Marugan-Hernandez et al., 2020). Comparing this same concentration in the 96-well plate format, AMP and SAL showed equivalent effects in parasite numbers in invasion and replication for both models. AMP did not show any significant change regarding the controls at any point, whereas SAL did not show differences in invasion, but replication was significantly reduced at 44 hpi (Two-way ANOVA, followed by Dunnett’s post-hoc test). ROB at 5 μ g/ml did not correlate with previous results from the 24-well plate model where strong effects were found in both invasion and replication. In the 96-well plate format, ROB did not show any effect in invasion or replication at 5 μ g/ml. Interestingly, this concentration has shown inhibitory effects in subsequent studies ( Felici et al., 2023) performed in the 96-well plate format, that were equivalent to the 24-well plate format described before. We attributed the lack of significant effects from ROB at 5 μ g/ml in the current study to a loss of effect due to continue use of the drug (where stock has gone several freeze-thaw rounds), which we have observed after using it as inhibition control in further studies.’ Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? All these points have been now included in the new version of the manuscript. Detailed responses can be seen above. We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? The two densities were derived of the previously optimised number for the 24-well plate format that was conferring a 100% confluence without an excess of cells (Marugan-Hernandez et al., 2020). This has been now detailed in ‘Optimisation of infection ratios’ section: ‘ Based on the amount of 0.3×10 6 per well in 500 μ l, previously optimised for the 24-well plates format to confer a confluence of 100% without excess of cells (where the surface of each well is four time larger than in the 96-well plate format; 0.3×10 6 / 4 = 0.075×10 6 ), we tested 0.1×10 6 and 0.05×10 6 cells per well for the 96-well plate format (just above and below to the equivalent figure) .’ Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. The temperature in the chicken intestine is 41 o C and this is the optimal temperature for Eimeria tenella development, if the temperature is lower, the parasite will not replicate. This has been clarified in ‘Optimisation of infection ratios’ section: ‘ This temperature is necessary for parasite development, as chicken Eimeria parasites develop in the intestine of chickens, whose internal temperature is 41 o C, higher than mammalian hosts. MDBK cells can support this increased temperature for up to six/seven days, longer than the required time for in vitro parasite replication. ’ A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. A flow chart has been included (Figure 1) aimed to clarify the experimental design of the invasion and replication assays. ‘Figure 1. Flow chart of sporozoite i nvasion and replication inhibition assays. 1. MDBK cells were seeded into 96-well plates to form a confluent monolayer (0.05x10 6 cells/well); 2. Sporozoites were purified from oocysts using DE-52 columns (Pastor-Fernandez et al., 2019); 3. Sporozoites were pre-incubated with anticoccidial drugs at four different concentrations (or without drugs for controls) for 1 hour at 4 o C; 4. Sporozoites were centrifuged, resuspended in AdDMEM and added to MDBK monolayers to allow invasion. 5. Infected cell monolayers were lysed and collected; 6. Genomic DNA was extracted from collected infected cell monolayers; 7. Real time qPCR was used to evaluate the number of parasite genomes for each sample.’ I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. A statistical comparison using the non-parametric Spearman's rank test has been included. This has shown a high degree of correlation with r=1. All this has been detailed in ‘Data analysis’ and ‘Sporozoites of E. tenella invaded and replicated at equivalent rates when transferred to a 96-well plate format’ sections: ‘ Correlation (r) between sporozoite quantification between the 24 and 96-well plate format cultures was determined using the nonparametric Spearman's rank test using GraphPad Prism version 6.00 (GraphPad Software, La Jolla, California, USA) .’ ‘ The linear rate of replication showed a very strong correlation between the 96 and the 24-well plate format models (r=1; 95% confidence interval; Figure 2) ’ Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Statistical analysis have been included to evaluate differences in the ‘number of zoites’ between the different groups. This has now been detailed in ‘Data analysis’ and ‘ Eimeria tenella 96-well plate format in vitro model is suitable to evaluate inhibition of invasion and development after treatment with traditional anticoccidials’ sections. A new figures (Figure 3) has been added. ‘Comparison of groups evaluating differences in ‘number of zoites’ after anticoccidial drug treatment vs. controls was performed using non-parametric Kruskal-Wallis test. The analysis was followed by Dunnett’s multiple comparisons as a post-hoc test. Statistically significant differences were established using a p<0.05. All analyses were performed using GraphPad Prism version 6.00.’ ‘Pre-treatment of sporozoites with different concentrations of AMP, ROB and SAL, three drugs with reported anticoccidial activity, showed a relative dose dependant effect ( Figure 3). There were no significant differences in the number of sporozoites able to invade host cells after the pre-treated groups vs. the controls at either 2 and 24 hpi ( Figure 3, A and B). However, treatment with the highest dose of AMP (50 μ g/ml) show a significant reduction in replication at both 44 and 52 hpi. Similarly, treatment with ROB (50 μ g/ml) exhibited a significant reduction in parasite numbers at 52 hpi ( Figure 3, C and D).’ ‘ Figure 3. Effects of anticoccidial drugs in intracellular numbers of parasites. A and B. Graphs shows the number of parasites by qPCR after invasion at 2 and 24 hpi, respectively (before nuclear division has started, see Figure 2); C and D. Graphs shows the number of parasites by qPCR after nuclear replication at 44 and 52 hpi, respectively. X-axis numbers represent the specific drug dilution used in μ g/ml. Asterisks indicate significant differences with the DMEM/DMSO controls (Dunnett’s multiple comparison test p<0.05).’ Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. We have included the comparison of anticoccidial drugs pre-treatment between the 24 and 96-well plate format in the ‘Discussion’ section: ‘When the same anticoccidial drugs (AMP, ROB and SAL) were evaluated in the 24-well plate format, only concentrations of 5 μ g/ml were tested ( Marugan-Hernandez et al., 2020). Comparing this same concentration in the 96-well plate format, AMP and SAL showed equivalent effects in parasite numbers in invasion and replication for both models. AMP did not show any significant change regarding the controls at any point, whereas SAL did not show differences in invasion, but replication was significantly reduced at 44 hpi (Two-way ANOVA, followed by Dunnett’s post-hoc test). ROB at 5 μ g/ml did not correlate with previous results from the 24-well plate model where strong effects were found in both invasion and replication. In the 96-well plate format, ROB did not show any effect in invasion or replication at 5 μ g/ml. Interestingly, this concentration has shown inhibitory effects in subsequent studies ( Felici et al., 2023) performed in the 96-well plate format, that were equivalent to the 24-well plate format described before. We attributed the lack of significant effects from ROB at 5 μ g/ml in the current study to a loss of effect due to continue use of the drug (where stock has gone several freeze-thaw rounds), which we have observed after using it as inhibition control in further studies.’ Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? All these points have been now included in the new version of the manuscript. Detailed responses can be seen above. Competing Interests: n/a Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Adjei-Mensah B. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.135172.r210464 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v1#referee-response-210464 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 02 Nov 2023 Benjamin Adjei-Mensah , Department of Animal Science, University of Ghana School of Agriculture (Ringgold ID: 356390), Accra, Greater Accra Region, Ghana Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.135172.r210464 Brief report title: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound screening This brief report aimed to adhere to the 3R, focusing ... Continue reading READ ALL Brief report title: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound screening This brief report aimed to adhere to the 3R, focusing much on the reduction aspect by reducing the number of chickens involved in the study. The goal was to use a high number of well plates (96) to pre-screen 10 compounds using a single chicken against a previous study of 24 well plates, which pre-screened two compounds per chicken. The article is clear and cites relevant literature to back the claims of the findings of this study. Appropriate experimental design has been followed and therefore makes the work relevant in the academic space. The statistical approach and its interpretation are appropriate for readability and comprehension. Based on the data provided and the findings, this work can be reproduced. Additionally, the conclusions drawn are supported by the findings of the study. However, I found these minor issues that need to be attended to: The article still requires English Language editing (proofreading). The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Check that there is space between all the reported values and their SI units. I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Check that there is space between all the reported values and their SI units. I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Are the 3Rs implications of the work described accurately? Yes Are a suitable application and appropriate end-users identified? Yes Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Nutrition, Gut physiology, Poultry science I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Adjei-Mensah B. Reviewer Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.135172.r210464 ) The direct URL for this report is: https://f1000research.com/articles/11-1135/v1#referee-response-210464 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 01 Oct 2024 Virginia Marugan-Hernandez , Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, AL8 7TA, UK 01 Oct 2024 Author Response We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article ... Continue reading We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article still requires English Language editing (proofreading). Author response: The article has gone further proofreading, changes have been highlighted throughout the manuscript using ‘Track Changes’ tool. Reviewer comment: The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Author response: We would like to clarify that the chickens are used to generate oocysts that would be later used to release the sporozoite stage to proceed with the in vitro infections. There are no ‘replicates’ in these type of experiments, as there is uniformity between the different batches of productions as we use a reference strain (not field isolates). For oocyst amplification, groups of 10 animals are typically used, and to minimize the overall numbers, the research group operates a pooled resource so that each batch is utilized efficiently, with minimal wastage (this means that when a batch has been produced, this will be used by different researchers for different experiments, and when is needed, a new round of amplification will be done). Chickens will be orally infected with 4,000 oocyst/animal, with an expected yield of ~300 - 500 x 10 6 sporulated oocysts per 10 chickens. All this details are contained in Table 1. In order to clarify this, some text has been added in ‘Parasites and chickens’ section: ‘ Eimeria tenella Wisconsin (Wis) strain ( McDougald & Jeffers, 1976 ) was propagated in ten four-week-old White Leghorn chickens reared under specific pathogen-free conditions. Each chicken was inoculated with 4,000 oocysts to obtain sufficient oocysts for all the in vitro experimental procedures. Table 1 summarises the detailed information of the experiment and used animals following ARRIVE guidelines. ’ Based on this yields, we did the estimation that the use of one chicken (which would produce ~30 x 10 6 oocysts) would allow the evaluation of 10 compounds with a 96-well plate format versus; whereas this will only allow to evaluate two compounds with a 24-well plate format, as the number of sporozoites (and therefor oocysts) needed per well is much higher. More details for this has been also added on the ‘Discussion’ section: ‘ Testing one compound at four different concentrations (excluding untreated controls) requires 12 million of sporozoites in the 24-well plate format (4 concentrations x 3 wells x 1 million/well) whereas only 2.4 million are necessary in the 96-well plate one (4 concentrations x 3 wells x 0.2 million/well); this means the miniaturised model requires 5 times less parasite material. Efficiency of sporozoite excystation and purification from oocysts is set at 1:1 in our experimental settings. A single chicken can produce an average of 30 million oocysts without causing clinical symptoms. Therefore, with the use of one chicken, we could test at least ten compounds (2.4 million/compound x 10 = 24 million oocysts, plus untreated compounds) with the 96-well format, whereas only two compounds (12 million/compound x 2 = 24 million oocysts, plus controls) could be tested in the 24-well plate format. This supposes a direct 80% reduction in animal use (testing 10 compounds would require 5 chickens in the 24-well plate format versus only 1 in the 96-well plate format, which means 4 less chickens out of 5), for the evaluation of anticoccidial compounds locally .’ Regarding the in vitro experiments. The number of replicates are specified in ‘Invasion and replication inhibition assays’ section: ‘ Two different biological replicated were performed in different weeks .’ Reviewer comment: Check that there is space between all the reported values and their SI units. Author response: This has been done (highlighted by the ‘Track Changes’ tool). Reviewer comment: I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Author response: Previous studies using the 24-well plate format to evaluate essential oils from oregano, garlic, thyme and sage (Sidiropoulou et al., 2020-2022) only focused in invasion. In this studies, high dosed of essential oils (100 μg/ml) show similar effects to Robenidine at 5 μg/ml However, as we did no evaluate any essential oil in our current study, we did not include any of these findings on the discussion. As we have recently published the evaluation of essential oils in the 96-well plate format, a small paragraph has been included in this regard in the ‘Discussion’ section: ‘This 96-well plate model has already supported the evaluation of essential oils and their main active compounds ( Felici et al., 2023 ), where the formers have shown similar effects on invasion and replication than ROB and SAL. This is important as research in natural compounds it is essential to replace current anticoccidials for which several resistances have been developed in field strains threatening their efficacy. These latest results evidence the suitability of the miniaturised model to detect inhibition of invasion and/or replication of natural compounds in addition to classical anticoccidal drugs.’ We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article still requires English Language editing (proofreading). Author response: The article has gone further proofreading, changes have been highlighted throughout the manuscript using ‘Track Changes’ tool. Reviewer comment: The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Author response: We would like to clarify that the chickens are used to generate oocysts that would be later used to release the sporozoite stage to proceed with the in vitro infections. There are no ‘replicates’ in these type of experiments, as there is uniformity between the different batches of productions as we use a reference strain (not field isolates). For oocyst amplification, groups of 10 animals are typically used, and to minimize the overall numbers, the research group operates a pooled resource so that each batch is utilized efficiently, with minimal wastage (this means that when a batch has been produced, this will be used by different researchers for different experiments, and when is needed, a new round of amplification will be done). Chickens will be orally infected with 4,000 oocyst/animal, with an expected yield of ~300 - 500 x 10 6 sporulated oocysts per 10 chickens. All this details are contained in Table 1. In order to clarify this, some text has been added in ‘Parasites and chickens’ section: ‘ Eimeria tenella Wisconsin (Wis) strain ( McDougald & Jeffers, 1976 ) was propagated in ten four-week-old White Leghorn chickens reared under specific pathogen-free conditions. Each chicken was inoculated with 4,000 oocysts to obtain sufficient oocysts for all the in vitro experimental procedures. Table 1 summarises the detailed information of the experiment and used animals following ARRIVE guidelines. ’ Based on this yields, we did the estimation that the use of one chicken (which would produce ~30 x 10 6 oocysts) would allow the evaluation of 10 compounds with a 96-well plate format versus; whereas this will only allow to evaluate two compounds with a 24-well plate format, as the number of sporozoites (and therefor oocysts) needed per well is much higher. More details for this has been also added on the ‘Discussion’ section: ‘ Testing one compound at four different concentrations (excluding untreated controls) requires 12 million of sporozoites in the 24-well plate format (4 concentrations x 3 wells x 1 million/well) whereas only 2.4 million are necessary in the 96-well plate one (4 concentrations x 3 wells x 0.2 million/well); this means the miniaturised model requires 5 times less parasite material. Efficiency of sporozoite excystation and purification from oocysts is set at 1:1 in our experimental settings. A single chicken can produce an average of 30 million oocysts without causing clinical symptoms. Therefore, with the use of one chicken, we could test at least ten compounds (2.4 million/compound x 10 = 24 million oocysts, plus untreated compounds) with the 96-well format, whereas only two compounds (12 million/compound x 2 = 24 million oocysts, plus controls) could be tested in the 24-well plate format. This supposes a direct 80% reduction in animal use (testing 10 compounds would require 5 chickens in the 24-well plate format versus only 1 in the 96-well plate format, which means 4 less chickens out of 5), for the evaluation of anticoccidial compounds locally .’ Regarding the in vitro experiments. The number of replicates are specified in ‘Invasion and replication inhibition assays’ section: ‘ Two different biological replicated were performed in different weeks .’ Reviewer comment: Check that there is space between all the reported values and their SI units. Author response: This has been done (highlighted by the ‘Track Changes’ tool). Reviewer comment: I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Author response: Previous studies using the 24-well plate format to evaluate essential oils from oregano, garlic, thyme and sage (Sidiropoulou et al., 2020-2022) only focused in invasion. In this studies, high dosed of essential oils (100 μg/ml) show similar effects to Robenidine at 5 μg/ml However, as we did no evaluate any essential oil in our current study, we did not include any of these findings on the discussion. As we have recently published the evaluation of essential oils in the 96-well plate format, a small paragraph has been included in this regard in the ‘Discussion’ section: ‘This 96-well plate model has already supported the evaluation of essential oils and their main active compounds ( Felici et al., 2023 ), where the formers have shown similar effects on invasion and replication than ROB and SAL. This is important as research in natural compounds it is essential to replace current anticoccidials for which several resistances have been developed in field strains threatening their efficacy. These latest results evidence the suitability of the miniaturised model to detect inhibition of invasion and/or replication of natural compounds in addition to classical anticoccidal drugs.’ Competing Interests: n/a Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 01 Oct 2024 Virginia Marugan-Hernandez , Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, AL8 7TA, UK 01 Oct 2024 Author Response We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article ... Continue reading We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article still requires English Language editing (proofreading). Author response: The article has gone further proofreading, changes have been highlighted throughout the manuscript using ‘Track Changes’ tool. Reviewer comment: The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Author response: We would like to clarify that the chickens are used to generate oocysts that would be later used to release the sporozoite stage to proceed with the in vitro infections. There are no ‘replicates’ in these type of experiments, as there is uniformity between the different batches of productions as we use a reference strain (not field isolates). For oocyst amplification, groups of 10 animals are typically used, and to minimize the overall numbers, the research group operates a pooled resource so that each batch is utilized efficiently, with minimal wastage (this means that when a batch has been produced, this will be used by different researchers for different experiments, and when is needed, a new round of amplification will be done). Chickens will be orally infected with 4,000 oocyst/animal, with an expected yield of ~300 - 500 x 10 6 sporulated oocysts per 10 chickens. All this details are contained in Table 1. In order to clarify this, some text has been added in ‘Parasites and chickens’ section: ‘ Eimeria tenella Wisconsin (Wis) strain ( McDougald & Jeffers, 1976 ) was propagated in ten four-week-old White Leghorn chickens reared under specific pathogen-free conditions. Each chicken was inoculated with 4,000 oocysts to obtain sufficient oocysts for all the in vitro experimental procedures. Table 1 summarises the detailed information of the experiment and used animals following ARRIVE guidelines. ’ Based on this yields, we did the estimation that the use of one chicken (which would produce ~30 x 10 6 oocysts) would allow the evaluation of 10 compounds with a 96-well plate format versus; whereas this will only allow to evaluate two compounds with a 24-well plate format, as the number of sporozoites (and therefor oocysts) needed per well is much higher. More details for this has been also added on the ‘Discussion’ section: ‘ Testing one compound at four different concentrations (excluding untreated controls) requires 12 million of sporozoites in the 24-well plate format (4 concentrations x 3 wells x 1 million/well) whereas only 2.4 million are necessary in the 96-well plate one (4 concentrations x 3 wells x 0.2 million/well); this means the miniaturised model requires 5 times less parasite material. Efficiency of sporozoite excystation and purification from oocysts is set at 1:1 in our experimental settings. A single chicken can produce an average of 30 million oocysts without causing clinical symptoms. Therefore, with the use of one chicken, we could test at least ten compounds (2.4 million/compound x 10 = 24 million oocysts, plus untreated compounds) with the 96-well format, whereas only two compounds (12 million/compound x 2 = 24 million oocysts, plus controls) could be tested in the 24-well plate format. This supposes a direct 80% reduction in animal use (testing 10 compounds would require 5 chickens in the 24-well plate format versus only 1 in the 96-well plate format, which means 4 less chickens out of 5), for the evaluation of anticoccidial compounds locally .’ Regarding the in vitro experiments. The number of replicates are specified in ‘Invasion and replication inhibition assays’ section: ‘ Two different biological replicated were performed in different weeks .’ Reviewer comment: Check that there is space between all the reported values and their SI units. Author response: This has been done (highlighted by the ‘Track Changes’ tool). Reviewer comment: I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Author response: Previous studies using the 24-well plate format to evaluate essential oils from oregano, garlic, thyme and sage (Sidiropoulou et al., 2020-2022) only focused in invasion. In this studies, high dosed of essential oils (100 μg/ml) show similar effects to Robenidine at 5 μg/ml However, as we did no evaluate any essential oil in our current study, we did not include any of these findings on the discussion. As we have recently published the evaluation of essential oils in the 96-well plate format, a small paragraph has been included in this regard in the ‘Discussion’ section: ‘This 96-well plate model has already supported the evaluation of essential oils and their main active compounds ( Felici et al., 2023 ), where the formers have shown similar effects on invasion and replication than ROB and SAL. This is important as research in natural compounds it is essential to replace current anticoccidials for which several resistances have been developed in field strains threatening their efficacy. These latest results evidence the suitability of the miniaturised model to detect inhibition of invasion and/or replication of natural compounds in addition to classical anticoccidal drugs.’ We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article still requires English Language editing (proofreading). Author response: The article has gone further proofreading, changes have been highlighted throughout the manuscript using ‘Track Changes’ tool. Reviewer comment: The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Author response: We would like to clarify that the chickens are used to generate oocysts that would be later used to release the sporozoite stage to proceed with the in vitro infections. There are no ‘replicates’ in these type of experiments, as there is uniformity between the different batches of productions as we use a reference strain (not field isolates). For oocyst amplification, groups of 10 animals are typically used, and to minimize the overall numbers, the research group operates a pooled resource so that each batch is utilized efficiently, with minimal wastage (this means that when a batch has been produced, this will be used by different researchers for different experiments, and when is needed, a new round of amplification will be done). Chickens will be orally infected with 4,000 oocyst/animal, with an expected yield of ~300 - 500 x 10 6 sporulated oocysts per 10 chickens. All this details are contained in Table 1. In order to clarify this, some text has been added in ‘Parasites and chickens’ section: ‘ Eimeria tenella Wisconsin (Wis) strain ( McDougald & Jeffers, 1976 ) was propagated in ten four-week-old White Leghorn chickens reared under specific pathogen-free conditions. Each chicken was inoculated with 4,000 oocysts to obtain sufficient oocysts for all the in vitro experimental procedures. Table 1 summarises the detailed information of the experiment and used animals following ARRIVE guidelines. ’ Based on this yields, we did the estimation that the use of one chicken (which would produce ~30 x 10 6 oocysts) would allow the evaluation of 10 compounds with a 96-well plate format versus; whereas this will only allow to evaluate two compounds with a 24-well plate format, as the number of sporozoites (and therefor oocysts) needed per well is much higher. More details for this has been also added on the ‘Discussion’ section: ‘ Testing one compound at four different concentrations (excluding untreated controls) requires 12 million of sporozoites in the 24-well plate format (4 concentrations x 3 wells x 1 million/well) whereas only 2.4 million are necessary in the 96-well plate one (4 concentrations x 3 wells x 0.2 million/well); this means the miniaturised model requires 5 times less parasite material. Efficiency of sporozoite excystation and purification from oocysts is set at 1:1 in our experimental settings. A single chicken can produce an average of 30 million oocysts without causing clinical symptoms. Therefore, with the use of one chicken, we could test at least ten compounds (2.4 million/compound x 10 = 24 million oocysts, plus untreated compounds) with the 96-well format, whereas only two compounds (12 million/compound x 2 = 24 million oocysts, plus controls) could be tested in the 24-well plate format. This supposes a direct 80% reduction in animal use (testing 10 compounds would require 5 chickens in the 24-well plate format versus only 1 in the 96-well plate format, which means 4 less chickens out of 5), for the evaluation of anticoccidial compounds locally .’ Regarding the in vitro experiments. The number of replicates are specified in ‘Invasion and replication inhibition assays’ section: ‘ Two different biological replicated were performed in different weeks .’ Reviewer comment: Check that there is space between all the reported values and their SI units. Author response: This has been done (highlighted by the ‘Track Changes’ tool). Reviewer comment: I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Author response: Previous studies using the 24-well plate format to evaluate essential oils from oregano, garlic, thyme and sage (Sidiropoulou et al., 2020-2022) only focused in invasion. In this studies, high dosed of essential oils (100 μg/ml) show similar effects to Robenidine at 5 μg/ml However, as we did no evaluate any essential oil in our current study, we did not include any of these findings on the discussion. As we have recently published the evaluation of essential oils in the 96-well plate format, a small paragraph has been included in this regard in the ‘Discussion’ section: ‘This 96-well plate model has already supported the evaluation of essential oils and their main active compounds ( Felici et al., 2023 ), where the formers have shown similar effects on invasion and replication than ROB and SAL. This is important as research in natural compounds it is essential to replace current anticoccidials for which several resistances have been developed in field strains threatening their efficacy. These latest results evidence the suitability of the miniaturised model to detect inhibition of invasion and/or replication of natural compounds in addition to classical anticoccidal drugs.’ Competing Interests: n/a Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 04 Oct 2022 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 01 Oct 24 read read Version 1 04 Oct 22 read read Benjamin Adjei-Mensah , University of Ghana School of Agriculture (Ringgold ID: 356390), Accra, Ghana Joseph D. Turner , Liverpool School of Tropical Medicine, Liverpool, UK Xiaokai Song , Nanjing Agricultural University, Nanjing, China Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Adjei-Mensah B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 07 Feb 2025 | for Version 2 Benjamin Adjei-Mensah , Department of Animal Science, University of Ghana School of Agriculture (Ringgold ID: 356390), Accra, Greater Accra Region, Ghana 0 Views copyright © 2025 Adjei-Mensah B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions I would like to appreciate the author for addressing all the comments I suggested. The article report is in good shape for indexing. Thanks. Competing Interests No competing interests were disclosed. Reviewer Expertise Nutrition, Gut physiology, Poultry science I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Adjei-Mensah B. Peer Review Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.172468.r356737) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1135/v2#referee-response-356737 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Song X. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 23 Dec 2024 | for Version 2 Xiaokai Song , Nanjing Agricultural University, Nanjing, China 0 Views copyright © 2024 Song X. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions In this manuscript, the author provides a detailed description of the miniaturization of the experimental model for the invasion of Eimeria tenella sporozoite in MDBK cells. The miniaturized model was proven by in vitro experiments to allow for simultaneous pre-screening of a greater number of different concentrations of anti-coccidial drugs, which will further reduce the number of infected chickens required for these drugs to be tested experimentally. Overall, this study presents a valuable contribution to the field of anticoccidial drug research. The authors’ efforts to reduce animal usage and improve the efficiency of drug screening are commendable. I have the following comments: Conduct a more comprehensive statistical analysis, including: Comparison of drug efficacy between the 24-well and 96-well plate formats at each time point and overall inhibition rate. Analysis of the reproducibility of the 96-well plate model across multiple experiments. Expand the discussion to address the limitations of the 96-well plate model compared to the 24-well plate model. Provide more details on the logistics and potential challenges of the pooled resource approach for oocyst amplification. Consider including a section on the potential for adapting the 96-well plate model for other Eimeria species. The title of Table 3 is too lengthy; it is suggested to be more concise. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise The Mechanism of Invasion by Chicken Coccidia I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Song X. Peer Review Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.172468.r340270) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1135/v2#referee-response-340270 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2023 Turner J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 13 Nov 2023 | for Version 1 Joseph D. Turner , Centre for Drugs and Diagnostics, Department of Parasitology, Liverpool School of Tropical Medicine, Liverpool, UK 0 Views copyright © 2023 Turner J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Not Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The work of Arias-Maroto et al., details miniaturisation of an Eimeria tenella sporozoite invasion and replication assay in immortalised bovine kidney epithelial cells. The in vitro assay, if successful in emulating the larger plate system, would further cut down the number of experimentally infected chickens required to generate parasites for these drug assays. 3Rs statement When stating the 80% reduction metric of use of chickens for generation of parasites due to miniaturisation, it would be informative if the authors could estimate numbers of chickens used for this purpose per annum in their lab, in the UK or globally that may be reduced via adoption of a miniaturised assay, as they have done in the discussion. Methods Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. Results and conclusions I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Suggest revisions before considering the work fully valid: Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? Are the 3Rs implications of the work described accurately? Partly Are a suitable application and appropriate end-users identified? Yes Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? No Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Parasitology, drug discovery & development, infection biology, immunobiology. Referee suggested by the NC3Rs for their scientific expertise and experience in assessing 3Rs impact. I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. reply Respond to this report Responses (1) Author Response 01 Oct 2024 Virginia Marugan-Hernandez, Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, AL8 7TA, UK We would like to thank Joseph D. Turner for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Rationale for selection of seeding densities in 96-well plates needs more explanation - was it based on scaling of volume, well area or well volume compared with 24 well plate, for instance? The two densities were derived of the previously optimised number for the 24-well plate format that was conferring a 100% confluence without an excess of cells (Marugan-Hernandez et al., 2020). This has been now detailed in ‘Optimisation of infection ratios’ section: ‘ Based on the amount of 0.3×10 6 per well in 500 μ l, previously optimised for the 24-well plates format to confer a confluence of 100% without excess of cells (where the surface of each well is four time larger than in the 96-well plate format; 0.3×10 6 / 4 = 0.075×10 6 ), we tested 0.1×10 6 and 0.05×10 6 cells per well for the 96-well plate format (just above and below to the equivalent figure) .’ Readers may wish to understand why it is necessary to culture at 41 degrees centigrade for infection of MDBK with sporozoites as this is unusual for mammalian cell culture. The temperature in the chicken intestine is 41 o C and this is the optimal temperature for Eimeria tenella development, if the temperature is lower, the parasite will not replicate. This has been clarified in ‘Optimisation of infection ratios’ section: ‘ This temperature is necessary for parasite development, as chicken Eimeria parasites develop in the intestine of chickens, whose internal temperature is 41 o C, higher than mammalian hosts. MDBK cells can support this increased temperature for up to six/seven days, longer than the required time for in vitro parasite replication. ’ A flow chart of the invasion and replication inhibition assays would help clarify timings of when sporozoites and drugs were added / removed, as without careful reading this is hard to follow. A flow chart has been included (Figure 1) aimed to clarify the experimental design of the invasion and replication assays. ‘Figure 1. Flow chart of sporozoite i nvasion and replication inhibition assays. 1. MDBK cells were seeded into 96-well plates to form a confluent monolayer (0.05x10 6 cells/well); 2. Sporozoites were purified from oocysts using DE-52 columns (Pastor-Fernandez et al., 2019); 3. Sporozoites were pre-incubated with anticoccidial drugs at four different concentrations (or without drugs for controls) for 1 hour at 4 o C; 4. Sporozoites were centrifuged, resuspended in AdDMEM and added to MDBK monolayers to allow invasion. 5. Infected cell monolayers were lysed and collected; 6. Genomic DNA was extracted from collected infected cell monolayers; 7. Real time qPCR was used to evaluate the number of parasite genomes for each sample.’ I agree the data supports the conclusion that infection and growth rate of Eimeria is similar between optimised 24 and 96 well plate cultures, but a suitable statistical comparison would be needed to confirm this. A statistical comparison using the non-parametric Spearman's rank test has been included. This has shown a high degree of correlation with r=1. All this has been detailed in ‘Data analysis’ and ‘Sporozoites of E. tenella invaded and replicated at equivalent rates when transferred to a 96-well plate format’ sections: ‘ Correlation (r) between sporozoite quantification between the 24 and 96-well plate format cultures was determined using the nonparametric Spearman's rank test using GraphPad Prism version 6.00 (GraphPad Software, La Jolla, California, USA) .’ ‘ The linear rate of replication showed a very strong correlation between the 96 and the 24-well plate format models (r=1; 95% confidence interval; Figure 2) ’ Further, there is a lack of statistics to test whether any of the drug compounds significantly inhibited invasion and/or growth - using PCR quantifications at either time point or the overall growth rate. Statistical analysis have been included to evaluate differences in the ‘number of zoites’ between the different groups. This has now been detailed in ‘Data analysis’ and ‘ Eimeria tenella 96-well plate format in vitro model is suitable to evaluate inhibition of invasion and development after treatment with traditional anticoccidials’ sections. A new figures (Figure 3) has been added. ‘Comparison of groups evaluating differences in ‘number of zoites’ after anticoccidial drug treatment vs. controls was performed using non-parametric Kruskal-Wallis test. The analysis was followed by Dunnett’s multiple comparisons as a post-hoc test. Statistically significant differences were established using a p<0.05. All analyses were performed using GraphPad Prism version 6.00.’ ‘Pre-treatment of sporozoites with different concentrations of AMP, ROB and SAL, three drugs with reported anticoccidial activity, showed a relative dose dependant effect ( Figure 3). There were no significant differences in the number of sporozoites able to invade host cells after the pre-treated groups vs. the controls at either 2 and 24 hpi ( Figure 3, A and B). However, treatment with the highest dose of AMP (50 μ g/ml) show a significant reduction in replication at both 44 and 52 hpi. Similarly, treatment with ROB (50 μ g/ml) exhibited a significant reduction in parasite numbers at 52 hpi ( Figure 3, C and D).’ ‘ Figure 3. Effects of anticoccidial drugs in intracellular numbers of parasites. A and B. Graphs shows the number of parasites by qPCR after invasion at 2 and 24 hpi, respectively (before nuclear division has started, see Figure 2); C and D. Graphs shows the number of parasites by qPCR after nuclear replication at 44 and 52 hpi, respectively. X-axis numbers represent the specific drug dilution used in μ g/ml. Asterisks indicate significant differences with the DMEM/DMSO controls (Dunnett’s multiple comparison test p<0.05).’ Further, there is no discussion whether these drugs and concentrations tested induce similar or different levels of inhibition in the miniaturised 96-well system compared with the prior standardised 24 well plate system. We have included the comparison of anticoccidial drugs pre-treatment between the 24 and 96-well plate format in the ‘Discussion’ section: ‘When the same anticoccidial drugs (AMP, ROB and SAL) were evaluated in the 24-well plate format, only concentrations of 5 μ g/ml were tested ( Marugan-Hernandez et al., 2020). Comparing this same concentration in the 96-well plate format, AMP and SAL showed equivalent effects in parasite numbers in invasion and replication for both models. AMP did not show any significant change regarding the controls at any point, whereas SAL did not show differences in invasion, but replication was significantly reduced at 44 hpi (Two-way ANOVA, followed by Dunnett’s post-hoc test). ROB at 5 μ g/ml did not correlate with previous results from the 24-well plate model where strong effects were found in both invasion and replication. In the 96-well plate format, ROB did not show any effect in invasion or replication at 5 μ g/ml. Interestingly, this concentration has shown inhibitory effects in subsequent studies ( Felici et al., 2023) performed in the 96-well plate format, that were equivalent to the 24-well plate format described before. We attributed the lack of significant effects from ROB at 5 μ g/ml in the current study to a loss of effect due to continue use of the drug (where stock has gone several freeze-thaw rounds), which we have observed after using it as inhibition control in further studies.’ Without statistical tests of the 3 replicates per condition to demonstrate meaningful levels of drug efficacy, and how reproducible between different experiments, and how consistent cf the 24-well original screen, it is not currently possible to conclude the 96-well plate system 'has been successfully miniaturised'. Please test that Eimeria infectivity / growth is not significantly different in 96- v 24-well plate systems. Please could the authors provide statistical tests to determine which drugs significantly reduce invasion and/or replication in their miniaturised assay. Could the authors compare drug efficacy achieved in 24 vs 96 well assays with any or all drug compounds screened? All these points have been now included in the new version of the manuscript. Detailed responses can be seen above. View more View less Competing Interests n/a reply Respond Report a concern Turner JD. Peer Review Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.135172.r173894) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1135/v1#referee-response-173894 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2023 Adjei-Mensah B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 02 Nov 2023 | for Version 1 Benjamin Adjei-Mensah , Department of Animal Science, University of Ghana School of Agriculture (Ringgold ID: 356390), Accra, Greater Accra Region, Ghana 0 Views copyright © 2023 Adjei-Mensah B. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Brief report title: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound screening This brief report aimed to adhere to the 3R, focusing much on the reduction aspect by reducing the number of chickens involved in the study. The goal was to use a high number of well plates (96) to pre-screen 10 compounds using a single chicken against a previous study of 24 well plates, which pre-screened two compounds per chicken. The article is clear and cites relevant literature to back the claims of the findings of this study. Appropriate experimental design has been followed and therefore makes the work relevant in the academic space. The statistical approach and its interpretation are appropriate for readability and comprehension. Based on the data provided and the findings, this work can be reproduced. Additionally, the conclusions drawn are supported by the findings of the study. However, I found these minor issues that need to be attended to: The article still requires English Language editing (proofreading). The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Check that there is space between all the reported values and their SI units. I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Check that there is space between all the reported values and their SI units. I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Are the 3Rs implications of the work described accurately? Yes Are a suitable application and appropriate end-users identified? Yes Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Nutrition, Gut physiology, Poultry science I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 01 Oct 2024 Virginia Marugan-Hernandez, Department of Pathobiology and Population Sciences, Royal Veterinary College, London, Hatfield, AL8 7TA, UK We would like to thank Benjamin Adjei-Mensah for his time and effort reviewing our manuscript. We provide below responses for the different queries and issues raised. Reviewer comment: The article still requires English Language editing (proofreading). Author response: The article has gone further proofreading, changes have been highlighted throughout the manuscript using ‘Track Changes’ tool. Reviewer comment: The authors should be clear on the number of replications. Were all the 10 birds induced with the oocysts? If so, was it the only one that was used during the in vitro studies? Author response: We would like to clarify that the chickens are used to generate oocysts that would be later used to release the sporozoite stage to proceed with the in vitro infections. There are no ‘replicates’ in these type of experiments, as there is uniformity between the different batches of productions as we use a reference strain (not field isolates). For oocyst amplification, groups of 10 animals are typically used, and to minimize the overall numbers, the research group operates a pooled resource so that each batch is utilized efficiently, with minimal wastage (this means that when a batch has been produced, this will be used by different researchers for different experiments, and when is needed, a new round of amplification will be done). Chickens will be orally infected with 4,000 oocyst/animal, with an expected yield of ~300 - 500 x 10 6 sporulated oocysts per 10 chickens. All this details are contained in Table 1. In order to clarify this, some text has been added in ‘Parasites and chickens’ section: ‘ Eimeria tenella Wisconsin (Wis) strain ( McDougald & Jeffers, 1976 ) was propagated in ten four-week-old White Leghorn chickens reared under specific pathogen-free conditions. Each chicken was inoculated with 4,000 oocysts to obtain sufficient oocysts for all the in vitro experimental procedures. Table 1 summarises the detailed information of the experiment and used animals following ARRIVE guidelines. ’ Based on this yields, we did the estimation that the use of one chicken (which would produce ~30 x 10 6 oocysts) would allow the evaluation of 10 compounds with a 96-well plate format versus; whereas this will only allow to evaluate two compounds with a 24-well plate format, as the number of sporozoites (and therefor oocysts) needed per well is much higher. More details for this has been also added on the ‘Discussion’ section: ‘ Testing one compound at four different concentrations (excluding untreated controls) requires 12 million of sporozoites in the 24-well plate format (4 concentrations x 3 wells x 1 million/well) whereas only 2.4 million are necessary in the 96-well plate one (4 concentrations x 3 wells x 0.2 million/well); this means the miniaturised model requires 5 times less parasite material. Efficiency of sporozoite excystation and purification from oocysts is set at 1:1 in our experimental settings. A single chicken can produce an average of 30 million oocysts without causing clinical symptoms. Therefore, with the use of one chicken, we could test at least ten compounds (2.4 million/compound x 10 = 24 million oocysts, plus untreated compounds) with the 96-well format, whereas only two compounds (12 million/compound x 2 = 24 million oocysts, plus controls) could be tested in the 24-well plate format. This supposes a direct 80% reduction in animal use (testing 10 compounds would require 5 chickens in the 24-well plate format versus only 1 in the 96-well plate format, which means 4 less chickens out of 5), for the evaluation of anticoccidial compounds locally .’ Regarding the in vitro experiments. The number of replicates are specified in ‘Invasion and replication inhibition assays’ section: ‘ Two different biological replicated were performed in different weeks .’ Reviewer comment: Check that there is space between all the reported values and their SI units. Author response: This has been done (highlighted by the ‘Track Changes’ tool). Reviewer comment: I expected some comparisons to be made in the discussion of the findings of the synthetic compounds against that which was reported using the essential oils since the former already have public health issues as indicated in the introduction. Author response: Previous studies using the 24-well plate format to evaluate essential oils from oregano, garlic, thyme and sage (Sidiropoulou et al., 2020-2022) only focused in invasion. In this studies, high dosed of essential oils (100 μg/ml) show similar effects to Robenidine at 5 μg/ml However, as we did no evaluate any essential oil in our current study, we did not include any of these findings on the discussion. As we have recently published the evaluation of essential oils in the 96-well plate format, a small paragraph has been included in this regard in the ‘Discussion’ section: ‘This 96-well plate model has already supported the evaluation of essential oils and their main active compounds ( Felici et al., 2023 ), where the formers have shown similar effects on invasion and replication than ROB and SAL. This is important as research in natural compounds it is essential to replace current anticoccidials for which several resistances have been developed in field strains threatening their efficacy. These latest results evidence the suitability of the miniaturised model to detect inhibition of invasion and/or replication of natural compounds in addition to classical anticoccidal drugs.’ View more View less Competing Interests n/a reply Respond Report a concern Adjei-Mensah B. Peer Review Report For: Reduction of chickens use to perform in vitro pre-screening of novel anticoccidials by miniaturisation and increased throughput of the current Eimeria tenella compound-screening model [version 2; peer review: 2 approved, 1 not approved] . F1000Research 2024, 11 :1135 ( https://doi.org/10.5256/f1000research.135172.r210464) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1135/v1#referee-response-210464 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Reduction of chickens use to perform in vitro...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/11-1135/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/11-1135/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/11-1135/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Arias-Maroto S et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/11-1135/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/11-1135", templates : { twitter : "Reduction of chickens use to perform in vitro pre-screening of.... Arias-Maroto S et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/11-1135/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/123102/172468") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "172468"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "334725": 0, "334724": 0, "162051": 0, "334727": 0, "152704": 0, "334726": 0, "356737": 9, "334733": 0, "334732": 0, "334729": 0, "334728": 0, "334731": 0, "334730": 0, "210463": 0, "210462": 0, "210461": 0, "210467": 0, "210466": 0, "210465": 0, "210464": 42, "210471": 0, "210469": 0, "340269": 0, "347181": 0, "340268": 0, "347180": 0, "340271": 0, "347183": 0, "347182": 0, "340270": 14, "210472": 0, "340265": 0, "347177": 0, "161582": 0, "340264": 0, "347176": 0, "340267": 0, "347179": 0, "340266": 0, "347178": 0, "191666": 0, "340273": 0, "347185": 0, "191670": 0, "340272": 0, "347184": 0, "191674": 0, "347196": 0, "191678": 0, "191682": 0, "173894": 48, "191687": 0, "173895": 0, "191691": 0, "191703": 0, "191700": 0, "191707": 0, "156650": 0, "156651": 0, "356735": 0, "152702": 0, "152703": 0, "152700": 0, "152701": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "2caad112-bb04-4f8f-81dc-bae0d1a9cfe9"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.