Reproduction-associated pathways in females of gibel carp (Carassius gibelio) shed light on the molecular mechanisms of the coexistence of asexual and sexual reproduction

Reproduction-associated pathways in females of gibel carp (Carassius gibelio) shed light on the molecular mechanisms of the coexistence of asexual and sexual reproduction | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Reproduction-associated pathways in females of gibel carp (Carassius gibelio) shed light on the molecular mechanisms of the coexistence of asexual and sexual reproduction Florian Jacques, Tomáš Tichopád, Martin Demko, Vojtěch Bystrý, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3908673/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Gibel carp ( Carassius gibelio ) is a cyprinid fish that originated in eastern Eurasia and is considered as invasive in European freshwater ecosystems. The populations of gibel carp in Europe are mostly composed of asexually reproducing triploid females ( i.e ., reproducing by gynogenesis) and sexually reproducing diploid females and males. Although some cases of coexisting sexual and asexual reproductive forms are known in vertebrates, the molecular mechanisms maintaining such coexistence are still in question. Both reproduction modes are supposed to exhibit evolutionary and ecological advantages and disadvantages. To better understand the coexistence of these two reproduction strategies, we performed transcriptome profile analysis of gonad tissues (ovaries) and studied the differentially expressed reproduction-associated genes in sexual and asexual females. We used high-throughput RNA sequencing to generate transcriptomic profiles of gonadal tissues of triploid asexual females and males, diploid sexual males and females of gibel carp, as well as diploid individuals from two closely-related species, C. auratus and Cyprinus carpio . Using SNP clustering, we showed the close similarity of C. gibelio and C. auratus with a basal position of C. carpio to both Carassius species. Using transcriptome profile analyses, we showed that many genes and pathways are involved in both gynogenetic and sexual reproduction in C. gibelio ; however, we also found that 1500 genes, including 100 genes involved in cell cycle control, meiosis, oogenesis, embryogenesis, fertilization, steroid hormone signaling, and biosynthesis were differently expressed in the ovaries of asexual and sexual females. We suggest that the overall downregulation of reproduction-associated pathways in asexual females, and their maintenance in sexual ones, allow for their stable coexistence, integrating the evolutionary and ecological advantages and disadvantages of the two reproductive forms. However, we showed that many sexual-reproduction-related genes are maintained and expressed in asexual females, suggesting that gynogenetic gibel carp retains the genetic toolkits for meiosis and sexual reproduction. These findings shed new light on the evolution of this asexual and sexual complex. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The establishment of sexual reproduction has been a major event in the evolution of eukaryotes (1). However, asexual reproduction has evolved independently in dozens of eukaryotic lineages, and is documented in approximately 80 vertebrate species, all representing reptiles, amphibians (2), and teleost fish (3). Asexual species often originate from hybridization events and/or ploidy alteration (4–7). These processes usually affect meiosis and generate new species with asexual females only (8–11). Both sexual and asexual reproduction exhibit various evolutionary and ecological advantages and disadvantages. The main disadvantage of sexual reproduction is the two-fold cost of meiosis and the production of male offspring (12). Consequently, sexual individuals can be outnumbered by parthenogenetic females that exhibit twice the egg production rate. On the other hand, parthenogenetic forms suffer from the accumulation of deleterious mutations and reduced adaptive abilities, including lower ecological tolerance and higher susceptibility to parasites, following the principle of Muller`s ratchet (13). Hence, asexually reproducing species are usually considered a short-term evolutionary dead-end, and this explains the maintenance of sexual reproduction in the vast majority of eukaryotic lineages (14). Still, asexual reproduction persists in nature, and for some vertebrates, sexual and asexual complexes of closely-related species often coexist with sexual forms in the same habitats (e.g., the teleosts Poecilia and Cobitis , and the lizard Aspidoscelis ). Interspecific hybridization played an important role in the formation of polyploid asexual species. In amphibians and teleosts, all-female asexual species reproduce by gynogenesis (15), a process where females use the sperm from males of the same species or a closely-related species to induce embryogenesis, without the contribution of paternal genetic material to the offspring. Regarding fish, several asexual-sexual complexes have been reported. The asexual North American leuciscid Phoxinus eos-neogaeus is the result of interspecific hybridization between the sexual species P. eos and P. neogaeus (16). In the European Cobitis complex, hybridization between sexual species generated sterile males and asexual triploid females that produce eggs through premeiotic endoreplication (6,17). The asexual Poecilia formosa from the Amazon basin, which forms eggs through achiasmatic meiosis without recombination (18), results from hybridization between two sexual species, P. mexicana and P. latipinna (19). The Iberian minnow Leuciscus alburnoides represents another case of a species resulting from hybridization, this with a complex genetic constitution and exhibiting the coexistence of diploid and triploid forms, as well as gynogenesis and sexual reproduction (20,21). The gibel carp ( Carassius gibelio ), also known as Prussian carp, considered as a subspecies of C. auratus or a member of the C. auratus complex, is a cyprinid fish originating from eastern Eurasia that became invasive in European freshwater ecosystems during the 20th century, due to its high ecological tolerance and adaptive abilities (22,23). Gibel carp exhibits a dual mode of reproduction - sexual reproduction and gynogenesis. The emergence of asexual reproduction in this species is concomitant with a triploidization event (24). The first populations invading the freshwaters of the Czech Republic around 1975 (25) included only triploid asexual females. Fifteen years later, mixed populations composed of triploid asexual females and diploid females and males reproducing sexually appeared. A low proportion of triploid and tetraploid males was also reported (25,26). In Asian populations of C. auratus gibelio (following the taxonomy used by Asian authors), this phenomenon was explained by allogynogenesis, where heterologous sperm sometimes contribute to the phenotype of the offspring (27). Zhou et al. (2000) even reported molecular evidence of sexual reproduction in the asexual females of Chinese populations of C. auratus gibelio . They suggest that homologous sperm insemination of the eggs of asexual females is similar to classical sexual reproduction (the fused nucleus of the zygote undergoes recombination and removes extra maternal chromosomes). However, there is no empirical evidence of the capacity of sexual reproduction in the asexual form of C. gibelio distributed across Europe. The coexistence of the two reproduction forms in C. gibelio might be a unique case of the switch from a unisexual species to a partly sexual species. Several mechanisms have been proposed to explain the coexistence of asexual and sexual individuals. Firstly, because asexual reproduction is associated with reduced genetic diversity, parasitism is supposed to play an important role in the maintenance of sexual reproduction (28,29). Clonally reproducing females of C. gibelio suffer from higher parasite loads when compared to the genetically variable sexual form. Sexual selection increases the variability of immune genes. Sexual diploids show higher genetic diversity in immune genes than asexual triploids, in accordance with the Red Queen hypothesis (29). The coexistence of the two reproduction forms in fish may also be facilitated by other ecological processes, such as male discrimination against asexual females (30), the generation of sexual individuals from asexual females (31), the differential competitive abilities of asexuals and sexuals (32), and the occupation of different ecological niches (33). While asexual reproduction allows for a quick clonal multiplication of individuals in stable environments (34), sexual reproduction favors genetic diversity, heterozygosity, and DNA repair, and hence adaptation to changing environments. Moreover, the necessity of asexual forms to coexist with sexual forms is directly related to gynogenesis, which requires males of conspecifics or close species in the same habitats for egg activation. C. gibelio represents a unique example of a species where sexual and asexual forms coexist (28). Hence, this species constitutes an object of study to elucidate the evolution of sexuality and asexuality in animals, and the mechanisms responsible for the stable coexistence of sexual and asexual individuals. Furthermore, the origin of C. gibelio is still in question. Yuan et al. (2010), focusing on hox genes, suggested the potential hybrid origin of triploid asexual C. gibelio from C. auratus and C. carpio . However, C. gibelio could also arise from autopolyploidization within the evolutionary branch of the C. auratus complex, leading to triploid asexual females (35,36). Understanding the role of polyploidization in the origin of C. gibelio , and the extent of the genomic contribution of C. carpio and C. auratus to C. gibelio , could provide a better understanding of the evolution of asexual and sexual reproduction in C. gibelio . Here, the molecular mechanisms associated with reproduction in C. gibelio were analysed to study the coexistence of asexual and sexual forms. In particular, the expression of reproduction-related genes was expected to differ between asexual and sexual females, since meiosis-related genes are not important for asexually reproducing individuals. To test this hypothesis, transcriptome profile analyses of gonadal tissues (ovaries) from asexual females and sexual females of C. gibelio were performed. In addition, the transcriptomes of the closely-associated species C. carpio and C. auratus were also analysed, with a particular emphasis on the genes contributing to sexual reproduction. Material and methods Fish tissue sampling Asexual and sexual C. gibelio were obtained from artificial breeding. Asexual females were obtained by induced embryogenesis using sperm of C. carpio . The sexual specimens were obtained from the interbreeding of sexual specimens. The fish were reared in aquarium conditions until the age of four years and subsequently their gonadal tissues were sampled (the age of the examined fish corresponded to 4+). Cyprinus carpio and Carassius auratus were obtained from external breeding facilities. Fish were euthanized using physical stunning through a blow to the skull with a blunt wooden instrument immediately followed by exsanguination. Four or five biological samples per fish group from a total of 8 fish groups were analysed (females and males of C. gibelio resulting from sexual reproduction, females and temperature-induced males of C. gibelio resulting from gynogenesis, females and males of sexual C. auratus , and females and males of sexual C. carpio ). Gonadal tissues of each fish specimen were individually submerged in Ambion RNAlater stabilization solution (Thermo Fisher Scientific). Tubes with tissues were stored at -80ºC until the isolation of total RNA. RNA extraction and library preparation Total RNA was isolated from the gonad tissue of each fish specimen. For extraction, PureLink® RNA Mini Kit (Ambion) with Trizol reagent (Thermo Fisher Scientific) and on-column PureLink DNase treatment were used according to the manufacturer´s protocol. Reagent and buffer volumes were adjusted according to the weight of tissue entering the isolation process (30 mg on average). The final elution was performed using 100 µl of RNAse-free water in the first step and the primal eluate in the second step. The yield and concentration of RNA isolates were checked using a QubitTM 4 fluorometer (Invitrogen by Thermo Fisher Scientific) and Qubit RNA HS Assay Kit (Thermo Fisher Scientific). The quality and integrity of RNA were analysed using RNA 6000 Nano Kit on a 2100 Bioanalyser instrument (Agilent Technologies). All RNA isolates were normalized by dilution at a uniform concentration of 20 ng/µl with RNase-free water. They served as templates for DNA library preparation in twice the reaction volume recommended by the manufacturer. All samples (RNA integrity number – RIN > 7) were used for DNA library preparation. 500ng of total RNA was used for mRNA enrichment using the Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Subsequently, NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina®, and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2, New England Biolabs) were used for library preparation, with 11 PCR cycles utilized for PCR enrichment. RNA fragmentation (13 minutes at 94°C) and the size selection conditions (a bead volume of 30 µl and 15 µl for the first and second bead selections, respectively) were further modified in the protocol. The quantification of DNA libraries was performed on a QubitTM 4 fluorometer (Invitrogen by Thermo Fisher Scientific) using Qubit dsDNA HS Assay Kit, and quality and size control were performed on a 2100 Bioanalyser with DNA 1000 Kit (Agilent Technologies). Finally, amplicons were pooled in equimolar amounts. The final concentration of each library in the pool was 10 nM in the pool. Subsequently, NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2, New England Biolabs) together with spike-in RNA were used for cDNA library preparation from total RNA. The quality of prepared cDNA libraries was evaluated using a Qubit fluorometer (Thermo Fisher). The quality of cDNA libraries was visualized by a 2100 Bioanalyser (Agilent), and the libraries were finally sequenced by Macrogen Korea on Illumina HiSeq X (one lane) in a paired-end configuration producing 150 bp long reads. Quality and quantity control steps were carried out by a service company. NGS data analyses A quality check of raw paired-end fastq reads was carried out by FastQC ( 37 ) and their origin was categorized using BioBloomTools v2.3.4 ( 15 ). The Illumina adapters clipping and quality trimming of raw fastq reads were performed using Trimmomatic v0.39 ( 38 ) with settings CROP:250 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:5 MINLEN:35. Trimmed RNA-Seq reads were mapped to the Carassius auratus genome (ASM336829v1) with Ensembl annotation (release 104) using STAR v2.7.3a ( 39 ) as a splice-aware short read aligner and default parameters except for --outFilterMismatchNoverLmax 0.1 and --twopassMode Basic. Quality control after alignment concerning the number and percentage of uniquely- and multi-mapped reads, rRNA contamination, mapped regions, read coverage distribution, strand specificity, gene biotypes, and PCR duplication was performed using several tools – namely, RSeQC v4.0.0 ( 40 ), Picard toolkit v2.25.6 ( 41 ), and Qualimap v.2.2.2 ( 42 ). All statistics were processed by MultiQC v1.10.1 ( 43 ). SNP clustering analysis The genomic sequences of all collected samples were aligned to the Carassius auratus reference genome (SM336829v1-104) utilizing the Burrows-Wheeler Aligner (BWA) software ( 44 ). Post alignment and germline variants were called using Strelka2 variant calling software ( 45 ), generating variant calls in VCF format which were further filtered to retain only high-confidence variants. These variants were then annotated using the reference Gene Transfer Format (GTF) file for Carassius auratus (ASM336829v1-104). Subsequent data processing was carried out in R, where the variant tables were further refined and merged with sample information. A series of filtering steps were performed to ensure only variants with sufficient coverage and sample counts were retained for analysis. The filtered variant table was then reorganized and formatted for subsequent comparative analyses. Variants located on sex chromosomes were excluded for certain analyses to ensure accurate cross-species comparisons. The data were then restructured to compare SNP identity across species, generating similarity matrices and Venn diagrams to visualize the overlap of SNPs by species and ploidy levels. Differential expression analysis and pathway enrichment analysis Appropriate bioinformatics tools were used for the processing of raw sequencing data. The genome of C. auratus was used as reference. The differential gene expression was calculated on the basis of the gene counts produced using featureCounts from the Subread package v2.0 ( 46 ) and further analysed by Bioconductor package DESeq2 v1.34.0 ( 47 ). Data generated by DESeq2 with independent filtering were selected for differential gene expression analysis to avoid potential false positive results. Differences in gene expression were considered significant on the basis of a cut-off of the adjusted p-value ≤ 0.05. GO term enrichment was analysed using David ( 48 ) to retrieve Gene Ontology terms in the Biological process, Cellular Component and Molecular function categories, as well as KEGG pathways ( 49 , 50 ). Graphical representations of the GO enrichment were realized using R ( 51 ) and Revigo ( 52 ). Reproduction-associated candidate genes were retrieved using the BlastKoala tool of KEGG ( 49 ), the BioMart tool of Ensembl ( 53 ), and published studies ( 19 , 54 – 56 ). GO terms enrichment was tested using Fisher’s exact test (α = 0.05) with false discovery rate (FDR) correction of the p-value. To interpret the biological functions of the DEGs, their mapping to the Gene Ontology (GO) ( 50 ) and KEGG ( 49 ) databases was performed to analyse pathway enrichment. In each of six fish groups associated with sexual reproduction and asexual males, significantly differently-expressed genes (DEGs) compared to the triploid asexual females of C. gibelio were selected on the basis of the following criteria: Basemean > 10, and a padj value < 0.05,. For KEGG pathway analysis, no filtering based on log2 fold change was applied. Gene functions were investigated using the biological databases Uniprot ( 57 ), KEGG ( 49 ), Zfin ( 58 ) and GeneCards ( 59 ). PCA was performed using the DESeq2 R package ( 47 ). For PCA based on reproduction-associated genes, a set of 208 reproduction genes was selected using the BioMart tool of Ensembl ( 53 ). Gene selection and real-time quantitative PCR Based on the results of an NGS approach and published studies ( 19 , 54 – 56 ), as well as the presence of appropriate GO and KEGG terms, candidate reproduction-associated genes were selected for the further analyses of gene expression. A-tubulin ( A-tub ) was used as a housekeeping gene to normalize variation in the gene expression. The Reference Gene Selection Tool from Bio-Rad CFX Maestro software (Bio-Rad), based on geNorm software principles ( 60 ) with an algorithm to normalize the Cq of each gene against the Cq values of the reference gene, was used. A total of 20 biologically-relevant genes were selected from transcriptomic outputs using published studies, and the expressions of 17 of them were validated by real-time quantitative PCR (qPCR). Three genes were excluded because of the amplification of unspecific products. Primers were designed using Primer Blast ( 61 ) at the exon-exon junction. A summary of the genes analysed, and their primer sequences are presented in Table 1 . Table 1 List of the target genes selected from RNA seq and the housekeeping gene analysed using RT-qPCR, and their respective primer sequences. Gene name Gene description Forward/reverse primers (5'->3') Amplicon size A-TUB Alpha-Tubulin TGCCAACTACGCCCG AGAGGTGAAACCAGAGCC PIWIL2 Piwi-Like Protein 2 TGACACCAACGGTTGCCA 81 CCCCCGTCCAAGAGGT ZPE3L2 Zona Pellucida Sperm-Binding Protein 3-Like TTCTTTGCCAATGGGTGGCT 92 TCCCACTGAAAACACCTTCCT RASA1B Ras Gtpase-Activating Protein 1 GGTTGTGGGTGACGAATGTC 97 CCATGAAACCAGGCTTTCCC HRASAL Gtpase Hras TCCGGGGAATCAGAGGTTGA 136 GGGGTCGTATTCGTCCACAA ZP3EL1 Zona Pellucida Sperm-Binding Protein 3-Like TCTCTGCTAATGGTTGGGTGT 129 CTGGTCACTTCCTCTTCGGT SPO11 SPO11, Initiator of Meiotic Double Stranded Breaks AGTACGGCTCACGGTCTCTG 117 TAAGCGTTTCCTCTGGGACTC SYCE1 Synaptonemal Complex Central Element Protein 1 CCCTACAGTTGGAGGGTACA 107 GTTCTGCTCAAGCTGCCTTTG C1ORF146 Chromosome 31 C1orf146 Homolog CAAGCCCCAGTCTACGGAAA 141 GGTTTACTTGTGGCCTTCGC SPINBZL Spindlin-Z-Like AAGAGCTCTCACAAGCACAAA 136 CTTGGACTAGTACGGTCCCC CAMSAP2A Calmodulin-Regulated Spectrin-Associated Protein 2 CCCAGACACCCGAAAAACAC 137 TCTTCTGGAACACTGTCTGTACC DMRT2A Doublesex- And Mab-3-Related Transcription Factor 2 AGCAAGCGACAGAGGACAAA 91 GTTGATGGACGAATGTGCCG NCOA2L Nuclear Receptor Coactivator 2 TTGCTGCTGAGTAATAACGACTG 141 TTTCCCCGACAGCACTCATC RNF212 Ring Finger Protein 212 CTTCGTGTCTCCTGGTCCTG 115 CAGACACCCTGTTTTCCTCTCT SOX8L Transcription Factor SOX-8 CAACAGCTCCACGGTGCTCA 112 TGGTGTTATCCGATGCACGC ALDH1A3 Aldehyde Dehydrogenase 1 A3 GAAAACCATGCCAGTCGATGA 141 GTGTTCCCGCAGGCCAAA CALM3A Calmodulin 3a TAGACACGTTTATCGCACGGG 83 AACGCCTCCTTGAACTCAGC BUC Bucky Ball GGACCTCAGGATCAAGGGAG 106 CTTCGTGGCCTTTGTTGGTG Table 1 Reverse transcription following total RNA extraction from preserved samples of gonadal tissues stored in RNAlater was performed using High-Capacity RNA-to-cDNA Kit (Applied Biosystems by Thermo Fisher Scientific) according to the manufacturer’s instructions. The suitability of primers, their optimal annealing temperatures and amplicon lengths, and the specificity of the amplification of all selected genes were verified by classical PCR for representative samples of all fish groups. The PCR reaction mix (10 ul) contained 5 µl of prepared cDNA, 1 x Taq Buffer with (NH4) 2 SO 4 , 1.5 mM MgCl 2 , 200 µM of each dNTP, 0.4 µM of forward and reverse primers (Table 1 ), 1 U of Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and nuclease-free water. PCR was run under the following conditions: initial denaturation at 95˚C for 4 min; 30 cycles of 95˚C for 30 s, an optimization gradient of 40–65˚C for 30 s, 72˚C for 45 s; and a final amplification at 72˚C for 10 min. At least 5 samples from each fish group were used for the test. Three replicates for each sample were included in the qPCR analysis. Real-time qPCR was performed using the LightCycler 480 II Real-Time PCR System (Roche Diagnostics) and LightCycler 480 SYBR Green I Master chemistry (Roche). The reaction mixture (final volume 20 µl) consisted of 10 µl of 2x SYBR Green I Master, 1 µl of each primer, 3 µl of dd H 2 O, and 5 µl of cDNA template. To test the reaction efficiency and to obtain the standard amplification curve, templates were prepared by means of six serial decimal dilutions of the cDNA of representatives of each fish group. Reactions were run on a LightCycler 480 Instrument II under the following conditions: 95˚C for 5 min; 45 cycles of 95˚C for 10 s, 55˚C for 10 s, and 72˚C for 10 s; melt curve 55˚C → 95˚C (increment 0.5˚C)/5 s. In each run plate, together with samples run in triplicates, one negative control, in which RNase/DNase-free water was used instead of the cDNA and A-tub as the reference gene, was analysed. LightCycler 480 software 1.5.1 was used for analyses of qPCR outputs. The relative expression value of the differentially expressed target gene – the normalized expression – was computed using the ΔΔCq method. Differences in gene expression between sexual and asexual females were statistically evaluated. The sequences of the primers used in this analysis are listed in Table 1 . Results Next generation sequencing and assembly and SNPs analysis of C. gibelio The sequencing of four to five diploid males and females from C. gibelio , C. auratus and C. carpio , and triploid females and males of C. gibelio yielded from 8M to 17M raw reads per individual ( Additional file 1 ). The number of mapped reads varied between 5M and 12M. Across individual samples, from 51–83% of reads were uniquely mapped, and from 12% and 22% of reads were multimapped. A total of 857,874 SNPs were identified in the transcriptomes of the eight fish groups (males and females of the three species including both triploid and diploid forms of gibel carp). We analysed the relationships between species using a clustering method based on SNP numbers. This clustering showed that C. gibelio and C. auratus are closely related and that asexual C. gibelio and sexual C. gibelio are conspecific (Fig. 1 A). Specifically, the proportion of SNPs shared between C. gibelio and C. auratus was 2.35 times higher than the proportion of SNPs shared by C. gibelio and C. carpio (Fig. 1 B). However, C. carpio and C. auratus shared only 3555 SNPs. The sexual diploid and asexual triploid individuals of C. gibelio were more similar to each other than to C. auratus or C. carpio and both forms shared a similar number of SNPs with C. auratus (Fig. 1 C). Differential gene expression analysis The transcriptome profiles of the females and males of C. gibelio , C. auratus and C. carpio were analysed (Fig. 2 ). Both reproductive forms – asexual and sexual – were included for C. gibelio . In all cases, the biological replicates of same sex, ploidy level, and species tend to be more similar to each other. Principal component analysis (PCA) based on transcriptome-wide gene expression (Fig. 2 A) showed differences in transcriptome profiles between sexes of the same species, these separated by PC1, and a similarity between the transcriptome profiles of the asexual females of C. gibelio and the sexual females of C. gibelio and C. auratus . However, even the females of C. auratus were separated from C. gibelio by PC1. Likewise, the transcriptomes of the diploid and triploid males of C. gibelio and C. auratus also tended to be similar to each other. According to the transcriptome profiles, the males and females of C. carpio were separated from the other fish groups by PC2. To compare the expression levels of reproduction-related genes among fish groups, a total of 208 genes related to reproduction were selected. This set of reproductive genes led to a similar grouping of species and sexes, as revealed by all of the transcriptomic data; however, the asexual triploid females C. gibelio were more separated from the sexual ones of by PC2 (Fig. 2 B). The numbers of non-differentially and differentially expressed genes are shown in Table 2 . For all comparisons, the number of upregulated genes in C. gibelio asexual females was higher than the number of downregulated genes or similar to the number of downregulated genes. Comparison of the asexual and sexual females of C. gibelio revealed 1728 differentially expressed genes (DEGs). The numbers of upregulated and downregulated genes are shown in Table 2 . The number of DEGs in asexual C. gibelio females was lower compared to sexual females in every species than compared to males of the same species. The number of DEGs between asexual females of C. gibelio and the females and males of C. auratus was higher, and the number of DEGs compared to the females and males of C. carpio was even higher (Table 2 ). Table 2 Number of non-differentially expressed genes and differentially expressed genes (down- and upregulated) in the triploid asexual females of C. gibelio compared to each of the diploid sexual males and females of C. gibelio , C. auratus and C. carpio . C. gibelio 2n females C. gibelio 2n males C. gibelio 3n males C. auratus 2n females C. auratus 2n males C. carpio 2n females C. carpio 2n males Non-differentially expressed gens 46058 43659 22363 47174 46089 42435 42751 Downregulated genes in asexual females 782 3836 13603 4214 8298 6773 9185 Upregulated genes in asexual females 946 10944 7634 4704 11841 6733 10818 Table 2 GO enrichment analysis The full transcriptomes of the three species were functionally annotated to 3747 GO terms for females and 3755 GO terms for males using BioMart ( 53 ). A total of 3635 were shared by all female lines, and 3721 were shared by all male lines. 30 GO terms identified in asexual females of C. gibelio were not identified in the sexual females of C. gibelio , and 30 GO terms identified in the sexual females were not present in the asexual females of C. gibelio . Three GO terms were identified in diploid males of C. gibelio but not in triploid males, and 3 GO terms were identified in triploid males of C. gibelio but not in diploid males (Fig. 3 ). Transcriptomes of sexual and asexual females were compared and investigated for pathway enrichment using overrepresentation analysis. Of the total of 1728 DEGs, 1471 were successfully annotated to the Gene Ontology (GO) and KEGG databases. A total of 809 were upregulated in asexual females in comparison to sexual females, and 662 downregulated. The significantly enriched GO terms are presented in Fig. 4 . In the biological process category, we identified GO terms associated with gametogenesis and cell cycle control, including egg coat formation (GO:0035803), the binding of sperm to zona pellucida (GO:0007339), the positive regulation of acrosome reaction (GO:2000344), synaptonemal complex assembly (GO:0007130), the negative regulation of nuclear division (GO:0051784), and the negative regulation of cell cycle process (GO:0010948). In the cellular component category, the most enriched terms included egg coat (GO:0035805). In the molecular function category, they included the structural constituent of egg coat (GO:0035804) and calcium ion binding (GO:0005509). The significantly enriched KEGG pathways included oocyte meiosis (caua04114), and cell cycle (caua04110). Meiosis-associated genes To determine whether meiotic pathways are disrupted in asexual females of C. gibelio , we first analysed the differences in expression levels of the meiosis-associated genes between sexual and asexual females following refs ( 54 – 56 , 62 , 63 ). Of the set of 40 meiosis-associated genes, almost all were detected in both asexual and sexual females; however, pms1 was not detected in most sexual and asexual females, and hormad2 was not detected in any sexual or asexual individual. Hence, the meiotic pathways did not appear to be disrupted in asexual females. Seven genes were significantly differently regulated. Spo11, msh2 , pds5b and stag1a displayed higher expression levels in sexual females when compared to asexual females, as well as rec114 , which was close to significance (padj = 0.07). In contrast, rad1 , one rad51b homologue and slc39a1 were significantly more expressed in asexual females. The other meiosis-associated genes, including meiotic nuclear division 1 ( mnd1), dmc1 , the double strand break repair rad1 and several rad51 homologues, did not show significant gene expression differences (Table 3 ). Table 3 List of meiosis-associated genes with their expression levels in sexual and asexual females of C. gibelio . Ensembl ID Gene name Gene description L2fc padj ENSCARG00000016377* spo11 SPO11 initiator of meiotic double stranded breaks -1.75 5.36e-6 ENSCARG00000024429 hormad1 HORMA domain containing 1 0.30 0.22 ENSCARG00000034047 mnd1 Meiotic nuclear division 1 -0.4 0.24 ENSCARG00000050983 mlh1 MutL homolog 1 -0.6 0.61 ENSCARG00000069004 mlh3 MutL homolog 3 -0.1 0.87 ENSCARG00000021963 pms1 PMS homolog 1 -0.33 NA ENSCARG00000010121 pms2 PMS homolog 2 0.02 0.97 ENSCARG00000007723 dmc1 DNA meiotic recombinase 1 -0.38 0.55 ENSCARG00000038661* msh2 MutS homolog 2 -0.85 5.83e-6 ENSCARG00000047192 msh4 MutS homolog 4 0.79 0.52 ENSCARG00000015097 msh5 MutS homolog 5 -0.01 0.99 ENSCARG00000011896 msh6 MutS homolog 6 -0.36 0.18 ENSCARG00000011987* rad1 Rad1 cohesin complex component 1.43 8.11e-6 ENSCARG00000026371 rad21 Rad21 cohesin complex component 0.75 0.37 ENSCARG00000022693 rad50 Rad50 double strand repair protein -0.25 0.70 ENSCARG00000002053 rad51c Rad51 recombinase 0.30 0.85 ENSCARG00000010638* rad51b Rad51 recombinase 0.81 0.03 ENSCARG00000018365 rad51d RAD51 recombinase 0.29 0.35 ENSCARG00000027817 rad51 RAD51 recombinase -0.71 0.55 ENSCARG00000056842 rad51 RAD51 recombinase 0.69 0.63 ENSCARG00000064885 rad51b RAD51 recombinase 0.31 0.69 ENSCARG00000047813 rad51 RAD51 recombinase 0.14 0.92 ENSCARG00000004144 rad51 RAD51 recombinase -0.02 0.96 ENSCARG00000045888 rad52 Rad52 DNA repair protein 0.01 0.96 ENSCARG00000039864 rec8 Rec8 meiotic recombination protein 1.27 0.59 ENSCARG00000032822 rec114 Rec114 meiotic recombination protein -1.4 0.07 ENSCARG00000057676 smc1b Structural maintenance of chromosome 1b 1.02 0.13 ENSCARG00000039472 smc1a Structural maintenance of chromosome 1a -0.11 0.74 ENSCARG00000005430 smc2 Structural maintenance of chromosome 2 -0.24 0.4 ENSCARG00000055515 smc3 Structural maintenance of chromosome 3 -0.21 0.51 ENSCARG00000010356 smc4 Structural maintenance of chromosome 4 0.13 0.90 ENSCARG00000042929 smc5 Structural maintenance of chromosome 5 -0.13 0.75 ENSCARG00000021147 pds5a PDS5 cohesin associated factor B -0.17 0.75 ENSCARG00000017951* pds5b PDS5 cohesin associated factor B -0.98 4.7e-6 ENSCARG00000001906* stag1a Cohesin subunit SA 1A -0.96 0.02 ENSCARG00000022475 stag1b Cohesin subunit SA 1B -0.24 0.47 ENSCARG00000052961 mre11 Double strand break repair nuclease -0.04 0.92 ENSCARG00000018605 hfm1 (mer3) Helicase for meiosis 1 -0.27 0.81 ENSCARG00000053878* slc39a1 Solute carrier family 39A1 0.65 0.04 ENSCARG00000062463 mus81 Crossover junction endonuclease MUS81 0.10 0.77 A positive log2 fold change (l2fc) indicates transcripts that were more abundant in asexual females when compared to sexual females. A negative log2 fold change indicates transcripts that were more abundant in sexual females when compared to asexual females. Asterisks indicate significant difference in expression levels between sexual and asexual females (padj < 0.05). Table 3 Identification of differentially expressed genes in sexual and asexual females of C. gibelio Among the 1728 differentially expressed genes revealed by transcriptome profile analysis, we specifically focussed on the genes related to reproduction pathways revealed by GO and KEGG enrichment analyses and published studies ( 19 , 54 , 56 ). We identified genes that were involved in reproduction pathways including cell cycle control, oocyte meiosis and maturation, and signalling pathways related to reproduction and sex differentiation (Fig. 5 , see Table 4 for the list of the genes and their biological function). Table 4 List of selected differently-expressed genes potentially involved in the reproduction of C. gibelio , including the description of gene function according to the biological databases Uniprot, KEGG, Zfin and GeneCards unless other references are mentioned. Ensembl ID Gene name Gene description Gene function l2fc padj ENSCARG00000024627 acvr2ba Activin receptor 2B Transduces activin signal from cell surface to cytoplasm -1.73 *** ENSCARG00000025713 akt1 RAC-alpha serine/threonine-protein kinase Meiotic maturation (126) 2.06 *** ENSCARG00000012651 bambia BMP and activin membrane bound inhibitor receptor 2 TGF-β signal transduction -2.18 *** ENSCARG00000010645 bcl2 Apoptosis regulator Bcl-2-like Apoptosis regulation and oocyte development 1.73 * ENSCARG00000036539 bmp2b Bone morphogenetic protein 2-like Growth factor involved in diverse cell processes including oocyte maturation 1.41 * ENSCARG00000042808 bmp8a Bone morphogenetic protein 8A-like Growth factor involved in diverse cell processes including oocyte maturation -7.80 *** ENSCARG00000045704 buc Bucky ball Formation of the Balbiani body in the oocyte, establishment of oocyte polarity -2.84 *** ENSCARG00000067925 c1orf146 Chromosome 31 c1orf146 homolog Synaptonemal complex assembly and meiotic recombination 1.15 * ENSCARG00000061657 calm3a Calmodulin 3a Fertilization Ca 2+ -dependant signal transduction pathway -1.07 *** ENSCARG00000004753 camk1gb Calcium/calmodulin-dependent protein kinase Ca 2+ -dependant signal transduction pathway 1.42 * ENSCARG00000025177 camsap2a Calmodulin-regulated spectrin-associated protein 2 Sperm binding protein in males 3.68 *** ENSCARG00000044731 ccna2 Cyclin A2 Cell cycle control 2.44 *** ENSCARG00000066013 ccnb2 Cyclin-B2 Cell cycle control 1.02 ** ENSCARG00000026715 ccnd2a Cyclin D2a Cell cycle control 1.50 ** ENSCARG00000060407 ccnf Cyclin F Cell cycle control 4.68 *** ENSCARG00000058284 cdk14 Cyclin dependant kinase 14 Cell cycle control 1.54 *** ENSCARG00000063775 cdk5rap1 CDK5 regulatory subunit associated protein 1 Cell cycle control 1.12 *** ENSCARG00000030409 clec C-type lectin Cell surface receptor involved in cell communication during egg fertilization -2.73 *** ENSCARG00000046375 clk4 Dual specific protein kinase CLK4 Sex differentiation 1.05 * ENSCARG00000056466 cpeb1a Cytoplasmic polyadenylation element binding Cell proliferation regulation -5.69 *** ENSCARG00000018125 cxcl12a Chemokine ligand 12a Development of oocytes -3.40 ** ENSCARG00000069389 cyp19a1a Cytochrome P450 19 A 1a Ovarian follicle development and female sex determination 1.81 ** ENSCARG00000036303 ddx20 DExD-box helicase 20 Ovarian development and function (127) -1.06 *** ENSCARG00000010183 ddx52 DExD-box helicase 52 Cell cycle control -1.77 *** ENSCARG00000031374 dmrt2a Doublesex and mab3 related transcription factor 2a Female germ cell development and oogenesis (128) 2.22 *** ENSCARG00000062724 dmrta2 Doublesex and mab3-related transcription factor 2 Female germ cell development and oogenesis 2.02 *** ENSCARG00000008338 e2f1 E2F transcription factor 1 Cell cycle control 3.11 *** ENSCARG00000037330 fbxo15 F-box protein 15 Embryonic development 3.60 *** ENSCARG00000050933 fbxo28 F-box only protein 28-like Cell cycle control and substrates degradation in meiosis (129) 1.03 * ENSCARG00000056526 emi1 (fbxo5) F-box protein Regulation of the APC in mitosis and meiosis -7.00 *** ENSCARG00000013439 emi1 (fbxo5) F-box protein Regulation of the APC in mitosis and meiosis -8.26 *** ENSCARG00000018093 emi1 (fbxo5) F-box protein Regulation of the APC in mitosis and meiosis -7.47 *** ENSCARG00000028524 fgf18a Fibroblast growth factor 18 Oocyte nuclear maturation (130) 4.97 *** ENSCARG00000016389 fgf4 Fibroblast growth factor 4 Oocyte differentiation (131) 3.03 *** ENSCARG00000009251 fmnl2a Formin-like 2A Cell division and polarity 4.13 *** ENSCARG00000056928 gadd45ba Growth arrest and DNA damage 45 ba Cell cycle control (132) 1.40 ** ENSCARG00000027726 grapb GRB2-related adapter protein B Oocyte meiosis 2.69 * ENSCARG00000027104 Grb2 Growth factor receptor bound protein 2 Signal transduction, GnRH signalling pathway -0.59 ** ENSCARG00000027108 h2af1o Histone 2A F1o Oocyte-specific histone H2A variant 2.07 ** ENSCARG00000033210 hbegf Heparin binding EGF like growth factor GnRH signalling pathway -0.93 *** ENSCARG00000013938 hrasa Gtpase hras-like Cell division regulation in response to growth factors -1.19 *** ENSCARG00000021215 hsd17b1 Hydroxysteroid 17-beta dehydrogenase 1 Estrogen activation and androgen inactivation 1.23 * ENSCARG00000005210 inha Inhibin Subunit Alpha Ovarian development (133) 1.32 ** ENSCARG00000015712 lbh LBH regulator of WNT signalling pathway Oocyte maturation in Gibel carp -1.58 *** ENSCARG00000017091 lhcgr Luteinizing hormone/choriogonadotropin receptor Gonad development and differentiation -1.64 * ENSCARG00000056775 mad2l2 Mitotic arrest deficient 2 like 2 Spindle assembly checkpoint protein 2.52 *** ENSCARG00000062672 mad2l2 Mitotic arrest deficient 2 like 2 Spindle assembly checkpoint protein 2.36 ** ENSCARG00000025045 mapk8ip3 MAPK 8 interacting protein 3 Involved in FSH signalling pathway 1.67 ** ENSCARG00000019928 mcm5 Minichromosome maintenance complex component 5 Cell cycle regulation -1.44 ** ENSCARG00000048754 mcm9 Minichromosome maintenance complex component 9 Repair of double stranded DNA breaks -1.22 *** ENSCARG00000035099 ncoa2 Nuclear receptor coactivator 2-like Activation of steroid receptors -1.67 *** ENSCARG00000039143 nqo1 NAD(P)H quinone dehydrogenase 1 Cell cycle control (134) -1.29 * ENSCARG00000020971 oxtr Oxytocin receptor Control of reproductive systems 1.72 ** ENSCARG00000004805 piwil2 Piwi-like protein 2 Meiotic differentiation of spermatocytes -1.50 *** ENSCARG00000061907 pkcdb Protein kinase C DB Component of the GnRH signalling pathway (135) 1.44 ** ENSCARG00000028187 pkcba Protein kinase C BA Component of the GnRH signalling pathway (135) 2.68 * ENSCARG00000013369 plcb4 Phospholipase C beta 4 Sperm cell fertilization (136) -2.62 *** ENSCARG00000034226 plcd4b Phospholipase C delta 4b Sperm cell fertilization -1.99 *** ENSCARG00000049505 pld4 Phospholipase D family member 4 GnRH signalling pathway 1.91 * ENSCARG00000044904 plxnb1a Plexin-B1-like Follicular development (137) 1.73 ** ENSCARG00000011987 rad1 Rad1 cohesin complex component Cell cycle checkpoint protein 1.43 *** ENSCARG00000036380 rasa1a Ras GTPase-activating protein 1-like Cell division regulation in response to growth factors -1.20 * ENSCARG00000013635 rasa1b Ras GTPase-activating protein 1-like Cell division regulation in response to growth factors -1.49 *** ENSCARG00000053044 rasl11b Ras-like protein family member 11B Sexual reproduction 2.15 * ENSCARG00000014802 rassf7b Ras association domain-containing protein 7-like Cell cycle control -8.71 *** ENSCARG00000012505 rbpms2b RNA-binding protein with multiple splicing 2-like Ovarian development (138) -1.09 *** ENSCARG00000019039 rfc3 Replication factor C3 Cell cycle progression (139) 0.97 * ENSCARG00000045179 rfc4 Replication factor C4 Cell cycle progression -1.03 * ENSCARG00000022178 rnf212 Ring finger protein 212 Meiotic recombination 5.34 *** ENSCARG00000006237 sbk3 Serine/threonine-protein kinase Female meiosis chromosome segregation -7.64 *** ENSCARG00000044509 setd7 SET domain containing 7 Sex differentiation -2.09 *** ENSCARG00000018258 smad2 Mothers against decapentaplegic homolog 2 TGF-β signalling pathway -1.18 *** ENSCARG00000064397 smad6a Mothers against decapentaplegic homolog 6-like TGF-β signalling pathway -1.60 ** ENSCARG00000058624 sox8a SRY-box transcription factor 8a Male sex determination 3.88 *** ENSCARG00000007149 spag1a Sperm-associated antigen 1A-like Sperm cell fertilization -2.39 *** ENSCARG00000000918 spinb Spindlin-Z-like Gametogenesis 1.36 *** ENSCARG00000017015 spinw Spindlin-W-like Gametogenesis -1.28 ** ENSCARG00000016377 spo11 SPO11 initiator of meiotic double stranded breaks Meiotic recombination -1.75 *** ENSCARG00000001906 stag1a Cohesin subunit STAG1A Sister chromatid cohesion complex -0.97 ** ENSCARG00000007335 stk32c Serine/threonine-protein kinase 32C Regulation of meiosis -1.39 *** ENSCARG00000018451 syce1 Synaptonemal complex element 1 Part of the synaptonemal complex -1.56 *** ENSCARG00000041319 tgfb1a Transforming growth factor beta-1-like Diverse pathways including gonadal growth 5.97 *** ENSCARG00000003682 tgfb1a Transforming growth factor beta-1-like Diverse pathways including gonadal growth 5.78 *** ENSCARG00000049821 uhrf1 Ubiquitin-like containing PHD and RING finger domain 1 Cell cycle control, epigenetic regulation 2.32 *** ENSCARG00000031722 wnt5b Wnt-5B Ovarian development 2.72 *** ENSCARG00000042293 wnt7bb Protein Wnt-7b-like Ovarian development 3.38 *** ENSCARG00000029293 zp3el Zona Pellucida Sperm-Binding Protein 3-Like Sperm binding glycoprotein of the egg coat 1.76 *** ENSCARG00000015906 zp3el Zona Pellucida Sperm-Binding Protein 3-Like Sperm binding glycoprotein of the egg coat 1.39 *** ENSCARG00000007183 zpel3 Zona Pellucida Sperm-Binding Protein 3-Like Sperm binding glycoprotein of the egg coat -1.08 ** ENSCARG00000042829 zpel3 Zona Pellucida Sperm-Binding Protein 3-Like Sperm binding glycoprotein of the egg coat -1.76 *** ENSCARG00000054343 sgo Shugoshin 1 Chromosome cohesion during cell division -0.68 *** ENSCARG00000000832 plkk1 Serine/threonine-protein kinase 10-like Cell cycle control and meiosis regulation -1.69 ** ENSCARG00000055958 ccnd3 Cyclin D3 Cell cycle control -1.03 ** ENSCARG00000038200 fmnl1a Formin-like 1A Cell division and polarity 2.27 *** ENSCARG00000032499 aurka (= eg2) Aurora kinase A Cell cycle control, spindle assembly during chromosome segregation 0.91 ** ENSCARG00000058511 pp1 Ser/thr-protein phosphatase PP1 catalytic subunit Oocyte meiosis -0.66 *** ENSCARG00000005591 cdc20 Cell division cycle protein 20 Cell cycle and meiosis regulation 0.69 * ENSCARG00000030662 cdc25 Cell division cycle protein 25 Cell cycle and meiosis regulation -0.65 ** ENSCARG00000064615 fzr1b Fizzy and cell division cycle 20 related 1 Cell cycle and meiosis regulation -0.56 * ENSCARG00000002809 creb (= atf4b) cAMP-dependent transcription factor ATF-4 GnRH signaling pathway -0.82 *** ENSCARG00000022063 acvr1 Activin receptor 1 TGF-B signaling pathway -0.74 * ENSCARG00000045643 fk Delta14-sterol reductase Steroid biosynthesis 1.89 * ENSCARG00000066569 ste1 (= sc5d) Lathosterol oxidase-like Steroid biosynthesis 1.21 ** ENSCARG00000063352 erg3 Sterol desaturase Steroid biosynthesis 1.22 ** ENSCARG00000040844 hyd1 Cholestenol Delta-isomerase Steroid biosynthesis -1.21 * ENSCARG00000069123 cyp27b1 Cytochrome P450 27 b 1 Steroid biosynthesis -2.09 *** ENSCARG00000018413 hsd3b Beta-hydroxy-Delta5-steroid dehydrogenase Steroid biosynthesis 3.03 *** A positive log2 fold change indicates transcripts that were more abundant in asexual females when compared to sexual females. A negative log2 fold change indicates transcripts that were more abundant in sexual females when compared to asexual females. Abbreviations: APC: anaphase promoting complex, BMP: bone morphogenic protein, CDK: cyclin dependant kinase, GnRH: gonadotropin releasing hormone, TGF: transforming growth factor. Asterisks indicate statistically significant differences between sexual and asexual females of C. gibelio based on padj value: *padj < 0.05, **padj < 0.01, ***padj < 0.001. Table 4 Asexual females retained detectable expressions of all the reproduction-associated genes identified. However, several genes involved in cell cycle control were differently expressed between asexual and sexual females. Asexual females upregulated genes of the Cyclin family, such as ccna2, ccnb2 , ccnd2a and ccnf as well as cdk14 , a member of the cyclin dependant kinase family ( Additional file 2 ). They also upregulated growth arrest and DNA damage protein 45 alpha B ( gadd45ab ), the activator e2f1 , mitotic arrest deficient 2 like 2 ( mad2l2 ), ring finger 212 ( rnf212 ), aurora kinase a ( aurora a), cell division cycle protein 20 (cdc20) , the apoptosis regulator bcl2 , serine threonine kinase 1 ( akt1) , and cdk5rap1 , which encodes the CDK5 regulatory-subunit-associated protein 1 (see Table 4 for their functions). Members of the formin family, fmnl1a and fmnl2a , were also upregulated in asexual females, as well as the spindlin spinb , while spinw was downregulated. Sexual females also upregulated two genes encoding ATP-dependant RNA helicases, ddx20 and ddx52 ; as well as nqo1 , which encodes the NAD(P)H quinone dehydrogenase 1; rassf7b , which encodes the ras-associated domain-containing protein 7b; and stag1a , which encodes a cohesin subunit. Sexual females upregulated genes involved in oocyte meiosis such as shugoshin 1 (sgo1) ; serine/threonine kinase 10 ( plkk1 ); phosphatase 1 (pp1 ); serine/threonine-protein kinase 32C ( stk32c ); cytoplasmic polyadenylation element binging ( cpeb ); syce1 , which encodes a protein of the synaptonemal complex that forms between homologous chromosomes during meiosis; and several gene copies of early mitotic inhibitor 1 (emi1 , also known as fbxo5) ( Additional file 3 , Table 4 ). They also upregulated genes involved in DNA mismatch repair, including rfc4 (replication factor C subunit 4 ) and genes that encode components of the minichromosome maintenance protein complex, mcm5 and mcm9 . Inversely, asexual females upregulated C1orf146 , involved in synaptonemal complex assembly. Concerning oocyte maturation pathways ( Additional file 4 ), sexual females upregulated bucky ball ( buc ), cell division cycle protein 25 (cdc25) , fizzy-related protein homolog 1b (fzr1b) , phospholipases cb4 and cd4 ( plcb4 and plcd4) , and several gene copies of zona-pellucida sperm-binding protein 3 ( zp3el ) (Table 4 ). On the other hand, asexual females upregulated h2af1 , which encodes an oocyte-specific histone, and uhrf1 , which encodes the oocyte specific cell cycle regulator E3 ubiquitin ligase. Members of the fibroblast growth factor ( fgf ) family were also upregulated. Several egg fertilization-related genes were differently regulated. Calmodulin 3a ( calm3a) , spag1a (sperm-associated antigen 1a-like ), and clec , which encodes a C-type lectin, were upregulated in sexual females ( Additional file 3 ). Camk1gb , which encodes a calcium/calmodulin-dependent protein kinase, and calmodulin-regulated spectrin-associated protein 2 (camsap2a) were upregulated in asexual females (Table 4 ). Genes involved in signalling pathways were also differentially regulated. Sexual females upregulated genes involved in the gonadotropin releasing hormone (GnRH) signalling pathway, which is important for female sexual differentiation ( Additional file 5) , such as creb , heparin-binding egf-like growth factor (hbegf ), growth factor receptor-bound protein 2 (grb2 ), rbpms2b , involved in ovarian development, and members of the Ras/MAPK family, specifically, hrasa, hrasb and rasa1b , as well as limb bud-heart (lbh) , bmp8 and bambia (Table 4 ). Asexual females upregulated pkc ; phospholipase d4b (pld4b); mapk8ip3 , involved in the FSH signalling pathway; the protein-kinase encoding gene clk4 ; plexin b1a ; bmp2b ; and members of the wnt family ( wnt5 and 7 ); as well as fbxo15 and fbxo28 , two members of the fbxo family (F-box with uncharacterized domains). Furthermore, components of the TGF-β (transforming growth factor) signalling pathway were differently regulated. Tgf-β 1a was upregulated in sexual females, while the activin receptors acvr1 and acvr2ba, bmp and activin membrane bound inhibitor activin receptor 2 ( bambia ), the receptor regulated mothers against decapentaplegic homolog ( smad2 ) and the inhibitory smad6 were downregulated ( Additional file 6 ). KEGG analysis identified DEGs involved in hormonal systems. Asexual females upregulated cyp19a1a , the doublesex and mab3 related transcription factors dmrta2 and dmrt2a , the sry-box transcription factor sox8a , inhibin alpha ( inha) , and oxtr , encoding the oxytocin receptor (Table 4 ). Sexual females upregulated piwil2 , c-x-c motif chemokine 12 ( cxcl12) , nuclear receptor coactivator 2 ( ncoa2) , and luteinizing hormone/choriogonadotropin receptor (lhcgr) . Several genes related to steroid biosynthesis were also found to be differently regulated between asexual and sexual females ( Additional file 7 ). Asexual females upregulated delta14-sterol reductase ( fk) ; lathosterol oxidase-like (ste1) ; 17beta-estradiol 17-dehydrogenase (hsd17b1 , 1.1.1.62); β-hydroxy-δ5-steroid dehydrogenase ( Hsd3b ); and genes encoding a glucuronosyltransferase (EC 2.4.1.17), a squalene synthase (EC 2.5.1.21), a delta14-sterol reductase (1.3.1.70), a sterol desaturase ( erg3 ), and a lathosterol oxidase (EC 1.14.19.20). They downregulated hyd1 , which encodes a cholestenol delta isomerase; the cytochrome P450 family member cyp27b1 (EC 1.14.15.18); and genes encoding a cholestenone-5-alpha-reductase (EC 1.3.1.22), a cholestenol delta-isomerase (EC 5.3.3.5), and a cholesterase (EC 3.1.1.13) ( Additional file 7 ). Validation of gene expression resulting from RNAseq by RT-qPCR To validate the DEGs revealed by RNAseq, we performed RT-qPCR for 17 selected genes involved in reproduction that were significantly up- or downregulated in asexual females of C. gibelio compared to sexual females (Table 1 ). The RT-qPCR analysis confirmed the downregulation of 10 and upregulation of 7 reproduction-associated genes (Fig. 6 ). There was a positive correlation between the log2 fold change of RNAseq and the log2 fold change of qPCR (r = 0.89, p < 0.001) ( Additional file 8 ). Discussion The present study analysed the transcriptome profiles of gonadal tissues from C. gibelio using RNA-seq, specifically to identify DEGs in ovaries associated with reproduction in triploid gynogenetic females and diploid sexual females. We also analysed the transcriptome profiles of ovaries and testes in males of C. gibelio , and the two closely-related species C. auratus and C. carpio . A total of 1728 genes were significantly upregulated or downregulated in asexual females of C. gibelio compared to sexual females. The transcriptome profiles based on normalized RNAseq read counts showed a sex-dependant difference for both - all transcribed genes or reproduction-associated genes, with an overall similarity between gynogenetic and sexual females of C. gibelio and females of C. auratus , and an overall similarity between the males of the two Carassius species. GO term overrepresentation analyses and KEGG pathway enrichment analyses indicated an overall overexpression of genes involved in meiosis and cell cycle control (cell cycle, negative regulation of nuclear division, negative regulation of cell cycle process, oocyte meiosis, and synaptonemal complex assembly), oocyte maturation (egg coat formation, structural constituent of egg coat, and calcium ion binding) and fertilization (binding of sperm to zona pellucida, positive regulation of acrosome reaction). Calcium ion binding, which plays critical roles in fertilization and early development (for review, see Whitaker ( 67 )), was also overrepresented in sexual females. This suggests that the regulation of oogenesis, as well as the response of oocytes to sperm cell binding, differ between sexual reproduction and gynogenesis, where the eggs are only activated by the sperm cell (for review, see Schlupp ( 68 )). An overall downregulation of meiotic and reproduction-associated genes was also reported in Poecilia formosa , a gynogenetic fish species of the Amazon basin, compared to its sexual parental ancestors, P. mexicana and P. latipinna ( 19 ). Similar results were reported in invertebrates that use cyclical parthenogenesis, such as the planktonic crustacean Daphnia , rotifers, and aphids, where the sexual forms upregulate genes involved in cell cycle control, meiosis, oogenesis, and oocyte maturation ( 69 – 72 ). On the basis of ovarian transcriptome profiles, we identified around 100 reproduction-associated genes related to oocyte meiosis, oogenesis, embryogenesis, hormone signalling, and fertilization that were differently expressed between sexual and gynogenetic females; the expression pattern of a set of 17 selected genes based on the basis of RNAseq was validated by RT-qPCR. We also specifically analysed 40 meiosis-related genes inferred by previous studies ( 54 – 56 , 62 , 63 ). We showed that sexual females upregulated several meiosis-associated genes involved in recombination and crossover and in DNA double-strand break formation during meiosis, including spo11, msh2 , pds5b , sbk3 , stag1a , and rec114 . Two components of the minichromosome complex ( mcm4 and mcm9 ), involved in crossover inhibition during meiosis ( 73 ), as well as syce1 , a component of the synaptonemal complex that forms between homologous chromosomes during recombination, were also upregulated in sexual females ( 74 – 76 ). Sexual females also upregulated genes involved in oocyte maturation, such as emi1 (also named fbxo5 ), a major F-box constituent of the E3 ubiquitin ligase protein that regulates the anaphase promoting complex (APC) during meiosis and mitosis ( 77 – 80 ); and spinw , a major maternal transcript expressed in oocytes during early development. The importance of spindlin in oocytes to embryo transition in C. gibelio has been established ( 81 ). Furthermore, several genes involved in cell cycle regulation, including three members of the Ras/MAPK family, hrasa, hrasb and rasa1b , which encode GTPases controlling cell growth, division, and differentiation ( 82 – 85 ) through the action of mitogen activated protein kinases ( 86 ), were also more expressed in sexual females. This suggests that cell cycle control regulation differs between sexual and gynogenetic females of C. gibelio . In accordance with our results, gynogenetic P. formosa was shown to underexpress meiosis-related genes, including sbk3, setd7 and stk32c , compared to its supposed sexual ancestors ( 19 ). Similarly, in cyclically parthenogenetic Daphnia , meiosis-related genes, including genes related to the spindle assembly checkpoint, the APC, and meiosis chromosome segregation, were upregulated during sexual reproduction ( 71 ). In particular, spo11 , which encodes a topoisomerase involved in chromosomal recombination during the meiotic prophase, was also described as an important player in the meiosis-to-parthenogenesis transition in pea aphid ( 87 ), although it was not reported in asexual P. formosa ( 19 ). However, our study also revealed that meiosis pathways were not fully disrupted in gynogenetic females of C. gibelio . They retained detectable expressions of all reproduction-associated genes identified, including meiosis-specific genes, in contrast to P. formosa , where some meiosis-related genes were not expressed ( 19 ). According to our analyses, several of the core meiosis specific genes, such as dmc1, mlh1, mnd1, mre11 and genes of the msh family ( 55 , 55 , 56 , 62 , 63 ), did not show significant differences in expression between sexual and gynogenetic females of gibel carp. Gynogenetic females even upregulated rad1 , a member of the cell cycle checkpoint, also involved in the recombination process during meiosis; rnf212 , involved in meiotic recombination; and mad2l2 , involved in the spindle assembly checkpoint; as well as meiosis-specific genes that were previously found to be downregulated in gynogenetic P. formosa , such as b4galt, clk4, dmrta2, grapb , and rasl11b ( 19 ). However, these results are in accordance with a study suggesting that meiosis is retained even in gynogenetic strains of C. gibelio in North-east Asia ( 88 ). Furthermore, meiosis genes were reported not to be necessarily associated with sexual reproduction, since asexual amoeba constitutively expressed meiosis-associated genes ( 54 ). Similar results were reported also in rotifers, where no meiosis-specific genes were differently expressed between parthenogenetic and sexual forms ( 70 ), and cyclically-parthenogenetic Daphnia , which was shown to express meiosis-specific genes during the parthenogenetic phase ( 89 ). In the pea aphid, several oogenesis and cell cycle-related genes were also upregulated during the asexual reproduction phase ( 69 ). Our results reveal an overall upregulation of pathways related to oocyte maturation in sexual females. They upregulated buc , involved in the formation of Balbiani bodies in the oocytes and germ plasm assembly, including follicular epithelium morphogenesis ( 90 ). This gene plays a key role in the specification of oocyte anterior/posterior polarity through interactions with the RNA-binding proteins, such as rbpms2 , a coactivator of transcriptional activity involved in meiosis and oogenesis ( 91 ). Sexual females of C. gibelio also upregulate genes involved in progesterone-mediated oocyte maturation, such as members of the plexin and Wnt families. The Wnt pathway regulator lbh , previously reported to be upregulated in females during oocyte maturation in C. gibeli o, was also more expressed in sexual females in our study. Similarly, in aphids, genes involved in oocyte axis formation were found to be upregulated during the sexual phase ( 72 ). Furthermore, our analyses support an overall upregulation of sperm-egg recognition and fertilization pathways in sexual females. They upregulated calm3a , a member of the calmodulin family responsible for calcium-dependant signal transduction following sperm binding, as well as plcb4 , a phospholipase involved in oocyte fertilization ( 92 ). In addition, sexual females upregulated components of the zona pellucida, the extracellular matrix surrounding the oocyte involved in sperm-egg recognition ( 93 ). A gene encoding a Ca 2+ -dependant C-type lectin, which was shown to be translocated in cortical granules during oocyte maturation and involved in sperm-egg recognition and fertilization in C. gibelio ( 94 ), was also significantly upregulated in sexual females. These findings highlight the importance of oocyte maturation, sperm-egg recognition, and fertilization pathways in the coexistence of sexual and asexual females. Inversely, some genes involved in oocyte development, such as DAZ-like genes, were not differentially expressed between gynogenetic and sexual females of gibel carp in our study, while others, including bcl2 ; the oocyte specific histone h2af1o , which plays a key role in fish embryogenesis ( 95 ); and several members of the FGF family, which promote meiosis and maturation of the oocytes ( 96 ), were even more expressed in asexual females than in sexual ones. Oocyte maturation and sperm cell binding pathways are not expected to be disrupted in asexual females, since they produce oocytes. Furthermore, gynogenetic C. gibelio females still require sperm cell binding to activate the eggs ( 68 , 97 ). The overexpression of some oogenesis-related genes was also reported in aphids during the parthenogenetic phase of their life cycle ( 69 ). Furthermore, the downregulation of uhrf1 , an oocyte-specific epigenetic regulator ( 98 ) in sexual females of C. gibelio , also reported in aphids ( 69 ), suggests a difference in the epigenetic regulation of oogenesis between sexual and asexual forms. Hence, these results suggest that many genes and pathways are involved in both parthenogenetic oogenesis and sexual oogenesis in C. gibelio . However, gene expression differs between the two reproduction forms. It is noteworthy that members of the same gene family can be up- or downregulated, such as members of the zona pellucida and F-box families. Such divergent expression, also reported in Daphnia ( 71 ), may suggest functional divergence among members of the same multigenic families. Our analyses also suggest differences in hormonal signalling and sex differentiation processes between sexual and gynogenetic reproduction. Components of the GnRH signalling pathway, and genes linked to ovarian fertility, such as the gene encoding the luteinizing hormone/choriogonadotropin receptor (lhcgr) , were more expressed in sexual females. The TGF-β signalling pathway, involved in many physiological processes including sexual differentiation in fish ( 99 – 101 ), was also differently regulated between gynogenetic and sexual females of C. gibelio . Sexual females upregulated smad genes, involved in oogenesis, ovarian function, and folliculogenesis via the negative regulation of TGF-β signalling. Regarding gynogenetic females, they upregulated two dmrt genes. These genes were shown to promote male differentiation and repress female-specific differentiation of the gonads, and they are also involved in brain sexual differentiation ( 64 , 104 , 105 ) as well as in XY reversal in sex-alternating fish species ( 64 ). Gynogenetic females of C. gibelio also upregulated ncoa2 , a transcriptional coactivator of steroid receptors and nuclear receptor, as well as sox8 , involved in female sex determination ( 106 ), meiotic progression, and embryonic development ( 107 ), and inhibin alpha ( inha) , involved in steroid hormone biosynthesis. Ovarian aromatase or estrogen synthetase ( cyp19a1a ), a member of the cytochrome P450 subfamily involved in steroidogenesis ( 108 ) and female folliculogenesis and gonadal differentiation, was also upregulated in gynogenetic females of C. gibelio , as was oxtr , a gene encoding the oxytocin receptor, a component of the oxytocin signalling system that modulates reproductive behaviour. Our results also suggest that sexual females upregulated some genes associated with the steroid hormone synthesis pathway. The hydroxysteroid 17-β-dehydrogenase gene hsd17b1 , which is both estrogenic ( 109 ) and androgenic ( 110 ), was more expressed in gynogenetic females. Furthermore, sexual females also upregulated the germ cell maintenance gene piwil2 , a member of the Argonaute family involved in male fertility ( 111 ). In this study, we also investigated the evolutionary history of C. gibelio . Ploidy changes shaped the evolution of cyprinids, particularly that of the Carassius auratus complex. This complex was formed by allotetraploidization ( 36 , 112 ) and further polyploidization events have been reported in diverse lineages of the complex, including C. auratus and C. gibelio ( 36 , 113 ). However, the evolutionary origin of C. gibelio is still in question. A study based on dmrt genes suggested a recent autopolyploidization event within the C. auratus complex that generated the triploid gynogenetic C. gibelio ( 35 ). However, an origin of C. gibelio by hybridization between C. auratus and C. carpio has also been proposed ( 114 ). Our SNP clustering, based on gonadal transcriptomes, using C. gibelio , C. auratus and C. carpio , suggests a close evolutionary relationship between sexual and gynogenetic C. gibelio , as well as a close relatedness between C. gibelio and C. auratus . This is in accordance with a study showing that two gene copies of four different Hox genes in the genome of gynogenetic C. gibelio are orthologous to the Hox genes of C. auratus and that one is orthologous to the Hox gene of C. carpio ( 114 ). That study suggested that triploid gynogenetic C. gibelio (3n = 15) resulted from interspecific hybridization between diploid C. auratus (2n = 100) and C. carpio (2n = 100), contributing with two sets and one set of chromosomes, respectively. However, the diploid form of C. gibelio was not included in that study. Other studies using mtDNA and hoxa2b gene sequences even suggested a more complex relationship between C. gibelio and C. auratus , where the monophyly of C. gibelio was not supported ( 115 , 116 ). In addition, gene flow was highlighted between the two species ( 88 , 115 ), suggesting that C. gibelio and C. auratus were conspecific and interfertile. Ploidy changes often affect meiosis, and parthenogenetic species usually result from interspecific hybridization ( 8 ) with some exceptions ( 117 ). Polyploidy can lead to the formation of unreduced eggs whose cell cycle is arrested at the metaphase of meiosis II ( 118 ). This results in asexually reproducing species, where the offspring are clones of the mother. Unisexual fish reproduce through gynogenesis, where the sperm from males of the same or closely-related species is still required to activate the egg. Still, because meiosis pathways were not disrupted, a later genetic contribution from a sperm donor such as C. auratus and C. carpio cannot be excluded. Such a case of a complex evolutionary history was reported in the unisexual salamander Ambystoma . However, in this case, the haploid genome of the sperm donor replaced the nuclear genome, a phenomenon known as kleptogenesis ( 119 , 120 ). Our results suggest that all along their evolutionary history, asexual lines of C. gibelio did not lose the genetic toolkit for meiosis, and that the sexual reproduction genetic toolkit is not under relaxed selection, a condition also reported in asexual P. formosa ( 19 ) and snails ( 121 ). The re-acquisition of sexual reproduction in asexual species is very rare and very few cases have been reported. Either some gynogenetic C. gibelio females were able to secondarily regain sexual reproduction and to produce both diploid and triploid males, or a minority of sexual individuals still persisted within the already formed gynogenetic form and became more abundant later ( 56 ). In all cases, this led to the current sympatric coexistence of sexual and gynogenetic individuals ( 26 , 122 ). Polyploidy in general, and triploidy in the case of gynogenetic C. gibelio could possibly compensate the deleterious effects of Muller’s ratchet or the accumulation of deleterious mutations by increasing the number of gene copies and favouring heterozygosity ( 54 ). The genomic incorporation of sperm-derived fragments from an exogenous species, which was reported in gynogenetic C. gibelio from aquaculture in China ( 27 ), can also favor genetic diversity in asexual lines. In C. gibelio , the combination of the advantages of gynogenetic reproduction, which allows for faster population growth ( 23 , 23 ), and sexual reproduction, which provides higher resistance to parasites and higher immune gene variability ( 29 ), higher aerobic performance and better immunity ( 123 ), lower metabolic rate, and lower energy intake ( 124 ), might explain the coexistence of sexual and asexual forms, and the high adaptive abilities of this species and its invasiveness in European water ecosystems. Declarations Acknowledgements We gratefully acknowledge the Bioinformatics Core Facility of CEITEC Masaryk University for providing the transcriptomic data presented in this paper. We also kindly thank Matthew Nicholls for English revision of the final draft. Funding The study was funded by the Czech Science Foundation, Project No. 22-27023S. We declare that the contributions of Kristína Civáňová Křížová and Kristýna Voříšková to this study were strictly associated only with their part-time commitment to project No. 22-27023S and that no institutional resources were provided by the Parasitology Group, Department of Botany and Zoology, Faculty of Science, Masaryk University Brno. Authors’ contributions FJ processed data analyses with the assistance of TT, performed a part of qPCR, and wrote the manuscript. MD performed basic bioinformatics analyses. VB performed SNP analyses. KV performed library preparation. KCK and MS performed a part of qPCR. MHF and FJ performed RNA extraction and quantification. LV performed experimental breeding and fish sampling. AŠ designed and supervised the study and contributed to the interpretation of results and the writing of the manuscript. All authors approved the final version of the manuscript. Data availability The data used in this study have been deposited in NCBI´s Gene Expression Omnibus (125) and are accessible through GEO Series accession number GSE254010 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE254010). Ethics approval and consent to participate The research was undertaken in line with the ethical requirements of the Czech Republic. The maintenance and care of experimental fish, as well as method of fish killing complied with legal requirements in the Czech Republic § 6, 7, 9 and 10 regulation No. 419/2012 about the care, breeding and using experimental animals. The experiment was approved by the Animal Care and Use Committee at the Faculty of Science, Masaryk University in Brno, Czech Republic. The experiment was conducted under the experimental project approved by the Ministry of Education, Sports and Youth under document n. MSMT-30071/2022-5. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Cavalier-smith T. Origins of the machinery of recombination and sex. Heredity. 2002;88(2):125–41. Neaves WB, Baumann P. Unisexual reproduction among vertebrates. Trends Genet. 2011;27(3):81–8. Tobler M, Schlupp I. Parasites in sexual and asexual mollies ( Poecilia , Poeciliidae, Teleostei): a case for the Red Queen? Biol Lett. 2005;1(2):166–8. Dufresne F, Hebert PDN. Hybridization and Origins of Polyploidy. Proc R Soc Lond. 1994;(258):141–6. Hartfield M. On the origin of asexual species by means of hybridization and drift. Mol Ecol. 2016;25(14):3264–5. Janko K, Kotlik P, Rab P. Evolutionary history of asexual hybrid loaches ( Cobitis : Teleostei) inferred from phylogenetic analysis of mitochondrial DNA variation. J Evol Biol. 2003;16(6):1280–7. Xu S, Innes DJ, Lynch M, Cristescu ME. The role of hybridization in the origin and spread of asexuality in Daphnia . Mol Ecol. 2013;22(17):4549–61. Lamatsch DK, Stöck M. Sperm-Dependent Parthenogenesis and Hybridogenesis in Teleost Fishes. In: Schön I, Martens K, Dijk P, editors. Lost Sex [Internet]. Dordrecht: Springer Netherlands; 2009. p. 399–432. Available from: http://link.springer.com/ 10.1007/978-90-481-2770-2_19 . Rothfels CJ, Otto SP. Polyploid Speciation. In: Encyclopedia of Evolutionary Biology [Internet]. Elsevier; 2016. p. 317–26. Available from: https://linkinghub.elsevier.com/retrieve/pii/B9780128000496000731 . Stenberg P, Saura A. Meiosis and Its Deviations in Polyploid Animals. Cytogenet Genome Res. 2013;140(2–4):185–203. Van de Peer Y, Mizrachi E, Marchal K. The evolutionary significance of polyploidy. Nat Rev Genet. 2017;18(7):411–24. Maynard Smith J. The origin and maintenance of sex. 1971. Muller HJ. The relation of recombination to mutational advance. Mutat Res Mol Mech Mutagen. 1964;1(1):2–9. Otto SP. The Evolutionary Enigma of Sex. Am Nat. 2009;174(S1):1–14. JianFang G, Li Z. Genetic basis and breeding application of clonal diversity and dual reproduction modes in polyploid Carassius auratus gibelio . 2010. Angers B, Schlosser IJ. The origin of Phoxinus eos-neogaeus unisexual hybrids: hybridization in Phoxinus . Mol Ecol. 2007;16(21):4562–71. Tichopád T, Franěk R, Doležálková-Kaštánková M, Dedukh D, Marta A, Halačka K, et al. Clonal gametogenesis is triggered by intrinsic stimuli in the hybrid’s germ cells but is dependent on sex differentiation. Biol Reprod. 2022;107(2):446–57. Dedukh D, Da Cruz I, Kneitz S, Marta A, Ormanns J, Tichopád T, et al. Achiasmatic meiosis in the unisexual Amazon molly, Poecilia formosa . Chromosome Res. 2022;30(4):443–57. Schedina IM, Groth D, Schlupp I, Tiedemann R. The gonadal transcriptome of the unisexual Amazon molly Poecilia formosa in comparison to its sexual ancestors, Poecilia mexicana and Poecilia latipinna . BMC Genomics. 2018;19(1):12. Alves MJ, Coelho MM, Collares-Pereira MJ. Evolution in action through hybridisation and polyploidy in an Iberian freshwater fish: a genetic review. Genetica. 2001;(111):375–85. Collares-Pereira MJ, Coelho MM. Reconfirming the hybrid origin and generic status of the Iberian cyprinid complex Squalius alburnoides . J Fish Biol. 2010;76(3):707–15. Hanfling B, Bolton P, Harley M, Carvalho GR. A molecular approach to detect hybridisation between crucian carp ( Carassius carassius ) and non-indigenous carp species ( Carassius spp. and Cyprinus carpio ). Freshw Biol. 2005;50(3):403–17. Fuad MMH, Vetešník L, Šimková A. Is gynogenetic reproduction in gibel carp ( Carassius gibelio ) a major trait responsible for invasiveness? J Vertebr Biol [Internet]. 2021;70(4). Available from: https://bioone.org/journals/journal-of-vertebrate-biology/volume-70/issue-4/jvb.21049/Is-gynogenetic-reproduction-in-gibel-carp-Carassius-gibelio-a-major/ 10.25225/jvb.21049.full . Zhu HP, Ma DM, Gui JF. Triploid origin of the gibel carp as revealed by 5S rDNA localization and chromosome painting. Chromosome Res. 2006;14(7):767–76. Lusková V, Lusk S, Halačka K, Vetešník L. Carassius auratus gibelio— The most successful invasive fish in waters of the Czech Republic. Russ J Biol Invasions. 2010;1(3):176–80. Zhou L, Wang Y, Gui JF. Genetic Evidence for Gonochoristic Reproduction in Gynogenetic Silver Crucian Carp ( Carassius auratus gibelio Bloch) as Revealed by RAPD Assays. J Mol Evol. 2000;51(5):498–506. Chen F, Li XY, Zhou L, Yu P, Wang ZW, Li Z, et al. Stable Genome Incorporation of Sperm-derived DNA Fragments in Gynogenetic Clone of Gibel Carp. Mar Biotechnol. 2020;22(1):54–66. Hakoyama H, Nishimura T, Matsubara N, Iguchi K. Difference in parasite load and nonspecific immune reaction between sexual and gynogenetic forms of Carassius auratus . Biol J Linn Soc. 2001;72(3):401–7. Šimková A, Košař M, Vetešník L, Vyskočilová M. MHC genes and parasitism in Carassius gibelio , a diploid-triploid fish species with dual reproduction strategies. BMC Evol Biol. 2013;13(1):122. Moore WS, McKay FE. Coexistence in Unisexual-Bisexual Species Complexes of Poeciliopsis (Pisces: Poeciliidae). Ecology. 1971;52(5):791–9. Barron JN, Lawson TJ, Jensen PA. Analysis of potential factors allowing coexistence in a sexual/asexual minnow complex. Oecologia. 2016;180(3):707–15. Schley D, Doncaster CP, Sluckin T. Population models of sperm-dependent parthenogenesis. J Theor Biol. 2004;229(4):559–72. Vrijenhoek RC. UNISEXUAL FISH: Model Systems for Studying Ecology and Evolution. 1994;(25):71–96. Barbuti R, Mautner S, Carnevale G, Milazzo P, Rama A, Sturmbauer C. Population dynamics with a mixed type of sexual and asexual reproduction in a fluctuating environment. BMC Evol Biol. 2012;12(1):49. Li XY, Zhang XJ, Li Z, Hong W, Liu W, Zhang J, et al. Evolutionary history of two divergent Dmrt1 genes reveals two rounds of polyploidy origins in gibel carp. Mol Phylogenet Evol. 2014;78:96–104. Luo J, Gao Y, Ma W, Bi X y, Wang S y, Wang J et al. Tempo and mode of recurrent polyploidization in the Carassius auratus species complex (Cypriniformes, Cyprinidae). Heredity. 2014;112(4):415–27. Andrews S. FastQC: a quality control tool for high throughput sequence data. 2010. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21. Wang L, Wang S, Li W. RSeQC: quality control of RNA-seq experiments. Bioinformatics. 2012;28(16):2184–5. Picard Toolkit. [Internet]. Broad Institute. ; 2018. Available from: GitHub Repository. http://broadinstitute.github.io/picard/ ; Broad Institute. Okonechnikov K, Conesa A, García-Alcalde F. Qualimap 2: advanced multi-sample quality control for high-throughput sequencing data. Bioinformatics. 2016;32(2):292–4. Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32(19):3047–8. Li H, Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics. 2009;25(14):1754–60. Kim S, Scheffler K, Halpern AL, Bekritsky MA, Noh E, Källberg M, et al. Strelka2: fast and accurate calling of germline and somatic variants. Nat Methods. 2018;15(8):591–4. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. Sherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022;50(W1):W216–21. Kanehisa M, Furumichi M, Sato Y, Kawashima M, Ishiguro-Watanabe M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023;51(D1):D587–92. The Gene Ontology Consortium, Carbon S, Douglass E, Good BM, Unni DR, Harris NL, et al. The Gene Ontology resource: enriching a GOld mine. Nucleic Acids Res. 2021;49(D1):D325–34. Bonnot T, Gillard M, Nagel D. A Simple Protocol for Informative Visualization of Enriched Gene Ontology Terms. BIO-Protoc [Internet]. 2019;9(22). Available from: https://bio-protocol.org/e3429 . Supek F, Bošnjak M, Škunca N, Šmuc T. REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms. Gibas C, editor. PLoS ONE. 2011;6(7):e21800. Kinsella RJ, Kahari A, Haider S, Zamora J, Proctor G, Spudich G, et al. Ensembl BioMarts: a hub for data retrieval across taxonomic space. Database. 2011;2011(0):bar030–0. Maciver SK. Asexual Amoebae Escape Muller’s Ratchet through Polyploidy. Trends Parasitol. 2016;32(11):855–62. Patil S, Moeys S, Von Dassow P, Huysman MJJ, Mapleson D, De Veylder L, et al. Identification of the meiotic toolkit in diatoms and exploration of meiosis-specific SPO11 and RAD51 homologs in the sexual species Pseudo-nitzschia multistriata and Seminavis robusta . BMC Genomics. 2015;16(1):930. Schurko AM, Logsdon JM. Using a meiosis detection toolkit to investigate ancient asexual scandals and the evolution of sex. BioEssays. 2008;30(6):579–89. Bairoch A. The Universal Protein Resource (UniProt). Nucleic Acids Res. 2004;33(Database issue):D154–9. Bradford YM, Van Slyke CE, Ruzicka L, Singer A, Eagle A, Fashena D et al. Zebrafish information network, the knowledgebase for Danio rerio research. Wood V, editor. Genetics. 2022;220(4):iyac016. Safran M, Dalah I, Alexander J, Rosen N, Iny Stein T, Shmoish M, et al. GeneCards Version 3: the human gene integrator. Database. 2010;2010(0):baq020–0. Vandesompele J, Preter KD, Roy NV, Paepe AD. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):research0034.1-0034.11. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13(1):134. Hillers KJ, Villeneuve AM. Chromosome-Wide Control of Meiotic Crossing over in C. elegans . Curr Biol. 2003;13(18):1641–7. Ramesh M, Malik S, Logsdon J. A Phylogenomic Inventory of Meiotic GenesEvidence for Sex in Giardia and an Early Eukaryotic Origin of Meiosis. Curr Biol. 2005;15(2):185–91. Casado-Navarro R, Serrano-Saiz E. DMRT Transcription Factors in the Control of Nervous System Sexual Differentiation. Front Neuroanat. 2022;16:937596. Kopp A. Dmrt genes in the development and evolution of sexual dimorphism. Trends Genet. 2012;28(4):175–84. Peng W, Xu J, Zhang Y, Feng J, Dong C, Jiang L, et al. An ultra-high density linkage map and QTL mapping for sex and growth-related traits of common carp ( Cyprinus carpio ). Sci Rep. 2016;6(1):26693. Whitaker M. Calcium at Fertilization and in Early Development. Physiol Rev. 2006;86(1):25–88. Schlupp I. The Evolutionary Ecology of Gynogenesis. Annu Rev Ecol Evol Syst. 2005;36(1):399–417. Gallot A, Shigenobu S, Hashiyama T, Jaubert-Possamai S, Tagu D. Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum . BMC Genomics. 2012;13(1):76. Hanson SJ, Stelzer CP, Welch DBM, Logsdon JM. Comparative transcriptome analysis of obligately asexual and cyclically sexual rotifers reveals genes with putative functions in sexual reproduction, dormancy, and asexual egg production. BMC Genomics. 2013;14(1):412. Huynh TV, Hall AS, Xu S. Transcriptomic Signature Cyclical Parthenogenesis. 2023;15(7):1–12. Le Trionnaire G, Wucher V, Tagu D. Genome expression control during the photoperiodic response of aphids: Seasonal photoperodism in aphids. Physiol Entomol. 2013;38(2):117–25. Hartmann M, Kohl KP, Sekelsky J, Hatkevich T. Meiotic MCM Proteins Promote and Inhibit Crossovers During Meiotic Recombination. Genetics. 2019;212:461–8. Costa Y, Speed R, Öllinger R, Alsheimer M, Semple CA, Gautier P, et al. Two novel proteins recruited by synaptonemal complex protein 1 (SYCP1) are at the centre of meiosis. J Cell Sci. 2005;118(12):2755–62. Page SL, Hawley RS. The genetics and molecular biology of the synaptonemal complex. Annu Rev Cell Dev Biol. 2004;20(1):525–58. Takemoto K, Imai Y, Saito K, Kawasaki T, Carlton PM, Ishiguro K, ichiro et al. Sycp2 is essential for synaptonemal complex assembly, early meiotic recombination and homologous pairing in zebrafish spermatocytes. Cohen PE, editor. PLOS Genet. 2020;16(2):e1008640. Miller JJ, Summers MK, Hansen DV, Nachury MV, Lehman NL, Loktev A, et al. Emi1 stably binds and inhibits the anaphase-promoting complex/cyclosome as a pseudosubstrate inhibitor. Genes Dev. 2006;20(17):2410–20. Anitha A, Gupta YR, Deepa S, Ningappa M, Rajanna KB, Senthilkumaran B. Gonadal transcriptome analysis of the common carp, Cyprinus carpio : Identification of differentially expressed genes and SSRs. Gen Comp Endocrinol. 2019;279:67–77. Iwai T, Yoshii A, Yokota T, Sakai C, Hori H, Kanamori A, et al. Structural components of the synaptonemal complex, SYCP1 and SYCP3, in the medaka fish Oryzias latipes . Exp Cell Res. 2006;312(13):2528–37. Page J, Viera A, Parra MT, Fuente RDL, Suja JÁ, Prieto I et al. Involvement of Synaptonemal Complex Proteins in Sex Chromosome Segregation during Marsupial Male Meiosis. Hawley RS, editor. PLoS Genet. 2006;2(8):e136. Sun M, Li Z, Gui J. Dynamic distribution of spindlin in nucleoli, nucleoplasm and spindle from primary oocytes to mature eggs and its critical function for oocyte-to‐embryo transition in gibel carp. J Exp Zool Part Ecol Genet Physiol. 2010;313A(8):461–73. Kipreos ET, Pagano M. The F-box protein family. Genome Biol. 2000;1(5):reviews30021. Molina JR, Adjei AA. The Ras/Raf/MAPK Pathway. J Thorac Oncol. 2006;1(1):7–9. Stacey DW. Cyclin D1 serves as a cell cycle regulatory switch in actively proliferating cells. Curr Opin Cell Biol. 2003;15(2):158–63. Tidyman WE, Rauen KA. The RASopathies: developmental syndromes of Ras/MAPK pathway dysregulation. Curr Opin Genet Dev. 2009;19(3):230–6. Goriely A, Wilkie AOM. Paternal Age Effect Mutations and Selfish Spermatogonial Selection: Causes and Consequences for Human Disease. Am J Hum Genet. 2012;90(2):175–200. Srinivasan DG, Abdelhady A, Stern DL. Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon pisum , Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis. Zhang M, editor. PLoS ONE. 2014;9(12):e115099. Zhang J, Sun M, Zhou L, Li Z, Liu Z, Li XY, et al. Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid Carassius gibelio . Sci Rep. 2015;5(1):10898. Zhang YN, Zhu XY, Wang WP, Wang Y, Wang L, Xu XX, et al. Reproductive switching analysis of Daphnia similoides between sexual female and parthenogenetic female by transcriptome comparison. Sci Rep. 2016;6(1):34241. Marlow FL, Mullins MC. Bucky ball functions in Balbiani body assembly and animal–vegetal polarity in the oocyte and follicle cell layer in zebrafish. Dev Biol. 2008;321(1):40–50. Aguero T, Zhou Y, Kloc M, Chang P, Houliston E, King M. Hermes (Rbpms) is a Critical Component of RNP Complexes that Sequester Germline RNAs during Oogenesis. J Dev Biol. 2016;4(1):2. Coward K, Ponting CP, Zhang N, Young C, Huang CJ, Chou CM, et al. Identification and functional analysis of an ovarian form of the egg activation factor phospholipase C zeta (PLCζ) in pufferfish: analysis of an ovarian form of PLC zeta. Mol Reprod Dev. 2011;78(1):48–56. Familiari G. Structural changes of the zona pellucida during fertilization and embryo development. Front Biosci. 2008;Volume(13):6730. Dong CH, Yang ST, Yang ZA, Zhang L, Gui JF. A C-type lectin associated and translocated with cortical granules during oocyte maturation and egg fertilization in fish. Dev Biol. 2004;265(2):341–54. Yue HM, Li Z, Wu N, Liu Z, Wang Y, Gui JF, Oocyte-Specific. H2A Variant H2af1o Is Required for Cell Synchrony Before Midblastula Transition in Early Zebrafish Embryos1. Biol Reprod [Internet]. 2013;89(4). Available from: https://academic.oup.com/biolreprod/article-lookup/doi/ 10.1095/biolreprod.113.108043 . Du C, Davis JS, Chen C, Li Z, Cao Y, Sun H, et al. FGF2/FGFR signaling promotes cumulus–oocyte complex maturation in vitro. Reproduction. 2021;161(2):205–14. Beukeboom LW, Vrijenhoek RC. Evolutionary genetics and ecology of sperm-dependent parthenogenesis. J Evol Biol. 1998;11(6):755–82. Maenohara S, Unoki M, Toh H, Ohishi H, Sharif J, Koseki H et al. Role of UHRF1 in de novo DNA methylation in oocytes and maintenance methylation in preimplantation embryos. Cohen PE, editor. PLOS Genet. 2017;13(10):e1007042. Amberg JJ, Goforth RR, Sepúlveda MS. Antagonists to the Wnt Cascade Exhibit Sex-Specific Expression in Gonads of Sexually Mature Shovelnose Sturgeon. Sex Dev. 2013;7(6):308–15. Liu Y, Zhang W, Du X, Zhao J, Liu X, Li X, et al. Sexually dimorphic expression in developing and adult gonads shows an important role of gonadal soma-derived factor during sex differentiation in olive flounder ( Paralichthys olivaceus ). Comp Biochem Physiol B Biochem Mol Biol. 2017;210:1–8. Prathibha Y, Senthilkumaran B. Expression of wnt4/5 during reproductive cycle of catfish and wnt5 promoter analysis. J Endocrinol. 2017;232(1):1–13. Li Q, Inhibitory, SMADs. Potential Regulators of Ovarian Function1. Biol Reprod [Internet]. 2015;92(2). Available from: https://academic.oup.com/biolreprod/article-lookup/doi/ 10.1095/biolreprod.114.125203 . Kaivo-oja N, Jeffery LA, Ritvos O, Mottershead DG. Smad signalling in the ovary. Reprod Biol Endocrinol. 2006;4(1):21. Bayer EA, Stecky RC, Neal L, Katsamba PS, Ahlsen G, Balaji V, et al. Ubiquitin-dependent regulation of a conserved DMRT protein controls sexually dimorphic synaptic connectivity and behavior. eLife. 2020;9:e59614. Johnsen H, Andersen Ø. Sex dimorphic expression of five dmrt genes identified in the Atlantic cod genome. The fish-specific dmrt2b diverged from dmrt2a before the fish whole-genome duplication. Gene. 2012;505(2):221–32. Yang B, Sun W, Jin L, Li P, Zhou Y, Qian G, et al. SOX8 is essential for male sexual differentiation in the Chinese soft-shelled turtle Pelodiscus sinensis . Biol Reprod. 2023;108(6):988–96. Takada S, Koopman P. Origin and possible roles of the Sox8 transcription factor gene during sexual development. Cytogenet Genome Res. 2003;101(3–4):212–8. Ahmed S. Review of the molecular modelling studies of the cytochrome P-450 estrogen synthetase enzyme, aromatase. Drug Des Discov. 1998;15(4):239–52. He W, Gauri M, Li T, Wang R, Lin SX. Current knowledge of the multifunctional 17β-hydroxysteroid dehydrogenase type 1 (HSD17B1). Gene. 2016;588(1):54–61. Saloniemi T, Welsh M, Lamminen T, Saunders P, Mäkelä S, Streng T, et al. Human HSD17B1 expression masculinizes transgenic female mice. Mol Cell Endocrinol. 2009;301(1–2):163–8. Gomes Fernandes M, He N, Wang F, Van Iperen L, Eguizabal C, Matorras R, et al. Human-specific subcellular compartmentalization of P-element induced wimpy testis-like (PIWIL) granules during germ cell development and spermatogenesis. Hum Reprod. 2018;33(2):258–69. Risinger C, Larhammar D. Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish. Proc Natl Acad Sci. 1993;90(22):10598–602. Luo J, Zhang YP, Huang SY. Genetic Diversity in Crucian Carp ( Carassius auratus ). 1999;37(9/10):267–79. Yuan J, He Z, Yuan X, Jiang X, Sun X, Zou S. Speciation of polyploid Cyprinidae fish of common carp, crucian carp, and silver crucian carp derived from duplicated Hox genes. J Exp Zoolog B Mol Dev Evol. 2010;314B(6):445–56. Gu Q, Wang S, Zhong H, Yuan H, Yang J, Yang C, et al. Phylogeographic relationships and the evolutionary history of the Carassius auratus complex with a newly born homodiploid raw fish (2nNCRC). BMC Genomics. 2022;23(1):242. Podlesnykh AV, Apalikova OV, Brykov VA. Phylogenetic relationships of silver crucian carp in Carassius auratus complex based on mtDNA analysis. Russ J Genet. 2012;48(12):1207–17. Sinclair EA, Pramuk JB, Bezy RL, Crandall KA, Sites JW Jr. DNA evidence for nonhybrid origins of parthenogenesis in natural populations of vertebrates. Evolution [Internet]. 2009; Available from: https://academic.oup.com/evolut/article/64/5/1346/6854312 . Tunquist BJ, Eyers PA, Chen LG, Lewellyn AL, Maller JL. Spindle checkpoint proteins Mad1 and Mad2 are required for cytostatic factor–mediated metaphase arrest. J Cell Biol. 2003;163(6):1231–42. Bi K, Bogart JP. Probing the meiotic mechanism of intergenomic exchanges by genomic in situ hybridization on lampbrush chromosomes of unisexual Ambystoma (Amphibia: Caudata). Chromosome Res. 2010;18(3):371–82. Bogart JP, Bartoszek J, Noble DWA, Bi K. Sex in unisexual salamanders: discovery of a new sperm donor with ancient affinities. Heredity. 2009;103(6):483–93. Rice CS. Evolution of meiosis genes in sexual vs. asexual Potamopyrgus antipodarum [Internet] [Master of Science]. [Iowa City, IA, United States]: University of Iowa; 2015. Available from: https://iro.uiowa.edu/esploro/outputs/graduate/9983776608402771 . Gui J, Zhou L. Genetic basis and breeding application of clonal diversity and dual reproduction modes in polyploid Carassius auratus gibelio . Sci China Life Sci. 2010;53(4):409–15. Šimková A, Vojtek L, Halačka K, Hyršl P, Vetešník L. The effect of hybridization on fish physiology, immunity and blood biochemistry: A case study in hybridizing Cyprinus carpio and Carassius gibelio (Cyprinidae). Aquaculture. 2015;435:381–9. Vetešník L, Halačka K, Šimková A. The effect of ploidy and temporal changes in the biochemical profile of gibel carp ( Carassius gibelio ): a cyprinid fish species with dual reproductive strategies. Fish Physiol Biochem. 2013;39(2):171–80. Edgar R. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30(1):207–10. Kalous J, Kubelka M, Šolc P, Šušor A, Motlík J. AKT (protein kinase B) is implicated in meiotic maturation of porcine oocytes. Reproduction. 2009;138(4):645–54. Mouillet JF, Yan X, Ou Q, Jin L, Muglia LJ, Crawford PA, et al. DEAD-Box Protein-103 (DP103, Ddx20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function. Endocrinology. 2008;149(5):2168–75. Steinfeld JS, Ameyaw KK, Wood CG, Johnston RM, Escauriza AJJ, Torija EG et al. The zebrafish dmrt family genes have cooperative and antagonistic roles in sex determination and oogenesis [Internet]. Developmental Biology; 2022 Aug. http://biorxiv.org/lookup/doi/10.1101/2022.08.28.505603 . Sun H, Sun G, Zhang H, An H, Guo Y, Ge J, et al. Proteomic Profiling Reveals the Molecular Control of Oocyte Maturation. Mol Cell Proteom. 2023;22(1):100481. Silva ESD, Amaral C, Barreta M, Antoniazzi A, Andrade LGD, Ferreira R, et al. FGF18 modulates CTGF mRNA expression in cumulus–oocyte complexes and early bovine embryos: preliminary data. Zygote. 2022;30(2):239–43. Pandey A, Gupta N, Gupta SC. Improvement of in vitro oocyte maturation with lectin supplementation and expression analysis of Cx43, GDF-9, FGF-4 and Fibronectin mRNA transcripts in Buffalo ( Bubalus bubalis ). J Assist Reprod Genet. 2009;26(6):365–71. Jin S, Tong T, Fan W, Fan F, Antinore MJ, Zhu X, et al. GADD45-induced cell cycle G2-M arrest associates with altered subcellular distribution of cyclin B1 and is independent of p38 kinase activity. Oncogene. 2002;21(57):8696–704. Suzumori N, Pangas S, Rajkovic A. Candidate Genes for Premature Ovarian Failure. Curr Med Chem. 2007;14(3):353–7. Oh ET, Kim HG, Kim CH, Lee J, Kim C, Lee JS, et al. NQO1 regulates cell cycle progression at the G2/M phase. Theranostics. 2023;13(3):873–95. Braden TD, Bervig T, Conn PM. Protein Kinase-C Activation Stimulates Synthesis of Gonadotropin-Releasing Hormone (GnRH) Receptors, but Does not Mediate GnRH-Stimulated Receptor Synthesis. Endocrinology. 1991;129(5):2486–90. Bill CA, Vines CM, Phospholipase C. In: Islam MdS, editor. Calcium Signaling [Internet]. Cham: Springer International Publishing; 2020. p. 215–42. (Advances in Experimental Medicine and Biology; vol. 1131). Available from: http://link.springer.com/ 10.1007/978-3-030-12457-1_9 . Regev A, Goldman S, Shalev E. Expression of plexin-B1 in the mouse ovary and its possible role in follicular development. Fertil Steril. 2005;84:1210–9. Kaufman OH, Lee K, Martin M, Rothhämel S, Marlow FL. rbpms2 functions in Balbiani body architecture and ovary fate. Pelegri F, editor. PLOS Genet. 2018;14(7):e1007489. Chae HD, Mitton B, Lacayo NJ, Sakamoto KM. Replication factor C3 is a CREB target gene that regulates cell cycle progression through the modulation of chromatin loading of PCNA. Leukemia. 2015;29(6):1379–89. Additional Declarations No competing interests reported. Supplementary Files Additionalfile1Jacquesetal.docx Additionalfile2Jacquesetal.docx Additionalfile3Jacquesetal.docx Additionalfile4Jacquesetal.docx Additionalfile5Jacquesetal.docx Additionalfile6Jacquesetal.docx Additionalfile7Jacquesetal.docx Additionalfile8Jacquesetal.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 01 Apr, 2024 Reviews received at journal 03 Mar, 2024 Reviewers agreed at journal 01 Mar, 2024 Reviewers agreed at journal 13 Feb, 2024 Reviewers invited by journal 11 Feb, 2024 Editor assigned by journal 06 Feb, 2024 Editor invited by journal 06 Feb, 2024 Submission checks completed at journal 06 Feb, 2024 First submitted to journal 29 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3908673","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":271617286,"identity":"d4c3c941-efb6-4b11-9b3c-2e614015b58c","order_by":0,"name":"Florian Jacques","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEklEQVRIiWNgGAWjYBAC9nYgkQDEjA0QATmYDD8uLTyH0bQYw2QkG/BpQQaJMJW4tTAzH/vwoOYOA3P74Ye3eSrq0vulDz97+KWCQcIchx4eZrbkGQnHnjEw9qQZW/OcOZw7sy/N3FjmDIOEzAHsWuyZeYwZEtgOA/2SwybN23Ygd8MZBjNpyTaGOgmcDgNp+QfU0v8GqOVfXbrBGfZv0pL/GCTwaklsA2qZAbKlgTnB4AyPmeTHBnxa2JIZEvsO8zDOeGZsOefYYcOZPTxl0gzHJHBrYW8+zPjj22E5w/7khzfe1NTJ8/Owb5P8UWODUwtcq2EDAwNcETMPAyENQCDPgKSF8QdhDaNgFIyCUTByAABxKk3ArpibRwAAAABJRU5ErkJggg==","orcid":"","institution":"Masaryk University","correspondingAuthor":true,"prefix":"","firstName":"Florian","middleName":"","lastName":"Jacques","suffix":""},{"id":271617287,"identity":"7baf3c5b-f1d6-4abe-96c3-f803a500442c","order_by":1,"name":"Tomáš Tichopád","email":"","orcid":"","institution":"University of South Bohemia in České Budějovice, South Bohemian Research Center of Aquaculture and Biodiversity of Hydrocenoses","correspondingAuthor":false,"prefix":"","firstName":"Tomáš","middleName":"","lastName":"Tichopád","suffix":""},{"id":271617288,"identity":"19d040bd-180c-496e-85a5-3cb78f90e83b","order_by":2,"name":"Martin Demko","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Martin","middleName":"","lastName":"Demko","suffix":""},{"id":271617289,"identity":"4106f8ea-5b1e-454f-b36a-263b4223ef33","order_by":3,"name":"Vojtěch Bystrý","email":"","orcid":"","institution":"Central European Institute of Technology, Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Vojtěch","middleName":"","lastName":"Bystrý","suffix":""},{"id":271617290,"identity":"63a9c228-d52a-40c2-85ee-c8de61156e29","order_by":4,"name":"Kristína Civáňová Křížová","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Kristína","middleName":"Civáňová","lastName":"Křížová","suffix":""},{"id":271617291,"identity":"94a85d79-9341-4be5-b9e5-c262d6ab05f1","order_by":5,"name":"Mária Seifertová","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Mária","middleName":"","lastName":"Seifertová","suffix":""},{"id":271617292,"identity":"892a7a8a-2e85-41ac-b5c6-b9c2aa6a03b5","order_by":6,"name":"Kristýna Voříšková","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Kristýna","middleName":"","lastName":"Voříšková","suffix":""},{"id":271617293,"identity":"b22e7836-21d5-4e92-b433-958aa4009355","order_by":7,"name":"Md Mehedi Hasan Fuad","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Md","middleName":"Mehedi Hasan","lastName":"Fuad","suffix":""},{"id":271617294,"identity":"26726797-789e-4c00-b467-2cbcd660ad5d","order_by":8,"name":"Lukáš Vetešník","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Lukáš","middleName":"","lastName":"Vetešník","suffix":""},{"id":271617295,"identity":"b0817576-af3b-4d54-b888-546050badf09","order_by":9,"name":"Andrea Šimková","email":"","orcid":"","institution":"Masaryk University","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Šimková","suffix":""}],"badges":[],"createdAt":"2024-01-29 10:19:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3908673/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3908673/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50877152,"identity":"630d12ab-018a-4253-b1d4-85c765cecfab","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":206837,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Dendrogram of the hierarchical clustering of different lineages based on the degree of SNP similarity. Venn diagrams of the numbers of SNPs shared (B) between \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e, and (C) between \u003cem\u003eC. auratus\u003c/em\u003e, \u003cem\u003eC. carpio\u003c/em\u003e, and diploid and triploid females of \u003cem\u003eC. gibelio\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/72d2b86d05e3afc88e03da7f.png"},{"id":50877157,"identity":"8f2c12a4-d95c-44e0-aae5-40a10a52fae6","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":138115,"visible":true,"origin":"","legend":"\u003cp\u003ePrincipal component analysis (PCA) of normalized RNAseq read counts between the diploid males and females of \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e and the triploid females and males of \u003cem\u003eC. gibelio\u003c/em\u003e for all genes (A) and a set of 208 randomly selected reproductive genes (B), on the first two principal components.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/cba836c96e7fac1c99b1214a.png"},{"id":50877154,"identity":"9db8bee7-c9f5-4b93-84df-d589d02e32e1","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":222236,"visible":true,"origin":"","legend":"\u003cp\u003eVenn diagram of Gene Ontology terms for the females (A) and males (B) of \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e, including the triploid asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e and the triploid males of \u003cem\u003eC. gibelio\u003c/em\u003e. Total numbers of unique and shared identified GO terms are indicated.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/00f97ac76edeb8cc7d0d1cdc.png"},{"id":50877160,"identity":"9af22b8c-54ab-402e-9c52-7ca4ce601e67","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":318925,"visible":true,"origin":"","legend":"\u003cp\u003eScatter chart of GO terms enrichment analysis in the biological process (A), cellular component (B), molecular function (C), and KEGG pathway (D) categories. The x-axis represents the fold enrichment (the number of DEGs in the GO term / the number of all DEGs)/(the number of genes annotated in this pathway/ the number of the genes annotated in all pathways). The y-axis corresponds to the enriched GO terms. The magnitude of dots represents the number of DEGs in the GO term, and the color corresponds to the -log10 of the false discovery rate (FDR).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/cc48c897d09448ca33b7c067.png"},{"id":50877158,"identity":"950a4a23-4166-4803-a767-674996d358ab","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":27417,"visible":true,"origin":"","legend":"\u003cp\u003eSummary of the number of genes upregulated in asexual females or in sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e in reproduction-associated pathways.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/8254fe25fcd5db596f8552fa.png"},{"id":50877156,"identity":"505c289b-af37-4408-b471-c3613a4e002c","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":68072,"visible":true,"origin":"","legend":"\u003cp\u003eValidation of gene expression resulting from RNAseq by the RT-qPCR approach using 17 reproduction-related genes. The x-axis displays the gene names. The y-axis displays the log2 fold change of the gene expression between sexual females and asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e. A positive log2 fold change of the gene expression indicates that the gene was upregulated in asexual females when compared to sexual females. A negative log2 fold change indicates that the gene was downregulated in asexual females when compared to sexual females. The data represent the means of five independent biological replicates, and bars represent standard deviation. Asterisks indicate statistically significant differences in the log2 fold change of qPCR data between sexual and asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e based on Student’s t-test: *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/a68376b3da00f056644e09cc.png"},{"id":50877716,"identity":"0f25795e-c0c2-4515-8e74-af9bbc5727c0","added_by":"auto","created_at":"2024-02-08 19:33:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1549296,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/4d2cb010-d0c7-4934-9d9b-aaf5c1b3f320.pdf"},{"id":50877547,"identity":"3f30bd4e-598a-49e4-bd02-a37638bae6b3","added_by":"auto","created_at":"2024-02-08 19:25:09","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18082,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/d7eaae459ce2f3b4774812a9.docx"},{"id":50877153,"identity":"a2c997af-452f-4976-a50c-92266864e8f9","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":42468,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/0b0d00b7b7d3b979d9c2c09f.docx"},{"id":50877163,"identity":"8ea4f658-df03-42cf-9720-6c0571098eda","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":44696,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile3Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/c07869844f4c53bdbb7caf7a.docx"},{"id":50877162,"identity":"bffa69e6-caa6-4ebd-9892-9f01c8a68acf","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":30466,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile4Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/2fe0095f85313a32e4271905.docx"},{"id":50877164,"identity":"c6c5f921-e949-41e6-a5b8-3aa8a8cca79e","added_by":"auto","created_at":"2024-02-08 19:17:10","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":31419,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile5Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/b328511ab8f0dc294aeecaec.docx"},{"id":50877159,"identity":"0f04ea88-01af-427b-a16b-373ffd36c24f","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":39607,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile6Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/3ec127a8e92785d40bd65382.docx"},{"id":50877161,"identity":"d9edeb05-8070-4b51-b0b8-6e45c22052e6","added_by":"auto","created_at":"2024-02-08 19:17:09","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":96806,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile7Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/1c1589466cdea976bd47e43a.docx"},{"id":50877165,"identity":"17016d42-2730-49ea-9b35-f63ef65e8666","added_by":"auto","created_at":"2024-02-08 19:17:10","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":51031,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile8Jacquesetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3908673/v1/1e3c9bda4acbd9167980fd2c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Reproduction-associated pathways in females of gibel carp (Carassius gibelio) shed light on the molecular mechanisms of the coexistence of asexual and sexual reproduction","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe establishment of sexual reproduction has been a major event in the evolution of eukaryotes\u0026nbsp;(1). However, asexual reproduction has evolved independently in dozens of eukaryotic lineages, and is documented in approximately 80 vertebrate species, all representing reptiles, amphibians\u0026nbsp;(2), and teleost fish\u0026nbsp;(3). Asexual species often originate from hybridization events and/or ploidy alteration\u0026nbsp;(4\u0026ndash;7). These processes usually affect meiosis and generate new species with asexual females only\u0026nbsp;(8\u0026ndash;11). Both sexual and asexual reproduction exhibit various evolutionary and ecological advantages and disadvantages. The main disadvantage of sexual reproduction is the two-fold cost of meiosis and the production of male offspring\u0026nbsp;(12). Consequently, sexual individuals can be outnumbered by parthenogenetic females that exhibit twice the egg production rate. On the other hand, parthenogenetic forms suffer from the accumulation of deleterious mutations and reduced adaptive abilities, including lower ecological tolerance and higher susceptibility to parasites, following the principle of Muller`s ratchet\u0026nbsp;(13). Hence, asexually reproducing species are usually considered a short-term evolutionary dead-end, and this explains the maintenance of sexual reproduction in the vast majority of eukaryotic lineages\u0026nbsp;(14). Still, asexual reproduction persists in nature, and for some vertebrates, sexual and asexual complexes of closely-related species often coexist with sexual forms in the same habitats (e.g., the teleosts \u003cem\u003ePoecilia\u003c/em\u003e and \u003cem\u003eCobitis\u003c/em\u003e, and the lizard \u003cem\u003eAspidoscelis\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003eInterspecific hybridization played an important role in the formation of polyploid asexual species. In amphibians and teleosts, all-female asexual species reproduce by gynogenesis\u0026nbsp;(15), a process where females use the sperm from males of the same species or a closely-related species to induce embryogenesis, without the contribution of paternal genetic material to the offspring. Regarding fish, several asexual-sexual complexes have been reported. The asexual North American leuciscid \u003cem\u003ePhoxinus eos-neogaeus\u003c/em\u003e is the result of interspecific hybridization between the sexual species \u003cem\u003eP. eos\u003c/em\u003e and \u003cem\u003eP. neogaeus\u0026nbsp;\u003c/em\u003e(16). In the European \u003cem\u003eCobitis\u003c/em\u003e complex, hybridization between sexual species generated sterile males and asexual triploid females that produce eggs through premeiotic endoreplication\u0026nbsp;(6,17). The asexual \u003cem\u003ePoecilia formosa\u003c/em\u003e from the Amazon basin, which forms eggs through achiasmatic meiosis without recombination\u0026nbsp;(18), results from hybridization between two sexual species, \u003cem\u003eP. mexicana\u003c/em\u003e and \u003cem\u003eP. latipinna\u003c/em\u003e (19). The Iberian minnow \u003cem\u003eLeuciscus alburnoides\u003c/em\u003e represents another case of a species resulting from hybridization, this with a complex genetic constitution and exhibiting the coexistence of diploid and triploid forms, as well as gynogenesis and sexual reproduction\u0026nbsp;(20,21).\u003c/p\u003e\n\u003cp\u003eThe gibel carp (\u003cem\u003eCarassius gibelio\u003c/em\u003e), also known as Prussian carp, considered as a subspecies of \u003cem\u003eC. auratus\u003c/em\u003e or a member of the \u003cem\u003eC. auratus\u003c/em\u003e complex,\u003cem\u003e\u0026nbsp;\u003c/em\u003eis a cyprinid fish originating from eastern Eurasia that became invasive in European freshwater ecosystems during the 20th century, due to its high ecological tolerance and adaptive abilities\u0026nbsp;(22,23). Gibel carp exhibits a dual mode of reproduction - sexual reproduction and gynogenesis. The emergence of asexual reproduction in this species is concomitant with a triploidization event\u0026nbsp;(24). The first populations invading the freshwaters of the Czech Republic around 1975\u0026nbsp;(25)\u0026nbsp;included only triploid asexual females. Fifteen years later, mixed populations composed of triploid asexual females and diploid females and males reproducing sexually appeared. A low proportion of triploid and tetraploid males was also reported\u0026nbsp;(25,26).\u003cem\u003e\u0026nbsp;\u003c/em\u003eIn Asian populations of\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eC. auratus gibelio\u003c/em\u003e (following the taxonomy used by Asian authors), this phenomenon was explained by allogynogenesis, where heterologous sperm sometimes contribute to the phenotype of the offspring\u0026nbsp;(27). Zhou et al. (2000) even reported molecular evidence of sexual reproduction in the asexual females of Chinese populations of \u003cem\u003eC. auratus\u003c/em\u003e \u003cem\u003egibelio\u003c/em\u003e. They suggest that homologous sperm insemination of the eggs of asexual females is similar to classical sexual reproduction (the fused nucleus of the zygote undergoes recombination and removes extra maternal chromosomes). However, there is no empirical evidence of the capacity of sexual reproduction in the asexual form of \u003cem\u003eC. gibelio\u003c/em\u003e distributed across Europe.\u003c/p\u003e\n\u003cp\u003eThe coexistence of the two reproduction forms in \u003cem\u003eC. gibelio\u003c/em\u003e might be a unique case of the switch from a unisexual species to a partly sexual species.\u0026nbsp;Several mechanisms have been proposed to explain the coexistence of asexual and sexual individuals. Firstly, because asexual reproduction is associated with reduced genetic diversity, parasitism\u0026nbsp;is supposed to play an important role in the maintenance of sexual reproduction\u0026nbsp;(28,29).\u0026nbsp;Clonally reproducing females of\u0026nbsp;\u003cem\u003eC. gibelio\u003c/em\u003e suffer from higher parasite loads when compared to the genetically variable sexual form. Sexual selection increases the variability of immune genes. Sexual diploids show higher genetic diversity in immune genes than asexual triploids, in accordance with the Red Queen hypothesis\u0026nbsp;(29). The coexistence of the two reproduction forms in fish may also be facilitated by other ecological processes, such as male discrimination against asexual females\u0026nbsp;(30), the generation of sexual individuals from asexual females\u0026nbsp;(31), the differential competitive abilities of asexuals and sexuals\u0026nbsp;(32), and the occupation of different ecological niches\u0026nbsp;(33). While asexual reproduction allows for a quick clonal multiplication of individuals in stable environments\u0026nbsp;(34), sexual reproduction favors genetic diversity, heterozygosity, and DNA repair, and hence adaptation to changing environments. Moreover, the necessity of asexual forms to coexist with sexual forms is directly related to gynogenesis, which requires males of conspecifics or close species in the same habitats for egg activation.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eC. gibelio\u0026nbsp;\u003c/em\u003erepresents a unique example of a species where sexual and asexual forms coexist\u0026nbsp;(28). Hence, this species constitutes an object of study to elucidate the evolution of sexuality and asexuality in animals, and the mechanisms responsible for the stable coexistence of sexual and asexual individuals. Furthermore, the origin of \u003cem\u003eC. gibelio\u0026nbsp;\u003c/em\u003eis still in question. Yuan \u003cem\u003eet al.\u003c/em\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003e(2010), focusing on hox genes, suggested the potential hybrid origin of triploid asexual \u003cem\u003eC. gibelio\u003c/em\u003e from \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e. However, \u003cem\u003eC. gibelio\u0026nbsp;\u003c/em\u003ecould also arise from autopolyploidization within the evolutionary branch of the \u003cem\u003eC. auratus\u0026nbsp;\u003c/em\u003ecomplex, leading to triploid asexual females\u0026nbsp;(35,36). Understanding the role of polyploidization in the origin of \u003cem\u003eC. gibelio\u003c/em\u003e, and the extent of the genomic contribution of \u003cem\u003eC. carpio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e to \u003cem\u003eC. gibelio\u003c/em\u003e, could provide a better understanding of the evolution of asexual and sexual reproduction in \u003cem\u003eC. gibelio\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eHere, the molecular mechanisms associated with reproduction in \u003cem\u003eC. gibelio\u0026nbsp;\u003c/em\u003ewere analysed to study the coexistence of asexual and sexual forms. In particular, the expression of reproduction-related genes was expected to differ between asexual and sexual females, since\u0026nbsp;meiosis-related genes are not important for asexually reproducing individuals.\u0026nbsp;To test this hypothesis, transcriptome profile analyses of gonadal tissues (ovaries) from asexual females and sexual females of \u003cem\u003eC. gibelio\u0026nbsp;\u003c/em\u003ewere performed. In addition, the transcriptomes of\u0026nbsp;the closely-associated species\u0026nbsp;\u003cem\u003eC. carpio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e were also analysed, with a particular emphasis on the genes contributing to sexual reproduction.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003eFish tissue sampling\u003c/h2\u003e \u003cp\u003eAsexual and sexual \u003cem\u003eC. gibelio\u003c/em\u003e were obtained from artificial breeding. Asexual females were obtained by induced embryogenesis using sperm of \u003cem\u003eC. carpio\u003c/em\u003e. The sexual specimens were obtained from the interbreeding of sexual specimens. The fish were reared in aquarium conditions until the age of four years and subsequently their gonadal tissues were sampled (the age of the examined fish corresponded to 4+). \u003cem\u003eCyprinus carpio\u003c/em\u003e and \u003cem\u003eCarassius auratus\u003c/em\u003e were obtained from external breeding facilities. Fish were euthanized using physical stunning through a blow to the skull with a blunt wooden instrument immediately followed by exsanguination.\u003c/p\u003e \u003cp\u003eFour or five biological samples per fish group from a total of 8 fish groups were analysed (females and males of \u003cem\u003eC. gibelio\u003c/em\u003e resulting from sexual reproduction, females and temperature-induced males of \u003cem\u003eC. gibelio\u003c/em\u003e resulting from gynogenesis, females and males of sexual \u003cem\u003eC. auratus\u003c/em\u003e, and females and males of sexual \u003cem\u003eC. carpio\u003c/em\u003e). Gonadal tissues of each fish specimen were individually submerged in Ambion RNAlater stabilization solution (Thermo Fisher Scientific). Tubes with tissues were stored at -80\u0026ordm;C until the isolation of total RNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and library preparation\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from the gonad tissue of each fish specimen. For extraction, PureLink\u0026reg; RNA Mini Kit (Ambion) with Trizol reagent (Thermo Fisher Scientific) and on-column PureLink DNase treatment were used according to the manufacturer\u0026acute;s protocol. Reagent and buffer volumes were adjusted according to the weight of tissue entering the isolation process (30 mg on average). The final elution was performed using 100 \u0026micro;l of RNAse-free water in the first step and the primal eluate in the second step. The yield and concentration of RNA isolates were checked using a QubitTM 4 fluorometer (Invitrogen by Thermo Fisher Scientific) and Qubit RNA HS Assay Kit (Thermo Fisher Scientific). The quality and integrity of RNA were analysed using RNA 6000 Nano Kit on a 2100 Bioanalyser instrument (Agilent Technologies). All RNA isolates were normalized by dilution at a uniform concentration of 20 ng/\u0026micro;l with RNase-free water. They served as templates for DNA library preparation in twice the reaction volume recommended by the manufacturer.\u003c/p\u003e \u003cp\u003eAll samples (RNA integrity number \u0026ndash; RIN\u0026thinsp;\u0026gt;\u0026thinsp;7) were used for DNA library preparation. 500ng of total RNA was used for mRNA enrichment using the Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Subsequently, NEBNext\u0026reg; Ultra\u0026trade; Directional RNA Library Prep Kit for Illumina\u0026reg;, and NEBNext\u0026reg; Multiplex Oligos for Illumina\u0026reg; (Dual Index Primers Set 2, New England Biolabs) were used for library preparation, with 11 PCR cycles utilized for PCR enrichment. RNA fragmentation (13 minutes at 94\u0026deg;C) and the size selection conditions (a bead volume of 30 \u0026micro;l and 15 \u0026micro;l for the first and second bead selections, respectively) were further modified in the protocol. The quantification of DNA libraries was performed on a QubitTM 4 fluorometer (Invitrogen by Thermo Fisher Scientific) using Qubit dsDNA HS Assay Kit, and quality and size control were performed on a 2100 Bioanalyser with DNA 1000 Kit (Agilent Technologies). Finally, amplicons were pooled in equimolar amounts. The final concentration of each library in the pool was 10 nM in the pool. Subsequently, NEBNext\u0026reg; Ultra\u0026trade; Directional RNA Library Prep Kit for Illumina\u0026reg; and NEBNext\u0026reg; Multiplex Oligos for Illumina\u0026reg; (Dual Index Primers Set 2, New England Biolabs) together with spike-in RNA were used for cDNA library preparation from total RNA. The quality of prepared cDNA libraries was evaluated using a Qubit fluorometer (Thermo Fisher). The quality of cDNA libraries was visualized by a 2100 Bioanalyser (Agilent), and the libraries were finally sequenced by Macrogen Korea on Illumina HiSeq X (one lane) in a paired-end configuration producing 150 bp long reads. Quality and quantity control steps were carried out by a service company.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eNGS data analyses\u003c/h2\u003e \u003cp\u003eA quality check of raw paired-end fastq reads was carried out by FastQC (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e) and their origin was categorized using BioBloomTools v2.3.4 (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). The Illumina adapters clipping and quality trimming of raw fastq reads were performed using Trimmomatic v0.39 (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e) with settings CROP:250 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:5 MINLEN:35. Trimmed RNA-Seq reads were mapped to the \u003cem\u003eCarassius auratus\u003c/em\u003e genome (ASM336829v1) with Ensembl annotation (release 104) using STAR v2.7.3a (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e) as a splice-aware short read aligner and default parameters except for --outFilterMismatchNoverLmax 0.1 and --twopassMode Basic. Quality control after alignment concerning the number and percentage of uniquely- and multi-mapped reads, rRNA contamination, mapped regions, read coverage distribution, strand specificity, gene biotypes, and PCR duplication was performed using several tools \u0026ndash; namely, RSeQC v4.0.0 (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e), Picard toolkit v2.25.6 (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e), and Qualimap v.2.2.2 (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). All statistics were processed by MultiQC v1.10.1 (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSNP clustering analysis\u003c/h2\u003e \u003cp\u003eThe genomic sequences of all collected samples were aligned to the \u003cem\u003eCarassius auratus\u003c/em\u003e reference genome (SM336829v1-104) utilizing the Burrows-Wheeler Aligner (BWA) software (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Post alignment and germline variants were called using Strelka2 variant calling software (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), generating variant calls in VCF format which were further filtered to retain only high-confidence variants. These variants were then annotated using the reference Gene Transfer Format (GTF) file for \u003cem\u003eCarassius auratus\u003c/em\u003e (ASM336829v1-104). Subsequent data processing was carried out in R, where the variant tables were further refined and merged with sample information. A series of filtering steps were performed to ensure only variants with sufficient coverage and sample counts were retained for analysis. The filtered variant table was then reorganized and formatted for subsequent comparative analyses. Variants located on sex chromosomes were excluded for certain analyses to ensure accurate cross-species comparisons. The data were then restructured to compare SNP identity across species, generating similarity matrices and Venn diagrams to visualize the overlap of SNPs by species and ploidy levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDifferential expression analysis and pathway enrichment analysis\u003c/h2\u003e \u003cp\u003eAppropriate bioinformatics tools were used for the processing of raw sequencing data. The genome of \u003cem\u003eC. auratus\u003c/em\u003e was used as reference. The differential gene expression was calculated on the basis of the gene counts produced using featureCounts from the Subread package v2.0 (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e) and further analysed by Bioconductor package DESeq2 v1.34.0 (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). Data generated by DESeq2 with independent filtering were selected for differential gene expression analysis to avoid potential false positive results. Differences in gene expression were considered significant on the basis of a cut-off of the adjusted p-value\u0026thinsp;\u0026le;\u0026thinsp;0.05. GO term enrichment was analysed using David (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e) to retrieve Gene Ontology terms in the Biological process, Cellular Component and Molecular function categories, as well as KEGG pathways (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Graphical representations of the GO enrichment were realized using R (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e) and Revigo (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). Reproduction-associated candidate genes were retrieved using the BlastKoala tool of KEGG (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e), the BioMart tool of Ensembl (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e), and published studies (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). GO terms enrichment was tested using Fisher\u0026rsquo;s exact test (α\u0026thinsp;=\u0026thinsp;0.05) with false discovery rate (FDR) correction of the p-value. To interpret the biological functions of the DEGs, their mapping to the Gene Ontology (GO) (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e) and KEGG (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e) databases was performed to analyse pathway enrichment. In each of six fish groups associated with sexual reproduction and asexual males, significantly differently-expressed genes (DEGs) compared to the triploid asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e were selected on the basis of the following criteria: Basemean\u0026thinsp;\u0026gt;\u0026thinsp;10, and a padj value\u0026thinsp;\u0026lt;\u0026thinsp;0.05,. For KEGG pathway analysis, no filtering based on log2 fold change was applied. Gene functions were investigated using the biological databases Uniprot (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e), KEGG (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e), Zfin (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e) and GeneCards (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). PCA was performed using the DESeq2 R package (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). For PCA based on reproduction-associated genes, a set of 208 reproduction genes was selected using the BioMart tool of Ensembl (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGene selection and real-time quantitative PCR\u003c/h2\u003e \u003cp\u003eBased on the results of an NGS approach and published studies (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e), as well as the presence of appropriate GO and KEGG terms, candidate reproduction-associated genes were selected for the further analyses of gene expression. A-tubulin (\u003cem\u003eA-tub\u003c/em\u003e) was used as a housekeeping gene to normalize variation in the gene expression. The Reference Gene Selection Tool from Bio-Rad CFX Maestro software (Bio-Rad), based on geNorm software principles (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e) with an algorithm to normalize the Cq of each gene against the Cq values of the reference gene, was used. A total of 20 biologically-relevant genes were selected from transcriptomic outputs using published studies, and the expressions of 17 of them were validated by real-time quantitative PCR (qPCR). Three genes were excluded because of the amplification of unspecific products. Primers were designed using Primer Blast (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e) at the exon-exon junction. A summary of the genes analysed, and their primer sequences are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of the target genes selected from RNA seq and the housekeeping gene analysed using RT-qPCR, and their respective primer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward/reverse primers (5'-\u0026gt;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eAmplicon size\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eA-TUB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAlpha-Tubulin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCAACTACGCCCG\u003c/p\u003e \u003cp\u003eAGAGGTGAAACCAGAGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePIWIL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePiwi-Like Protein 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACACCAACGGTTGCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCCCGTCCAAGAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eZPE3L2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eZona Pellucida Sperm-Binding Protein 3-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTTTGCCAATGGGTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCACTGAAAACACCTTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRASA1B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRas Gtpase-Activating Protein 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTTGTGGGTGACGAATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATGAAACCAGGCTTTCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHRASAL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGtpase Hras\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCGGGGAATCAGAGGTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGGTCGTATTCGTCCACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eZP3EL1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eZona Pellucida Sperm-Binding Protein 3-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCTGCTAATGGTTGGGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e129\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGTCACTTCCTCTTCGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSPO11\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSPO11, Initiator of Meiotic Double Stranded Breaks\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTACGGCTCACGGTCTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e117\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAAGCGTTTCCTCTGGGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSYCE1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSynaptonemal Complex Central Element Protein 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCTACAGTTGGAGGGTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTCTGCTCAAGCTGCCTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eC1ORF146\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChromosome 31 C1orf146 Homolog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAGCCCCAGTCTACGGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTTTACTTGTGGCCTTCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSPINBZL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpindlin-Z-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGAGCTCTCACAAGCACAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGGACTAGTACGGTCCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCAMSAP2A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCalmodulin-Regulated Spectrin-Associated Protein 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCAGACACCCGAAAAACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e137\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTCTGGAACACTGTCTGTACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDMRT2A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDoublesex- And Mab-3-Related Transcription Factor 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCAAGCGACAGAGGACAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTGATGGACGAATGTGCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNCOA2L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNuclear Receptor Coactivator 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGCTGCTGAGTAATAACGACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTCCCCGACAGCACTCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRNF212\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRing Finger Protein 212\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCGTGTCTCCTGGTCCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e115\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGACACCCTGTTTTCCTCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSOX8L\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTranscription Factor SOX-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAACAGCTCCACGGTGCTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTGTTATCCGATGCACGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eALDH1A3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAldehyde Dehydrogenase 1 A3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAAACCATGCCAGTCGATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGTTCCCGCAGGCCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCALM3A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCalmodulin 3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGACACGTTTATCGCACGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACGCCTCCTTGAACTCAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBUC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBucky Ball\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACCTCAGGATCAAGGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCGTGGCCTTTGTTGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c5\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003c/p\u003e \u003cp\u003eReverse transcription following total RNA extraction from preserved samples of gonadal tissues stored in RNAlater was performed using High-Capacity RNA-to-cDNA Kit (Applied Biosystems by Thermo Fisher Scientific) according to the manufacturer\u0026rsquo;s instructions. The suitability of primers, their optimal annealing temperatures and amplicon lengths, and the specificity of the amplification of all selected genes were verified by classical PCR for representative samples of all fish groups. The PCR reaction mix (10 ul) contained 5 \u0026micro;l of prepared cDNA, 1 x Taq Buffer with (NH4)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 200 \u0026micro;M of each dNTP, 0.4 \u0026micro;M of forward and reverse primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 1 U of Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and nuclease-free water. PCR was run under the following conditions: initial denaturation at 95˚C for 4 min; 30 cycles of 95˚C for 30 s, an optimization gradient of 40\u0026ndash;65˚C for 30 s, 72˚C for 45 s; and a final amplification at 72˚C for 10 min. At least 5 samples from each fish group were used for the test. Three replicates for each sample were included in the qPCR analysis.\u003c/p\u003e \u003cp\u003eReal-time qPCR was performed using the LightCycler 480 II Real-Time PCR System (Roche Diagnostics) and LightCycler 480 SYBR Green I Master chemistry (Roche). The reaction mixture (final volume 20 \u0026micro;l) consisted of 10 \u0026micro;l of 2x SYBR Green I Master, 1 \u0026micro;l of each primer, 3 \u0026micro;l of dd H\u003csub\u003e2\u003c/sub\u003eO, and 5 \u0026micro;l of cDNA template. To test the reaction efficiency and to obtain the standard amplification curve, templates were prepared by means of six serial decimal dilutions of the cDNA of representatives of each fish group. Reactions were run on a LightCycler 480 Instrument II under the following conditions: 95˚C for 5 min; 45 cycles of 95˚C for 10 s, 55˚C for 10 s, and 72˚C for 10 s; melt curve 55˚C \u0026rarr; 95˚C (increment 0.5˚C)/5 s. In each run plate, together with samples run in triplicates, one negative control, in which RNase/DNase-free water was used instead of the cDNA and \u003cem\u003eA-tub\u003c/em\u003e as the reference gene, was analysed. LightCycler 480 software 1.5.1 was used for analyses of qPCR outputs. The relative expression value of the differentially expressed target gene \u0026ndash; the normalized expression \u0026ndash; was computed using the ΔΔCq method. Differences in gene expression between sexual and asexual females were statistically evaluated. The sequences of the primers used in this analysis are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eNext generation sequencing and assembly and SNPs analysis of\u003c/b\u003e \u003cb\u003eC. gibelio\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe sequencing of four to five diploid males and females from \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e, and triploid females and males of \u003cem\u003eC. gibelio\u003c/em\u003e yielded from 8M to 17M raw reads per individual (\u003cb\u003eAdditional file 1\u003c/b\u003e). The number of mapped reads varied between 5M and 12M. Across individual samples, from 51\u0026ndash;83% of reads were uniquely mapped, and from 12% and 22% of reads were multimapped. A total of 857,874 SNPs were identified in the transcriptomes of the eight fish groups (males and females of the three species including both triploid and diploid forms of gibel carp). We analysed the relationships between species using a clustering method based on SNP numbers. This clustering showed that \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e are closely related and that asexual \u003cem\u003eC. gibelio\u003c/em\u003e and sexual \u003cem\u003eC. gibelio\u003c/em\u003e are conspecific (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Specifically, the proportion of SNPs shared between \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e was 2.35 times higher than the proportion of SNPs shared by \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). However, \u003cem\u003eC. carpio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e shared only 3555 SNPs. The sexual diploid and asexual triploid individuals of \u003cem\u003eC. gibelio\u003c/em\u003e were more similar to each other than to \u003cem\u003eC. auratus\u003c/em\u003e or \u003cem\u003eC. carpio\u003c/em\u003e and both forms shared a similar number of SNPs with \u003cem\u003eC. auratus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eDifferential gene expression analysis\u003c/h2\u003e \u003cp\u003eThe transcriptome profiles of the females and males of \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e were analysed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Both reproductive forms \u0026ndash; asexual and sexual \u0026ndash; were included for \u003cem\u003eC. gibelio\u003c/em\u003e. In all cases, the biological replicates of same sex, ploidy level, and species tend to be more similar to each other. Principal component analysis (PCA) based on transcriptome-wide gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) showed differences in transcriptome profiles between sexes of the same species, these separated by PC1, and a similarity between the transcriptome profiles of the asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e and the sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e. However, even the females of \u003cem\u003eC. auratus\u003c/em\u003e were separated from \u003cem\u003eC. gibelio\u003c/em\u003e by PC1. Likewise, the transcriptomes of the diploid and triploid males of \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e also tended to be similar to each other. According to the transcriptome profiles, the males and females of \u003cem\u003eC. carpio\u003c/em\u003e were separated from the other fish groups by PC2. To compare the expression levels of reproduction-related genes among fish groups, a total of 208 genes related to reproduction were selected. This set of reproductive genes led to a similar grouping of species and sexes, as revealed by all of the transcriptomic data; however, the asexual triploid females \u003cem\u003eC. gibelio\u003c/em\u003e were more separated from the sexual ones of by PC2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eThe numbers of non-differentially and differentially expressed genes are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. For all comparisons, the number of upregulated genes in \u003cem\u003eC. gibelio\u003c/em\u003e asexual females was higher than the number of downregulated genes or similar to the number of downregulated genes. Comparison of the asexual and sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e revealed 1728 differentially expressed genes (DEGs). The numbers of upregulated and downregulated genes are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The number of DEGs in asexual \u003cem\u003eC. gibelio\u003c/em\u003e females was lower compared to sexual females in every species than compared to males of the same species. The number of DEGs between asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e and the females and males of \u003cem\u003eC. auratus\u003c/em\u003e was higher, and the number of DEGs compared to the females and males of \u003cem\u003eC. carpio\u003c/em\u003e was even higher (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNumber of non-differentially expressed genes and differentially expressed genes (down- and upregulated) in the triploid asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e compared to each of the diploid sexual males and females of \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eC. gibelio\u003c/em\u003e 2n females\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eC. gibelio\u003c/em\u003e\u003c/p\u003e \u003cp\u003e2n males\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eC. gibelio\u003c/em\u003e\u003c/p\u003e \u003cp\u003e3n males\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eC. auratus\u003c/em\u003e\u003c/p\u003e \u003cp\u003e2n females\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eC. auratus\u003c/em\u003e\u003c/p\u003e \u003cp\u003e2n males\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eC. carpio\u003c/em\u003e 2n females\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eC. carpio\u003c/em\u003e 2n males\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNon-differentially expressed gens\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46058\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e43659\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22363\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e47174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e46089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e42435\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e42751\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDownregulated genes in asexual females\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e782\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3836\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13603\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8298\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6773\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e9185\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUpregulated genes in asexual females\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e946\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10944\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7634\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4704\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11841\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e10818\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eGO enrichment analysis\u003c/h2\u003e \u003cp\u003eThe full transcriptomes of the three species were functionally annotated to 3747 GO terms for females and 3755 GO terms for males using BioMart (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). A total of 3635 were shared by all female lines, and 3721 were shared by all male lines. 30 GO terms identified in asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e were not identified in the sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e, and 30 GO terms identified in the sexual females were not present in the asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e. Three GO terms were identified in diploid males of \u003cem\u003eC. gibelio\u003c/em\u003e but not in triploid males, and 3 GO terms were identified in triploid males of \u003cem\u003eC. gibelio\u003c/em\u003e but not in diploid males (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTranscriptomes of sexual and asexual females were compared and investigated for pathway enrichment using overrepresentation analysis. Of the total of 1728 DEGs, 1471 were successfully annotated to the Gene Ontology (GO) and KEGG databases. A total of 809 were upregulated in asexual females in comparison to sexual females, and 662 downregulated. The significantly enriched GO terms are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e. In the biological process category, we identified GO terms associated with gametogenesis and cell cycle control, including egg coat formation (GO:0035803), the binding of sperm to zona pellucida (GO:0007339), the positive regulation of acrosome reaction (GO:2000344), synaptonemal complex assembly (GO:0007130), the negative regulation of nuclear division (GO:0051784), and the negative regulation of cell cycle process (GO:0010948). In the cellular component category, the most enriched terms included egg coat (GO:0035805). In the molecular function category, they included the structural constituent of egg coat (GO:0035804) and calcium ion binding (GO:0005509). The significantly enriched KEGG pathways included oocyte meiosis (caua04114), and cell cycle (caua04110).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMeiosis-associated genes\u003c/h2\u003e \u003cp\u003eTo determine whether meiotic pathways are disrupted in asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e, we first analysed the differences in expression levels of the meiosis-associated genes between sexual and asexual females following refs (\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). Of the set of 40 meiosis-associated genes, almost all were detected in both asexual and sexual females; however, \u003cem\u003epms1\u003c/em\u003e was not detected in most sexual and asexual females, and \u003cem\u003ehormad2\u003c/em\u003e was not detected in any sexual or asexual individual. Hence, the meiotic pathways did not appear to be disrupted in asexual females. Seven genes were significantly differently regulated. \u003cem\u003eSpo11, msh2\u003c/em\u003e, \u003cem\u003epds5b\u003c/em\u003e and \u003cem\u003estag1a\u003c/em\u003e displayed higher expression levels in sexual females when compared to asexual females, as well as \u003cem\u003erec114\u003c/em\u003e, which was close to significance (padj\u0026thinsp;=\u0026thinsp;0.07). In contrast, \u003cem\u003erad1\u003c/em\u003e, one \u003cem\u003erad51b\u003c/em\u003e homologue and \u003cem\u003eslc39a1\u003c/em\u003e were significantly more expressed in asexual females. The other meiosis-associated genes, including meiotic nuclear division 1 (\u003cem\u003emnd1), dmc1\u003c/em\u003e, the double strand break repair \u003cem\u003erad1\u003c/em\u003e and several \u003cem\u003erad51\u003c/em\u003e homologues, did not show significant gene expression differences (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of meiosis-associated genes with their expression levels in sexual and asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnsembl ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eL2fc\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003epadj\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000016377*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003espo11\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSPO11 initiator of meiotic double stranded breaks\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-1.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.36e-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000024429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehormad1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHORMA domain containing 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000034047\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emnd1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMeiotic nuclear division 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000050983\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emlh1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutL homolog 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000069004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emlh3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutL homolog 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000021963\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epms1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePMS homolog 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000010121\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epms2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePMS homolog 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.97\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000007723\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003edmc1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDNA meiotic recombinase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000038661*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emsh2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutS homolog 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.83e-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000047192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emsh4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutS homolog 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000015097\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emsh5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutS homolog 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.99\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000011896\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emsh6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutS homolog 6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000011987*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad1 cohesin complex component\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.11e-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000026371\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad21\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad21 cohesin complex component\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000022693\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad50\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad50 double strand repair protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000002053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51c\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000010638*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018365\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51d\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAD51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.35\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000027817\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAD51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000056842\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAD51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000064885\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAD51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000047813\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAD51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.92\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000004144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad51\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAD51 recombinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000045888\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad52\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad52 DNA repair protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000039864\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erec8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRec8 meiotic recombination protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000032822\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erec114\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRec114 meiotic recombination protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-1.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000057676\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmc1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStructural maintenance of chromosome 1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000039472\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmc1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStructural maintenance of chromosome 1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.74\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000005430\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmc2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStructural maintenance of chromosome 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000055515\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmc3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStructural maintenance of chromosome 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.51\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000010356\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmc4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStructural maintenance of chromosome 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000042929\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmc5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStructural maintenance of chromosome 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000021147\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epds5a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePDS5 cohesin associated factor B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000017951*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epds5b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePDS5 cohesin associated factor B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.7e-6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000001906*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003estag1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCohesin subunit SA 1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000022475\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003estag1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCohesin subunit SA 1B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000052961\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emre11\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDouble strand break repair nuclease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.92\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018605\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehfm1 (mer3)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHelicase for meiosis 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000053878*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eslc39a1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSolute carrier family 39A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000062463\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emus81\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCrossover junction endonuclease MUS81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.77\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eA positive log2 fold change (l2fc) indicates transcripts that were more abundant in asexual females when compared to sexual females. A negative log2 fold change indicates transcripts that were more abundant in sexual females when compared to asexual females. Asterisks indicate significant difference in expression levels between sexual and asexual females (padj\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentification of differentially expressed genes in sexual and asexual females of\u003c/b\u003e \u003cb\u003eC. gibelio\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAmong the 1728 differentially expressed genes revealed by transcriptome profile analysis, we specifically focussed on the genes related to reproduction pathways revealed by GO and KEGG enrichment analyses and published studies (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). We identified genes that were involved in reproduction pathways including cell cycle control, oocyte meiosis and maturation, and signalling pathways related to reproduction and sex differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e, see Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e for the list of the genes and their biological function).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of selected differently-expressed genes potentially involved in the reproduction of \u003cem\u003eC. gibelio\u003c/em\u003e, including the description of gene function according to the biological databases Uniprot, KEGG, Zfin and GeneCards unless other references are mentioned.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnsembl ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGene function\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003el2fc\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003epadj\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000024627\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eacvr2ba\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eActivin receptor 2B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTransduces activin signal from cell surface to cytoplasm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000025713\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eakt1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRAC-alpha serine/threonine-protein kinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMeiotic maturation (126)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000012651\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ebambia\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBMP and activin membrane bound inhibitor receptor 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGF-β signal transduction\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000010645\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ebcl2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eApoptosis regulator Bcl-2-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eApoptosis regulation and oocyte development\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000036539\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ebmp2b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBone morphogenetic protein 2-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGrowth factor involved in diverse cell processes including oocyte maturation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000042808\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ebmp8a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBone morphogenetic protein 8A-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGrowth factor involved in diverse cell processes including oocyte maturation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-7.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000045704\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ebuc\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBucky ball\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFormation of the Balbiani body in the oocyte, establishment of oocyte polarity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000067925\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ec1orf146\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChromosome 31 c1orf146 homolog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSynaptonemal complex assembly and meiotic recombination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000061657\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecalm3a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCalmodulin 3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFertilization Ca\u003csup\u003e2+\u003c/sup\u003e-dependant signal transduction pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000004753\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecamk1gb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCalcium/calmodulin-dependent protein kinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e-dependant signal transduction pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000025177\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecamsap2a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCalmodulin-regulated spectrin-associated protein 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm binding protein in males\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000044731\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eccna2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclin A2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000066013\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eccnb2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclin-B2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000026715\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eccnd2a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclin D2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000060407\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eccnf\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclin F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000058284\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecdk14\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclin dependant kinase 14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000063775\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecdk5rap1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDK5 regulatory subunit associated protein 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000030409\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eclec\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC-type lectin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell surface receptor involved in cell communication during egg fertilization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000046375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eclk4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual specific protein kinase CLK4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSex differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000056466\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecpeb1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCytoplasmic polyadenylation element binding\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell proliferation regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-5.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018125\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecxcl12a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChemokine ligand 12a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDevelopment of oocytes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-3.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000069389\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecyp19a1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCytochrome P450 19 A 1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOvarian follicle development and female sex determination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000036303\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eddx20\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDExD-box helicase 20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOvarian development and function (127)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000010183\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eddx52\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDExD-box helicase 52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000031374\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003edmrt2a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDoublesex and mab3 related transcription factor 2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale germ cell development and oogenesis (128)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000062724\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003edmrta2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDoublesex and mab3-related transcription factor 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale germ cell development and oogenesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000008338\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ee2f1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eE2F transcription factor 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000037330\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efbxo15\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF-box protein 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEmbryonic development\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000050933\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efbxo28\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF-box only protein 28-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control and substrates degradation in meiosis (129)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000056526\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eemi1 (fbxo5)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF-box protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRegulation of the APC in mitosis and meiosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-7.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000013439\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eemi1 (fbxo5)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF-box protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRegulation of the APC in mitosis and meiosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-8.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eemi1 (fbxo5)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF-box protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRegulation of the APC in mitosis and meiosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-7.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000028524\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efgf18a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFibroblast growth factor 18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOocyte nuclear maturation (130)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000016389\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efgf4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFibroblast growth factor 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOocyte differentiation (131)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000009251\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efmnl2a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormin-like 2A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell division and polarity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000056928\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003egadd45ba\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGrowth arrest and DNA damage 45 ba\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control (132)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000027726\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003egrapb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGRB2-related adapter protein B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOocyte meiosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000027104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eGrb2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGrowth factor receptor bound protein 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSignal transduction, GnRH signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000027108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eh2af1o\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHistone 2A F1o\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOocyte-specific histone H2A variant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000033210\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehbegf\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHeparin binding EGF like growth factor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGnRH signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000013938\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehrasa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGtpase hras-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell division regulation in response to growth factors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000021215\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehsd17b1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHydroxysteroid 17-beta dehydrogenase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEstrogen activation and androgen inactivation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000005210\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003einha\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInhibin Subunit Alpha\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOvarian development (133)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000015712\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003elbh\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLBH regulator of WNT signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOocyte maturation in Gibel carp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000017091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003elhcgr\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLuteinizing hormone/choriogonadotropin receptor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGonad development and differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000056775\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emad2l2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMitotic arrest deficient 2 like 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSpindle assembly checkpoint protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000062672\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emad2l2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMitotic arrest deficient 2 like 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSpindle assembly checkpoint protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000025045\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emapk8ip3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMAPK 8 interacting protein 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eInvolved in FSH signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000019928\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emcm5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMinichromosome maintenance complex component 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000048754\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003emcm9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMinichromosome maintenance complex component 9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRepair of double stranded DNA breaks\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000035099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003encoa2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNuclear receptor coactivator 2-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eActivation of steroid receptors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000039143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003enqo1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNAD(P)H quinone dehydrogenase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control (134)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000020971\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eoxtr\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOxytocin receptor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eControl of reproductive systems\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000004805\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epiwil2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePiwi-like protein 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMeiotic differentiation of spermatocytes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000061907\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epkcdb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProtein kinase C DB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eComponent of the GnRH signalling pathway (135)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000028187\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epkcba\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProtein kinase C BA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eComponent of the GnRH signalling pathway (135)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000013369\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eplcb4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhospholipase C beta 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm cell fertilization (136)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000034226\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eplcd4b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhospholipase C delta 4b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm cell fertilization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000049505\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epld4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhospholipase D family member 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGnRH signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000044904\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eplxnb1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePlexin-B1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFollicular development (137)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000011987\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erad1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRad1 cohesin complex component\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle checkpoint protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000036380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erasa1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRas GTPase-activating protein 1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell division regulation in response to growth factors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000013635\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erasa1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRas GTPase-activating protein 1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell division regulation in response to growth factors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000053044\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erasl11b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRas-like protein family member 11B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSexual reproduction\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000014802\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erassf7b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRas association domain-containing protein 7-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-8.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000012505\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erbpms2b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRNA-binding protein with multiple splicing 2-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOvarian development (138)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000019039\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erfc3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReplication factor C3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle progression (139)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000045179\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003erfc4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReplication factor C4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle progression\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000022178\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ernf212\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRing finger protein 212\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMeiotic recombination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000006237\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esbk3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSerine/threonine-protein kinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale meiosis chromosome segregation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-7.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000044509\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esetd7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSET domain containing 7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSex differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018258\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmad2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMothers against decapentaplegic homolog 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGF-β signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000064397\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esmad6a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMothers against decapentaplegic homolog 6-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGF-β signalling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000058624\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esox8a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSRY-box transcription factor 8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale sex determination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000007149\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003espag1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSperm-associated antigen 1A-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm cell fertilization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000000918\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003espinb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSpindlin-Z-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGametogenesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000017015\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003espinw\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSpindlin-W-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGametogenesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000016377\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003espo11\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSPO11 initiator of meiotic double stranded breaks\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMeiotic recombination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000001906\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003estag1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCohesin subunit STAG1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSister chromatid cohesion complex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000007335\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003estk32c\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSerine/threonine-protein kinase 32C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRegulation of meiosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018451\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esyce1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSynaptonemal complex element 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePart of the synaptonemal complex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000041319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003etgfb1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTransforming growth factor beta-1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDiverse pathways including gonadal growth\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000003682\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003etgfb1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTransforming growth factor beta-1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDiverse pathways including gonadal growth\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000049821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003euhrf1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUbiquitin-like containing PHD and RING finger domain 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control, epigenetic regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000031722\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ewnt5b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWnt-5B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOvarian development\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000042293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ewnt7bb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProtein Wnt-7b-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOvarian development\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000029293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ezp3el\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZona Pellucida Sperm-Binding Protein 3-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm binding glycoprotein of the egg coat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000015906\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ezp3el\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZona Pellucida Sperm-Binding Protein 3-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm binding glycoprotein of the egg coat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000007183\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ezpel3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZona Pellucida Sperm-Binding Protein 3-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm binding glycoprotein of the egg coat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000042829\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ezpel3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZona Pellucida Sperm-Binding Protein 3-Like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSperm binding glycoprotein of the egg coat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000054343\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003esgo\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eShugoshin 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eChromosome cohesion during cell division\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000000832\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eplkk1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSerine/threonine-protein kinase 10-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control and meiosis regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000055958\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eccnd3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCyclin D3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000038200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efmnl1a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormin-like 1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell division and polarity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000032499\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eaurka (=\u0026thinsp;eg2)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAurora kinase A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle control, spindle assembly during chromosome segregation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000058511\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003epp1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSer/thr-protein phosphatase PP1 catalytic subunit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOocyte meiosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000005591\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecdc20\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell division cycle protein 20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle and meiosis regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000030662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecdc25\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCell division cycle protein 25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle and meiosis regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000064615\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efzr1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFizzy and cell division cycle 20 related 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCell cycle and meiosis regulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000002809\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecreb (=\u0026thinsp;atf4b)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecAMP-dependent transcription factor ATF-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGnRH signaling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000022063\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eacvr1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eActivin receptor 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGF-B signaling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-0.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000045643\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003efk\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDelta14-sterol reductase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSteroid biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000066569\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003este1 (=\u0026thinsp;sc5d)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLathosterol oxidase-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSteroid biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000063352\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eerg3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSterol desaturase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSteroid biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000040844\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehyd1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCholestenol Delta-isomerase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSteroid biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000069123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecyp27b1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCytochrome P450 27 b 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSteroid biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eENSCARG00000018413\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ehsd3b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBeta-hydroxy-Delta5-steroid dehydrogenase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSteroid biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eA positive log2 fold change indicates transcripts that were more abundant in asexual females when compared to sexual females. A negative log2 fold change indicates transcripts that were more abundant in sexual females when compared to asexual females. Abbreviations: APC: anaphase promoting complex, BMP: bone morphogenic protein, CDK: cyclin dependant kinase, GnRH: gonadotropin releasing hormone, TGF: transforming growth factor. Asterisks indicate statistically significant differences between sexual and asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e based on padj value: *padj\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **padj\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***padj\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003c/p\u003e \u003cp\u003eAsexual females retained detectable expressions of all the reproduction-associated genes identified. However, several genes involved in cell cycle control were differently expressed between asexual and sexual females. Asexual females upregulated genes of the Cyclin family, such as \u003cem\u003eccna2, ccnb2\u003c/em\u003e, \u003cem\u003eccnd2a\u003c/em\u003e and \u003cem\u003eccnf\u003c/em\u003e as well as \u003cem\u003ecdk14\u003c/em\u003e, a member of the cyclin dependant kinase family (\u003cb\u003eAdditional file 2\u003c/b\u003e). They also upregulated \u003cem\u003egrowth arrest and DNA damage protein 45 alpha B\u003c/em\u003e (\u003cem\u003egadd45ab\u003c/em\u003e), the activator \u003cem\u003ee2f1\u003c/em\u003e, \u003cem\u003emitotic arrest deficient 2 like 2\u003c/em\u003e (\u003cem\u003emad2l2\u003c/em\u003e), \u003cem\u003ering finger 212\u003c/em\u003e (\u003cem\u003ernf212\u003c/em\u003e), \u003cem\u003eaurora kinase\u003c/em\u003e a (\u003cem\u003eaurora a), cell division cycle protein 20 (cdc20)\u003c/em\u003e, the apoptosis regulator \u003cem\u003ebcl2\u003c/em\u003e, \u003cem\u003eserine threonine kinase 1\u003c/em\u003e (\u003cem\u003eakt1)\u003c/em\u003e, and \u003cem\u003ecdk5rap1\u003c/em\u003e, which encodes the CDK5 regulatory-subunit-associated protein 1 (see Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e for their functions). Members of the formin family, \u003cem\u003efmnl1a\u003c/em\u003e and \u003cem\u003efmnl2a\u003c/em\u003e, were also upregulated in asexual females, as well as the spindlin \u003cem\u003espinb\u003c/em\u003e, while \u003cem\u003espinw\u003c/em\u003e was downregulated. Sexual females also upregulated two genes encoding ATP-dependant RNA helicases, \u003cem\u003eddx20\u003c/em\u003e and \u003cem\u003eddx52\u003c/em\u003e; as well as \u003cem\u003enqo1\u003c/em\u003e, which encodes the NAD(P)H quinone dehydrogenase 1; \u003cem\u003erassf7b\u003c/em\u003e, which encodes the ras-associated domain-containing protein 7b; and \u003cem\u003estag1a\u003c/em\u003e, which encodes a cohesin subunit.\u003c/p\u003e \u003cp\u003eSexual females upregulated genes involved in oocyte meiosis such as \u003cem\u003eshugoshin 1 (sgo1)\u003c/em\u003e; \u003cem\u003eserine/threonine kinase 10\u003c/em\u003e (\u003cem\u003eplkk1\u003c/em\u003e); \u003cem\u003ephosphatase 1 (pp1\u003c/em\u003e); \u003cem\u003eserine/threonine-protein kinase 32C\u003c/em\u003e (\u003cem\u003estk32c\u003c/em\u003e); \u003cem\u003ecytoplasmic polyadenylation element binging\u003c/em\u003e (\u003cem\u003ecpeb\u003c/em\u003e); \u003cem\u003esyce1\u003c/em\u003e, which encodes a protein of the synaptonemal complex that forms between homologous chromosomes during meiosis; and several gene copies of \u003cem\u003eearly mitotic inhibitor 1 (emi1\u003c/em\u003e, also known as \u003cem\u003efbxo5)\u003c/em\u003e (\u003cb\u003eAdditional file 3\u003c/b\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). They also upregulated genes involved in DNA mismatch repair, including \u003cem\u003erfc4 (replication factor C subunit 4\u003c/em\u003e) and genes that encode components of the minichromosome maintenance protein complex, \u003cem\u003emcm5\u003c/em\u003e and \u003cem\u003emcm9\u003c/em\u003e. Inversely, asexual females upregulated \u003cem\u003eC1orf146\u003c/em\u003e, involved in synaptonemal complex assembly.\u003c/p\u003e \u003cp\u003eConcerning oocyte maturation pathways (\u003cb\u003eAdditional file 4\u003c/b\u003e), sexual females upregulated \u003cem\u003ebucky ball\u003c/em\u003e (\u003cem\u003ebuc\u003c/em\u003e), \u003cem\u003ecell division cycle protein 25 (cdc25)\u003c/em\u003e, \u003cem\u003efizzy-related protein homolog 1b (fzr1b)\u003c/em\u003e, \u003cem\u003ephospholipases cb4\u003c/em\u003e and \u003cem\u003ecd4\u003c/em\u003e (\u003cem\u003eplcb4\u003c/em\u003e and \u003cem\u003eplcd4)\u003c/em\u003e, and several gene copies of \u003cem\u003ezona-pellucida sperm-binding protein 3\u003c/em\u003e (\u003cem\u003ezp3el\u003c/em\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). On the other hand, asexual females upregulated \u003cem\u003eh2af1\u003c/em\u003e, which encodes an oocyte-specific histone, and \u003cem\u003euhrf1\u003c/em\u003e, which encodes the oocyte specific cell cycle regulator E3 ubiquitin ligase. Members of the \u003cem\u003efibroblast growth factor\u003c/em\u003e (\u003cem\u003efgf\u003c/em\u003e) family were also upregulated. Several egg fertilization-related genes were differently regulated. \u003cem\u003eCalmodulin 3a\u003c/em\u003e (\u003cem\u003ecalm3a)\u003c/em\u003e, \u003cem\u003espag1a (sperm-associated antigen 1a-like\u003c/em\u003e), and \u003cem\u003eclec\u003c/em\u003e, which encodes a C-type lectin, were upregulated in sexual females (\u003cb\u003eAdditional file 3\u003c/b\u003e). \u003cem\u003eCamk1gb\u003c/em\u003e, which encodes a calcium/calmodulin-dependent protein kinase, and \u003cem\u003ecalmodulin-regulated spectrin-associated protein 2 (camsap2a)\u003c/em\u003e were upregulated in asexual females (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenes involved in signalling pathways were also differentially regulated. Sexual females upregulated genes involved in the gonadotropin releasing hormone (GnRH) signalling pathway, which is important for female sexual differentiation (\u003cb\u003eAdditional file 5)\u003c/b\u003e, such as \u003cem\u003ecreb\u003c/em\u003e, \u003cem\u003eheparin-binding egf-like growth factor (hbegf\u003c/em\u003e), \u003cem\u003egrowth factor receptor-bound protein 2 (grb2\u003c/em\u003e), \u003cem\u003erbpms2b\u003c/em\u003e, involved in ovarian development, and members of the Ras/MAPK family, specifically, \u003cem\u003ehrasa, hrasb\u003c/em\u003e and \u003cem\u003erasa1b\u003c/em\u003e, as well as \u003cem\u003elimb bud-heart (lbh)\u003c/em\u003e, \u003cem\u003ebmp8\u003c/em\u003e and \u003cem\u003ebambia\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Asexual females upregulated \u003cem\u003epkc\u003c/em\u003e; \u003cem\u003ephospholipase d4b (pld4b); mapk8ip3\u003c/em\u003e, involved in the FSH signalling pathway; the protein-kinase encoding gene \u003cem\u003eclk4\u003c/em\u003e; \u003cem\u003eplexin b1a\u003c/em\u003e; \u003cem\u003ebmp2b\u003c/em\u003e; and members of the \u003cem\u003ewnt\u003c/em\u003e family (\u003cem\u003ewnt5\u003c/em\u003e and \u003cem\u003e7\u003c/em\u003e); as well as \u003cem\u003efbxo15\u003c/em\u003e and \u003cem\u003efbxo28\u003c/em\u003e, two members of the \u003cem\u003efbxo\u003c/em\u003e family (F-box with uncharacterized domains). Furthermore, components of the TGF-β (transforming growth factor) signalling pathway were differently regulated. \u003cem\u003eTgf-β 1a\u003c/em\u003e was upregulated in sexual females, while the activin receptors \u003cem\u003eacvr1\u003c/em\u003e and \u003cem\u003eacvr2ba, bmp and activin membrane bound inhibitor activin receptor 2\u003c/em\u003e (\u003cem\u003ebambia\u003c/em\u003e), the receptor regulated \u003cem\u003emothers against decapentaplegic homolog\u003c/em\u003e (\u003cem\u003esmad2\u003c/em\u003e) and the inhibitory \u003cem\u003esmad6\u003c/em\u003e were downregulated (\u003cb\u003eAdditional file 6\u003c/b\u003e).\u003c/p\u003e \u003cp\u003eKEGG analysis identified DEGs involved in hormonal systems. Asexual females upregulated \u003cem\u003ecyp19a1a\u003c/em\u003e, the \u003cem\u003edoublesex and mab3 related transcription factors dmrta2\u003c/em\u003e and \u003cem\u003edmrt2a\u003c/em\u003e, the \u003cem\u003esry-box transcription factor sox8a\u003c/em\u003e, \u003cem\u003einhibin alpha\u003c/em\u003e (\u003cem\u003einha)\u003c/em\u003e, and \u003cem\u003eoxtr\u003c/em\u003e, encoding the oxytocin receptor (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Sexual females upregulated \u003cem\u003epiwil2\u003c/em\u003e, \u003cem\u003ec-x-c motif chemokine 12\u003c/em\u003e (\u003cem\u003ecxcl12)\u003c/em\u003e, \u003cem\u003enuclear receptor coactivator 2\u003c/em\u003e (\u003cem\u003encoa2)\u003c/em\u003e, and \u003cem\u003eluteinizing hormone/choriogonadotropin receptor (lhcgr)\u003c/em\u003e. Several genes related to steroid biosynthesis were also found to be differently regulated between asexual and sexual females (\u003cb\u003eAdditional file 7\u003c/b\u003e). Asexual females upregulated \u003cem\u003edelta14-sterol reductase\u003c/em\u003e (\u003cem\u003efk)\u003c/em\u003e; \u003cem\u003elathosterol oxidase-like (ste1)\u003c/em\u003e; \u003cem\u003e17beta-estradiol 17-dehydrogenase (hsd17b1\u003c/em\u003e, 1.1.1.62); \u003cem\u003eβ-hydroxy-δ5-steroid dehydrogenase\u003c/em\u003e (\u003cem\u003eHsd3b\u003c/em\u003e); and genes encoding a glucuronosyltransferase (EC 2.4.1.17), a squalene synthase (EC 2.5.1.21), a delta14-sterol reductase (1.3.1.70), a sterol desaturase (\u003cem\u003eerg3\u003c/em\u003e), and a lathosterol oxidase (EC 1.14.19.20). They downregulated \u003cem\u003ehyd1\u003c/em\u003e, which encodes a cholestenol delta isomerase; the cytochrome P450 family member \u003cem\u003ecyp27b1\u003c/em\u003e (EC 1.14.15.18); and genes encoding a cholestenone-5-alpha-reductase (EC 1.3.1.22), a cholestenol delta-isomerase (EC 5.3.3.5), and a cholesterase (EC 3.1.1.13) (\u003cb\u003eAdditional file 7\u003c/b\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eValidation of gene expression resulting from RNAseq by RT-qPCR\u003c/h2\u003e \u003cp\u003eTo validate the DEGs revealed by RNAseq, we performed RT-qPCR for 17 selected genes involved in reproduction that were significantly up- or downregulated in asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e compared to sexual females (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The RT-qPCR analysis confirmed the downregulation of 10 and upregulation of 7 reproduction-associated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003e). There was a positive correlation between the log2 fold change of RNAseq and the log2 fold change of qPCR (r\u0026thinsp;=\u0026thinsp;0.89, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (\u003cb\u003eAdditional file 8\u003c/b\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study analysed the transcriptome profiles of gonadal tissues from \u003cem\u003eC. gibelio\u003c/em\u003e using RNA-seq, specifically to identify DEGs in ovaries associated with reproduction in triploid gynogenetic females and diploid sexual females. We also analysed the transcriptome profiles of ovaries and testes in males of \u003cem\u003eC. gibelio\u003c/em\u003e, and the two closely-related species \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e. A total of 1728 genes were significantly upregulated or downregulated in asexual females of \u003cem\u003eC. gibelio\u003c/em\u003e compared to sexual females. The transcriptome profiles based on normalized RNAseq read counts showed a sex-dependant difference for both - all transcribed genes or reproduction-associated genes, with an overall similarity between gynogenetic and sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e and females of \u003cem\u003eC. auratus\u003c/em\u003e, and an overall similarity between the males of the two \u003cem\u003eCarassius\u003c/em\u003e species.\u003c/p\u003e \u003cp\u003eGO term overrepresentation analyses and KEGG pathway enrichment analyses indicated an overall overexpression of genes involved in meiosis and cell cycle control (cell cycle, negative regulation of nuclear division, negative regulation of cell cycle process, oocyte meiosis, and synaptonemal complex assembly), oocyte maturation (egg coat formation, structural constituent of egg coat, and calcium ion binding) and fertilization (binding of sperm to zona pellucida, positive regulation of acrosome reaction). Calcium ion binding, which plays critical roles in fertilization and early development (for review, see Whitaker (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e)), was also overrepresented in sexual females. This suggests that the regulation of oogenesis, as well as the response of oocytes to sperm cell binding, differ between sexual reproduction and gynogenesis, where the eggs are only activated by the sperm cell (for review, see Schlupp (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e)). An overall downregulation of meiotic and reproduction-associated genes was also reported in \u003cem\u003ePoecilia formosa\u003c/em\u003e, a gynogenetic fish species of the Amazon basin, compared to its sexual parental ancestors, \u003cem\u003eP. mexicana\u003c/em\u003e and \u003cem\u003eP. latipinna\u003c/em\u003e (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Similar results were reported in invertebrates that use cyclical parthenogenesis, such as the planktonic crustacean \u003cem\u003eDaphnia\u003c/em\u003e, rotifers, and aphids, where the sexual forms upregulate genes involved in cell cycle control, meiosis, oogenesis, and oocyte maturation (\u003cspan additionalcitationids=\"CR70 CR71\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOn the basis of ovarian transcriptome profiles, we identified around 100 reproduction-associated genes related to oocyte meiosis, oogenesis, embryogenesis, hormone signalling, and fertilization that were differently expressed between sexual and gynogenetic females; the expression pattern of a set of 17 selected genes based on the basis of RNAseq was validated by RT-qPCR. We also specifically analysed 40 meiosis-related genes inferred by previous studies (\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). We showed that sexual females upregulated several meiosis-associated genes involved in recombination and crossover and in DNA double-strand break formation during meiosis, including \u003cem\u003espo11, msh2\u003c/em\u003e, \u003cem\u003epds5b\u003c/em\u003e, \u003cem\u003esbk3\u003c/em\u003e, \u003cem\u003estag1a\u003c/em\u003e, and \u003cem\u003erec114\u003c/em\u003e. Two components of the minichromosome complex (\u003cem\u003emcm4\u003c/em\u003e and \u003cem\u003emcm9\u003c/em\u003e), involved in crossover inhibition during meiosis (\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e), as well as \u003cem\u003esyce1\u003c/em\u003e, a component of the synaptonemal complex that forms between homologous chromosomes during recombination, were also upregulated in sexual females (\u003cspan additionalcitationids=\"CR75\" citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e). Sexual females also upregulated genes involved in oocyte maturation, such as \u003cem\u003eemi1\u003c/em\u003e (also named \u003cem\u003efbxo5\u003c/em\u003e), a major F-box constituent of the E3 ubiquitin ligase protein that regulates the anaphase promoting complex (APC) during meiosis and mitosis (\u003cspan additionalcitationids=\"CR78 CR79\" citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e); and \u003cem\u003espinw\u003c/em\u003e, a major maternal transcript expressed in oocytes during early development. The importance of spindlin in oocytes to embryo transition in \u003cem\u003eC. gibelio\u003c/em\u003e has been established (\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e). Furthermore, several genes involved in cell cycle regulation, including three members of the Ras/MAPK family, \u003cem\u003ehrasa, hrasb and rasa1b\u003c/em\u003e, which encode GTPases controlling cell growth, division, and differentiation (\u003cspan additionalcitationids=\"CR83 CR84\" citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e) through the action of mitogen activated protein kinases (\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e), were also more expressed in sexual females. This suggests that cell cycle control regulation differs between sexual and gynogenetic females of \u003cem\u003eC. gibelio\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn accordance with our results, gynogenetic \u003cem\u003eP. formosa\u003c/em\u003e was shown to underexpress meiosis-related genes, including \u003cem\u003esbk3, setd7\u003c/em\u003e and \u003cem\u003estk32c\u003c/em\u003e, compared to its supposed sexual ancestors (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Similarly, in cyclically parthenogenetic \u003cem\u003eDaphnia\u003c/em\u003e, meiosis-related genes, including genes related to the spindle assembly checkpoint, the APC, and meiosis chromosome segregation, were upregulated during sexual reproduction (\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e). In particular, \u003cem\u003espo11\u003c/em\u003e, which encodes a topoisomerase involved in chromosomal recombination during the meiotic prophase, was also described as an important player in the meiosis-to-parthenogenesis transition in pea aphid (\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e), although it was not reported in asexual \u003cem\u003eP. formosa\u003c/em\u003e (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, our study also revealed that meiosis pathways were not fully disrupted in gynogenetic females of \u003cem\u003eC. gibelio\u003c/em\u003e. They retained detectable expressions of all reproduction-associated genes identified, including meiosis-specific genes, in contrast to \u003cem\u003eP. formosa\u003c/em\u003e, where some meiosis-related genes were not expressed (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). According to our analyses, several of the core meiosis specific genes, such as \u003cem\u003edmc1, mlh1, mnd1, mre11\u003c/em\u003e and genes of the \u003cem\u003emsh\u003c/em\u003e family (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e), did not show significant differences in expression between sexual and gynogenetic females of gibel carp. Gynogenetic females even upregulated \u003cem\u003erad1\u003c/em\u003e, a member of the cell cycle checkpoint, also involved in the recombination process during meiosis; \u003cem\u003ernf212\u003c/em\u003e, involved in meiotic recombination; and \u003cem\u003emad2l2\u003c/em\u003e, involved in the spindle assembly checkpoint; as well as meiosis-specific genes that were previously found to be downregulated in gynogenetic \u003cem\u003eP. formosa\u003c/em\u003e, such as \u003cem\u003eb4galt, clk4, dmrta2, grapb\u003c/em\u003e, and \u003cem\u003erasl11b\u003c/em\u003e (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). However, these results are in accordance with a study suggesting that meiosis is retained even in gynogenetic strains of \u003cem\u003eC. gibelio\u003c/em\u003e in North-east Asia (\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e). Furthermore, meiosis genes were reported not to be necessarily associated with sexual reproduction, since asexual amoeba constitutively expressed meiosis-associated genes (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Similar results were reported also in rotifers, where no meiosis-specific genes were differently expressed between parthenogenetic and sexual forms (\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e), and cyclically-parthenogenetic \u003cem\u003eDaphnia\u003c/em\u003e, which was shown to express meiosis-specific genes during the parthenogenetic phase (\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e). In the pea aphid, several oogenesis and cell cycle-related genes were also upregulated during the asexual reproduction phase (\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur results reveal an overall upregulation of pathways related to oocyte maturation in sexual females. They upregulated \u003cem\u003ebuc\u003c/em\u003e, involved in the formation of Balbiani bodies in the oocytes and germ plasm assembly, including follicular epithelium morphogenesis (\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e). This gene plays a key role in the specification of oocyte anterior/posterior polarity through interactions with the RNA-binding proteins, such as \u003cem\u003erbpms2\u003c/em\u003e, a coactivator of transcriptional activity involved in meiosis and oogenesis (\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e). Sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e also upregulate genes involved in progesterone-mediated oocyte maturation, such as members of the plexin and Wnt families. The Wnt pathway regulator \u003cem\u003elbh\u003c/em\u003e, previously reported to be upregulated in females during oocyte maturation in \u003cem\u003eC. gibeli\u003c/em\u003eo, was also more expressed in sexual females in our study. Similarly, in aphids, genes involved in oocyte axis formation were found to be upregulated during the sexual phase (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e). Furthermore, our analyses support an overall upregulation of sperm-egg recognition and fertilization pathways in sexual females. They upregulated \u003cem\u003ecalm3a\u003c/em\u003e, a member of the calmodulin family responsible for calcium-dependant signal transduction following sperm binding, as well as \u003cem\u003eplcb4\u003c/em\u003e, a phospholipase involved in oocyte fertilization (\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e). In addition, sexual females upregulated components of the zona pellucida, the extracellular matrix surrounding the oocyte involved in sperm-egg recognition (\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e). A gene encoding a Ca\u003csup\u003e2+\u003c/sup\u003e-dependant C-type lectin, which was shown to be translocated in cortical granules during oocyte maturation and involved in sperm-egg recognition and fertilization in \u003cem\u003eC. gibelio\u003c/em\u003e (\u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e), was also significantly upregulated in sexual females. These findings highlight the importance of oocyte maturation, sperm-egg recognition, and fertilization pathways in the coexistence of sexual and asexual females.\u003c/p\u003e \u003cp\u003eInversely, some genes involved in oocyte development, such as DAZ-like genes, were not differentially expressed between gynogenetic and sexual females of gibel carp in our study, while others, including \u003cem\u003ebcl2\u003c/em\u003e; the oocyte specific histone \u003cem\u003eh2af1o\u003c/em\u003e, which plays a key role in fish embryogenesis (\u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e); and several members of the FGF family, which promote meiosis and maturation of the oocytes (\u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e96\u003c/span\u003e), were even more expressed in asexual females than in sexual ones. Oocyte maturation and sperm cell binding pathways are not expected to be disrupted in asexual females, since they produce oocytes. Furthermore, gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e females still require sperm cell binding to activate the eggs (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e, \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e). The overexpression of some oogenesis-related genes was also reported in aphids during the parthenogenetic phase of their life cycle (\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e). Furthermore, the downregulation of \u003cem\u003euhrf1\u003c/em\u003e, an oocyte-specific epigenetic regulator (\u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e98\u003c/span\u003e) in sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e, also reported in aphids (\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e), suggests a difference in the epigenetic regulation of oogenesis between sexual and asexual forms. Hence, these results suggest that many genes and pathways are involved in both parthenogenetic oogenesis and sexual oogenesis in \u003cem\u003eC. gibelio\u003c/em\u003e. However, gene expression differs between the two reproduction forms. It is noteworthy that members of the same gene family can be up- or downregulated, such as members of the zona pellucida and F-box families. Such divergent expression, also reported in \u003cem\u003eDaphnia\u003c/em\u003e (\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e), may suggest functional divergence among members of the same multigenic families.\u003c/p\u003e \u003cp\u003eOur analyses also suggest differences in hormonal signalling and sex differentiation processes between sexual and gynogenetic reproduction. Components of the GnRH signalling pathway, and genes linked to ovarian fertility, such as the gene encoding the luteinizing hormone/choriogonadotropin receptor \u003cem\u003e(lhcgr)\u003c/em\u003e, were more expressed in sexual females. The TGF-β signalling pathway, involved in many physiological processes including sexual differentiation in fish (\u003cspan additionalcitationids=\"CR100\" citationid=\"CR99\" class=\"CitationRef\"\u003e99\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e101\u003c/span\u003e), was also differently regulated between gynogenetic and sexual females of \u003cem\u003eC. gibelio\u003c/em\u003e. Sexual females upregulated \u003cem\u003esmad\u003c/em\u003e genes, involved in oogenesis, ovarian function, and folliculogenesis \u003cem\u003evia\u003c/em\u003e the negative regulation of TGF-β signalling. Regarding gynogenetic females, they upregulated two \u003cem\u003edmrt\u003c/em\u003e genes. These genes were shown to promote male differentiation and repress female-specific differentiation of the gonads, and they are also involved in brain sexual differentiation (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e104\u003c/span\u003e, \u003cspan citationid=\"CR105\" class=\"CitationRef\"\u003e105\u003c/span\u003e) as well as in XY reversal in sex-alternating fish species (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). Gynogenetic females of \u003cem\u003eC. gibelio\u003c/em\u003e also upregulated \u003cem\u003encoa2\u003c/em\u003e, a transcriptional coactivator of steroid receptors and nuclear receptor, as well as \u003cem\u003esox8\u003c/em\u003e, involved in female sex determination (\u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e106\u003c/span\u003e), meiotic progression, and embryonic development (\u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e107\u003c/span\u003e), and inhibin alpha (\u003cem\u003einha)\u003c/em\u003e, involved in steroid hormone biosynthesis. Ovarian aromatase or estrogen synthetase (\u003cem\u003ecyp19a1a\u003c/em\u003e), a member of the cytochrome P450 subfamily involved in steroidogenesis (\u003cspan citationid=\"CR108\" class=\"CitationRef\"\u003e108\u003c/span\u003e) and female folliculogenesis and gonadal differentiation, was also upregulated in gynogenetic females of \u003cem\u003eC. gibelio\u003c/em\u003e, as was \u003cem\u003eoxtr\u003c/em\u003e, a gene encoding the oxytocin receptor, a component of the oxytocin signalling system that modulates reproductive behaviour. Our results also suggest that sexual females upregulated some genes associated with the steroid hormone synthesis pathway. The hydroxysteroid 17-β-dehydrogenase gene \u003cem\u003ehsd17b1\u003c/em\u003e, which is both estrogenic (\u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e109\u003c/span\u003e) and androgenic (\u003cspan citationid=\"CR110\" class=\"CitationRef\"\u003e110\u003c/span\u003e), was more expressed in gynogenetic females. Furthermore, sexual females also upregulated the germ cell maintenance gene \u003cem\u003epiwil2\u003c/em\u003e, a member of the Argonaute family involved in male fertility (\u003cspan citationid=\"CR111\" class=\"CitationRef\"\u003e111\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, we also investigated the evolutionary history of \u003cem\u003eC. gibelio\u003c/em\u003e. Ploidy changes shaped the evolution of cyprinids, particularly that of the \u003cem\u003eCarassius auratus\u003c/em\u003e complex. This complex was formed by allotetraploidization (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR112\" class=\"CitationRef\"\u003e112\u003c/span\u003e) and further polyploidization events have been reported in diverse lineages of the complex, including \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. gibelio\u003c/em\u003e (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR113\" class=\"CitationRef\"\u003e113\u003c/span\u003e). However, the evolutionary origin of \u003cem\u003eC. gibelio\u003c/em\u003e is still in question. A study based on \u003cem\u003edmrt\u003c/em\u003e genes suggested a recent autopolyploidization event within the \u003cem\u003eC. auratus\u003c/em\u003e complex that generated the triploid gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). However, an origin of \u003cem\u003eC. gibelio\u003c/em\u003e by hybridization between \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e has also been proposed (\u003cspan citationid=\"CR114\" class=\"CitationRef\"\u003e114\u003c/span\u003e). Our SNP clustering, based on gonadal transcriptomes, using \u003cem\u003eC. gibelio\u003c/em\u003e, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e, suggests a close evolutionary relationship between sexual and gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e, as well as a close relatedness between \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e. This is in accordance with a study showing that two gene copies of four different \u003cem\u003eHox\u003c/em\u003e genes in the genome of gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e are orthologous to the \u003cem\u003eHox\u003c/em\u003e genes of \u003cem\u003eC. auratus\u003c/em\u003e and that one is orthologous to the \u003cem\u003eHox\u003c/em\u003e gene of \u003cem\u003eC. carpio\u003c/em\u003e (\u003cspan citationid=\"CR114\" class=\"CitationRef\"\u003e114\u003c/span\u003e). That study suggested that triploid gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e (3n\u0026thinsp;=\u0026thinsp;15) resulted from interspecific hybridization between diploid \u003cem\u003eC. auratus\u003c/em\u003e (2n\u0026thinsp;=\u0026thinsp;100) and \u003cem\u003eC. carpio\u003c/em\u003e (2n\u0026thinsp;=\u0026thinsp;100), contributing with two sets and one set of chromosomes, respectively. However, the diploid form of \u003cem\u003eC. gibelio\u003c/em\u003e was not included in that study. Other studies using mtDNA and \u003cem\u003ehoxa2b\u003c/em\u003e gene sequences even suggested a more complex relationship between \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e, where the monophyly of \u003cem\u003eC. gibelio\u003c/em\u003e was not supported (\u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e115\u003c/span\u003e, \u003cspan citationid=\"CR116\" class=\"CitationRef\"\u003e116\u003c/span\u003e). In addition, gene flow was highlighted between the two species (\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e, \u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e115\u003c/span\u003e), suggesting that \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e were conspecific and interfertile.\u003c/p\u003e \u003cp\u003ePloidy changes often affect meiosis, and parthenogenetic species usually result from interspecific hybridization (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e) with some exceptions (\u003cspan citationid=\"CR117\" class=\"CitationRef\"\u003e117\u003c/span\u003e). Polyploidy can lead to the formation of unreduced eggs whose cell cycle is arrested at the metaphase of meiosis II (\u003cspan citationid=\"CR118\" class=\"CitationRef\"\u003e118\u003c/span\u003e). This results in asexually reproducing species, where the offspring are clones of the mother. Unisexual fish reproduce through gynogenesis, where the sperm from males of the same or closely-related species is still required to activate the egg. Still, because meiosis pathways were not disrupted, a later genetic contribution from a sperm donor such as \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eC. carpio\u003c/em\u003e cannot be excluded. Such a case of a complex evolutionary history was reported in the unisexual salamander \u003cem\u003eAmbystoma\u003c/em\u003e. However, in this case, the haploid genome of the sperm donor replaced the nuclear genome, a phenomenon known as kleptogenesis (\u003cspan citationid=\"CR119\" class=\"CitationRef\"\u003e119\u003c/span\u003e, \u003cspan citationid=\"CR120\" class=\"CitationRef\"\u003e120\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur results suggest that all along their evolutionary history, asexual lines of \u003cem\u003eC. gibelio\u003c/em\u003e did not lose the genetic toolkit for meiosis, and that the sexual reproduction genetic toolkit is not under relaxed selection, a condition also reported in asexual \u003cem\u003eP. formosa\u003c/em\u003e (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) and snails (\u003cspan citationid=\"CR121\" class=\"CitationRef\"\u003e121\u003c/span\u003e). The re-acquisition of sexual reproduction in asexual species is very rare and very few cases have been reported. Either some gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e females were able to secondarily regain sexual reproduction and to produce both diploid and triploid males, or a minority of sexual individuals still persisted within the already formed gynogenetic form and became more abundant later (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). In all cases, this led to the current sympatric coexistence of sexual and gynogenetic individuals (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR122\" class=\"CitationRef\"\u003e122\u003c/span\u003e). Polyploidy in general, and triploidy in the case of gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e could possibly compensate the deleterious effects of Muller\u0026rsquo;s ratchet or the accumulation of deleterious mutations by increasing the number of gene copies and favouring heterozygosity (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). The genomic incorporation of sperm-derived fragments from an exogenous species, which was reported in gynogenetic \u003cem\u003eC. gibelio\u003c/em\u003e from aquaculture in China (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e), can also favor genetic diversity in asexual lines. In \u003cem\u003eC. gibelio\u003c/em\u003e, the combination of the advantages of gynogenetic reproduction, which allows for faster population growth (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), and sexual reproduction, which provides higher resistance to parasites and higher immune gene variability (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e), higher aerobic performance and better immunity (\u003cspan citationid=\"CR123\" class=\"CitationRef\"\u003e123\u003c/span\u003e), lower metabolic rate, and lower energy intake (\u003cspan citationid=\"CR124\" class=\"CitationRef\"\u003e124\u003c/span\u003e), might explain the coexistence of sexual and asexual forms, and the high adaptive abilities of this species and its invasiveness in European water ecosystems.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWe gratefully acknowledge the Bioinformatics Core Facility of CEITEC Masaryk University for providing the transcriptomic data presented in this paper.\u0026nbsp;\u003c/em\u003eWe also kindly thank Matthew Nicholls for English revision of the final draft. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was funded by the Czech Science Foundation, Project No. 22-27023S. We declare that the contributions of Krist\u0026iacute;na Civ\u0026aacute;ňov\u0026aacute; Kř\u0026iacute;žov\u0026aacute; and Krist\u0026yacute;na Voř\u0026iacute;\u0026scaron;kov\u0026aacute; to this study were strictly associated only with their part-time commitment to project No. 22-27023S and that no institutional resources were provided by the Parasitology Group, Department of Botany and Zoology, Faculty of Science, Masaryk University Brno.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFJ processed data analyses with the assistance of TT, performed a part of qPCR, and wrote the manuscript. MD performed basic bioinformatics analyses. VB performed SNP analyses. KV performed library preparation. KCK and MS performed a part of qPCR. MHF and FJ performed RNA extraction and quantification. LV performed experimental breeding and fish sampling. A\u0026Scaron; designed and supervised the study and contributed to the interpretation of results and the writing of the manuscript. All authors approved the final version of the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data used in this study have been deposited in NCBI\u0026acute;s Gene Expression Omnibus (125) and are accessible through GEO Series accession number GSE254010 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE254010).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research was undertaken in line with the ethical requirements of the Czech Republic. The maintenance and care of experimental fish, as well as method of fish killing complied with legal requirements in the Czech Republic \u0026sect; 6, 7, 9 and 10 regulation No. 419/2012 about the care, breeding and using experimental animals. The experiment was approved by the Animal Care and Use Committee at the Faculty of Science, Masaryk University in Brno, Czech Republic. The experiment was conducted under the experimental project approved by the Ministry of Education, Sports and Youth under document n. MSMT-30071/2022-5.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCavalier-smith T. Origins of the machinery of recombination and sex. Heredity. 2002;88(2):125\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeaves WB, Baumann P. Unisexual reproduction among vertebrates. Trends Genet. 2011;27(3):81\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTobler M, Schlupp I. Parasites in sexual and asexual mollies (\u003cem\u003ePoecilia\u003c/em\u003e, Poeciliidae, Teleostei): a case for the Red Queen? Biol Lett. 2005;1(2):166\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDufresne F, Hebert PDN. Hybridization and Origins of Polyploidy. Proc R Soc Lond. 1994;(258):141\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHartfield M. On the origin of asexual species by means of hybridization and drift. Mol Ecol. 2016;25(14):3264\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanko K, Kotlik P, Rab P. Evolutionary history of asexual hybrid loaches (\u003cem\u003eCobitis\u003c/em\u003e: Teleostei) inferred from phylogenetic analysis of mitochondrial DNA variation. J Evol Biol. 2003;16(6):1280\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu S, Innes DJ, Lynch M, Cristescu ME. The role of hybridization in the origin and spread of asexuality in \u003cem\u003eDaphnia\u003c/em\u003e. Mol Ecol. 2013;22(17):4549\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamatsch DK, St\u0026ouml;ck M. Sperm-Dependent Parthenogenesis and Hybridogenesis in Teleost Fishes. In: Sch\u0026ouml;n I, Martens K, Dijk P, editors. Lost Sex [Internet]. Dordrecht: Springer Netherlands; 2009. p. 399\u0026ndash;432. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://link.springer.com/\u003c/span\u003e\u003cspan address=\"http://link.springer.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-90-481-2770-2_19\u003c/span\u003e\u003cspan address=\"10.1007/978-90-481-2770-2_19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRothfels CJ, Otto SP. Polyploid Speciation. In: Encyclopedia of Evolutionary Biology [Internet]. Elsevier; 2016. p. 317\u0026ndash;26. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://linkinghub.elsevier.com/retrieve/pii/B9780128000496000731\u003c/span\u003e\u003cspan address=\"https://linkinghub.elsevier.com/retrieve/pii/B9780128000496000731\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStenberg P, Saura A. Meiosis and Its Deviations in Polyploid Animals. Cytogenet Genome Res. 2013;140(2\u0026ndash;4):185\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan de Peer Y, Mizrachi E, Marchal K. The evolutionary significance of polyploidy. Nat Rev Genet. 2017;18(7):411\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaynard Smith J. The origin and maintenance of sex. 1971.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuller HJ. The relation of recombination to mutational advance. Mutat Res Mol Mech Mutagen. 1964;1(1):2\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtto SP. The Evolutionary Enigma of Sex. Am Nat. 2009;174(S1):1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJianFang G, Li Z. Genetic basis and breeding application of clonal diversity and dual reproduction modes in polyploid \u003cem\u003eCarassius auratus gibelio\u003c/em\u003e. 2010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAngers B, Schlosser IJ. The origin of \u003cem\u003ePhoxinus eos-neogaeus\u003c/em\u003e unisexual hybrids: hybridization in \u003cem\u003ePhoxinus\u003c/em\u003e. Mol Ecol. 2007;16(21):4562\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTichop\u0026aacute;d T, Franěk R, Dolež\u0026aacute;lkov\u0026aacute;-Kašt\u0026aacute;nkov\u0026aacute; M, Dedukh D, Marta A, Halačka K, et al. Clonal gametogenesis is triggered by intrinsic stimuli in the hybrid\u0026rsquo;s germ cells but is dependent on sex differentiation. Biol Reprod. 2022;107(2):446\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDedukh D, Da Cruz I, Kneitz S, Marta A, Ormanns J, Tichop\u0026aacute;d T, et al. Achiasmatic meiosis in the unisexual Amazon molly, \u003cem\u003ePoecilia formosa\u003c/em\u003e. Chromosome Res. 2022;30(4):443\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchedina IM, Groth D, Schlupp I, Tiedemann R. The gonadal transcriptome of the unisexual Amazon molly \u003cem\u003ePoecilia formosa\u003c/em\u003e in comparison to its sexual ancestors, \u003cem\u003ePoecilia mexicana\u003c/em\u003e and \u003cem\u003ePoecilia latipinna\u003c/em\u003e. BMC Genomics. 2018;19(1):12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlves MJ, Coelho MM, Collares-Pereira MJ. Evolution in action through hybridisation and polyploidy in an Iberian freshwater fish: a genetic review. Genetica. 2001;(111):375\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollares-Pereira MJ, Coelho MM. Reconfirming the hybrid origin and generic status of the Iberian cyprinid complex \u003cem\u003eSqualius alburnoides\u003c/em\u003e. J Fish Biol. 2010;76(3):707\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanfling B, Bolton P, Harley M, Carvalho GR. A molecular approach to detect hybridisation between crucian carp (\u003cem\u003eCarassius carassius\u003c/em\u003e) and non-indigenous carp species (\u003cem\u003eCarassius spp.\u003c/em\u003e and \u003cem\u003eCyprinus carpio\u003c/em\u003e). Freshw Biol. 2005;50(3):403\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuad MMH, Vetešn\u0026iacute;k L, Šimkov\u0026aacute; A. Is gynogenetic reproduction in gibel carp (\u003cem\u003eCarassius gibelio\u003c/em\u003e) a major trait responsible for invasiveness? J Vertebr Biol [Internet]. 2021;70(4). Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioone.org/journals/journal-of-vertebrate-biology/volume-70/issue-4/jvb.21049/Is-gynogenetic-reproduction-in-gibel-carp-Carassius-gibelio-a-major/\u003c/span\u003e\u003cspan address=\"https://bioone.org/journals/journal-of-vertebrate-biology/volume-70/issue-4/jvb.21049/Is-gynogenetic-reproduction-in-gibel-carp-Carassius-gibelio-a-major/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.25225/jvb.21049.full\u003c/span\u003e\u003cspan address=\"10.25225/jvb.21049.full\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu HP, Ma DM, Gui JF. Triploid origin of the gibel carp as revealed by 5S rDNA localization and chromosome painting. Chromosome Res. 2006;14(7):767\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuskov\u0026aacute; V, Lusk S, Halačka K, Vetešn\u0026iacute;k L. \u003cem\u003eCarassius auratus gibelio\u0026mdash;\u003c/em\u003eThe most successful invasive fish in waters of the Czech Republic. Russ J Biol Invasions. 2010;1(3):176\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou L, Wang Y, Gui JF. Genetic Evidence for Gonochoristic Reproduction in Gynogenetic Silver Crucian Carp (\u003cem\u003eCarassius auratus gibelio\u003c/em\u003e Bloch) as Revealed by RAPD Assays. J Mol Evol. 2000;51(5):498\u0026ndash;506.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen F, Li XY, Zhou L, Yu P, Wang ZW, Li Z, et al. Stable Genome Incorporation of Sperm-derived DNA Fragments in Gynogenetic Clone of Gibel Carp. Mar Biotechnol. 2020;22(1):54\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHakoyama H, Nishimura T, Matsubara N, Iguchi K. Difference in parasite load and nonspecific immune reaction between sexual and gynogenetic forms of \u003cem\u003eCarassius auratus\u003c/em\u003e. Biol J Linn Soc. 2001;72(3):401\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŠimkov\u0026aacute; A, Košař M, Vetešn\u0026iacute;k L, Vyskočilov\u0026aacute; M. MHC genes and parasitism in \u003cem\u003eCarassius gibelio\u003c/em\u003e, a diploid-triploid fish species with dual reproduction strategies. BMC Evol Biol. 2013;13(1):122.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore WS, McKay FE. Coexistence in Unisexual-Bisexual Species Complexes of \u003cem\u003ePoeciliopsis\u003c/em\u003e (Pisces: Poeciliidae). Ecology. 1971;52(5):791\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarron JN, Lawson TJ, Jensen PA. Analysis of potential factors allowing coexistence in a sexual/asexual minnow complex. Oecologia. 2016;180(3):707\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchley D, Doncaster CP, Sluckin T. Population models of sperm-dependent parthenogenesis. J Theor Biol. 2004;229(4):559\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVrijenhoek RC. UNISEXUAL FISH: Model Systems for Studying Ecology and Evolution. 1994;(25):71\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarbuti R, Mautner S, Carnevale G, Milazzo P, Rama A, Sturmbauer C. Population dynamics with a mixed type of sexual and asexual reproduction in a fluctuating environment. BMC Evol Biol. 2012;12(1):49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi XY, Zhang XJ, Li Z, Hong W, Liu W, Zhang J, et al. Evolutionary history of two divergent Dmrt1 genes reveals two rounds of polyploidy origins in gibel carp. Mol Phylogenet Evol. 2014;78:96\u0026ndash;104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo J, Gao Y, Ma W, Bi X y, Wang S y, Wang J et al. Tempo and mode of recurrent polyploidization in the Carassius auratus species complex (Cypriniformes, Cyprinidae). Heredity. 2014;112(4):415\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrews S. FastQC: a quality control tool for high throughput sequence data. 2010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Wang S, Li W. RSeQC: quality control of RNA-seq experiments. Bioinformatics. 2012;28(16):2184\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePicard Toolkit. [Internet]. Broad Institute. ; 2018. Available from: GitHub Repository. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://broadinstitute.github.io/picard/\u003c/span\u003e\u003cspan address=\"http://broadinstitute.github.io/picard/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; Broad Institute.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkonechnikov K, Conesa A, Garc\u0026iacute;a-Alcalde F. Qualimap 2: advanced multi-sample quality control for high-throughput sequencing data. Bioinformatics. 2016;32(2):292\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEwels P, Magnusson M, Lundin S, K\u0026auml;ller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32(19):3047\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Durbin R. Fast and accurate short read alignment with Burrows\u0026ndash;Wheeler transform. Bioinformatics. 2009;25(14):1754\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim S, Scheffler K, Halpern AL, Bekritsky MA, Noh E, K\u0026auml;llberg M, et al. Strelka2: fast and accurate calling of germline and somatic variants. Nat Methods. 2018;15(8):591\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022;50(W1):W216\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanehisa M, Furumichi M, Sato Y, Kawashima M, Ishiguro-Watanabe M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023;51(D1):D587\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThe Gene Ontology Consortium, Carbon S, Douglass E, Good BM, Unni DR, Harris NL, et al. The Gene Ontology resource: enriching a GOld mine. Nucleic Acids Res. 2021;49(D1):D325\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonnot T, Gillard M, Nagel D. A Simple Protocol for Informative Visualization of Enriched Gene Ontology Terms. BIO-Protoc [Internet]. 2019;9(22). Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bio-protocol.org/e3429\u003c/span\u003e\u003cspan address=\"https://bio-protocol.org/e3429\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSupek F, Bošnjak M, Škunca N, Šmuc T. REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms. Gibas C, editor. PLoS ONE. 2011;6(7):e21800.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKinsella RJ, Kahari A, Haider S, Zamora J, Proctor G, Spudich G, et al. Ensembl BioMarts: a hub for data retrieval across taxonomic space. Database. 2011;2011(0):bar030\u0026ndash;0.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaciver SK. Asexual Amoebae Escape Muller\u0026rsquo;s Ratchet through Polyploidy. Trends Parasitol. 2016;32(11):855\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatil S, Moeys S, Von Dassow P, Huysman MJJ, Mapleson D, De Veylder L, et al. Identification of the meiotic toolkit in diatoms and exploration of meiosis-specific SPO11 and RAD51 homologs in the sexual species \u003cem\u003ePseudo-nitzschia multistriata\u003c/em\u003e and \u003cem\u003eSeminavis robusta\u003c/em\u003e. BMC Genomics. 2015;16(1):930.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchurko AM, Logsdon JM. Using a meiosis detection toolkit to investigate ancient asexual scandals and the evolution of sex. BioEssays. 2008;30(6):579\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBairoch A. The Universal Protein Resource (UniProt). Nucleic Acids Res. 2004;33(Database issue):D154\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradford YM, Van Slyke CE, Ruzicka L, Singer A, Eagle A, Fashena D et al. Zebrafish information network, the knowledgebase for \u003cem\u003eDanio rerio\u003c/em\u003e research. Wood V, editor. Genetics. 2022;220(4):iyac016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafran M, Dalah I, Alexander J, Rosen N, Iny Stein T, Shmoish M, et al. GeneCards Version 3: the human gene integrator. Database. 2010;2010(0):baq020\u0026ndash;0.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVandesompele J, Preter KD, Roy NV, Paepe AD. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):research0034.1-0034.11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13(1):134.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHillers KJ, Villeneuve AM. Chromosome-Wide Control of Meiotic Crossing over in \u003cem\u003eC. elegans\u003c/em\u003e. Curr Biol. 2003;13(18):1641\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamesh M, Malik S, Logsdon J. A Phylogenomic Inventory of Meiotic GenesEvidence for Sex in \u003cem\u003eGiardia\u003c/em\u003e and an Early Eukaryotic Origin of Meiosis. Curr Biol. 2005;15(2):185\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasado-Navarro R, Serrano-Saiz E. DMRT Transcription Factors in the Control of Nervous System Sexual Differentiation. Front Neuroanat. 2022;16:937596.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKopp A. Dmrt genes in the development and evolution of sexual dimorphism. Trends Genet. 2012;28(4):175\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng W, Xu J, Zhang Y, Feng J, Dong C, Jiang L, et al. An ultra-high density linkage map and QTL mapping for sex and growth-related traits of common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e). Sci Rep. 2016;6(1):26693.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitaker M. Calcium at Fertilization and in Early Development. Physiol Rev. 2006;86(1):25\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchlupp I. The Evolutionary Ecology of Gynogenesis. Annu Rev Ecol Evol Syst. 2005;36(1):399\u0026ndash;417.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallot A, Shigenobu S, Hashiyama T, Jaubert-Possamai S, Tagu D. Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect \u003cem\u003eAcyrthosiphon pisum\u003c/em\u003e. BMC Genomics. 2012;13(1):76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanson SJ, Stelzer CP, Welch DBM, Logsdon JM. Comparative transcriptome analysis of obligately asexual and cyclically sexual rotifers reveals genes with putative functions in sexual reproduction, dormancy, and asexual egg production. BMC Genomics. 2013;14(1):412.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuynh TV, Hall AS, Xu S. Transcriptomic Signature Cyclical Parthenogenesis. 2023;15(7):1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Trionnaire G, Wucher V, Tagu D. Genome expression control during the photoperiodic response of aphids: Seasonal photoperodism in aphids. Physiol Entomol. 2013;38(2):117\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHartmann M, Kohl KP, Sekelsky J, Hatkevich T. Meiotic MCM Proteins Promote and Inhibit Crossovers During Meiotic Recombination. Genetics. 2019;212:461\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCosta Y, Speed R, \u0026Ouml;llinger R, Alsheimer M, Semple CA, Gautier P, et al. Two novel proteins recruited by synaptonemal complex protein 1 (SYCP1) are at the centre of meiosis. J Cell Sci. 2005;118(12):2755\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePage SL, Hawley RS. The genetics and molecular biology of the synaptonemal complex. Annu Rev Cell Dev Biol. 2004;20(1):525\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakemoto K, Imai Y, Saito K, Kawasaki T, Carlton PM, Ishiguro K, ichiro et al. Sycp2 is essential for synaptonemal complex assembly, early meiotic recombination and homologous pairing in zebrafish spermatocytes. Cohen PE, editor. PLOS Genet. 2020;16(2):e1008640.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller JJ, Summers MK, Hansen DV, Nachury MV, Lehman NL, Loktev A, et al. Emi1 stably binds and inhibits the anaphase-promoting complex/cyclosome as a pseudosubstrate inhibitor. Genes Dev. 2006;20(17):2410\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnitha A, Gupta YR, Deepa S, Ningappa M, Rajanna KB, Senthilkumaran B. Gonadal transcriptome analysis of the common carp, \u003cem\u003eCyprinus carpio\u003c/em\u003e: Identification of differentially expressed genes and SSRs. Gen Comp Endocrinol. 2019;279:67\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwai T, Yoshii A, Yokota T, Sakai C, Hori H, Kanamori A, et al. Structural components of the synaptonemal complex, SYCP1 and SYCP3, in the medaka fish \u003cem\u003eOryzias latipes\u003c/em\u003e. Exp Cell Res. 2006;312(13):2528\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePage J, Viera A, Parra MT, Fuente RDL, Suja J\u0026Aacute;, Prieto I et al. Involvement of Synaptonemal Complex Proteins in Sex Chromosome Segregation during Marsupial Male Meiosis. Hawley RS, editor. PLoS Genet. 2006;2(8):e136.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun M, Li Z, Gui J. Dynamic distribution of spindlin in nucleoli, nucleoplasm and spindle from primary oocytes to mature eggs and its critical function for oocyte-to‐embryo transition in gibel carp. J Exp Zool Part Ecol Genet Physiol. 2010;313A(8):461\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKipreos ET, Pagano M. The F-box protein family. Genome Biol. 2000;1(5):reviews30021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolina JR, Adjei AA. The Ras/Raf/MAPK Pathway. J Thorac Oncol. 2006;1(1):7\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStacey DW. Cyclin D1 serves as a cell cycle regulatory switch in actively proliferating cells. Curr Opin Cell Biol. 2003;15(2):158\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTidyman WE, Rauen KA. The RASopathies: developmental syndromes of Ras/MAPK pathway dysregulation. Curr Opin Genet Dev. 2009;19(3):230\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoriely A, Wilkie AOM. Paternal Age Effect Mutations and Selfish Spermatogonial Selection: Causes and Consequences for Human Disease. Am J Hum Genet. 2012;90(2):175\u0026ndash;200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrinivasan DG, Abdelhady A, Stern DL. Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, \u003cem\u003eAcyrthosiphon pisum\u003c/em\u003e, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis. Zhang M, editor. PLoS ONE. 2014;9(12):e115099.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Sun M, Zhou L, Li Z, Liu Z, Li XY, et al. Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid \u003cem\u003eCarassius gibelio\u003c/em\u003e. Sci Rep. 2015;5(1):10898.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang YN, Zhu XY, Wang WP, Wang Y, Wang L, Xu XX, et al. Reproductive switching analysis of \u003cem\u003eDaphnia similoides\u003c/em\u003e between sexual female and parthenogenetic female by transcriptome comparison. Sci Rep. 2016;6(1):34241.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarlow FL, Mullins MC. Bucky ball functions in Balbiani body assembly and animal\u0026ndash;vegetal polarity in the oocyte and follicle cell layer in zebrafish. Dev Biol. 2008;321(1):40\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAguero T, Zhou Y, Kloc M, Chang P, Houliston E, King M. Hermes (Rbpms) is a Critical Component of RNP Complexes that Sequester Germline RNAs during Oogenesis. J Dev Biol. 2016;4(1):2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoward K, Ponting CP, Zhang N, Young C, Huang CJ, Chou CM, et al. Identification and functional analysis of an ovarian form of the egg activation factor phospholipase C zeta (PLCζ) in pufferfish: analysis of an ovarian form of PLC zeta. Mol Reprod Dev. 2011;78(1):48\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFamiliari G. Structural changes of the zona pellucida during fertilization and embryo development. Front Biosci. 2008;Volume(13):6730.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong CH, Yang ST, Yang ZA, Zhang L, Gui JF. A C-type lectin associated and translocated with cortical granules during oocyte maturation and egg fertilization in fish. Dev Biol. 2004;265(2):341\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYue HM, Li Z, Wu N, Liu Z, Wang Y, Gui JF, Oocyte-Specific. H2A Variant H2af1o Is Required for Cell Synchrony Before Midblastula Transition in Early Zebrafish Embryos1. Biol Reprod [Internet]. 2013;89(4). Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://academic.oup.com/biolreprod/article-lookup/doi/\u003c/span\u003e\u003cspan address=\"https://academic.oup.com/biolreprod/article-lookup/doi/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1095/biolreprod.113.108043\u003c/span\u003e\u003cspan address=\"10.1095/biolreprod.113.108043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu C, Davis JS, Chen C, Li Z, Cao Y, Sun H, et al. FGF2/FGFR signaling promotes cumulus\u0026ndash;oocyte complex maturation in vitro. Reproduction. 2021;161(2):205\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeukeboom LW, Vrijenhoek RC. Evolutionary genetics and ecology of sperm-dependent parthenogenesis. J Evol Biol. 1998;11(6):755\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaenohara S, Unoki M, Toh H, Ohishi H, Sharif J, Koseki H et al. Role of UHRF1 in de novo DNA methylation in oocytes and maintenance methylation in preimplantation embryos. Cohen PE, editor. PLOS Genet. 2017;13(10):e1007042.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmberg JJ, Goforth RR, Sep\u0026uacute;lveda MS. Antagonists to the Wnt Cascade Exhibit Sex-Specific Expression in Gonads of Sexually Mature Shovelnose Sturgeon. Sex Dev. 2013;7(6):308\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Zhang W, Du X, Zhao J, Liu X, Li X, et al. Sexually dimorphic expression in developing and adult gonads shows an important role of gonadal soma-derived factor during sex differentiation in olive flounder (\u003cem\u003eParalichthys olivaceus\u003c/em\u003e). Comp Biochem Physiol B Biochem Mol Biol. 2017;210:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrathibha Y, Senthilkumaran B. Expression of wnt4/5 during reproductive cycle of catfish and wnt5 promoter analysis. J Endocrinol. 2017;232(1):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Inhibitory, SMADs. Potential Regulators of Ovarian Function1. Biol Reprod [Internet]. 2015;92(2). Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://academic.oup.com/biolreprod/article-lookup/doi/\u003c/span\u003e\u003cspan address=\"https://academic.oup.com/biolreprod/article-lookup/doi/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1095/biolreprod.114.125203\u003c/span\u003e\u003cspan address=\"10.1095/biolreprod.114.125203\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaivo-oja N, Jeffery LA, Ritvos O, Mottershead DG. Smad signalling in the ovary. Reprod Biol Endocrinol. 2006;4(1):21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBayer EA, Stecky RC, Neal L, Katsamba PS, Ahlsen G, Balaji V, et al. Ubiquitin-dependent regulation of a conserved DMRT protein controls sexually dimorphic synaptic connectivity and behavior. eLife. 2020;9:e59614.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnsen H, Andersen \u0026Oslash;. Sex dimorphic expression of five dmrt genes identified in the Atlantic cod genome. The fish-specific dmrt2b diverged from dmrt2a before the fish whole-genome duplication. Gene. 2012;505(2):221\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang B, Sun W, Jin L, Li P, Zhou Y, Qian G, et al. \u003cem\u003eSOX8\u003c/em\u003e is essential for male sexual differentiation in the Chinese soft-shelled turtle \u003cem\u003ePelodiscus sinensis\u003c/em\u003e. Biol Reprod. 2023;108(6):988\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakada S, Koopman P. Origin and possible roles of the \u003cem\u003eSox8\u003c/em\u003e transcription factor gene during sexual development. Cytogenet Genome Res. 2003;101(3\u0026ndash;4):212\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed S. Review of the molecular modelling studies of the cytochrome P-450 estrogen synthetase enzyme, aromatase. Drug Des Discov. 1998;15(4):239\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe W, Gauri M, Li T, Wang R, Lin SX. Current knowledge of the multifunctional 17β-hydroxysteroid dehydrogenase type 1 (HSD17B1). Gene. 2016;588(1):54\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaloniemi T, Welsh M, Lamminen T, Saunders P, M\u0026auml;kel\u0026auml; S, Streng T, et al. Human HSD17B1 expression masculinizes transgenic female mice. Mol Cell Endocrinol. 2009;301(1\u0026ndash;2):163\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGomes Fernandes M, He N, Wang F, Van Iperen L, Eguizabal C, Matorras R, et al. Human-specific subcellular compartmentalization of P-element induced wimpy testis-like (PIWIL) granules during germ cell development and spermatogenesis. Hum Reprod. 2018;33(2):258\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRisinger C, Larhammar D. Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish. Proc Natl Acad Sci. 1993;90(22):10598\u0026ndash;602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo J, Zhang YP, Huang SY. Genetic Diversity in Crucian Carp (\u003cem\u003eCarassius auratus\u003c/em\u003e). 1999;37(9/10):267\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan J, He Z, Yuan X, Jiang X, Sun X, Zou S. Speciation of polyploid Cyprinidae fish of common carp, crucian carp, and silver crucian carp derived from duplicated Hox genes. J Exp Zoolog B Mol Dev Evol. 2010;314B(6):445\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu Q, Wang S, Zhong H, Yuan H, Yang J, Yang C, et al. Phylogeographic relationships and the evolutionary history of the Carassius auratus complex with a newly born homodiploid raw fish (2nNCRC). BMC Genomics. 2022;23(1):242.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePodlesnykh AV, Apalikova OV, Brykov VA. Phylogenetic relationships of silver crucian carp in \u003cem\u003eCarassius auratus\u003c/em\u003e complex based on mtDNA analysis. Russ J Genet. 2012;48(12):1207\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinclair EA, Pramuk JB, Bezy RL, Crandall KA, Sites JW Jr. DNA evidence for nonhybrid origins of parthenogenesis in natural populations of vertebrates. Evolution [Internet]. 2009; Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://academic.oup.com/evolut/article/64/5/1346/6854312\u003c/span\u003e\u003cspan address=\"https://academic.oup.com/evolut/article/64/5/1346/6854312\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTunquist BJ, Eyers PA, Chen LG, Lewellyn AL, Maller JL. Spindle checkpoint proteins Mad1 and Mad2 are required for cytostatic factor\u0026ndash;mediated metaphase arrest. J Cell Biol. 2003;163(6):1231\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBi K, Bogart JP. Probing the meiotic mechanism of intergenomic exchanges by genomic in situ hybridization on lampbrush chromosomes of unisexual Ambystoma (Amphibia: Caudata). Chromosome Res. 2010;18(3):371\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBogart JP, Bartoszek J, Noble DWA, Bi K. Sex in unisexual salamanders: discovery of a new sperm donor with ancient affinities. Heredity. 2009;103(6):483\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRice CS. Evolution of meiosis genes in sexual vs. asexual \u003cem\u003ePotamopyrgus antipodarum\u003c/em\u003e [Internet] [Master of Science]. [Iowa City, IA, United States]: University of Iowa; 2015. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://iro.uiowa.edu/esploro/outputs/graduate/9983776608402771\u003c/span\u003e\u003cspan address=\"https://iro.uiowa.edu/esploro/outputs/graduate/9983776608402771\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGui J, Zhou L. Genetic basis and breeding application of clonal diversity and dual reproduction modes in polyploid \u003cem\u003eCarassius auratus gibelio\u003c/em\u003e. Sci China Life Sci. 2010;53(4):409\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŠimkov\u0026aacute; A, Vojtek L, Halačka K, Hyršl P, Vetešn\u0026iacute;k L. The effect of hybridization on fish physiology, immunity and blood biochemistry: A case study in hybridizing \u003cem\u003eCyprinus carpio\u003c/em\u003e and \u003cem\u003eCarassius gibelio\u003c/em\u003e (Cyprinidae). Aquaculture. 2015;435:381\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVetešn\u0026iacute;k L, Halačka K, Šimkov\u0026aacute; A. The effect of ploidy and temporal changes in the biochemical profile of gibel carp (\u003cem\u003eCarassius gibelio\u003c/em\u003e): a cyprinid fish species with dual reproductive strategies. Fish Physiol Biochem. 2013;39(2):171\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar R. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30(1):207\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalous J, Kubelka M, Šolc P, Šušor A, Motl\u0026iacute;k J. AKT (protein kinase B) is implicated in meiotic maturation of porcine oocytes. Reproduction. 2009;138(4):645\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMouillet JF, Yan X, Ou Q, Jin L, Muglia LJ, Crawford PA, et al. DEAD-Box Protein-103 (DP103, Ddx20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function. Endocrinology. 2008;149(5):2168\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteinfeld JS, Ameyaw KK, Wood CG, Johnston RM, Escauriza AJJ, Torija EG et al. The zebrafish \u003cem\u003edmrt\u003c/em\u003e family genes have cooperative and antagonistic roles in sex determination and oogenesis [Internet]. Developmental Biology; 2022 Aug. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://biorxiv.org/lookup/doi/10.1101/2022.08.28.505603\u003c/span\u003e\u003cspan address=\"http://biorxiv.lookup/doi/10.1101/2022.08.28.505603\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun H, Sun G, Zhang H, An H, Guo Y, Ge J, et al. Proteomic Profiling Reveals the Molecular Control of Oocyte Maturation. Mol Cell Proteom. 2023;22(1):100481.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva ESD, Amaral C, Barreta M, Antoniazzi A, Andrade LGD, Ferreira R, et al. FGF18 modulates \u003cem\u003eCTGF\u003c/em\u003e mRNA expression in cumulus\u0026ndash;oocyte complexes and early bovine embryos: preliminary data. Zygote. 2022;30(2):239\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandey A, Gupta N, Gupta SC. Improvement of in vitro oocyte maturation with lectin supplementation and expression analysis of Cx43, GDF-9, FGF-4 and Fibronectin mRNA transcripts in Buffalo (\u003cem\u003eBubalus bubalis\u003c/em\u003e). J Assist Reprod Genet. 2009;26(6):365\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin S, Tong T, Fan W, Fan F, Antinore MJ, Zhu X, et al. GADD45-induced cell cycle G2-M arrest associates with altered subcellular distribution of cyclin B1 and is independent of p38 kinase activity. Oncogene. 2002;21(57):8696\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzumori N, Pangas S, Rajkovic A. Candidate Genes for Premature Ovarian Failure. Curr Med Chem. 2007;14(3):353\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh ET, Kim HG, Kim CH, Lee J, Kim C, Lee JS, et al. NQO1 regulates cell cycle progression at the G2/M phase. Theranostics. 2023;13(3):873\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBraden TD, Bervig T, Conn PM. Protein Kinase-C Activation Stimulates Synthesis of Gonadotropin-Releasing Hormone (GnRH) Receptors, but Does not Mediate GnRH-Stimulated Receptor Synthesis. Endocrinology. 1991;129(5):2486\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBill CA, Vines CM, Phospholipase C. In: Islam MdS, editor. Calcium Signaling [Internet]. Cham: Springer International Publishing; 2020. p. 215\u0026ndash;42. (Advances in Experimental Medicine and Biology; vol. 1131). Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://link.springer.com/\u003c/span\u003e\u003cspan address=\"http://link.springer.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-030-12457-1_9\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-12457-1_9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRegev A, Goldman S, Shalev E. Expression of plexin-B1 in the mouse ovary and its possible role in follicular development. Fertil Steril. 2005;84:1210\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaufman OH, Lee K, Martin M, Rothh\u0026auml;mel S, Marlow FL. rbpms2 functions in Balbiani body architecture and ovary fate. Pelegri F, editor. PLOS Genet. 2018;14(7):e1007489.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChae HD, Mitton B, Lacayo NJ, Sakamoto KM. Replication factor C3 is a CREB target gene that regulates cell cycle progression through the modulation of chromatin loading of PCNA. Leukemia. 2015;29(6):1379\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3908673/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3908673/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGibel carp (\u003cem\u003eCarassius gibelio\u003c/em\u003e) is a cyprinid fish that originated in eastern Eurasia and is considered as invasive in European freshwater ecosystems. The populations of gibel carp in Europe are mostly composed of asexually reproducing triploid females (\u003cem\u003ei.e\u003c/em\u003e., reproducing by gynogenesis) and sexually reproducing diploid females and males. Although some cases of coexisting sexual and asexual reproductive forms are known in vertebrates, the molecular mechanisms maintaining such coexistence are still in question. Both reproduction modes are supposed to exhibit evolutionary and ecological advantages and disadvantages. To better understand the coexistence of these two reproduction strategies, we performed transcriptome profile analysis of gonad tissues (ovaries) and studied the differentially expressed reproduction-associated genes in sexual and asexual females. We used high-throughput RNA sequencing to generate transcriptomic profiles of gonadal tissues of triploid asexual females and males, diploid sexual males and females of gibel carp, as well as diploid individuals from two closely-related species, \u003cem\u003eC. auratus\u003c/em\u003e and \u003cem\u003eCyprinus carpio\u003c/em\u003e. Using SNP clustering, we showed the close similarity of \u003cem\u003eC. gibelio\u003c/em\u003e and \u003cem\u003eC. auratus\u003c/em\u003e with a basal position of \u003cem\u003eC. carpio\u003c/em\u003e to both \u003cem\u003eCarassius \u003c/em\u003especies. Using transcriptome profile analyses, we showed that many genes and pathways are involved in both gynogenetic and sexual reproduction in \u003cem\u003eC. gibelio\u003c/em\u003e; however, we also found that 1500 genes, including 100 genes involved in cell cycle control, meiosis, oogenesis, embryogenesis, fertilization, steroid hormone signaling, and biosynthesis were differently expressed in the ovaries of asexual and sexual females. We suggest that the overall downregulation of reproduction-associated pathways in asexual females, and their maintenance in sexual ones, allow for their stable coexistence, integrating the evolutionary and ecological advantages and disadvantages of the two reproductive forms. However, we showed that many sexual-reproduction-related genes are maintained and expressed in asexual females, suggesting that gynogenetic gibel carp retains the genetic toolkits for meiosis and sexual reproduction. These findings shed new light on the evolution of this asexual and sexual complex.\u003c/p\u003e","manuscriptTitle":"Reproduction-associated pathways in females of gibel carp (Carassius gibelio) shed light on the molecular mechanisms of the coexistence of asexual and sexual reproduction","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-08 19:17:04","doi":"10.21203/rs.3.rs-3908673/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-01T13:42:58+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-03T21:13:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"34d96bf6-7cde-4d6f-9004-99fa9624b840","date":"2024-03-02T04:29:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"5ad0872e-630e-4cd5-b735-8cb15eb3a0d1_SNPRID","date":"2024-02-13T13:47:12+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-11T18:40:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-06T14:19:41+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-02-06T13:51:30+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-06T13:48:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2024-01-29T10:10:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d78f19d1-25d4-4adb-a66a-091507f142bc","owner":[],"postedDate":"February 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-28T16:15:15+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-08 19:17:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3908673","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3908673","identity":"rs-3908673","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}