Response of vWF, BDNF, hippocampal and cardiac tissues to consumption of Khar-e Maryam extract and training in rats’ model of post-traumatic stress disorder (PTSD)

Response of vWF, BDNF, hippocampal and cardiac tissues to consumption of Khar-e Maryam extract and training in rats’ model of post-traumatic stress disorder (PTSD) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Response of vWF, BDNF, hippocampal and cardiac tissues to consumption of Khar-e Maryam extract and training in rats’ model of post-traumatic stress disorder (PTSD) Farah Nameni, Asma Tovasoli, Saba Aghamiri This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7887589/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background and Objective : Post-traumatic stress disorder is a common mental disorder that can impair memory, learning, and mood. This study aimed to investigate the effects of concurrent exercise and milk thistle extract on hippocampal tissue, myocardial tissue, von Willebrand factor, and BDNF levels on post-traumatic stress disorder in male rats. Methods Fifty five male Wistar rats were randomly divided into five groups: healthy, PTSD, combined exercise, Khar-e Maryam extract, and combined exercise + Khar-e Maryam extract. The PTSD model was induced using a standard stress protocol. The concurrent exercise program was performed for 4 weeks. The supplementation groups received 30 international units of Khar-e Maryam extract daily. After the end of the interventions, hippocampal and heart tissue samples were isolated. The levels of von Willebrand factor and BDNF were also measured and analyzed by ELISA. Data were analyzed using the two-way analysis of variance test, and the Tukey post hoc test. Results Concurrent use of Khar-e Maryam extract and exercise intervention after induction of post-traumatic stress disorder significantly increased BDNF gene expression levels, significantly decreased vWF gene expression levels, and positive changes in hippocampal and cardiac tissue compared to the PTSD group. Conclusion The findings indicate that concurrent exercise with Khar-e Maryam extract supplementation can have a synergistic effect in improving hippocampal and cardiac function and regulating BDNF and vWF gene expression levels in an animal model of PTSD. Accordingly, non-pharmacological interventions such as regular physical activity and consumption of medicinal herbs can be effective in improving outcomes related to PTSD. Health sciences/Diseases Health sciences/Medical research Biological sciences/Neuroscience Biological sciences/Physiology Post-traumatic stress disorder cardiac tissue von Willebrand factor combined exercise Khar-e Maryam BDNF Hippocampus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Highlights • PTSD simultaneously damages the brain (hippocampal atrophy and reduced BDNF) and the heart (tissue changes and increased vWF). • Combined training actively mitigates both types of damage by increasing BDNF and improving cardiac function. • Khar-e Maryam protects neural and cardiac tissues from damage due to its potent antioxidant properties. • The main goal is to investigate the synergistic effect of these two interventions for a more comprehensive treatment approach 1.Introduction Post-Traumatic Stress Disorder (PTSD) is a complex neuropsychological disorder that develops in response to traumatic experiences (such as war, natural disasters, or violence). It is characterized by symptoms including intrusive memories, avoidance of trauma-related stimuli, negative alterations in cognition and mood, and increased arousal. Beyond its destructive impact on mental health, PTSD also has widespread physiological and neurobiological consequences. Among the most significant physiological changes are disruptions to the hypothalamic-pituitary-adrenal (HPA) axis and structural and functional alterations in key brain regions like the hippocampus. The hippocampus, which plays a vital role in memory and emotion regulation, often undergoes atrophy in individuals with PTSD. This is associated with a decrease in the level of brain-derived neurotrophic factor (BDNF). BDNF is a crucial neurotrophin essential for the survival, growth, and differentiation of neurons and its reduction is directly linked to neuronal damage and cognitive impairment in PTSD(Mann et al.,2024). Moreover, PTSD can have damaging effects on the cardiovascular system. Chronic stress and the constant activation of the sympathetic nervous system in PTSD patients lead to an increased risk of developing cardiovascular diseases. The cardiac muscle tissue in these individuals may undergo structural and functional changes. One of the important markers for these disorders is an increase in the level of von Willebrand factor (vWF). vWF is a multimeric glycoprotein that plays a key role in hemostasis and blood clotting, and its elevated levels are associated with a higher risk of thrombosis and cardiovascular events. Understanding these physiological connections and molecular mechanisms in PTSD is crucial for developing comprehensive therapeutic strategies(Dong et al.,2025). The connection between these damages is entirely logical and cohesive. Chronic stress in PTSD simultaneously affects both the nervous and cardiovascular systems. The hyper-activation of the HPA axis and the sympathetic nervous system leads to the release of stress hormones like cortisol and catecholamines. These hormones directly and negatively impact the hippocampal tissue, causing a reduction in BDNF and resulting in neuronal damage. Simultaneously, these same hormones and the oxidative stress they cause damage the cardiac muscle tissue and lead to an increase in von Willebrand factor (vWF) levels. Therefore, the neural and cardiac damages in PTSD are two sides of the same coin, linked by a shared pathophysiological mechanism: chronic stress(Raise-Abdullahi et al., 2023 ). In recent years, non-pharmacological approaches and natural supplements have gained attention as complementary therapies for managing PTSD. Combined training, which includes a mix of aerobic and resistance exercises, is recognized as a powerful and multifaceted intervention. Extensive research has shown that regular exercise can improve cognitive function, reduce symptoms of anxiety and depression, and increase BDNF levels in the brain. By stimulating neurogenesis and improving synaptic function, exercise can counteract the damage to the hippocampus caused by chronic stress. The anti-inflammatory and antioxidant effects of exercise also help protect both neural and cardiac tissues from oxidative damage. Furthermore, exercise can improve cardiovascular function, lower blood pressure, and by modulating coagulation factors like vWF, reduce the risk of cardiovascular events(Björkman et al.,2022). In addition to exercise, the use of herbal compounds like Khar-e Maryam is being explored as a complementary approach. Khar-e Maryam, the main active component of Khar-e Maryam (Silybum marianum) extract, is known for its antioxidant, anti-inflammatory, and hepatoprotective properties. Emerging evidence suggests that Khar-e Maryam can have protective effects on the central nervous system. By crossing the blood-brain barrier, this compound is capable of reducing oxidative stress in brain tissues and increasing BDNF levels. Additionally, the antioxidant properties of Khar-e Maryam can provide protection against cardiovascular damage caused by chronic stress. However, limited research has been conducted on the simultaneous effects of combined training and Khar-e Maryam consumption on the neurobiological and physiological outcomes in animal models of PTSD(Mahmoud et al., 2025). Specifically, this study aims to examine the changes in hippocampal tissue, BDNF levels, cardiac muscle tissue, and von Willebrand factor (vWF) in male rats with PTSD. The animal model of PTSD is widely used to study disease mechanisms and evaluate the effects of therapeutic interventions. The results of this research can help elucidate the molecular and physiological mechanisms of these interventions in managing PTSD and provide a basis for developing more comprehensive and effective treatment strategies in humans(Manukhina et al., 2021 ). This study will not only add to the existing knowledge about the neurobiological and cardiovascular effects of PTSD but also help evaluate the combined potential of non-pharmacological interventions and natural supplements in combating the complications of this disorder. 2.Materials and methods All procedures involving animals were approved by the Institutional Animal Care and Use Committee and reported in accordance with the ARRIVE guidelines. This controlled experimental study was conducted using a 2×2 factorial design on male Wistar rats. The study was approved by the University Ethics Committee (Ethics code:IR.IAU.SRB. REC.1404.190) and carried out in accordance with international ethical guidelines for the care and use of laboratory animals. The statistical population included 55 adult male Wistar rats, aged 8–10 weeks and weighing 280–320 g, which were obtained from the Laboratory Animal Breeding Center of the Pasteur Institute and transferred to the university animal facility. Before the intervention, a one-week adaptation period was considered under standard laboratory conditions: a 12:12 h light/dark cycle, temperature of 22 ± 3°C, and relative humidity of 50–60%. During this time, the animals had free access to standard pellet food and water. 2.1.Sample Size The inclusion criteria were healthy male Wistar rats, 8–10 weeks old, weighing 200–250 g, with no history of disease or drug treatment, and at least one week of environmental adaptation. Exclusion criteria included the appearance of disease symptoms or abnormal behaviors, body weight loss greater than 20% during the study, non-compliance with the training protocol, or death during the experimental period. The animals were housed in polycarbonate cages, five rats per cage, under standard laboratory conditions. 2.2.Induction of the PTSD model To induce the PTSD model, in the first stage, rats were restrained and immobilized for 2 hours using a 100 ml bottle with a diameter of 4 cm that was not capable of movement. In the second stage, following restraint and immobilization, rats were forced to swim in a special animal pool for 15 minutes. In the third stage, after a 15-minute rest, they were placed in a chamber filled with ether for 3 minutes to induce anesthesia. Then they were removed from the chamber and returned to their cages in a standard temperature environment(Fan et al., 2021)(Fig. 1 ). Following the PTSD protocol, the rats were randomly assigned to five groups: 1. healthy control group (C); 2. PTSD group (P) that only underwent stress; 3. Exercise group (E) that received the training protocol in addition to stress; 4. Khar-e Maryam group (S) that received Khar-e Maryam in addition to stress; and 5. Combined group (E + S) that received both interventions. The therapeutic interventions began eight weeks after PTSD induction, allowing time for the symptoms to stabilize. 2.3.Combined Training Protocol The combined training protocol involved a mix of aerobic and resistance exercises on a custom-built rodent treadmill, performed 6 days a week. The training program was conducted over a 4-week period, combining resistance and aerobic training. All training sessions were performed using a specialized animal treadmill (Taghiz Gostar Iranian, Model 2020) and a custom-built vertical ladder. The training was structured to include three resistance sessions and three aerobic sessions per week, conducted on alternating days. Resistance training was carried out on Saturdays, Mondays, and Wednesdays. Each session consisted of three sets, with each set comprising four ascents of a 1-meter high vertical ladder with 26 steps (4 cm apart). A 30-second rest was provided between each climb. To apply resistance, a weight was attached to the animals' tails, and tail stimulation was used to encourage continuous movement. The principle of progressive overload was implemented by increasing the percentage of body weight carried by the animals on a weekly basis. Specifically, the weight was 50% of the animal's body weight in the first week, 60% in the second week, 70% in the third week, and 80% in the fourth week. Aerobic training sessions were performed on Sundays, Tuesdays, and Thursdays for a total of 6 weeks. Prior to the main training program, the animals were exposed to a 3-day familiarization program with treadmill running. Following this period, each rat's maximal oxygen consumption (VO2max) was determined using a graded exercise protocol. The average of these records was then used as a reference to design the main training program in terms of both distance and time, ensuring that the intensity was tailored to each animal's capacity(Kim et al., 2015 )( Table 1 ). Table 1 Aerobic exercise protocol Week Training intensity (% Vmax) Speed (m/min) time (min) distance (m) 1 50 17.5 30 525 2 60 21 30 630 3 70 24.5 30 735 4 80 28 30 840 2.4.Preparation of Khar-e Maryam Extract Plant species are licensed for cultivation and harvesting by the Ministry of Agriculture and Jihad Sazandegi. The plant species of Milk Thistle were obtained by Professor Reza Omidbeigi from Zardband Pharmaceutical Company and identified and confirmed by the Department of Botany, Islamic Azad University, Marvdasht Branch, Iran. The certified specimen (number IAUM-2024-SM01) is kept in the Herbarium of Islamic Azad University, Marvdasht Branch, Iran. According to the information, to prepare the extract, first the seeds are completely cleaned and dried. Then they are converted into fine powder using a grinder. To increase the extraction efficiency and remove non-polar lipids, the powdered seeds were subjected to a defatting process using petroleum ether in a Soxhlet apparatus. After defatting, the solvent was removed and the defatted powder was transferred to a new Soxhlet apparatus to extract the target compounds. The main extraction was performed using 96% absolute ethanol as the solvent. The extraction process was carried out over several hours (e.g., 6–8 hours) until the solvent in the Soxhlet cycle became colorless, indicating complete extraction of the active compounds. Finally, the ethanolic extract was concentrated under reduced pressure using a rotary evaporator to remove the ethanol. The resulting concentrated extract was then lyophilized (freeze-dried) to obtain a dry powder, which was stored at -20°C until further use. The yield of the extract was calculated to ensure a consistent and reliable preparation. Khar-e Maryam was administered daily via oral gavage at a specified dose (30 IU). The Khar-e Maryam dose was chosen based on previous studies to ensure maximum protective effects (Tileshova et al., 2024 ). At the end of the 4-week period, the rats were euthanized using a high-dose anesthetic injection (e.g., ketamine and xylazine) followed by cervical dislocation. Samples of hippocampal and cardiac muscle tissue were rapidly isolated and stored in liquid nitrogen for subsequent biochemical and histological analyses. The level of von Willebrand factor (vWF) was measured from collected blood plasma samples using standard ELISA kits. Similarly, BDNF levels in hippocampal tissue were quantified using the ELISA method. Furthermore, histological changes in the hippocampus and cardiac muscle were analyzed using specialized staining techniques and microscopic examination. The data from the experiments were analyzed using reputable statistical software (e.g., SPSS) with a One-way ANOVA test, and a statistical significance level of P < 0.05 was adopted. 2.5.Administration of Khar-e Maryam via Oral Gavage The prepared ethanolic extract of Khar-e Maryam was administered to the rats in the Khar-e Maryam and combined treatment groups via oral gavage. This method was chosen to ensure the precise and controlled delivery of the substance directly into the stomach, thereby bypassing any potential degradation or dose-related effects that could occur in the oral cavity or during early digestive processes. For daily administration, the required dose of Khar-e Maryam was calculated for each rat at 300 mg/kg of its most recent body weight. The calculated amount of the powdered extract was then freshly dissolved in an appropriate vehicle, which could be sterile distilled water or a saline solution. To improve the solubility of Khar-e Maryam and ensure a uniform suspension, a small amount of a wetting agent, such as Tween 80, was added to the solution. The prepared solution was administered daily at a consistent time to all animals in the respective treatment groups throughout the study period. The gavage procedure was performed meticulously to ensure accuracy and safety. Each rat was carefully restrained, and a specialized gavage needle (a curved needle with a blunt, rounded tip) was gently inserted into the mouth and navigated down the esophagus, taking care to avoid the trachea. Once the correct placement of the needle was confirmed, the solution was slowly and steadily infused into the stomach. This precise and systematic procedure guaranteed that each animal received its exact, predetermined dose, which was critical for ensuring the reliability and reproducibility of the experimental results. 2.6.Examining the Dependent Variables Hippocampal tissue extraction After 48 hours from the last training session, animals were anesthetized with intra peritoneal injection of ketamine (80 mg/kg) and xylazine (10 mg/kg). After confirming the absence of reflexes and adequate anesthesia, the chest cavity was opened, and transcardial perfusion was performed using cold saline to remove blood from the brain tissue. Then, the skull was carefully opened with surgical instruments, and the brain was quickly removed and placed on an ice plate. Under a stereomicroscope, the hippocampus was identified according to the rat brain atlas, separated from the surrounding cortex bilaterally with fine forceps, and immediately washed with cold saline. The isolated hippocampal tissues were frozen in liquid nitrogen and then fixed in 10% neutral buffered formalin for subsequent biochemical assays, as well as histological and immune histochemical analyses. 2.7.Heart Tissue Collection and Preparation for ELISA Forty-eight hours after the last training session, the animals were deeply anesthetized with an intra-peritoneal injection of ketamine (80 mg/kg) and xylazine (10 mg/kg). After confirming the absence of reflexes, a midline incision was made to open the thoracic cavity, and the heart was carefully exposed and excised. The heart was immediately rinsed in ice-cold saline to remove blood residues, and surrounding connective tissue and vessels were gently trimmed. For biochemical analysis, approximately 50–100 mg of the left ventricle was dissected and placed on ice. The tissue was homogenized in 5–10 volumes of ice-cold phosphate-buffered saline or the lysis buffer recommended by the ELISA kit, using a mechanical homogenizer until a uniform suspension was achieved. The homogenate was then centrifuged at 12,000–15,000 × g for 15–20 minutes at 4°C, and the supernatant was carefully collected, aliquoted, and stored at − 80°C until analysis. The total protein concentration of the samples was measured using the Bradford or BCA assay to facilitate normalization of the ELISA results. All procedures were performed under sterile conditions and in accordance with ethical guidelines for the care and use of laboratory animals, ensuring minimal stress and tissue degradation during sample preparation. After the final training session, all animals were euthanized according to ethical standards to minimize pain and distress. Anesthesia was induced by intraperitoneal injection of ketamine (90 mg/kg) and xylazine (10 mg/kg), followed by an overdose of sodium pentobarbital (200 mg/kg, i.p.) for euthanasia. All procedures were conducted in accordance with the institutional guidelines for the care and use of laboratory animals and were approved by the Institutional Animal Ethics Committee (Ethics code: IR.IAU.SRB.REC.1404.190). 2.8.Assessment of BDNF The level of brain-derived neurotrophic factor (BDNF) was measured in the collected hippocampal tissue using an enzyme-linked immune sorbent assay (ELISA) according to the manufacturer’s instructions. Briefly, hippocampal tissues were homogenized in ice-cold lysis buffer and centrifuged at 12,000–15,000 × g for 15–20 minutes at 4°C. The resulting supernatant was collected, and total protein concentration was determined using the Bradford or BCA method to normalize BDNF levels. For the ELISA, samples and standards were added to the wells coated with specific anti-BDNF antibodies. After incubation and washing steps to remove unbound substances, a detection antibody was applied, followed by a substrate solution to produce a colorimetric signal proportional to the BDNF concentration. Optical density was measured at the appropriate wavelength using a microplate reader, and BDNF levels were calculated based on the standard curve and expressed as pg/mg protein. All procedures were performed under cold conditions to prevent protein degradation, and care was taken to minimize variations between samples to ensure accurate and reliable quantification of BDNF. 2.9.Quality Control and Assay Accuracy To ensure the reliability and accuracy of biochemical measurements, all ELISA assays were performed in duplicate, and strict adherence to the manufacturers’ protocols was maintained. Standard curves were prepared for each plate using known concentrations of the target proteins (BDNF, vWF), and sample concentrations were calculated relative to these curves. Positive and negative controls were included in each assay to verify assay performance and detect potential technical errors. Pipettes and laboratory equipment were calibrated regularly, and all reagents were prepared fresh or stored under recommended conditions to prevent degradation. In addition, intra-assay and inter-assay coefficients of variation (CVs) were monitored, and any measurements with CVs exceeding 10% were repeated. Careful sample handling, including performing all procedures on ice and minimizing freeze-thaw cycles, was employed to reduce variability and preserve protein integrity. These measures ensured high precision and reproducibility of the experimental data. 2.10.Statistical Analysis Data analysis was performed using SPSS version 26. First, the normality of the data distribution was assessed using the Shapiro-Wilk test, and homogeneity of variances was evaluated with the Levene test. Descriptive statistics were presented as mean ± standard deviation (SD). Within-group comparisons (pre- and post-intervention) were conducted using paired t-tests, while between-group differences were analyzed using two-way ANOVA. Tukey’s post hoc test was applied to determine the specific location of significant differences. The significance level for all tests was set at p < 0.05. Effect sizes were calculated using Cohen’s d for pairwise comparisons and Eta squared (η²) for ANOVA to quantify the magnitude of observed effects. 3.Results 3.1.Body Weight Changes The body weights of rats were monitored throughout the study across the five experimental groups: control, PTSD, concurrent training, Khar-e Maryam extract, and concurrent training with Khar-e Maryam extract. Descriptive analysis indicated that all groups began with comparable baseline weights (p > 0.05) (Table 2 ).Within-group comparisons using paired t-tests showed that rats in the PTSD group exhibited a slight, though not statistically significant, reduction in body weight over the study period. In contrast, rats in the training-only and extract-only groups generally maintained or slightly increased their weights. The concurrent training with Khar-e Maryam extract group demonstrated a modest but statistically significant increase in body weight compared with the PTSD group (p < 0.05).Two-way ANOVA revealed significant main effects of both intervention type and PTSD condition on body weight (p < 0.05). Post hoc analysis (Tukey’s test) showed that the combined intervention group had higher mean body weight than the PTSD-only group, whereas no significant differences were detected between the control and single-intervention groups.Overall, these findings suggest a potential attenuating effect of concurrent training and Khar-e Maryam extract on PTSD-associated weight changes in rats, although further studies are needed to confirm these effects and clarify the underlying mechanisms. Table 2 Body weights of rats before and after interventions (Mean ± SD) Variable Control Group PTSD Group Concurrent Training Group + TSD Khar-e Maryam Extract Group + PTSD Khar-e Maryam Extract + Concurrent Training Group + PTSD p-value Baseline Weight (g) 302 ± 12 288 ± 10 295 ± 11 290 ± 10 298 ± 12 0.345 Post-Intervention Weight (g) 301 ± 10 279 ± 9 300 ± 10 298 ± 8 309 ± 12 0.028* Weight Change (g) –1 –9 + 5 + 8 + 11 0.031* Food Intake (g/day) 24.6 ± 2.1 23.8 ± 2.0 26.1 ± 2.4* 25.9 ± 2.3* 27.3 ± 2.5* 0.037* Water Intake (mL/day) 32.4 ± 3.2 31.5 ± 3.0 37.8 ± 3.7* 36.9 ± 3.5* 39.1 ± 3.8* 0.029* *: p < 0.05 3.2.Gene Expression Analysis of vWF and BDNF Hippocampal and cardiac tissues were collected as previously described, immediately snap-frozen in liquid nitrogen, and stored at − 80°C until analysis. Total RNA was isolated using a commercial RNA extraction kit in accordance with the manufacturer’s protocol. RNA concentration and purity were determined spectrophotometrically, and RNA integrity was verified by agarose gel electrophoresis or fragment analysis where applicable. Complementary DNA (cDNA) was synthesized from 500 ng–1 µg of total RNA using a standard reverse transcription kit following the supplier’s instructions.Specific primer pairs for rat BDNF and vWF were designed according to standard criteria (targeting exon–exon junctions when possible; amplicon length 80–200 bp; primer length 18–22 nt; GC content 40–60%; and balanced melting temperatures). Primer specificity was verified in silico using NCBI BLAST and experimentally confirmed through melt-curve analysis and assessment of amplification efficiency. TBP was selected as the housekeeping gene, and two independent primer sets were employed to ensure normalization consistency across groups. Primer sequences, amplicon sizes, efficiencies, and NCBI accession numbers are summarized in Table 3 .Quantitative real-time PCR (qPCR) was conducted using SYBR Green chemistry on a standard real-time PCR platform. Each reaction was run in technical duplicate or triplicate, and non-template controls were included to exclude contamination. Relative gene expression was determined by the comparative Ct (ΔΔCt) method, with expression levels normalized to TBP and presented as fold change relative to the control group. Primer specificity was confirmed by single-peak melt curves and, when applicable, agarose gel electrophoresis. Only primers with acceptable amplification efficiency were included in the final analysis. All reactions were performed under RNase-free conditions, and sample handling was minimized to preserve RNA quality. While qPCR provides a sensitive measure of relative gene expression, the results should be interpreted cautiously, as they reflect transcriptional rather than post-translational changes. Further protein-level or functional assays are recommended to confirm these molecular findings Table 3 Primer sequences, amplicon sizes and efficiencies for qPCR analysis of BDNF, vWF, and TBP in Rattus norvegicus Gene Primer Sequences Amplicon size (bp) Efficiency (%) Accession No. TBP Forward:5’- GCGGGGTCATGAAATCCAGT-3’ 147 100 NM_001270399 Reverse: 5’- AGTGATGTGGGGACAAAACGA − 3’ BDNF Forward: 5’- GAACGGGAGGGGTAGATTTC − 3’ 120 95 NM_001270630.1 Reverse: 5’- CAACCAGAATGGAGAGTGAAGA − 3’ TBP Forward: 5’- GCGGGGTCATGAAATCCAGT-3’ 147 98 NM_001110335 Reverse: 5’- AGTGATGTGGGGACAAAACGA − 3’ VWF Forward: 5’- TCAAAGCCCCTGGACAACTC − 3’ 170 98 NC_051339.1 Reverse: 5’- TCCGAAAGGATTCATCTTGCCA − 3’ Tm (°C): 60 Bp (base pair) 3.3.Protein Quantification of vWF and BDNF by ELISA Parallel hippocampal and cardiac tissue samples were homogenized in ice-cold lysis buffer and centrifuged to obtain clear supernatants. Total protein concentration was determined using a standard colorimetric assay. Levels of vWF and BDNF were quantified with commercially available enzyme-linked immunosorbent assay (ELISA) kits, following the manufacturer’s protocols. All samples and standards were analyzed in duplicate, and standard curves as well as internal quality controls were included on each plate to ensure assay reliability. Results were normalized to total protein content and expressed as pg/mg protein. Inter- and intra-assay coefficients of variation were monitored, and samples with variability exceeding the acceptable range were re-assayed. All procedures were performed under cold conditions to minimize protein degradation and ensure assay consistency. Note ELISA provides quantitative estimates of target proteins; however, it does not assess post-translational modifications or activity states. Future studies incorporating complementary techniques (e.g., Western blot or immunohistochemistry) could help confirm and localize the observed protein changes. 3.4.Results – Gene Expression of BDNF and vWF The effects of PTSD, exercise training, Khar-e Maryam extract supplementation, and their combination on the expression of hippocampal and cardiac BDNF and vWF genes were examined using quantitative real-time PCR (qPCR). Relative expression values were normalized to the housekeeping gene TBP and expressed as fold change relative to the control group. Exposure to PTSD resulted in a significant reduction in BDNF mRNA levels compared with the control group (p < 0.01). Exercise training alone increased BDNF expression relative to the PTSD group (p < 0.05), and Khar-e Maryam extract supplementation also elevated BDNF levels, though to a lesser extent (p < 0.05). The combined intervention of exercise and Khar-e Maryam extract produced the largest increase in BDNF expression compared with both the PTSD and exercise-only groups (p < 0.01) (Fig. 2 , Table 4 ). Table 4 Results of two-way analysis of variance in BDNF expression values ​​to examine the group effect Variable Inferential statistics Source of variance Sum of Squares df Mean Square Effect Size (Partial η²) F Value P Value mRNA BDNF Concurrent Exercise 0.4692 1 9/10 0.367 15.79 0.002* Khar-e Maryam extract 0.3844 1 07/2 0.301 12.94 0.004* Concurrent Exercise and Khar-e Maryam extract 0.0676 1 4/7 0.537 2.28 0.016* Residual 0.357 21 5/13 0.279 - - *: p < 0.05 Two-way ANOVA indicated that approximately 37% of the variance in BDNF expression was associated with exercise (F = 15.79, η² =0.367, p < 0.05), and about 30% with Khar-e Maryam extract supplementation (F = 12.94, η² =0.301, p < 0.05). The interaction between the two factors accounted for an additional 53.7% of the variance (F = 2.28, η² =0.537, p < 0.05), suggesting an additive rather than independent effect. PTSD exposure significantly increased vWF mRNA expression compared with the control group (p < 0.01). Exercise training reduced vWF levels relative to the PTSD group (p < 0.05), and Khar-e Maryam extract supplementation produced a smaller yet significant reduction (p < 0.05). The combined intervention further decreased vWF expression, with levels approaching those observed in the control group (p < 0.01) (Fig. 3 , Table 5 ). Table 5 Results of two-way analysis of variance in vWF expression values ​​to examine the group effect Variable Inferential statistics Source of variance Sum of Squares df Mean Square Effect Size (Partial η²) F Value P Value mRNA vWF Concurrent Exercise 3.440 1 3.440 0.125 14.72 0.0001* Khar-e Maryam extract 0.001 1 0.001 0.001 0.01 0.95 Concurrent Exercise and Khar-e Maryam extract 1.025 1 1.025 0.041 4.39 0.049* Residual 4.908 21 0.234 - - - *: p < 0.05 Analysis of variance showed that approximately 13% of the variance in vWF expression was attributable to exercise (F = 14.72, η² =0.13, p < 0.05), 0.1% to Khar-e Maryam extract alone (F = 0.01, η² = 0.001, p < 0.05), and about 4% to their interaction (F = 4.39, η² = 0.041, p < 0.05). Overall, these data indicate differential modulation of BDNF and vWF gene expression by exercise and Khar-e Maryam extract under PTSD conditions. However, interpretation should be made cautiously, as gene-level changes may not directly translate to protein or functional outcomes Comparison of H&E-stained hippocampal tissue samples revealed differences between experimental groups. In PTSD models, cells exhibited neuronal damage, apoptosis, decreased density, and nuclei that were smaller and darker than those in healthy controls. Healthy samples showed a higher cell density, predominantly round or oval nuclei, clear cytoplasmic borders, and minimal abnormalities. A halo of transparency around some nuclei was observed, indicating normal neuronal structure, and the extracellular matrix appeared uniform. In PTSD samples subjected to concurrent exercise training, cell density was generally higher than in untreated PTSD models, although scattered cells with dark or irregular nuclei were still present. In PTSD samples treated with Khar-e Maryam extract, an increased density of rounder cells and larger nuclei was observed, approaching the appearance of healthy tissue. In samples receiving both interventions, cell morphology appeared closer to that of healthy controls, with relatively dense, round cells and a uniform matrix (Fig. 4 ) In hematoxylin and eosin–stained myocardial tissue, areas of infarction were identified by regions showing necrosis compared with surrounding border zones and healthy myocardium. Observed features included loss of typical myocardial morphology, necrotic cells with absent nuclei, and disruption of entire muscle fibers. Quantitative assessment indicated a reduction in the myocardial infarction index in groups receiving exercise or Khar-e Maryam extract compared with the PTSD-only group. This reduction was more pronounced in the PTSD + KH + T group. Levels of inflammatory cell infiltration were lower in the exercise-only and extract-only groups than in the PTSD group (Figs. 5 and 6 ) 4. Discussion In the present study, milk thistle extract, combined with concurrent aerobic and resistance exercise, increased BDNF levels in PTSD model rats, returning them almost to control levels. This finding is consistent with the studies of Rentería et al. ( 2022 ) and Antolasic et al. (2024). Physical exercise and antioxidant-rich plant compounds are likely to enhance neuroplasticity and BDNF expression. The physiological mechanisms underlying exercise-induced BDNF upregulation primarily include increased cerebral blood flow, activation of CREB and MAPK/ERK signaling pathways, and stimulation of hippocampal and prefrontal neurogenesis (Li et al. 2025 ; Toader et al. 2025 ). It is also possible that aerobic exercise increases oxygen consumption and neurotrophic factor production, and resistance exercise induces mechanical stress and systemic release of growth factors such as IGF-1, which can synergistically enhance BDNF signaling. Clemente-Suárez et al. ( 2025 ) also suggested a synergistic effect by combining these two types of exercise, which restores BDNF levels to normal. Polyphenolic and flavonoid compounds of milk thistle are likely to activate BDNF-related signaling pathways such as TrkB-PI3K-Akt and CREB. Nomakawa et al. (2025) reported similar results. These compounds may reduce cortisol levels and neuroinflammatory responses that are typically increased in PTSD, and negatively affect BDNF expression. Ji et al. (2025) also reported that the extract not only exerts direct neuroprotective effects, but also enhances the BDNF response to exercise by creating a favorable metabolic and cellular environment. The differences are in the dose of the extract, the duration of administration, the characteristics of the PTSD model, or the severity of the stress. Zalta et al. ( 2024 ) and Valotto Neto et al. ( 2024 ) also consider the results to be influenced by these factors. In studies that did not show increases in BDNF, chronically elevated cortisol levels or severe stress may have prevented the activation of neuroplastic pathways. D’Assis et al. (2019) reported that BDNF and cortisol have distinct roles in brain physiology, with their systems integrated by glucocorticoid receptors. BDNF polymorphisms appear to influence cortisol responses to stress. BDNF and cortisol have complementary roles in the nervous system, with cortisol being a positive/negative regulator. Exercise positively regulates both factors, regardless of BDNF polymorphism. Their study used human models. Milk thistle extract reduces oxidative stress, but activates CREB/TrkB signaling and suppresses neuroinflammation, all of which facilitate the return of BDNF to baseline levels. Nomakawa et al. (2024) have implicated decreased BDNF expression in the pathogenesis of Alzheimer's disease. Shayan et al. ( 2024 ) reported increased anxiety-like behavior in rats exposed to stress, and the effect of nanosilymarin was significant. Simultaneous exercise and milk thistle extract synergistically improved anxiety-like behavior, reduced inflammation, and increased BDNF-mediated hippocampal CREB signaling. However, BDNF responses to these interventions are influenced by dose, duration, stress severity, and individual differences, which require further investigation into the precise molecular mechanisms. Von Willebrand factor is a large multimeric glycoprotein synthesized primarily by endothelial cells and megakaryocytes, playing a critical role in platelet adhesion, coagulation, and vascular repair. Beyond its hemostatic function, vWF is recognized as a sensitive biomarker of endothelial activation, inflammation, and oxidative stress. In post-traumatic stress disorder (PTSD), chronic overactivation of the hypothalamic–pituitary–adrenal (HPA) axis leads to sustained elevations of glucocorticoids and catecholamines, which enhance the generation of reactive oxygen species (ROS) and induce endothelial injury. Consequently, endothelial Weibel–Palade bodies release vWF into the circulation and local tissues, leading to elevated vWF expression in both hippocampal and cardiac regions. This response reflects microvascular dysfunction, increased vascular permeability, and potential local ischemic injury, linking PTSD to both neurovascular and cardiovascular complications( Huang,2024). The Silybum marianum (Khar-e Maryam) extract, rich in flavonolignans such as silybin, silychristin, and silydianin, exhibits strong antioxidant, anti-inflammatory, and cytoprotective properties. Silymarin, its main active complex, exerts inhibitory effects on the NF-κB signaling pathway, thereby reducing the expression of pro-inflammatory cytokines including TNF-α, IL-6, and IL-1β. Simultaneously, silymarin activates the Nrf2/ARE pathway, enhancing endogenous antioxidant defenses through upregulation of enzymes such as superoxide dismutase (SOD), glutathione peroxidase (GPx), and catalase. This dual regulation diminishes oxidative stress and stabilizes endothelial integrity, ultimately attenuating vWF release. Moreover, silymarin exhibits neuroprotective effects by modulating GABAergic transmission, reducing glutamate excitotoxicity, and normalizing HPA axis activity, thereby preserving hippocampal structure and cognitive function under chronic stress conditions(Jaffar,2024). Exercise training, particularly aerobic or combined modalities, also exerts profound regulatory effects on endothelial and neural health. Through activation of the PI3K/Akt/eNOS signaling pathway, exercise increases nitric oxide (NO) bioavailability, improves vascular tone, and suppresses inflammation. Concurrently, regular physical activity downregulates stress-induced hormonal responses, reduces oxidative stress, and restores redox balance. These effects collectively contribute to reduced endothelial activation and decreased vWF expression in both the hippocampal and cardiac tissues(Biernat, 2024). Importantly, the combination of Silybum marianum extract and exercise appears to have a synergistic effect in modulating vWF levels. Both interventions converge on common molecular pathways—namely suppression of NF-κB/TNF-α/IL-6 and activation of Nrf2/ARE and PI3K/Akt/eNOS—leading to enhanced antioxidant capacity, reduced inflammation, and improved endothelial function. In the hippocampus, these effects help protect the blood–brain barrier, mitigate neuroinflammation, and preserve neuronal integrity, while in the heart they reduce endothelial permeability and protect against microthrombotic injury(Nehmi, 2021). Collectively, these findings suggest that elevated vWF in PTSD reflects systemic endothelial dysfunction and oxidative–inflammatory stress. Both Silybum marianum and exercise serve as potent modulators of these pathological processes by restoring endothelial homeostasis, normalizing HPA axis activity, and enhancing antioxidant defenses. The combined intervention may thus represent a promising therapeutic approach to mitigate both neurovascular and cardiovascular disturbances associated with chronic psychological stress(Khan, 2024). The improvement of hippocampal tissue in PTSD animal models through combined Khar-e Maryam (Anastatica hierochuntica) extract and exercise training is mediated through multiple converging neuroprotective mechanisms. Exercise training activates molecular cascades centered around Brain-Derived Neurotrophic Factor (BDNF), which binds to TrkB receptors and activates PI3K/Akt, MAPK/ERK, and PLCγ pathways, ultimately promoting neurogenesis in the dentate gyrus, synaptogenesis, and long-term potentiation (LTP) while preventing neuronal apoptosis (Bimbova et al., 2021 ). Deficient BDNF-TrkB signaling in the hippocampus contributes to contextual fear learning deficits and impaired fear extinction characteristic of PTSD (Groves- Jaehne et al., 2023 ), and exercise has been shown to increase hippocampal BDNF expression, neuropeptide Y (NPY), and delta-opioid receptor (DOR) signaling, correlating with enhanced stress resilience (Garavito et al., 2025 ). Concurrently, exercise regulates the dysregulated hypothalamic-pituitary-adrenal (HPA) axis by restoring negative feedback mechanisms and balancing glucocorticoid receptor (GR) and mineralocorticoid receptor (MR) expression, thereby reducing chronic cortisol-induced hippocampal damage (Daskalakis et al., 2022 ). Furthermore, exercise stimulates hippocampal angiogenesis through VEGF upregulation, improving cerebral blood flow and oxygen delivery, with von Willebrand Factor (vWF) serving as a marker of endothelial function and neurovascular coupling essential for neuroplasticity. Khar-e Maryam extract provides complementary neuroprotection through its rich polyphenolic and flavonoid composition, demonstrating antioxidant activity comparable to or exceeding standard antioxidants like alpha-tocopherol (Ghahramani et al., 2020). These bioactive compounds activate the Nrf2/ARE pathway, upregulating endogenous antioxidant enzymes (SOD, catalase, glutathione peroxidase) that reduce reactive oxygen species (ROS) and lipid peroxidation, thereby protecting hippocampal mitochondrial DNA and neuronal membrane integrity (Sidiropoulou et al., 2023 ). Additionally, polyphenols inhibit the NF-κB pathway, reducing pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and microglial activation while exercise increases anti-inflammatory IL-10 and regulates M1/M2 microglial polarization, collectively attenuating neuroinflammation-induced hippocampal damage. This multi-modal synergy—where exercise-induced BDNF upregulation and neurogenic stimulus are supported by the antioxidant and anti-inflammatory milieu created by plant polyphenols—results in comprehensive restoration of hippocampal structural integrity, including increased neuronal density, enhanced dendritic spine density, improved synaptic transmission, and ultimately recovery of learning, memory, and emotional regulation functions impaired in PTSD (Mamun et al., 2024 ). The observed amelioration of cardiac tissue damage in the rat model of PTSD following the consumption of Khar-e Maryam extract and exercise training is rooted in a robust synergistic physiological and molecular mechanism. Chronic stress associated with PTSD induces severe systemic inflammation and oxidative stress, leading to myocardial cell damage, cardiac fibrosis, and endothelial dysfunction(Demirtaş et al., 2025 ). The core of this improvement is attributed to the potent antioxidant and anti-inflammatory properties of Silymarin. At the signaling level, Silymarin primarily acts by activating the Nrf2 signaling pathway, a master regulator of cellular antioxidant defense, thereby enhancing the heart's capacity to neutralize reactive oxygen species (ROS). Simultaneously, it inhibits the NF-κB pathway, effectively reducing the transcription and release of pro-inflammatory cytokines that drive myocardial injury(de Freitas et al., 2024 ). Furthermore, the combination of the extract and exercise significantly contributes to the upregulation of BDNF, particularly in the hippocampus, which improves central stress regulation and reduces the autonomic nervous system's burden on the heart. This comprehensive protection is further evidenced by a potential decrease in vWF levels, indicating the restoration of endothelial health and a lowered risk of prothrombotic events. Collectively, these interventions mitigate chronic stress-induced structural damage and functional impairment in the cardiac tissue(Gomes et al.,2024). This study has several limitations. The sample size was small and only one rat strain was used, limiting generalizability. The PTSD model mimics only part of the human condition. The Silybum marianum extract was not fully standardized, and only one dose and duration were tested. Molecular markers (vWF and BDNF) were measured at a single time point without full behavioral or functional evaluation. Species differences and potential bias due to lack of blinding are also noted. Future studies should use larger samples, standardized extracts, and broader assessments. Abbreviations PTSD Post-Traumatic Stress Disorder vWF von Willebrand factor BDNF brain-derived neurotrophic factor NPY neuropeptide Y CREB cAMP-Response Element Binding Protein MAPK mitogen-activated protein kinases ERK Extracellular signal-regulated kinases IGF-1 Insulin-like Growth Factor-1 TrkB Tropomyosin receptor kinase B PI3K Phosphoinositide 3-kinases Akt Protein kinase B ROS reactive oxygen species NF-κB Nuclear factor kappa B Nrf2 Nuclear factor (erythroid-derived 2)-like 2 SOD superoxide dismutase GPx glutathione peroxidase (GPx) GABA γ-Amino butyric acid PI3K Phosphoinositide 3-kinases eNOS Endothelial nitric oxide synthase HPA Hypothalamic–pituitary–adrenal axis NO nitric oxide TNF-α Tumor necrosis factorα IL-6 Interleukin 6 LTP long-term potentiation DOR delta-opioid receptor GR glucocorticoid receptor Declarations Conflict of Interest : The authors declare no conflicts of interest Declaration of Interest Statement :The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper Competing Interests ok Funding sources: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Author Contribution Conceptualization and Methodology, F.N. , A.T. ,S.A; Formal Analysis and Research, F.N. , A.T. ,S.A.; Writing, Preparation of the original draft, F.N. Writing, Review and Editing, F.N. Acknowledgement The authors would like to sincerely thank the Research Council of Tehran Science and Research Branch, Islamic Azad University for supporting this study. We also appreciate the valuable technical assistance provided by the laboratory staff of the Department of Physiology. Data Availability Data is provided within the manuscript . References Mann, S. K., Marwaha, R. & Torrico, T. J. Posttraumatic Stress Disorder. [Updated 2024 Feb 25]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 Jan-. Available from: https://www.ncbi.nlm.nih.gov/books/NBK559129/ Dong, H. & Lin, Z. Physiology mechanisms of exercise for PTSD: A narrative review. Front. Psychol. 16 , 1483523. https://doi.org/10.3389/fpsyg.2025.1483523 (2025). Raise-Abdullahi, P. et al. Hypothalamus and Post-Traumatic Stress Disorder: A Review. Brain Sci. 13 (7), 1010. https://doi.org/10.3390/brainsci13071010 (2023). Björkman, F. & Ekblom, Ö. Physical Exercise as Treatment for PTSD: A Systematic Review and Meta-Analysis. Mil Med. ;187(9–10):e1103-e1113. (2022). 10.1093/milmed/usab497 . PMID: 34850063. Mahmoud, N. N. & Selim, M. T. Phytochemical analysis and antimicrobial activity of Silybum marianum L. Via multi-solvent extraction. AMB Express . 15 , 122. https://doi.org/10.1186/s13568-025-01925-2 (2025). Manukhina, E. B. et al. Cardiac injury in rats with experimental posttraumatic stress disorder and mechanisms of its limitation in experimental posttraumatic stress disorder-resistant rats. J. Appl. Physiol. 130 (3), 759–771 (2021). Epub 2021 Jan 7. PMID: 33411642. Fan, Z., Chen, J., Li, L., Wang, H., Gong, X., Xu, H., … Yan, C. (2021). Environmental enrichment modulates HPA axis reprogramming in adult male rats exposed to early adolescent stress. Neuroscience research, 172, 63–72. Kim, H. J. et al. Resistance training inhibits the elevation of skeletal muscle derived -BDNF level concomitant with improvement of muscle strength in zucker diabetic rat. J. Exerc. Nutr. Biochem. 19 (4), 281–288 (2015). Tileshova, M. et al. Phytochemical study of milk thistle, Silybum marianum (L.) Gaertn. Casp. J. Environ. Sci. 22 (5), 1293–1299. 10.22124/cjes.2024.8345 (2024). Rentería, I., Pablo, C. P., Lira, J., Johnson, D. K. & F. S., & Concurrent Training Increases Serum Brain-Derived Neurotrophic Factor in Older Adults Regardless of the Exercise Frequency. Front. Aging Neurosci. 14 , 791698. https://doi.org/10.3389/fnagi.2022.791698 (2022). Antolasic, E., Jaehne, E. & van den Buuse, M. Interaction of Brain-derived Neurotrophic Factor, Exercise, and Fear Extinction: Implications for Post-traumatic Stress Disorder // Current Neuropharmacology. – 2024. - Vol. 22. - N. 4. - P. 543–556. 10.2174/1570159X21666230724101321 Li, P., Hu, Y., Tong, L. & Bi, X. High-intensity training on CREB activation for improving brain health: A narrative review of possible molecular talks. Front. Endocrinol. 15 , 1498495. https://doi.org/10.3389/fendo.2024.1498495 (2025). Toader, C. et al. From Synaptic Plasticity to Neurodegeneration: BDNF as a Transformative Target in Medicine. Int. J. Mol. Sci. 26 (9), 4271. https://doi.org/10.3390/ijms26094271 (2025). Clemente-Suárez, V. J., Martín-Rodríguez, A., Curiel-Regueros, A., Rubio-Zarapuz, A. & Tornero-Aguilera, J. F. Neuro-Nutrition and Exercise Synergy: Exploring the Bioengineering of Cognitive Enhancement and Mental Health Optimization. Bioengineering 12 (2), 208. https://doi.org/10.3390/bioengineering12020208 (2025). Numakawa, T. & Kajihara, R. The Role of Brain-Derived Neurotrophic Factor as an Essential Mediator in Neuronal Functions and the Therapeutic Potential of Its Mimetics for Neuroprotection in Neurologic and Psychiatric Disorders. Molecules 30 (4), 848. https://doi.org/10.3390/molecules30040848 (2025). Jie, S., Fu, A., Wang, C. & Rajabi, S. A comprehensive review on the impact of polyphenol supplementation and exercise on depression and brain function parameters. Behav. Brain Funct. 21 (1), 10. 10.1186/s12993-025-00273-2 (2025). PMID: 40140839; PMCID: PMC11948876. Zalta, A. K. et al. Brain Derived Neurotrophic Factor and Treatment Outcomes Among Veterans Attending an Intensive Treatment Program for Posttraumatic Stress Disorder. J. Psychiatr. Res. 173 , 1. https://doi.org/10.1016/j.jpsychires.2024.02.045 (2024). Valotto Neto, L. J. et al. Investigating the Neuroprotective and Cognitive-Enhancing Effects of Bacopa monnieri: A Systematic Review Focused on Inflammation, Oxidative Stress, Mitochondrial Dysfunction, and Apoptosis. Antioxidants 13 (4), 393. https://doi.org/10.3390/antiox13040393 (2024). De Assis, G. G. & Gasanov, E. V. BDNF and Cortisol integrative system – Plasticity vs. Degeneration: Implications of the Val66Met polymorphism. Front. Neuroendocr. 55 , 100784. https://doi.org/10.1016/j.yfrne.2019.100784 (2019). Numakawa, T. & Kajihara, R. An Interaction between Brain-Derived Neurotrophic Factor and Stress-Related Glucocorticoids in the Pathophysiology of Alzheimer’s Disease. Int. J. Mol. Sci. 25 (3), 1596. https://doi.org/10.3390/ijms25031596 (2024). Shayan, E. et al. Synergistic effects of citicoline and silymarin nanomicelles in restraint stress-exposed mice. Behav. Brain. Res. 464 , 114929. https://doi.org/10.1016/j.bbr.2024.114929 (2024). Huang, S. The molecular linkage of von Willebrand Factor (VWF) and pathological coagulation in (2024). disease. [Doctoral Thesis, Maastricht University]. Maastricht University. https://doi.org/10.26481/dis . 20241212sh. Jaffar, H. M., Khan, F. A., Rahim, M. A. & Zongo, E. Silymarin: Unveiling its pharmacological spectrum and therapeutic potential in liver diseases—A comprehensive narrative review. Food Sci. Nutr. 12 (5), 3097. https://doi.org/10.1002/fsn3.4010 (2024). Biernat, K., Kuciel, N., Mazurek, J. & Hap, K. Is It Possible to Train the Endothelium?—A. Narrative Literature Rev. Life . 14 (5), 616. https://doi.org/10.3390/life14050616 (2024). Nehmi, V. A. et al. A novel supplement with yeast β-glucan, prebiotic, minerals and Silybum marianum synergistically modulates metabolic and inflammatory pathways and improves steatosis in obese mice. J. Integr. Med. 19 (5), 439–450 (2021). Epub 2021 May 28. PMID: 34108131. Khan, G., Murtaja Alam Khan, A., Singh, B. & Alqahtani, E. M. Stress-Induced Insulin Resistance: Role of Von Willebrand Factor. IntechOpen. (2024). 10.5772/intechopen.1005260 Bimbova, K. K. et al. Activation of Three Major Signaling Pathways After Endurance Training and Spinal Cord Injury. Mol. Neurobiol. 59 (2), 950. https://doi.org/10.1007/s12035-021-02628-y (2021). Jaehne, E. J. et al. Impaired fear memory in a rat model of the brain-derived neurotrophic factor Val66Met polymorphism is reversed by chronic exercise. Neurobiol. Learn. Mem. 203 , 107779. https://doi.org/10.1016/j.nlm.2023.107779 (2023). Garavito, A. R., Martínez, V. D., Cortés, E. J., Negrete Díaz, J. V. & Montilla Rodríguez, L. M. Impact of physical exercise on the regulation of brain-derived neurotrophic factor in people with neurodegenerative diseases. Front. Neurol. 15 , 1505879. https://doi.org/10.3389/fneur.2024.1505879 (2025). Daskalakis, N. P., Meijer, O. C. & De Kloet, E. R. Mineralocorticoid receptor and glucocorticoid receptor work alone and together in cell-type-specific manner: Implications for resilience prediction and targeted therapy. Neurobiol. Stress . 18 , 100455. https://doi.org/10.1016/j.ynstr.2022.100455 (2022). Ghahramani, M. & Razavi Majd, Z. The Effect of Physical Activity on VEGF and HIF-1 Signaling. J. Clin. Res. Paramed Sci. 9 (2), e98493. https://doi.org/10.5812/jcrps.98493 (2020). Sidiropoulou, G. A., Metaxas, A. & Kourti, M. Natural antioxidants that act against Alzheimer’s disease through modulation of the NRF2 pathway: A focus on their molecular mechanisms of action. Front. Endocrinol. 14 , 1217730. https://doi.org/10.3389/fendo.2023.1217730 (2023). Mamun, A. A., Shao, C., Geng, P., Wang, S. & Xiao, J. Polyphenols Targeting NF-κB Pathway in Neurological Disorders: What We Know So Far? Int. J. Biol. Sci. 20 (4), 1332. https://doi.org/10.7150/ijbs.90982 (2024). Demirtaş, H. et al. Potential Protective Effects of Boldine in Rat with an Experimental Myocardial Ischemia-Reperfusion Model. J. Updates Cardiovasc. Med. 13 (1), 41–52. 10.32596/jucvm.galenos.2025.2025-9-139 (2025). de Freitas, J. A., Santamarina, A. B., Otoch, J. P. & Pessoa, A. F. M. Silymarin: A Natural Compound for Obesity Management. Obesities 4 (3), 292–313. https://doi.org/10.3390/obesities4030024 (2024). Gomes, S. et al. The Effects of the Association Between a High-Fat Diet and Physical Exercise on BDNF Expression in the Hippocampus: A Comprehensive Review. Life , 15 (6), (2025). 945.https://doi.org/10.3390/life15060945 Additional Declarations Competing interest reported. ok Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7887589","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":543908332,"identity":"2c84d937-6e05-41c0-a41d-22f948a70ee1","order_by":0,"name":"Farah Nameni","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBAC9gYog429EcpkJqCF5wBMC89BUrUwSCQQ6TAe9gNsD37m2OTxST5u/MzDYCfPwM77AL8WngR2w95tacVs0onN0jwMyYYNzOwGeLXYMySwSfBuO5zYJp3YANTCnMDAzEbAYfwP2CT/bvuf2CZ5sPk3D0M9EVokEtikebcdSGyTYGwD2nKYGC0P26RltyUntvEktlnOMThu2EbYYcnHJN9us0uc33788Y03FdXy/PzH8GthYGBsQOIAw4qAHaNgFIyCUTAKiAEA3QI1w6I9n60AAAAASUVORK5CYII=","orcid":"","institution":"Department of Exercise Physiology, Va.P C., Islamic Azad University, Varamin,","correspondingAuthor":true,"prefix":"","firstName":"Farah","middleName":"","lastName":"Nameni","suffix":""},{"id":543908333,"identity":"e1f2aec1-99fe-48b6-9288-e6b9a4c0597e","order_by":1,"name":"Asma Tovasoli","email":"","orcid":"","institution":"Tehran Science and Research Branch, Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Asma","middleName":"","lastName":"Tovasoli","suffix":""},{"id":543908334,"identity":"27156957-6ef9-4d64-b517-4d6d0e38d957","order_by":2,"name":"Saba Aghamiri","email":"","orcid":"","institution":"Tehran Science and Research Branch, Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Saba","middleName":"","lastName":"Aghamiri","suffix":""}],"badges":[],"createdAt":"2025-10-17 14:23:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7887589/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7887589/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96245046,"identity":"c508901a-4b4f-446b-b965-170ab253ecdc","added_by":"auto","created_at":"2025-11-19 07:19:46","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":748660,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/1de2ee835f72c66450ab7a3e.docx"},{"id":96244526,"identity":"a5cf76c9-046a-4bb6-9bb8-44afbe8f6aac","added_by":"auto","created_at":"2025-11-19 07:18:45","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27247,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/c0cd0655c11fef757902fc15.docx"},{"id":95949810,"identity":"40dd4ed3-7af9-4232-afe5-482bcfa7b5e2","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":58193,"visible":true,"origin":"","legend":"","description":"","filename":"InvestigatingtheSynergisticEffectsofCombinedTrainingandSilybininintheManagementofPost.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/6ba8df5855d40b9d6d85ff87.docx"},{"id":96245078,"identity":"aa64ed85-57e5-489e-935d-e9aae32614ae","added_by":"auto","created_at":"2025-11-19 07:19:49","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14102,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/063e500da3fa3d852e6b5c5a.docx"},{"id":95949818,"identity":"840ba2a5-cbb0-4950-a5d4-3731d64eac75","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27339,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/e6bdb78d36a4edec7388e593.docx"},{"id":95949816,"identity":"3c5d8c7c-1882-4798-9adf-98e97099c37f","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14985,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/cdc47433c7d2c006027794dd.docx"},{"id":96244818,"identity":"249fdf60-7f3c-47cc-9393-67ba53459351","added_by":"auto","created_at":"2025-11-19 07:19:20","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":229026,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/8e0c9c9a4e735c4c6323ac9c.docx"},{"id":96245097,"identity":"fe9c22c6-f63f-4dde-8610-12603dfe0c8c","added_by":"auto","created_at":"2025-11-19 07:19:51","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14792,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/8b14ed0e16fddf3a084310ad.docx"},{"id":96245033,"identity":"01b8cafe-455c-4524-b82a-55dfb2059d7b","added_by":"auto","created_at":"2025-11-19 07:19:46","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14769,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/7de0991f08a75fee0b72b148.docx"},{"id":96245128,"identity":"5405227d-b2df-4b2d-8991-85060f703817","added_by":"auto","created_at":"2025-11-19 07:19:54","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3714170,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/da5cceaa17e4584ac7a7a372.docx"},{"id":95949827,"identity":"a6ace03b-8ee3-4b77-83eb-eca21a291d90","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15127,"visible":true,"origin":"","legend":"","description":"","filename":"Table5.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/76a5156b6f6b85cf326f72a2.docx"},{"id":96245760,"identity":"caffef53-ac03-4758-9bb5-9ec02445f974","added_by":"auto","created_at":"2025-11-19 07:22:21","extension":"docx","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":197646,"visible":true,"origin":"","legend":"","description":"","filename":"Subject1Subject2Subject3.docx","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/4e0c828ddd8e0a82e0915060.docx"},{"id":96243789,"identity":"77d23801-660b-4ccf-b631-994045b2dc77","added_by":"auto","created_at":"2025-11-19 07:17:02","extension":"json","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5553,"visible":true,"origin":"","legend":"","description":"","filename":"3bb9607c959648f2ae8a76421c1e188b.json","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/b461cfaf607cddf354a08be4.json"},{"id":95949837,"identity":"0f65f820-6e52-4799-8192-44e74e4b1b56","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140485,"visible":true,"origin":"","legend":"","description":"","filename":"3bb9607c959648f2ae8a76421c1e188b1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/11d4f8d3fab29b63afed42bf.xml"},{"id":96245070,"identity":"f3208916-5fa4-4d91-a1f3-b61e0fb37cec","added_by":"auto","created_at":"2025-11-19 07:19:49","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":433551,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/799081d865706e75d8c2d523.jpeg"},{"id":95949836,"identity":"c4fdaa0a-43b0-4fa3-9c5b-66975901d916","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":431397,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/726f9a0c33e6b34f96ced7cf.jpeg"},{"id":96243729,"identity":"b4d9c290-d55d-496d-9726-67968a372ac2","added_by":"auto","created_at":"2025-11-19 07:16:55","extension":"jpeg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":250799,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/6e49e807d267bd4efe362a6b.jpeg"},{"id":95949823,"identity":"57e56b93-bdbc-433f-b28b-fc128e70d72f","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":214793,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/c5e52bb2e594addfd244b9d1.jpeg"},{"id":95949833,"identity":"da359d2b-61f4-4475-aa18-b9b12711580a","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3700008,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/e35031e738a0f5e6e1bbcf9d.png"},{"id":95949821,"identity":"0dce8d46-c0c4-4850-88cb-2498e99b2e60","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":81160,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/183bacb739d78ded9191f883.png"},{"id":96244832,"identity":"e5cee294-28e4-476c-a300-dfd88e50b769","added_by":"auto","created_at":"2025-11-19 07:19:23","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":242008,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/9e817382667174fd53f5d59d.png"},{"id":95949831,"identity":"a82a5c12-c40d-4f95-b05e-4c9683d32856","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":123113,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/a9e072ede8ac1ae9a2f3b9ee.png"},{"id":96245408,"identity":"4ba915e4-f359-4f0f-917c-b3b18fe87211","added_by":"auto","created_at":"2025-11-19 07:20:36","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165111,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/28a768e51f9cef8da8c3b0e4.png"},{"id":96244213,"identity":"39908e26-67f7-4be4-be2f-39d673b0d794","added_by":"auto","created_at":"2025-11-19 07:17:57","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":642739,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/de372adf618dd7e2e837cd99.png"},{"id":95949838,"identity":"ddea74ce-256d-4560-8a16-0d611bcd7ccb","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"xml","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134614,"visible":true,"origin":"","legend":"","description":"","filename":"3bb9607c959648f2ae8a76421c1e188b1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/19d55b4e348043b5d5b8ef39.xml"},{"id":96244461,"identity":"80c35af2-b694-4a42-be34-73b10d44a6e6","added_by":"auto","created_at":"2025-11-19 07:18:30","extension":"html","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":151077,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/5e54ad9797a2035c527bc73b.html"},{"id":95949807,"identity":"0a72a5c4-ee31-4de9-857c-20297e46830e","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":196361,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/29113864f97bf13c145d571a.jpg"},{"id":95949808,"identity":"24a6f2f2-82ae-492d-b3bd-c92762b0f572","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":305366,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/4f4772e95361ab6d0466e1c1.jpg"},{"id":96244507,"identity":"1f6ba3ef-2e45-4976-abde-e293d0314c6b","added_by":"auto","created_at":"2025-11-19 07:18:40","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":306110,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/40c672edda5602e7c039ce7b.jpg"},{"id":96244182,"identity":"e4b9e4e8-11a0-4518-b06e-a59aad84312a","added_by":"auto","created_at":"2025-11-19 07:17:53","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":756327,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure14.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/7f8120db3441c2fea369fde8.jpg"},{"id":95949814,"identity":"8c4e29e7-160f-4781-9324-911d4cc35342","added_by":"auto","created_at":"2025-11-14 18:58:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":482919,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/ad9be190f977fef17853869f.jpg"},{"id":96245407,"identity":"25d06b52-34ea-401c-993d-aea2505d8305","added_by":"auto","created_at":"2025-11-19 07:20:36","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":517421,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figure16.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/c9bba79e364c70e12f331640.jpg"},{"id":100133303,"identity":"d2c411fa-9e10-44f2-905c-75489737ab59","added_by":"auto","created_at":"2026-01-13 10:25:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3739090,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7887589/v1/2a34461e-4724-464f-b460-fc65e26de1b2.pdf"}],"financialInterests":"Competing interest reported. ok","formattedTitle":"Response of vWF, BDNF, hippocampal and cardiac tissues to consumption of Khar-e Maryam extract and training in rats’ model of post-traumatic stress disorder (PTSD)","fulltext":[{"header":"Highlights","content":"\u003cp\u003e\u0026bull; PTSD simultaneously damages the brain (hippocampal atrophy and reduced BDNF) and the heart (tissue changes and increased vWF).\u003c/p\u003e\u003cp\u003e\u0026bull; Combined training actively mitigates both types of damage by increasing BDNF and improving cardiac function.\u003c/p\u003e\u003cp\u003e\u0026bull; Khar-e Maryam protects neural and cardiac tissues from damage due to its potent antioxidant properties.\u003c/p\u003e\u003cp\u003e\u0026bull; The main goal is to investigate the synergistic effect of these two interventions for a more comprehensive treatment approach\u003c/p\u003e"},{"header":"1.Introduction","content":"\u003cp\u003ePost-Traumatic Stress Disorder (PTSD) is a complex neuropsychological disorder that develops in response to traumatic experiences (such as war, natural disasters, or violence). It is characterized by symptoms including intrusive memories, avoidance of trauma-related stimuli, negative alterations in cognition and mood, and increased arousal. Beyond its destructive impact on mental health, PTSD also has widespread physiological and neurobiological consequences. Among the most significant physiological changes are disruptions to the hypothalamic-pituitary-adrenal (HPA) axis and structural and functional alterations in key brain regions like the hippocampus. The hippocampus, which plays a vital role in memory and emotion regulation, often undergoes atrophy in individuals with PTSD. This is associated with a decrease in the level of brain-derived neurotrophic factor (BDNF). BDNF is a crucial neurotrophin essential for the survival, growth, and differentiation of neurons and its reduction is directly linked to neuronal damage and cognitive impairment in PTSD(Mann et al.,2024).\u003c/p\u003e\u003cp\u003eMoreover, PTSD can have damaging effects on the cardiovascular system. Chronic stress and the constant activation of the sympathetic nervous system in PTSD patients lead to an increased risk of developing cardiovascular diseases. The cardiac muscle tissue in these individuals may undergo structural and functional changes. One of the important markers for these disorders is an increase in the level of von Willebrand factor (vWF). vWF is a multimeric glycoprotein that plays a key role in hemostasis and blood clotting, and its elevated levels are associated with a higher risk of thrombosis and cardiovascular events. Understanding these physiological connections and molecular mechanisms in PTSD is crucial for developing comprehensive therapeutic strategies(Dong et al.,2025).\u003c/p\u003e\u003cp\u003eThe connection between these damages is entirely logical and cohesive. Chronic stress in PTSD simultaneously affects both the nervous and cardiovascular systems. The hyper-activation of the HPA axis and the sympathetic nervous system leads to the release of stress hormones like cortisol and catecholamines. These hormones directly and negatively impact the hippocampal tissue, causing a reduction in BDNF and resulting in neuronal damage. Simultaneously, these same hormones and the oxidative stress they cause damage the cardiac muscle tissue and lead to an increase in von Willebrand factor (vWF) levels. Therefore, the neural and cardiac damages in PTSD are two sides of the same coin, linked by a shared pathophysiological mechanism: chronic stress(Raise-Abdullahi et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn recent years, non-pharmacological approaches and natural supplements have gained attention as complementary therapies for managing PTSD. Combined training, which includes a mix of aerobic and resistance exercises, is recognized as a powerful and multifaceted intervention. Extensive research has shown that regular exercise can improve cognitive function, reduce symptoms of anxiety and depression, and increase BDNF levels in the brain. By stimulating neurogenesis and improving synaptic function, exercise can counteract the damage to the hippocampus caused by chronic stress. The anti-inflammatory and antioxidant effects of exercise also help protect both neural and cardiac tissues from oxidative damage. Furthermore, exercise can improve cardiovascular function, lower blood pressure, and by modulating coagulation factors like vWF, reduce the risk of cardiovascular events(Bj\u0026ouml;rkman et al.,2022).\u003c/p\u003e\u003cp\u003eIn addition to exercise, the use of herbal compounds like Khar-e Maryam is being explored as a complementary approach. Khar-e Maryam, the main active component of Khar-e Maryam (Silybum marianum) extract, is known for its antioxidant, anti-inflammatory, and hepatoprotective properties. Emerging evidence suggests that Khar-e Maryam can have protective effects on the central nervous system. By crossing the blood-brain barrier, this compound is capable of reducing oxidative stress in brain tissues and increasing BDNF levels. Additionally, the antioxidant properties of Khar-e Maryam can provide protection against cardiovascular damage caused by chronic stress. However, limited research has been conducted on the simultaneous effects of combined training and Khar-e Maryam consumption on the neurobiological and physiological outcomes in animal models of PTSD(Mahmoud et al., 2025).\u003c/p\u003e\u003cp\u003eSpecifically, this study aims to examine the changes in hippocampal tissue, BDNF levels, cardiac muscle tissue, and von Willebrand factor (vWF) in male rats with PTSD. The animal model of PTSD is widely used to study disease mechanisms and evaluate the effects of therapeutic interventions. The results of this research can help elucidate the molecular and physiological mechanisms of these interventions in managing PTSD and provide a basis for developing more comprehensive and effective treatment strategies in humans(Manukhina et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This study will not only add to the existing knowledge about the neurobiological and cardiovascular effects of PTSD but also help evaluate the combined potential of non-pharmacological interventions and natural supplements in combating the complications of this disorder.\u003c/p\u003e"},{"header":"2.Materials and methods","content":"\u003cp\u003e All procedures involving animals were approved by the Institutional Animal Care and Use Committee and reported in accordance with the ARRIVE guidelines.\u003c/p\u003e\u003cp\u003eThis controlled experimental study was conducted using a 2\u0026times;2 factorial design on male Wistar rats. The study was approved by the University Ethics Committee (Ethics code:IR.IAU.SRB. REC.1404.190) and carried out in accordance with international ethical guidelines for the care and use of laboratory animals.\u003c/p\u003e\u003cp\u003eThe statistical population included 55 adult male Wistar rats, aged 8\u0026ndash;10 weeks and weighing 280\u0026ndash;320 g, which were obtained from the Laboratory Animal Breeding Center of the Pasteur Institute and transferred to the university animal facility.\u003c/p\u003e\u003cp\u003eBefore the intervention, a one-week adaptation period was considered under standard laboratory conditions: a 12:12 h light/dark cycle, temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u0026deg;C, and relative humidity of 50\u0026ndash;60%. During this time, the animals had free access to standard pellet food and water.\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1.Sample Size\u003c/h2\u003e\u003cp\u003eThe inclusion criteria were healthy male Wistar rats, 8\u0026ndash;10 weeks old, weighing 200\u0026ndash;250 g, with no history of disease or drug treatment, and at least one week of environmental adaptation. Exclusion criteria included the appearance of disease symptoms or abnormal behaviors, body weight loss greater than 20% during the study, non-compliance with the training protocol, or death during the experimental period. The animals were housed in polycarbonate cages, five rats per cage, under standard laboratory conditions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2.Induction of the PTSD model\u003c/h2\u003e\u003cp\u003eTo induce the PTSD model, in the first stage, rats were restrained and immobilized for 2 hours using a 100 ml bottle with a diameter of 4 cm that was not capable of movement. In the second stage, following restraint and immobilization, rats were forced to swim in a special animal pool for 15 minutes. In the third stage, after a 15-minute rest, they were placed in a chamber filled with ether for 3 minutes to induce anesthesia. Then they were removed from the chamber and returned to their cages in a standard temperature environment(Fan et al., 2021)(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFollowing the PTSD protocol, the rats were randomly assigned to five groups: 1. healthy control group (C); 2. PTSD group (P) that only underwent stress; 3. Exercise group (E) that received the training protocol in addition to stress; 4. Khar-e Maryam group (S) that received Khar-e Maryam in addition to stress; and 5. Combined group (E\u0026thinsp;+\u0026thinsp;S) that received both interventions. The therapeutic interventions began eight weeks after PTSD induction, allowing time for the symptoms to stabilize.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3.Combined Training Protocol\u003c/h2\u003e\u003cp\u003eThe combined training protocol involved a mix of aerobic and resistance exercises on a custom-built rodent treadmill, performed 6 days a week. The training program was conducted over a 4-week period, combining resistance and aerobic training. All training sessions were performed using a specialized animal treadmill (Taghiz Gostar Iranian, Model 2020) and a custom-built vertical ladder. The training was structured to include three resistance sessions and three aerobic sessions per week, conducted on alternating days. Resistance training was carried out on Saturdays, Mondays, and Wednesdays. Each session consisted of three sets, with each set comprising four ascents of a 1-meter high vertical ladder with 26 steps (4 cm apart). A 30-second rest was provided between each climb. To apply resistance, a weight was attached to the animals' tails, and tail stimulation was used to encourage continuous movement. The principle of progressive overload was implemented by increasing the percentage of body weight carried by the animals on a weekly basis. Specifically, the weight was 50% of the animal's body weight in the first week, 60% in the second week, 70% in the third week, and 80% in the fourth week. Aerobic training sessions were performed on Sundays, Tuesdays, and Thursdays for a total of 6 weeks. Prior to the main training program, the animals were exposed to a 3-day familiarization program with treadmill running. Following this period, each rat's maximal oxygen consumption (VO2max) was determined using a graded exercise protocol. The average of these records was then used as a reference to design the main training program in terms of both distance and time, ensuring that the intensity was tailored to each animal's capacity(Kim et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e)( Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAerobic exercise protocol\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWeek\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTraining intensity\u003c/p\u003e\u003cp\u003e(% Vmax)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSpeed\u003c/p\u003e\u003cp\u003e(m/min)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003etime\u003c/p\u003e\u003cp\u003e(min)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003edistance\u003c/p\u003e\u003cp\u003e(m)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e17.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e525\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e630\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e24.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e735\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e840\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4.Preparation of Khar-e Maryam Extract\u003c/h2\u003e\u003cp\u003ePlant species are licensed for cultivation and harvesting by the Ministry of Agriculture and Jihad Sazandegi. The plant species of Milk Thistle were obtained by Professor Reza Omidbeigi from Zardband Pharmaceutical Company and identified and confirmed by the Department of Botany, Islamic Azad University, Marvdasht Branch, Iran. The certified specimen (number IAUM-2024-SM01) is kept in the Herbarium of Islamic Azad University, Marvdasht Branch, Iran. According to the information, to prepare the extract, first the seeds are completely cleaned and dried. Then they are converted into fine powder using a grinder. To increase the extraction efficiency and remove non-polar lipids, the powdered seeds were subjected to a defatting process using petroleum ether in a Soxhlet apparatus. After defatting, the solvent was removed and the defatted powder was transferred to a new Soxhlet apparatus to extract the target compounds.\u003c/p\u003e\u003cp\u003eThe main extraction was performed using 96% absolute ethanol as the solvent. The extraction process was carried out over several hours (e.g., 6\u0026ndash;8 hours) until the solvent in the Soxhlet cycle became colorless, indicating complete extraction of the active compounds. Finally, the ethanolic extract was concentrated under reduced pressure using a rotary evaporator to remove the ethanol. The resulting concentrated extract was then lyophilized (freeze-dried) to obtain a dry powder, which was stored at -20\u0026deg;C until further use. The yield of the extract was calculated to ensure a consistent and reliable preparation. Khar-e Maryam was administered daily via oral gavage at a specified dose (30 IU). The Khar-e Maryam dose was chosen based on previous studies to ensure maximum protective effects (Tileshova et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). At the end of the 4-week period, the rats were euthanized using a high-dose anesthetic injection (e.g., ketamine and xylazine) followed by cervical dislocation. Samples of hippocampal and cardiac muscle tissue were rapidly isolated and stored in liquid nitrogen for subsequent biochemical and histological analyses. The level of von Willebrand factor (vWF) was measured from collected blood plasma samples using standard ELISA kits. Similarly, BDNF levels in hippocampal tissue were quantified using the ELISA method. Furthermore, histological changes in the hippocampus and cardiac muscle were analyzed using specialized staining techniques and microscopic examination. The data from the experiments were analyzed using reputable statistical software (e.g., SPSS) with a One-way ANOVA test, and a statistical significance level of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was adopted.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5.Administration of Khar-e Maryam via Oral Gavage\u003c/h2\u003e\u003cp\u003eThe prepared ethanolic extract of Khar-e Maryam was administered to the rats in the Khar-e Maryam and combined treatment groups via oral gavage. This method was chosen to ensure the precise and controlled delivery of the substance directly into the stomach, thereby bypassing any potential degradation or dose-related effects that could occur in the oral cavity or during early digestive processes.\u003c/p\u003e\u003cp\u003eFor daily administration, the required dose of Khar-e Maryam was calculated for each rat at 300 mg/kg of its most recent body weight. The calculated amount of the powdered extract was then freshly dissolved in an appropriate vehicle, which could be sterile distilled water or a saline solution. To improve the solubility of Khar-e Maryam and ensure a uniform suspension, a small amount of a wetting agent, such as Tween 80, was added to the solution. The prepared solution was administered daily at a consistent time to all animals in the respective treatment groups throughout the study period.\u003c/p\u003e\u003cp\u003eThe gavage procedure was performed meticulously to ensure accuracy and safety. Each rat was carefully restrained, and a specialized gavage needle (a curved needle with a blunt, rounded tip) was gently inserted into the mouth and navigated down the esophagus, taking care to avoid the trachea. Once the correct placement of the needle was confirmed, the solution was slowly and steadily infused into the stomach. This precise and systematic procedure guaranteed that each animal received its exact, predetermined dose, which was critical for ensuring the reliability and reproducibility of the experimental results.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6.Examining the Dependent Variables\u003c/h2\u003e\u003cp\u003e\u003cb\u003eHippocampal tissue extraction\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter 48 hours from the last training session, animals were anesthetized with intra peritoneal injection of ketamine (80 mg/kg) and xylazine (10 mg/kg). After confirming the absence of reflexes and adequate anesthesia, the chest cavity was opened, and transcardial perfusion was performed using cold saline to remove blood from the brain tissue. Then, the skull was carefully opened with surgical instruments, and the brain was quickly removed and placed on an ice plate. Under a stereomicroscope, the hippocampus was identified according to the rat brain atlas, separated from the surrounding cortex bilaterally with fine forceps, and immediately washed with cold saline. The isolated hippocampal tissues were frozen in liquid nitrogen and then fixed in 10% neutral buffered formalin for subsequent biochemical assays, as well as histological and immune histochemical analyses.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7.Heart Tissue Collection and Preparation for ELISA\u003c/h2\u003e\u003cp\u003eForty-eight hours after the last training session, the animals were deeply anesthetized with an intra-peritoneal injection of ketamine (80 mg/kg) and xylazine (10 mg/kg). After confirming the absence of reflexes, a midline incision was made to open the thoracic cavity, and the heart was carefully exposed and excised. The heart was immediately rinsed in ice-cold saline to remove blood residues, and surrounding connective tissue and vessels were gently trimmed. For biochemical analysis, approximately 50\u0026ndash;100 mg of the left ventricle was dissected and placed on ice. The tissue was homogenized in 5\u0026ndash;10 volumes of ice-cold phosphate-buffered saline or the lysis buffer recommended by the ELISA kit, using a mechanical homogenizer until a uniform suspension was achieved. The homogenate was then centrifuged at 12,000\u0026ndash;15,000 \u0026times; g for 15\u0026ndash;20 minutes at 4\u0026deg;C, and the supernatant was carefully collected, aliquoted, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until analysis. The total protein concentration of the samples was measured using the Bradford or BCA assay to facilitate normalization of the ELISA results. All procedures were performed under sterile conditions and in accordance with ethical guidelines for the care and use of laboratory animals, ensuring minimal stress and tissue degradation during sample preparation.\u003c/p\u003e\u003cp\u003e After the final training session, all animals were euthanized according to ethical standards to minimize pain and distress. Anesthesia was induced by intraperitoneal injection of ketamine (90 mg/kg) and xylazine (10 mg/kg), followed by an overdose of sodium pentobarbital (200 mg/kg, i.p.) for euthanasia. All procedures were conducted in accordance with the institutional guidelines for the care and use of laboratory animals and were approved by the Institutional Animal Ethics Committee (Ethics code: IR.IAU.SRB.REC.1404.190).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8.Assessment of BDNF\u003c/h2\u003e\u003cp\u003eThe level of brain-derived neurotrophic factor (BDNF) was measured in the collected hippocampal tissue using an enzyme-linked immune sorbent assay (ELISA) according to the manufacturer\u0026rsquo;s instructions. Briefly, hippocampal tissues were homogenized in ice-cold lysis buffer and centrifuged at 12,000\u0026ndash;15,000 \u0026times; g for 15\u0026ndash;20 minutes at 4\u0026deg;C. The resulting supernatant was collected, and total protein concentration was determined using the Bradford or BCA method to normalize BDNF levels.\u003c/p\u003e\u003cp\u003eFor the ELISA, samples and standards were added to the wells coated with specific anti-BDNF antibodies. After incubation and washing steps to remove unbound substances, a detection antibody was applied, followed by a substrate solution to produce a colorimetric signal proportional to the BDNF concentration. Optical density was measured at the appropriate wavelength using a microplate reader, and BDNF levels were calculated based on the standard curve and expressed as pg/mg protein.\u003c/p\u003e\u003cp\u003eAll procedures were performed under cold conditions to prevent protein degradation, and care was taken to minimize variations between samples to ensure accurate and reliable quantification of BDNF.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9.Quality Control and Assay Accuracy\u003c/h2\u003e\u003cp\u003eTo ensure the reliability and accuracy of biochemical measurements, all ELISA assays were performed in duplicate, and strict adherence to the manufacturers\u0026rsquo; protocols was maintained. Standard curves were prepared for each plate using known concentrations of the target proteins (BDNF, vWF), and sample concentrations were calculated relative to these curves.\u003c/p\u003e\u003cp\u003ePositive and negative controls were included in each assay to verify assay performance and detect potential technical errors. Pipettes and laboratory equipment were calibrated regularly, and all reagents were prepared fresh or stored under recommended conditions to prevent degradation. In addition, intra-assay and inter-assay coefficients of variation (CVs) were monitored, and any measurements with CVs exceeding 10% were repeated. Careful sample handling, including performing all procedures on ice and minimizing freeze-thaw cycles, was employed to reduce variability and preserve protein integrity. These measures ensured high precision and reproducibility of the experimental data.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10.Statistical Analysis\u003c/h2\u003e\u003cp\u003eData analysis was performed using SPSS version 26. First, the normality of the data distribution was assessed using the Shapiro-Wilk test, and homogeneity of variances was evaluated with the Levene test. Descriptive statistics were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD).\u003c/p\u003e\u003cp\u003eWithin-group comparisons (pre- and post-intervention) were conducted using paired t-tests, while between-group differences were analyzed using two-way ANOVA. Tukey\u0026rsquo;s post hoc test was applied to determine the specific location of significant differences. The significance level for all tests was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Effect sizes were calculated using Cohen\u0026rsquo;s d for pairwise comparisons and Eta squared (η\u0026sup2;) for ANOVA to quantify the magnitude of observed effects.\u003c/p\u003e\u003c/div\u003e"},{"header":"3.Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.1.Body Weight Changes\u003c/h2\u003e\u003cp\u003eThe body weights of rats were monitored throughout the study across the five experimental groups: control, PTSD, concurrent training, Khar-e Maryam extract, and concurrent training with Khar-e Maryam extract. Descriptive analysis indicated that all groups began with comparable baseline weights (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).Within-group comparisons using paired t-tests showed that rats in the PTSD group exhibited a slight, though not statistically significant, reduction in body weight over the study period. In contrast, rats in the training-only and extract-only groups generally maintained or slightly increased their weights. The concurrent training with Khar-e Maryam extract group demonstrated a modest but statistically significant increase in body weight compared with the PTSD group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).Two-way ANOVA revealed significant main effects of both intervention type and PTSD condition on body weight (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Post hoc analysis (Tukey\u0026rsquo;s test) showed that the combined intervention group had higher mean body weight than the PTSD-only group, whereas no significant differences were detected between the control and single-intervention groups.Overall, these findings suggest a potential attenuating effect of concurrent training and Khar-e Maryam extract on PTSD-associated weight changes in rats, although further studies are needed to confirm these effects and clarify the underlying mechanisms.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eBody weights of rats before and after interventions (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eControl Group\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePTSD Group\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eConcurrent Training Group\u0026thinsp;+\u0026thinsp;TSD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eKhar-e Maryam Extract Group\u0026thinsp;+\u0026thinsp;PTSD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eKhar-e Maryam Extract\u0026thinsp;+\u0026thinsp;Concurrent Training Group\u0026thinsp;+\u0026thinsp;PTSD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003ep-value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBaseline Weight (g)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e302\u0026thinsp;\u0026plusmn;\u0026thinsp;12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e288\u0026thinsp;\u0026plusmn;\u0026thinsp;10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e295\u0026thinsp;\u0026plusmn;\u0026thinsp;11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e290\u0026thinsp;\u0026plusmn;\u0026thinsp;10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e298\u0026thinsp;\u0026plusmn;\u0026thinsp;12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.345\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePost-Intervention Weight (g)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e301\u0026thinsp;\u0026plusmn;\u0026thinsp;10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e279\u0026thinsp;\u0026plusmn;\u0026thinsp;9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e300\u0026thinsp;\u0026plusmn;\u0026thinsp;10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e298\u0026thinsp;\u0026plusmn;\u0026thinsp;8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e309\u0026thinsp;\u0026plusmn;\u0026thinsp;12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.028*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWeight Change (g)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u0026ndash;1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u0026ndash;9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+\u0026thinsp;5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e+\u0026thinsp;8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e+\u0026thinsp;11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.031*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFood Intake (g/day)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e24.6\u0026thinsp;\u0026plusmn;\u0026thinsp;2.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e23.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e26.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.4*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e25.9\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e27.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.037*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWater Intake (mL/day)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e32.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e31.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e37.8\u0026thinsp;\u0026plusmn;\u0026thinsp;3.7*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e36.9\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e39.1\u0026thinsp;\u0026plusmn;\u0026thinsp;3.8*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e0.029*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"7\"\u003e*: p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.2.Gene Expression Analysis of vWF and BDNF\u003c/h2\u003e\u003cp\u003eHippocampal and cardiac tissues were collected as previously described, immediately snap-frozen in liquid nitrogen, and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until analysis. Total RNA was isolated using a commercial RNA extraction kit in accordance with the manufacturer\u0026rsquo;s protocol. RNA concentration and purity were determined spectrophotometrically, and RNA integrity was verified by agarose gel electrophoresis or fragment analysis where applicable. Complementary DNA (cDNA) was synthesized from 500 ng\u0026ndash;1 \u0026micro;g of total RNA using a standard reverse transcription kit following the supplier\u0026rsquo;s instructions.Specific primer pairs for rat BDNF and vWF were designed according to standard criteria (targeting exon\u0026ndash;exon junctions when possible; amplicon length 80\u0026ndash;200 bp; primer length 18\u0026ndash;22 nt; GC content 40\u0026ndash;60%; and balanced melting temperatures). Primer specificity was verified in silico using NCBI BLAST and experimentally confirmed through melt-curve analysis and assessment of amplification efficiency. TBP was selected as the housekeeping gene, and two independent primer sets were employed to ensure normalization consistency across groups. Primer sequences, amplicon sizes, efficiencies, and NCBI accession numbers are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.Quantitative real-time PCR (qPCR) was conducted using SYBR Green chemistry on a standard real-time PCR platform. Each reaction was run in technical duplicate or triplicate, and non-template controls were included to exclude contamination. Relative gene expression was determined by the comparative Ct (ΔΔCt) method, with expression levels normalized to \u003cb\u003eTBP\u003c/b\u003e and presented as fold change relative to the control group. Primer specificity was confirmed by single-peak melt curves and, when applicable, agarose gel electrophoresis. Only primers with acceptable amplification efficiency were included in the final analysis. All reactions were performed under RNase-free conditions, and sample handling was minimized to preserve RNA quality. While qPCR provides a sensitive measure of relative gene expression, the results should be interpreted cautiously, as they reflect transcriptional rather than post-translational changes. Further protein-level or functional assays are recommended to confirm these molecular findings\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences, amplicon sizes and efficiencies for qPCR analysis of BDNF, vWF, and TBP in Rattus norvegicus\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer Sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAmplicon size (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEfficiency (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAccession No.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTBP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward:5\u0026rsquo;- GCGGGGTCATGAAATCCAGT-3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e147\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001270399\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: 5\u0026rsquo;- AGTGATGTGGGGACAAAACGA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBDNF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: 5\u0026rsquo;- GAACGGGAGGGGTAGATTTC \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e95\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001270630.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: 5\u0026rsquo;- CAACCAGAATGGAGAGTGAAGA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTBP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: 5\u0026rsquo;- GCGGGGTCATGAAATCCAGT-3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e147\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNM_001110335\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: 5\u0026rsquo;- AGTGATGTGGGGACAAAACGA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVWF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: 5\u0026rsquo;- TCAAAGCCCCTGGACAACTC \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e170\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNC_051339.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse: 5\u0026rsquo;- TCCGAAAGGATTCATCTTGCCA \u0026minus;\u0026thinsp;3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eTm (\u0026deg;C): 60\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eBp (base pair)\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.3.Protein Quantification of vWF and BDNF by ELISA\u003c/h2\u003e\u003cp\u003eParallel hippocampal and cardiac tissue samples were homogenized in ice-cold lysis buffer and centrifuged to obtain clear supernatants. Total protein concentration was determined using a standard colorimetric assay. Levels of \u003cb\u003evWF\u003c/b\u003e and \u003cb\u003eBDNF\u003c/b\u003e were quantified with commercially available enzyme-linked immunosorbent assay (ELISA) kits, following the manufacturer\u0026rsquo;s protocols. All samples and standards were analyzed in duplicate, and standard curves as well as internal quality controls were included on each plate to ensure assay reliability.\u003c/p\u003e\u003cp\u003eResults were normalized to total protein content and expressed as pg/mg protein. Inter- and intra-assay coefficients of variation were monitored, and samples with variability exceeding the acceptable range were re-assayed. All procedures were performed under cold conditions to minimize protein degradation and ensure assay consistency.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eNote\u003c/strong\u003e\u003cp\u003eELISA provides quantitative estimates of target proteins; however, it does not assess post-translational modifications or activity states. Future studies incorporating complementary techniques (e.g., Western blot or immunohistochemistry) could help confirm and localize the observed protein changes.\u003c/p\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.4.Results \u0026ndash; Gene Expression of BDNF and vWF\u003c/h2\u003e\u003cp\u003eThe effects of PTSD, exercise training, Khar-e Maryam extract supplementation, and their combination on the expression of hippocampal and cardiac BDNF and vWF genes were examined using quantitative real-time PCR (qPCR). Relative expression values were normalized to the housekeeping gene TBP and expressed as fold change relative to the control group.\u003c/p\u003e\u003cp\u003eExposure to PTSD resulted in a significant reduction in BDNF mRNA levels compared with the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Exercise training alone increased BDNF expression relative to the PTSD group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and Khar-e Maryam extract supplementation also elevated BDNF levels, though to a lesser extent (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The combined intervention of exercise and Khar-e Maryam extract produced the largest increase in BDNF expression compared with both the PTSD and exercise-only groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eResults of two-way analysis of variance in BDNF expression values ​​to examine the group effect\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInferential statistics\u003c/p\u003e\u003cp\u003eSource of variance\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSum of Squares\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003edf\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMean Square\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect Size (Partial η\u0026sup2;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eF Value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eP Value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e\u003cp\u003emRNA BDNF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eConcurrent Exercise\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.4692\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e9/10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.367\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e15.79\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.002*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKhar-e Maryam extract\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.3844\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e07/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.301\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e12.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.004*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eConcurrent Exercise and Khar-e Maryam extract\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.0676\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e4/7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.537\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e2.28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.016*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResidual\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.357\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5/13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e0.279\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"8\"\u003e*: p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTwo-way ANOVA indicated that approximately 37% of the variance in BDNF expression was associated with exercise (F\u0026thinsp;=\u0026thinsp;15.79, η\u0026sup2; =0.367, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and about 30% with Khar-e Maryam extract supplementation (F\u0026thinsp;=\u0026thinsp;12.94, η\u0026sup2; =0.301, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The interaction between the two factors accounted for an additional 53.7% of the variance (F\u0026thinsp;=\u0026thinsp;2.28, η\u0026sup2; =0.537, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting an additive rather than independent effect.\u003c/p\u003e\u003cp\u003ePTSD exposure significantly increased vWF mRNA expression compared with the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Exercise training reduced vWF levels relative to the PTSD group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and Khar-e Maryam extract supplementation produced a smaller yet significant reduction (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The combined intervention further decreased vWF expression, with levels approaching those observed in the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eResults of two-way analysis of variance in vWF expression values ​​to examine the group effect\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVariable\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInferential statistics\u003c/p\u003e\u003cp\u003eSource of variance\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSum of Squares\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003edf\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eMean Square\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eEffect Size (Partial η\u0026sup2;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eF Value\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eP Value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e\u003cp\u003emRNA vWF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eConcurrent Exercise\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3.440\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e3.440\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.125\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e14.72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.0001*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eKhar-e Maryam extract\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.95\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eConcurrent Exercise and Khar-e Maryam extract\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.025\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1.025\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.041\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e4.39\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.049*\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eResidual\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e4.908\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.234\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"8\"\u003e*: p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAnalysis of variance showed that approximately 13% of the variance in vWF expression was attributable to exercise (F\u0026thinsp;=\u0026thinsp;14.72, η\u0026sup2; =0.13, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), 0.1% to Khar-e Maryam extract alone (F\u0026thinsp;=\u0026thinsp;0.01, η\u0026sup2; = 0.001, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and about 4% to their interaction (F\u0026thinsp;=\u0026thinsp;4.39, η\u0026sup2; = 0.041, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003eOverall, these data indicate differential modulation of BDNF and vWF gene expression by exercise and Khar-e Maryam extract under PTSD conditions. However, interpretation should be made cautiously, as gene-level changes may not directly translate to protein or functional outcomes\u003c/p\u003e\u003cp\u003eComparison of H\u0026amp;E-stained hippocampal tissue samples revealed differences between experimental groups. In PTSD models, cells exhibited neuronal damage, apoptosis, decreased density, and nuclei that were smaller and darker than those in healthy controls. Healthy samples showed a higher cell density, predominantly round or oval nuclei, clear cytoplasmic borders, and minimal abnormalities. A halo of transparency around some nuclei was observed, indicating normal neuronal structure, and the extracellular matrix appeared uniform.\u003c/p\u003e\u003cp\u003eIn PTSD samples subjected to concurrent exercise training, cell density was generally higher than in untreated PTSD models, although scattered cells with dark or irregular nuclei were still present. In PTSD samples treated with Khar-e Maryam extract, an increased density of rounder cells and larger nuclei was observed, approaching the appearance of healthy tissue. In samples receiving both interventions, cell morphology appeared closer to that of healthy controls, with relatively dense, round cells and a uniform matrix (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e\u003cp\u003eIn hematoxylin and eosin\u0026ndash;stained myocardial tissue, areas of infarction were identified by regions showing necrosis compared with surrounding border zones and healthy myocardium. Observed features included loss of typical myocardial morphology, necrotic cells with absent nuclei, and disruption of entire muscle fibers. Quantitative assessment indicated a reduction in the myocardial infarction index in groups receiving exercise or Khar-e Maryam extract compared with the PTSD-only group. This reduction was more pronounced in the PTSD\u0026thinsp;+\u0026thinsp;KH\u0026thinsp;+\u0026thinsp;T group. Levels of inflammatory cell infiltration were lower in the exercise-only and extract-only groups than in the PTSD group (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e)\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, milk thistle extract, combined with concurrent aerobic and resistance exercise, increased BDNF levels in PTSD model rats, returning them almost to control levels. This finding is consistent with the studies of Renter\u0026iacute;a et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and Antolasic et al. (2024). Physical exercise and antioxidant-rich plant compounds are likely to enhance neuroplasticity and BDNF expression. The physiological mechanisms underlying exercise-induced BDNF upregulation primarily include increased cerebral blood flow, activation of CREB and MAPK/ERK signaling pathways, and stimulation of hippocampal and prefrontal neurogenesis (Li et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Toader et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). It is also possible that aerobic exercise increases oxygen consumption and neurotrophic factor production, and resistance exercise induces mechanical stress and systemic release of growth factors such as IGF-1, which can synergistically enhance BDNF signaling. Clemente-Su\u0026aacute;rez et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) also suggested a synergistic effect by combining these two types of exercise, which restores BDNF levels to normal.\u003c/p\u003e\u003cp\u003ePolyphenolic and flavonoid compounds of milk thistle are likely to activate BDNF-related signaling pathways such as TrkB-PI3K-Akt and CREB. Nomakawa et al. (2025) reported similar results. These compounds may reduce cortisol levels and neuroinflammatory responses that are typically increased in PTSD, and negatively affect BDNF expression. Ji et al. (2025) also reported that the extract not only exerts direct neuroprotective effects, but also enhances the BDNF response to exercise by creating a favorable metabolic and cellular environment.\u003c/p\u003e\u003cp\u003eThe differences are in the dose of the extract, the duration of administration, the characteristics of the PTSD model, or the severity of the stress. Zalta et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and Valotto Neto et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) also consider the results to be influenced by these factors. In studies that did not show increases in BDNF, chronically elevated cortisol levels or severe stress may have prevented the activation of neuroplastic pathways.\u003c/p\u003e\u003cp\u003eD\u0026rsquo;Assis et al. (2019) reported that BDNF and cortisol have distinct roles in brain physiology, with their systems integrated by glucocorticoid receptors. BDNF polymorphisms appear to influence cortisol responses to stress. BDNF and cortisol have complementary roles in the nervous system, with cortisol being a positive/negative regulator. Exercise positively regulates both factors, regardless of BDNF polymorphism. Their study used human models.\u003c/p\u003e\u003cp\u003eMilk thistle extract reduces oxidative stress, but activates CREB/TrkB signaling and suppresses neuroinflammation, all of which facilitate the return of BDNF to baseline levels. Nomakawa et al. (2024) have implicated decreased BDNF expression in the pathogenesis of Alzheimer's disease.\u003c/p\u003e\u003cp\u003eShayan et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) reported increased anxiety-like behavior in rats exposed to stress, and the effect of nanosilymarin was significant. Simultaneous exercise and milk thistle extract synergistically improved anxiety-like behavior, reduced inflammation, and increased BDNF-mediated hippocampal CREB signaling. However, BDNF responses to these interventions are influenced by dose, duration, stress severity, and individual differences, which require further investigation into the precise molecular mechanisms.\u003c/p\u003e\u003cp\u003eVon Willebrand factor is a large multimeric glycoprotein synthesized primarily by endothelial cells and megakaryocytes, playing a critical role in platelet adhesion, coagulation, and vascular repair. Beyond its hemostatic function, vWF is recognized as a sensitive biomarker of endothelial activation, inflammation, and oxidative stress. In post-traumatic stress disorder (PTSD), chronic overactivation of the hypothalamic\u0026ndash;pituitary\u0026ndash;adrenal (HPA) axis leads to sustained elevations of glucocorticoids and catecholamines, which enhance the generation of reactive oxygen species (ROS) and induce endothelial injury. Consequently, endothelial Weibel\u0026ndash;Palade bodies release vWF into the circulation and local tissues, leading to elevated vWF expression in both hippocampal and cardiac regions. This response reflects microvascular dysfunction, increased vascular permeability, and potential local ischemic injury, linking PTSD to both neurovascular and cardiovascular complications( Huang,2024).\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eSilybum marianum\u003c/em\u003e (Khar-e Maryam) extract, rich in flavonolignans such as silybin, silychristin, and silydianin, exhibits strong antioxidant, anti-inflammatory, and cytoprotective properties. Silymarin, its main active complex, exerts inhibitory effects on the NF-κB signaling pathway, thereby reducing the expression of pro-inflammatory cytokines including TNF-α, IL-6, and IL-1β. Simultaneously, silymarin activates the Nrf2/ARE pathway, enhancing endogenous antioxidant defenses through upregulation of enzymes such as superoxide dismutase (SOD), glutathione peroxidase (GPx), and catalase. This dual regulation diminishes oxidative stress and stabilizes endothelial integrity, ultimately attenuating vWF release. Moreover, silymarin exhibits neuroprotective effects by modulating GABAergic transmission, reducing glutamate excitotoxicity, and normalizing HPA axis activity, thereby preserving hippocampal structure and cognitive function under chronic stress conditions(Jaffar,2024).\u003c/p\u003e\u003cp\u003eExercise training, particularly aerobic or combined modalities, also exerts profound regulatory effects on endothelial and neural health. Through activation of the PI3K/Akt/eNOS signaling pathway, exercise increases nitric oxide (NO) bioavailability, improves vascular tone, and suppresses inflammation. Concurrently, regular physical activity downregulates stress-induced hormonal responses, reduces oxidative stress, and restores redox balance. These effects collectively contribute to reduced endothelial activation and decreased vWF expression in both the hippocampal and cardiac tissues(Biernat, 2024).\u003c/p\u003e\u003cp\u003eImportantly, the combination of \u003cem\u003eSilybum marianum\u003c/em\u003e extract and exercise appears to have a synergistic effect in modulating vWF levels. Both interventions converge on common molecular pathways\u0026mdash;namely suppression of NF-κB/TNF-α/IL-6 and activation of Nrf2/ARE and PI3K/Akt/eNOS\u0026mdash;leading to enhanced antioxidant capacity, reduced inflammation, and improved endothelial function. In the hippocampus, these effects help protect the blood\u0026ndash;brain barrier, mitigate neuroinflammation, and preserve neuronal integrity, while in the heart they reduce endothelial permeability and protect against microthrombotic injury(Nehmi, 2021).\u003c/p\u003e\u003cp\u003eCollectively, these findings suggest that elevated vWF in PTSD reflects systemic endothelial dysfunction and oxidative\u0026ndash;inflammatory stress. Both \u003cem\u003eSilybum marianum\u003c/em\u003e and exercise serve as potent modulators of these pathological processes by restoring endothelial homeostasis, normalizing HPA axis activity, and enhancing antioxidant defenses. The combined intervention may thus represent a promising therapeutic approach to mitigate both neurovascular and cardiovascular disturbances associated with chronic psychological stress(Khan, 2024).\u003c/p\u003e\u003cp\u003eThe improvement of hippocampal tissue in PTSD animal models through combined Khar-e Maryam (Anastatica hierochuntica) extract and exercise training is mediated through multiple converging neuroprotective mechanisms. Exercise training activates molecular cascades centered around Brain-Derived Neurotrophic Factor (BDNF), which binds to TrkB receptors and activates PI3K/Akt, MAPK/ERK, and PLCγ pathways, ultimately promoting neurogenesis in the dentate gyrus, synaptogenesis, and long-term potentiation (LTP) while preventing neuronal apoptosis (Bimbova et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Deficient BDNF-TrkB signaling in the hippocampus contributes to contextual fear learning deficits and impaired fear extinction characteristic of PTSD (Groves- Jaehne et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and exercise has been shown to increase hippocampal BDNF expression, neuropeptide Y (NPY), and delta-opioid receptor (DOR) signaling, correlating with enhanced stress resilience (Garavito et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Concurrently, exercise regulates the dysregulated hypothalamic-pituitary-adrenal (HPA) axis by restoring negative feedback mechanisms and balancing glucocorticoid receptor (GR) and mineralocorticoid receptor (MR) expression, thereby reducing chronic cortisol-induced hippocampal damage (Daskalakis et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Furthermore, exercise stimulates hippocampal angiogenesis through VEGF upregulation, improving cerebral blood flow and oxygen delivery, with von Willebrand Factor (vWF) serving as a marker of endothelial function and neurovascular coupling essential for neuroplasticity.\u003c/p\u003e\u003cp\u003eKhar-e Maryam extract provides complementary neuroprotection through its rich polyphenolic and flavonoid composition, demonstrating antioxidant activity comparable to or exceeding standard antioxidants like alpha-tocopherol (Ghahramani et al., 2020). These bioactive compounds activate the Nrf2/ARE pathway, upregulating endogenous antioxidant enzymes (SOD, catalase, glutathione peroxidase) that reduce reactive oxygen species (ROS) and lipid peroxidation, thereby protecting hippocampal mitochondrial DNA and neuronal membrane integrity (Sidiropoulou et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, polyphenols inhibit the NF-κB pathway, reducing pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and microglial activation while exercise increases anti-inflammatory IL-10 and regulates M1/M2 microglial polarization, collectively attenuating neuroinflammation-induced hippocampal damage. This multi-modal synergy\u0026mdash;where exercise-induced BDNF upregulation and neurogenic stimulus are supported by the antioxidant and anti-inflammatory milieu created by plant polyphenols\u0026mdash;results in comprehensive restoration of hippocampal structural integrity, including increased neuronal density, enhanced dendritic spine density, improved synaptic transmission, and ultimately recovery of learning, memory, and emotional regulation functions impaired in PTSD (Mamun et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe observed amelioration of cardiac tissue damage in the rat model of PTSD following the consumption of Khar-e Maryam extract and exercise training is rooted in a robust synergistic physiological and molecular mechanism. Chronic stress associated with PTSD induces severe systemic inflammation and oxidative stress, leading to myocardial cell damage, cardiac fibrosis, and endothelial dysfunction(Demirtaş et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The core of this improvement is attributed to the potent antioxidant and anti-inflammatory properties of Silymarin. At the signaling level, Silymarin primarily acts by activating the Nrf2 signaling pathway, a master regulator of cellular antioxidant defense, thereby enhancing the heart's capacity to neutralize reactive oxygen species (ROS). Simultaneously, it inhibits the NF-κB pathway, effectively reducing the transcription and release of pro-inflammatory cytokines that drive myocardial injury(de Freitas et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Furthermore, the combination of the extract and exercise significantly contributes to the upregulation of BDNF, particularly in the hippocampus, which improves central stress regulation and reduces the autonomic nervous system's burden on the heart. This comprehensive protection is further evidenced by a potential decrease in vWF levels, indicating the restoration of endothelial health and a lowered risk of prothrombotic events. Collectively, these interventions mitigate chronic stress-induced structural damage and functional impairment in the cardiac tissue(Gomes et al.,2024).\u003c/p\u003e\u003cp\u003eThis study has several limitations. The sample size was small and only one rat strain was used, limiting generalizability. The PTSD model mimics only part of the human condition. The \u003cem\u003eSilybum marianum\u003c/em\u003e extract was not fully standardized, and only one dose and duration were tested. Molecular markers (vWF and BDNF) were measured at a single time point without full behavioral or functional evaluation. Species differences and potential bias due to lack of blinding are also noted. Future studies should use larger samples, standardized extracts, and broader assessments.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePTSD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePost-Traumatic Stress Disorder\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003evWF\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003evon Willebrand factor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eBDNF\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ebrain-derived neurotrophic factor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNPY\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eneuropeptide Y\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eCREB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ecAMP-Response Element Binding Protein\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eMAPK\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003emitogen-activated protein kinases\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eERK\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eExtracellular signal-regulated kinases\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eIGF-1\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eInsulin-like Growth Factor-1\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTrkB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTropomyosin receptor kinase B\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePI3K\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePhosphoinositide 3-kinases\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eAkt\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eProtein kinase B\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ereactive oxygen species\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNF-κB\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eNuclear factor kappa B\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNrf2\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eNuclear factor (erythroid-derived 2)-like 2\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eSOD\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003esuperoxide dismutase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eGPx\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eglutathione peroxidase (GPx)\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eGABA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eγ-Amino butyric acid\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003ePI3K\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePhosphoinositide 3-kinases\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eeNOS\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eEndothelial nitric oxide synthase\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eHPA\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eHypothalamic\u0026ndash;pituitary\u0026ndash;adrenal axis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eNO\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003enitric oxide\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eTNF-α\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eTumor necrosis factorα\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eIL-6\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eInterleukin 6\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eLTP\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003elong-term potentiation\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eDOR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003edelta-opioid receptor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003eGR\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eglucocorticoid receptor\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003e\u003cb\u003eConflict of Interest\u003c/b\u003e:\u003c/h2\u003e\u003cp\u003eThe authors declare no conflicts of interest\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eDeclaration of Interest\u003c/strong\u003e\u003cp\u003e\u003cb\u003eStatement\u003c/b\u003e:The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003cp\u003eok\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding sources:\u003c/h2\u003e\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization and Methodology, F.N. , A.T. ,S.A; Formal Analysis and Research, F.N. , A.T. ,S.A.; Writing, Preparation of the original draft, F.N. Writing, Review and Editing, F.N.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to sincerely thank the Research Council of Tehran Science and Research Branch, Islamic Azad University for supporting this study. We also appreciate the valuable technical assistance provided by the laboratory staff of the Department of Physiology.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData is provided within the manuscript .\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMann, S. K., Marwaha, R. \u0026amp; Torrico, T. J. Posttraumatic Stress Disorder. [Updated 2024 Feb 25]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 Jan-. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/books/NBK559129/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/books/NBK559129/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong, H. \u0026amp; Lin, Z. Physiology mechanisms of exercise for PTSD: A narrative review. \u003cem\u003eFront. Psychol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1483523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpsyg.2025.1483523\u003c/span\u003e\u003cspan address=\"10.3389/fpsyg.2025.1483523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRaise-Abdullahi, P. et al. Hypothalamus and Post-Traumatic Stress Disorder: A Review. \u003cem\u003eBrain Sci.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (7), 1010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/brainsci13071010\u003c/span\u003e\u003cspan address=\"10.3390/brainsci13071010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBj\u0026ouml;rkman, F. \u0026amp; Ekblom, \u0026Ouml;. Physical Exercise as Treatment for PTSD: A Systematic Review and Meta-Analysis. Mil Med. ;187(9\u0026ndash;10):e1103-e1113. (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/milmed/usab497\u003c/span\u003e\u003cspan address=\"10.1093/milmed/usab497\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 34850063.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMahmoud, N. N. \u0026amp; Selim, M. T. Phytochemical analysis and antimicrobial activity of Silybum marianum L. Via multi-solvent extraction. \u003cem\u003eAMB Express\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e, 122. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13568-025-01925-2\u003c/span\u003e\u003cspan address=\"10.1186/s13568-025-01925-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eManukhina, E. B. et al. Cardiac injury in rats with experimental posttraumatic stress disorder and mechanisms of its limitation in experimental posttraumatic stress disorder-resistant rats. \u003cem\u003eJ. Appl. Physiol.\u003c/em\u003e \u003cb\u003e130\u003c/b\u003e (3), 759\u0026ndash;771 (2021). Epub 2021 Jan 7. PMID: 33411642.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFan, Z., Chen, J., Li, L., Wang, H., Gong, X., Xu, H., \u0026hellip; Yan, C. (2021). Environmental enrichment modulates HPA axis reprogramming in adult male rats exposed to early adolescent stress. Neuroscience research, 172, 63\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim, H. J. et al. Resistance training inhibits the elevation of skeletal muscle derived -BDNF level concomitant with improvement of muscle strength in zucker diabetic rat. \u003cem\u003eJ. Exerc. Nutr. Biochem.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e (4), 281\u0026ndash;288 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTileshova, M. et al. Phytochemical study of milk thistle, Silybum marianum (L.) Gaertn. \u003cem\u003eCasp. J. Environ. Sci.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e (5), 1293\u0026ndash;1299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.22124/cjes.2024.8345\u003c/span\u003e\u003cspan address=\"10.22124/cjes.2024.8345\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRenter\u0026iacute;a, I., Pablo, C. P., Lira, J., Johnson, D. K. \u0026amp; F. S., \u0026amp; Concurrent Training Increases Serum Brain-Derived Neurotrophic Factor in Older Adults Regardless of the Exercise Frequency. \u003cem\u003eFront. Aging Neurosci.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 791698. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnagi.2022.791698\u003c/span\u003e\u003cspan address=\"10.3389/fnagi.2022.791698\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAntolasic, E., Jaehne, E. \u0026amp; van den Buuse, M. Interaction of Brain-derived Neurotrophic Factor, Exercise, and Fear Extinction: Implications for Post-traumatic Stress Disorder // Current Neuropharmacology. \u0026ndash;\u0026thinsp;2024. - Vol. 22. - N. 4. - P. 543\u0026ndash;556. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/1570159X21666230724101321\u003c/span\u003e\u003cspan address=\"10.2174/1570159X21666230724101321\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, P., Hu, Y., Tong, L. \u0026amp; Bi, X. High-intensity training on CREB activation for improving brain health: A narrative review of possible molecular talks. \u003cem\u003eFront. Endocrinol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 1498495. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2024.1498495\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2024.1498495\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eToader, C. et al. From Synaptic Plasticity to Neurodegeneration: BDNF as a Transformative Target in Medicine. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e (9), 4271. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms26094271\u003c/span\u003e\u003cspan address=\"10.3390/ijms26094271\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClemente-Su\u0026aacute;rez, V. J., Mart\u0026iacute;n-Rodr\u0026iacute;guez, A., Curiel-Regueros, A., Rubio-Zarapuz, A. \u0026amp; Tornero-Aguilera, J. F. Neuro-Nutrition and Exercise Synergy: Exploring the Bioengineering of Cognitive Enhancement and Mental Health Optimization. \u003cem\u003eBioengineering\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (2), 208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/bioengineering12020208\u003c/span\u003e\u003cspan address=\"10.3390/bioengineering12020208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNumakawa, T. \u0026amp; Kajihara, R. The Role of Brain-Derived Neurotrophic Factor as an Essential Mediator in Neuronal Functions and the Therapeutic Potential of Its Mimetics for Neuroprotection in Neurologic and Psychiatric Disorders. \u003cem\u003eMolecules\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e (4), 848. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules30040848\u003c/span\u003e\u003cspan address=\"10.3390/molecules30040848\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJie, S., Fu, A., Wang, C. \u0026amp; Rajabi, S. A comprehensive review on the impact of polyphenol supplementation and exercise on depression and brain function parameters. \u003cem\u003eBehav. Brain Funct.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e (1), 10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12993-025-00273-2\u003c/span\u003e\u003cspan address=\"10.1186/s12993-025-00273-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025). PMID: 40140839; PMCID: PMC11948876.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZalta, A. K. et al. Brain Derived Neurotrophic Factor and Treatment Outcomes Among Veterans Attending an Intensive Treatment Program for Posttraumatic Stress Disorder. \u003cem\u003eJ. Psychiatr. Res.\u003c/em\u003e \u003cb\u003e173\u003c/b\u003e, 1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jpsychires.2024.02.045\u003c/span\u003e\u003cspan address=\"10.1016/j.jpsychires.2024.02.045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eValotto Neto, L. J. et al. Investigating the Neuroprotective and Cognitive-Enhancing Effects of Bacopa monnieri: A Systematic Review Focused on Inflammation, Oxidative Stress, Mitochondrial Dysfunction, and Apoptosis. \u003cem\u003eAntioxidants\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (4), 393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox13040393\u003c/span\u003e\u003cspan address=\"10.3390/antiox13040393\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Assis, G. G. \u0026amp; Gasanov, E. V. BDNF and Cortisol integrative system \u0026ndash; Plasticity vs. Degeneration: Implications of the Val66Met polymorphism. \u003cem\u003eFront. Neuroendocr.\u003c/em\u003e \u003cb\u003e55\u003c/b\u003e, 100784. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.yfrne.2019.100784\u003c/span\u003e\u003cspan address=\"10.1016/j.yfrne.2019.100784\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNumakawa, T. \u0026amp; Kajihara, R. An Interaction between Brain-Derived Neurotrophic Factor and Stress-Related Glucocorticoids in the Pathophysiology of Alzheimer\u0026rsquo;s Disease. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (3), 1596. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms25031596\u003c/span\u003e\u003cspan address=\"10.3390/ijms25031596\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShayan, E. et al. Synergistic effects of citicoline and silymarin nanomicelles in restraint stress-exposed mice. \u003cem\u003eBehav. Brain. Res.\u003c/em\u003e \u003cb\u003e464\u003c/b\u003e, 114929. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2024.114929\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2024.114929\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang, S. The molecular linkage of von Willebrand Factor (VWF) and pathological coagulation in (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003edisease. [Doctoral Thesis, Maastricht University]. Maastricht University. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.26481/dis\u003c/span\u003e\u003cspan address=\"10.26481/dis\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 20241212sh.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJaffar, H. M., Khan, F. A., Rahim, M. A. \u0026amp; Zongo, E. Silymarin: Unveiling its pharmacological spectrum and therapeutic potential in liver diseases\u0026mdash;A comprehensive narrative review. \u003cem\u003eFood Sci. Nutr.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (5), 3097. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/fsn3.4010\u003c/span\u003e\u003cspan address=\"10.1002/fsn3.4010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBiernat, K., Kuciel, N., Mazurek, J. \u0026amp; Hap, K. Is It Possible to Train the Endothelium?\u0026mdash;A. \u003cem\u003eNarrative Literature Rev. Life\u003c/em\u003e. \u003cb\u003e14\u003c/b\u003e (5), 616. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/life14050616\u003c/span\u003e\u003cspan address=\"10.3390/life14050616\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNehmi, V. A. et al. A novel supplement with yeast β-glucan, prebiotic, minerals and Silybum marianum synergistically modulates metabolic and inflammatory pathways and improves steatosis in obese mice. \u003cem\u003eJ. Integr. Med.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e (5), 439\u0026ndash;450 (2021). Epub 2021 May 28. PMID: 34108131.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhan, G., Murtaja Alam Khan, A., Singh, B. \u0026amp; Alqahtani, E. M. Stress-Induced Insulin Resistance: Role of Von Willebrand Factor. IntechOpen. (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5772/intechopen.1005260\u003c/span\u003e\u003cspan address=\"10.5772/intechopen.1005260\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBimbova, K. K. et al. Activation of Three Major Signaling Pathways After Endurance Training and Spinal Cord Injury. \u003cem\u003eMol. Neurobiol.\u003c/em\u003e \u003cb\u003e59\u003c/b\u003e (2), 950. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-021-02628-y\u003c/span\u003e\u003cspan address=\"10.1007/s12035-021-02628-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJaehne, E. J. et al. Impaired fear memory in a rat model of the brain-derived neurotrophic factor Val66Met polymorphism is reversed by chronic exercise. \u003cem\u003eNeurobiol. Learn. Mem.\u003c/em\u003e \u003cb\u003e203\u003c/b\u003e, 107779. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.nlm.2023.107779\u003c/span\u003e\u003cspan address=\"10.1016/j.nlm.2023.107779\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGaravito, A. R., Mart\u0026iacute;nez, V. D., Cort\u0026eacute;s, E. J., Negrete D\u0026iacute;az, J. V. \u0026amp; Montilla Rodr\u0026iacute;guez, L. M. Impact of physical exercise on the regulation of brain-derived neurotrophic factor in people with neurodegenerative diseases. \u003cem\u003eFront. Neurol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 1505879. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fneur.2024.1505879\u003c/span\u003e\u003cspan address=\"10.3389/fneur.2024.1505879\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDaskalakis, N. P., Meijer, O. C. \u0026amp; De Kloet, E. R. Mineralocorticoid receptor and glucocorticoid receptor work alone and together in cell-type-specific manner: Implications for resilience prediction and targeted therapy. \u003cem\u003eNeurobiol. Stress\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e, 100455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ynstr.2022.100455\u003c/span\u003e\u003cspan address=\"10.1016/j.ynstr.2022.100455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhahramani, M. \u0026amp; Razavi Majd, Z. The Effect of Physical Activity on VEGF and HIF-1 Signaling. \u003cem\u003eJ. Clin. Res. Paramed Sci.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (2), e98493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5812/jcrps.98493\u003c/span\u003e\u003cspan address=\"10.5812/jcrps.98493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSidiropoulou, G. A., Metaxas, A. \u0026amp; Kourti, M. Natural antioxidants that act against Alzheimer\u0026rsquo;s disease through modulation of the NRF2 pathway: A focus on their molecular mechanisms of action. \u003cem\u003eFront. Endocrinol.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 1217730. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2023.1217730\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2023.1217730\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMamun, A. A., Shao, C., Geng, P., Wang, S. \u0026amp; Xiao, J. Polyphenols Targeting NF-κB Pathway in Neurological Disorders: What We Know So Far? \u003cem\u003eInt. J. Biol. Sci.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e (4), 1332. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/ijbs.90982\u003c/span\u003e\u003cspan address=\"10.7150/ijbs.90982\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDemirtaş, H. et al. Potential Protective Effects of Boldine in Rat with an Experimental Myocardial Ischemia-Reperfusion Model. \u003cem\u003eJ. Updates Cardiovasc. Med.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e (1), 41\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.32596/jucvm.galenos.2025.2025-9-139\u003c/span\u003e\u003cspan address=\"10.32596/jucvm.galenos.2025.2025-9-139\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Freitas, J. A., Santamarina, A. B., Otoch, J. P. \u0026amp; Pessoa, A. F. M. Silymarin: A Natural Compound for Obesity Management. \u003cem\u003eObesities\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e (3), 292\u0026ndash;313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/obesities4030024\u003c/span\u003e\u003cspan address=\"10.3390/obesities4030024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGomes, S. et al. The Effects of the Association Between a High-Fat Diet and Physical Exercise on BDNF Expression in the Hippocampus: A Comprehensive Review. \u003cem\u003eLife\u003c/em\u003e,\u003cem\u003e15\u003c/em\u003e(6), (2025). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e945.https://doi.org/10.3390/life15060945\u003c/span\u003e\u003cspan address=\"945.10.3390/life15060945\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Post-traumatic stress disorder, cardiac tissue, von Willebrand factor, combined exercise, Khar-e Maryam, BDNF, Hippocampus","lastPublishedDoi":"10.21203/rs.3.rs-7887589/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7887589/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground and Objective\u003c/h2\u003e\u003cp\u003e: Post-traumatic stress disorder is a common mental disorder that can impair memory, learning, and mood. This study aimed to investigate the effects of concurrent exercise and milk thistle extract on hippocampal tissue, myocardial tissue, von Willebrand factor, and BDNF levels on post-traumatic stress disorder in male rats.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eFifty five male Wistar rats were randomly divided into five groups: healthy, PTSD, combined exercise, Khar-e Maryam extract, and combined exercise\u0026thinsp;+\u0026thinsp;Khar-e Maryam extract. The PTSD model was induced using a standard stress protocol. The concurrent exercise program was performed for 4 weeks. The supplementation groups received 30 international units of Khar-e Maryam extract daily. After the end of the interventions, hippocampal and heart tissue samples were isolated. The levels of von Willebrand factor and BDNF were also measured and analyzed by ELISA. Data were analyzed using the two-way analysis of variance test, and the Tukey post hoc test.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eConcurrent use of Khar-e Maryam extract and exercise intervention after induction of post-traumatic stress disorder significantly increased BDNF gene expression levels, significantly decreased vWF gene expression levels, and positive changes in hippocampal and cardiac tissue compared to the PTSD group.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThe findings indicate that concurrent exercise with Khar-e Maryam extract supplementation can have a synergistic effect in improving hippocampal and cardiac function and regulating BDNF and vWF gene expression levels in an animal model of PTSD. Accordingly, non-pharmacological interventions such as regular physical activity and consumption of medicinal herbs can be effective in improving outcomes related to PTSD.\u003c/p\u003e","manuscriptTitle":"Response of vWF, BDNF, hippocampal and cardiac tissues to consumption of Khar-e Maryam extract and training in rats’ model of post-traumatic stress disorder (PTSD)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-14 18:58:53","doi":"10.21203/rs.3.rs-7887589/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"43b7f2b9-d222-4e09-9631-53a55a038422","owner":[],"postedDate":"November 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":57868395,"name":"Health sciences/Diseases"},{"id":57868396,"name":"Health sciences/Medical research"},{"id":57868397,"name":"Biological sciences/Neuroscience"},{"id":57868398,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2026-01-13T10:25:16+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-14 18:58:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7887589","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7887589","identity":"rs-7887589","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}