The Human LRRK2-R1441G Mutation Drives Age-Dependent Oxidative Stress and Mitochondrial Dysfunction in Dopaminergic Neurons

The Human LRRK2-R1441G Mutation Drives Age-Dependent Oxidative Stress and Mitochondrial Dysfunction in Dopaminergic Neurons | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Human LRRK2-R1441G Mutation Drives Age-Dependent Oxidative Stress and Mitochondrial Dysfunction in Dopaminergic Neurons Yuanxin Chen, Lianteng Zhi, Shiquan Cui, Huaixin Wang, Chenbo Zeng, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8177400/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 11 You are reading this latest preprint version Abstract Background Mitochondrial dysfunction and oxidative stress are central to the pathogenesis of Parkinson’s disease (PD), particularly affecting substantia nigra pars compacta (SNc) dopamine (DA) neurons. Here, we investigate how the R1441G mutation in leucine-rich repeat kinase 2 (LRRK2), a key genetic contributor to familial and sporadic PD, impacts mitochondrial function in midbrain DA neurons. Methods We employed a BAC transgenic mouse model overexpressing human LRRK2-R1441G and crossed it with TH-mito-roGFP mice to enable mitochondria-targeted redox imaging specifically in DA neurons. Acute midbrain slices from 3-, 6-, and 10-month-old mice were imaged using two-photon microscopy to assess mitochondrial oxidative stress. In parallel, mitochondrial respiratory function, membrane potential flickering events, and expression of uncoupling proteins (UCP4/UCP5) were analyzed. Spatial transcriptomic profiling was performed using the GeoMx® Digital Spatial Profiler to uncover associated molecular alterations. Results We observed a progressive increase in mitochondrial oxidative stress in SNc DA neurons of LRRK2 BAC-hR1441G mice at 3, 6, and 10 months of age. This was accompanied by reduced respiratory complex activity, attenuated mitochondrial membrane potential flickering, and diminished expression of UCP4 and UCP5. Spatial transcriptomic analysis revealed dysregulation of genes linked to mitochondrial uncoupling, calcium signaling, and redox regulation in LRRK2-R1441G SNc tissue. Conclusions These findings reveal an age-dependent progression of mitochondrial dysfunction in LRRK2-R1441G SNc DA neurons. Dysregulation of calcium channels and uncoupling proteins emerges as a key mechanism contributing to bioenergetic failure, suggesting potential therapeutic targets to mitigate PD progression. Parkinson’s disease LRRK2 Mitochondrial dysfunction oxidative stress mitochondria membrane potential (MMP) Uncoupling protein (UCP) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Parkinson’s disease (PD) is a progressive neurodegenerative disorder characterized by the selective loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNc) and the accumulation of α-synuclein pathology [ 1 – 3 ]. While both genetic and environmental factors contribute to PD, aging remains the greatest risk factor [ 4 ]. However, the mechanisms by which age-related cellular dysfunctions drive PD pathogenesis remain poorly understood. Among the most implicated factors, mitochondrial dysfunction and oxidative stress have emerged as critical contributors to dopaminergic neurodegeneration. Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common genetic cause of both familial and sporadic PD [ 5 – 7 ]. Among these, the R1441G mutation disrupts the GTPase function of LRRK2, leading to aberrant kinase activity and pathological consequences, including abnormal mitochondrial function, oxidative stress, and calcium dysregulation [ 8 – 11 ]. Although mitochondrial dysfunction has been implicated in PD, whether and how the LRRK2-R1441G mutation directly contributes to mitochondrial abnormalities, oxidative stress, and neurodegeneration in an age-dependent manner remains unresolved. Mitochondria are essential for ATP production, calcium buffering, and reactive oxygen species (ROS) regulation [ 12 , 13 ]. In DA neurons, which exhibit high metabolic demands due to autonomous pacemaking activity, mitochondrial health is particularly critical. Dysfunctional mitochondria lead to energy deficits, excessive ROS production, and oxidative damage, all of which are known contributors to neuronal vulnerability in PD [ 14 ]. Notably, mitochondrial oxidative stress can be exacerbated by dysregulated calcium homeostasis, as excessive cytosolic and mitochondrial calcium levels further impair mitochondrial respiration and trigger cell death pathways. Here, we investigate the role of mitochondrial dysfunction and oxidative stress in LRRK2-R1441G-associated PD using a BAC transgenic mouse model that overexpresses human LRRK2-R1441G. This model exhibits progressive motor, neurochemical, and pathological deficits, closely mirroring human PD [ 15 ]. By crossing these mice with TH-mito-roGFP reporters and applying two-photon ratiometric imaging, we uncovered age-dependent mitochondrial impairment marked by early oxidative stress in striatal DA terminals and calcium overload driven by increased MCU expression. These deficits were mitigated by L-type calcium channel blockade, implicating calcium dysregulation as a driver of oxidative stress. Furthermore, we observed impaired mitochondrial membrane potential (MMP) flickering and reduced UCP4/UCP5 expression, exacerbating ROS accumulation [ 16 , 17 ] was significantly impaired in hR1441G DA neurons. Spatial transcriptomics of the substantia nigra further confirmed the upregulation of redox stress pathways in LRRK2-R1441G DA neurons. Taking together, our study provides the first direct mechanistic link between hLRRK2-R1441G, mitochondrial oxidative stress, and calcium dysregulation in PD, highlighting UCPs, MCU, and L-type calcium channels as potential therapeutic targets in PD. Materials and methods Animals BAC LRRK2(hR1441G) transgenic mice (Stock #009604, The Jackson Laboratory) were obtained from Dr. Chenjian Li’s laboratory at Weill Medical College of Cornell University and maintained on a Taconic FVB/N genetic background. Transgenic mice expressing a roGFP construct under the tyrosine hydroxylase (TH) promoter, with a mitochondria-targeting matrix sequence, were acquired from Dr. James Surmeier’s laboratory at Northwestern University. These mice were backcrossed onto the FVB/N background for eight generations before being crossed with hLRRK2-R1441G mice, generating GFP-expressing hR1441G and non-transgenic (nTg) lines. All mice were maintained on an FVB/N background (Taconic). The animals were housed in a temperature- and humidity-controlled environment with a 12-hour light/dark cycle and provided ad libitum access to food and water in a specific pathogen-free facility. All experimental procedures involving animals were conducted in accordance with the National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committees (IACUC) of Thomas Jefferson University and The University of Georgia. Ethics declaration All animal experiments were conducted in accordance with the National Institutes of Health guidelines. Experimental procedures were approved by the Institutional Animal Care and Use Committees (IACUC) of Thomas Jefferson University (Protocol \(\:01452\) ) and the University of Georgia (Protocol \(\:\#\:\text{A}2023\:05-031-\text{Y}1-\text{A}1\) ). All efforts were made to minimize animal suffering and to reduce the number of animals used. For most of the experiments, mice were coded so investigators were blinded to genotype. Brain Slice Preparation Mice were anesthetized using a ketamine/xylazine mixture, followed by transcardial perfusion with ice-cold, oxygenated cutting solution containing (in mM): 125 NaCl, 2.5 KCl, 26 NaHCO3, 3.7 MgSO4, 0.3 KH2PO4, and 10 glucose (pH 7.4). Following perfusion, the mice were decapitated, and the brains were immediately removed and sectioned in ice-cold, oxygenated cutting solution using a vibratome (VT1000S, Leica Microsystems, Germany). Brain slices, 250 µm in thickness, were recovered at 34°C in oxygenated artificial cerebrospinal fluid (aCSF; in mM: 125 NaCl, 2.5 KCl, 26 NaHCO3, 2.4 CaCl2, 1.3 MgSO4, 0.3 KH2PO4, 10 glucose, 2 HEPES, pH 7.4) for 30 minutes and then maintained at room temperature. For oxygen consumption rate (OCR) measurements, 160 µm-thick slices of the striatum were prepared and transferred to respiration buffer composed of preoxygenated aCSF supplemented with 25 mM glucose, 2 mM L-glutamine, and 4 mg/mL bovine serum albumin (BSA), freshly added before use (pH 7.4, 37°C). Tissue punches were immediately taken from the slices for subsequent respiration studies. TH-Immunogold Labeling and Electron Microscopy LRRK2 WT and BAC-RG mice were perfused transcardially with 3.75% acrolein and 2% paraformaldehyde in 0.1 M sodium phosphate buffer (PB, pH 7.4). Brains were removed and post-fixed for 30 min in 2% paraformaldehyde before being transferred to PB. Brains were coded so investigators were blinded to genotype. Brains were sectioned into 50 µm slices in PB using a vibratome. Sections were then treated with 1% sodium borohydride in PB for 30 minutes to reduce free aldehydes, followed by extensive rinsing in PB. The tissue was subsequently transferred to 0.01 M tris-buffered saline (TBS), pH 7.6. Some sections were further processed by transferring them to a cryoprotectant solution and frozen for future use, while the remaining sections were immediately processed for immunogold-silver labeling of tyrosine hydroxylase (TH). Blocking solution was prepared in TBS containing 3% goat serum, 1% bovine serum albumin (BSA), and 0.04% Triton X-100, and applied to the tissue for 30 minutes to enhance antibody penetration. The primary antibody, mouse anti-TH (Chemicon), was diluted 1:5000 in the blocking solution and incubated with the tissue overnight at room temperature. After incubation, sections were washed in TBS, followed by 0.01 M phosphate-buffered saline (PBS), pH 7.4. They were then incubated for 30 minutes in a washing buffer consisting of PBS, 0.8% BSA, 0.1% fish gelatin, and 3% goat serum. Next, sections were transferred to a solution containing 0.8 nm gold-conjugated anti-mouse secondary antibody, diluted 1:50 in the washing buffer, and incubated overnight at room temperature. The following day, the sections were rinsed thoroughly in washing buffer, followed by PBS, and incubated for 10 minutes in 2.5% glutaraldehyde in PBS to stabilize the gold particles. After rinsing in PBS, sections were treated with the proprietary Enhancement Conditioning Solution (ECS; Aurion/Electron Microscopy Sciences). The sections were then incubated in Aurion R-Gent SE-EM kit reagents at room temperature for an empirically determined time of approximately 90–120 minutes. After further rinsing in ECS, the sections were transferred to PB. For electron microscopic visualization, immunogold-silver labeled tissue was subjected to osmication, dehydration, and plastic embedding. Sections were incubated in 2% osmium tetroxide in PB for 30 minutes, followed by rinsing in PB. The tissue was then sequentially dehydrated in 30%, 50%, 70%, and 95% ethanol solutions, and subsequently exposed twice to 100% ethanol for 10 minutes each, followed by two 10-minute exposures to propylene oxide. The sections were incubated overnight in a 1:1 mixture of epoxy resin (Epon; EMBed-812, Electron Microscopy Sciences) and propylene oxide before being transferred to pure Epon for 2 hours. The sections were embedded in Epon between sheets of commercial plastic and polymerized under heavy lead weights at 62°C for 72 hours. The embedded tissue sections containing the dorsal striatum were mounted on plastic blocks, and excess tissue was trimmed, leaving a trapezoidal region within the dorsolateral striatum. This region of interest was then sectioned into ultrathin (50–60 nm) slices using an ultramicrotome and collected onto copper-400 mesh grids. The ultrathin sections were counterstained with uranyl acetate and lead citrate. Ultrathin tissue sections were examined using a Morgagni FEI transmission electron microscope at 36,000X magnification. Sampling of TH-immunolabeled profiles was done near the interface between tissue and epoxy resin, where maximal antibody penetration occurred. To decrease the collection of false positive results, TH-labeled axons were defined as profiles containing a minimum of three gold-silver particles, with many axons exhibiting considerably more than three particles. Measurement of Real-Time Oxygen Consumption Rate (OCR ) Real-time oxygen consumption rate (OCR) in acute brain slices was measured using a Seahorse XF24 analyzer (Seahorse Bioscience) with minor modifications to the manufacturer’s protocol. To optimize conditions for OCR measurement, various combinations of slice thickness (150 µm or 200 µm) and punch size (1.0 mm, 1.5 mm, and 2.0 mm) were tested. Brain slices were secured to the center of the mesh in an islet capture plate as described previously [ 18 ]. The microplate was then incubated at 37°C for 1 hour to equilibrate temperature and pH. Drugs and inhibitors were diluted in prewarmed (37°C) respiration buffer to stock concentrations (10×, 11×, 12×, and 13× the working concentrations for ports A, B, C, and D, respectively) and preloaded into the reagent ports of a sensor cartridge. The sensor cartridge had been hydrated overnight in Seahorse calibration solution at 37°C without CO 2 . Each injection had a volume of 75 µL. Following a 30-minute calibration and equilibration period, OCR was measured in each well of the plate using a program consisting of 3-minute mixing, 3-minute waiting, and 2-minute measurement cycles. Baseline OCR was determined with four measurements, followed by sequential injections of port A (10 mM pyruvate, 3 X measurements), port B (20 mM oligomycin, 8 X measurements), port C (10 mM or other concentrations of FCCP, 5X measurements), and port D (20 mM antimycin A, 6 X measurements). The parameters for load, measure, and calibration distance of probe head were set to 27,800. Reagents used in Seahorse experiments included bovine serum albumin (BSA) (A6003), glucose (G8270), sodium pyruvate (P2256), L-glutamine (C3126), oligomycin from streptomyces diastatochromogenes (O4876), carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) (C2920), antimycin A from streptomyces sp. (A8674), which were purchased from Sigma Aldrich (St. Louis, MO) and rotenone (3616, Tocris). In addition, stainless steel biopsy punches were purchased from Miltex (York, PA); and XF24 Islet Flux-Paks from Seahorse Bioscience (Billerica, MA). Details of key resources and reagents are provided in Table 1 . Table 1 Key Source and reagent Reagent or Resource Source Identifier Reagent Tetramethylrhodamine methyl ester (TMRM) Invitrogen Cat #T668 Dithiothreitol (DTT) Sigma Cat #D0632 Aldrithiol Sigma Cat #143049 Genipin Sigma Cat #G4796 Isradipine Tocris Cat #2004 N-(2-mercaptopropionyl)-glycine (MPG) Sigma Cat #M6635 Bovine serum albumin (BSA) Sigma Cat #A6003 Sodium pyruvate Sigma Cat #P2256 L-glutamine Sigma Cat #C3126 Oligomycin Sigma Cat #O4876 Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) Sigma Cat #C2920 Antimycin A Sigma Cat #A8674 Rotenone Tocris Cat #3616 Source XF24 Islet capture microplate Agilent Cat #101122-100 XF24 Islet capture FluxPaks Agilent Cat #101174 TMRM Dye Labeling Tetramethylrhodamine methyl ester (TMRM; Invitrogen) was used to monitor mitochondrial membrane potential. A 10 mM TMRM stock solution prepared in DMSO was diluted in oxygenated artificial cerebrospinal fluid (aCSF) to a final working concentration of 4 µM. Brain slices were incubated in the oxygenated TMRM-containing aCSF at 37°C for 30 minutes to allow for dye equilibration and accumulation within the mitochondrial matrix. Following incubation, the slices were transferred to oxygenated TMRM-free aCSF and washed for 30 minutes to remove excess dye. To assess the sensitivity of roGFP protein to oxidative stress, brain slices expressing roGFP were sequentially perfused with aCSF containing the reductant dithiothreitol (DTT, 2 mM, Sigma) for 45 minutes, followed by the oxidant aldrithiol (Ald, 100 µM, Sigma) for an additional 45 minutes. To investigate the effects of uncoupling proteins (UCPs), L-type calcium channel blockers, and antioxidants on mitochondrial membrane potential (MMP) ex vivo , brain slices were incubated in oxygenated aCSF containing genipin (Sigma), isradipine (Tocris-Cookson, 10 µM), or N-(2-mercaptopropionyl)-glycine (MPG, 10 µM, Sigma) for 30 minutes, respectively. To examine whether L-type calcium channel inhibition reduce or diminish calcium-dependent mitochondrial oxidant stress in the animal, we administered intraperitoneally isradipine (3 mg/kg body weight) daily for 7–10 days. Details of key resources and reagents are provided in Table 1 . Real-Time PCR Following the protocol described by Guzman et al., total RNA from the substantia nigra (SN) region was extracted for quantification of uncoupling protein (UCP) mRNA levels. (Primer sequence are provided in Table 2 ). Ventral midbrain regions, encompassing the SNc and VTA, were micro-dissected from 10-month-old LRRK2 wild-type (WT) and BAC-R1441G mice. Total RNA was extracted using TRIzol reagent (Invitrogen), and cDNA synthesis was performed via reverse transcription (Quanta Biosciences) using oligo-(dT)15 primers. Table 2 qPCR primer Primer Sense/anti-sense mUCP4 CCTAAAGCTGTGGCAAGGAG CAATGACCGATTTCCAGAGG mUCP5 GTGCTGCAATCGTTGTGGGAGT GCCAAACCACAGGTGAAACTGG mUCP2 TAAAGGTCCGCTTCCAGGCTCA ACGGGCAACATTGGGAGAAGTC mActin-ß CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG Quantitative PCR (qPCR) was carried out to analyze cDNA from each sample, employing SYBR Green as the fluorescent dye and sense/antisense primers synthesized by Integrated DNA Technologies. The qPCR cycling parameters included an initial denaturation step at 95°C for 3 minutes, followed by 40 cycles of 15 seconds at 94°C, 1 minute at 60°C, and 30 seconds at 72°C. SYBR Green fluorescence was measured after each cycle. Relative mRNA expression levels were calculated using the comparative CT (ΔΔCT) method. Gene-specific mRNA expression was normalized to β-actin levels to obtain Δ C T values (Δ C T = C T (UCP4/5) − C T (ß-actin)). Paired Δ C T s for WT and BAC-R1441G groups and the mRNA abundance were calculated from the Eq. 2 −∆∆ CT . All samples were analyzed in triplicate to ensure accuracy. Western Blot Western Blot Mouse SN slices were homogenized in RIPA lysis buffer containing 1X protease inhibitor cocktail and centrifuged at 21,000g for 30 minutes at 4°C. Protein concentration was determined using the BCA protein assay kit. A total of 200 µg of protein was mixed with 4X Laemmli buffer and β-mercaptoethanol to achieve a final concentration of 1 µg/µl in 1X Laemmli buffer and 10% β-mercaptoethanol, then boiled for 5 minutes at 95°C. A total of 10–20 µg of protein per lane was loaded onto 10% polyacrylamide gels and electrophoresis in Tris/glycine buffer, followed by transfer to 0.2 µm PVDF membranes. The PVDFs were blocked with 5% non-fat dry milk in TBS containing 0.05% Tween-20 (TBST) for 1–2 hours at room temperature with gentle shaking at 20 rpm, and then incubated with primary antibodies overnight at 4°C. After washing TBST three times, the PVDFs were incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody for 1 hour at room temperature with gentle shaking at 20 rpm. The PVDFs were then washed three times with TBST, developed using Femto Sensitivity Substrate, and imaged using a ChemiDoc MP Imager (Bio-Rad). Antibodies, protein assay kits, and buffer solutions are listed in Table 3 . Table 3 Antibody List Antibody Company Source CatLog Dilution UCP4 Santa Cruz Mouse sc-365295 1:500 MCU CST Rabbit 14997S 1:1000 MICU1 sigma rabbit HPA037480 1:1000 MICU2 abcam rabbit ab101465 1:1000 MICU3 sigma rabbit HPA024771 1:1000 HRP Goat Anti-Mouse IgG (H + L) JACKSON IMMUNO RESEARCH LABORATORIES INC 115-035-166 1:10000 HRP Goat Anti-Rabbit IgG (H + L) JACKSON IMMUNO RESEARCH LABORATORIES INC 111-035-144 1:10000 Goat anti-Mouse IgG, IgM (H + L) Cross-Adsorbed Secondary Antibody, HRP Invitrogen 31446 1:10000 SuperSignal™ West Femto Maximum Sensitivity Substrate Thermo Scientific 34096 Pierce™ BCA Protein Assay Kits Thermo Scientific 23227 Immun-Blot PVDF Membrane, Roll, 26 cm x 3.3 m Bio-rad 1620177 RIPA Lysis and Extraction Buffer Thermo Scientific 89900 Pierce Protease and Phosphatase Inhibitor Mini Tablets, EDTA-free Thermo Scientific A32961 Stereotaxic Injection of AAV Mice were anesthetized with isoflurane (1–2%) or ketamine/xylazine (100 mg/10 mg/kg). A small craniotomy, approximately 0.8 mm in diameter, was made over the right midbrain (− 3.4 mm caudal, + 1.0 mm lateral). To achieve expression of cyto-GCaMP6 or mito-GCaMP6 in dopaminergic neurons, 0.1–0.2 µl of AAV-GCaMP6-mito virus (10^13 vg/ml, a gift from Dr. James Surmeier’s lab at Northwestern University) was pressure-injected through a syringe into the midbrain at a depth of -4.2 mm ventral from the dura surface. Following the injections, the incisional wound on the skull was sealed with tissue adhesive (3M Vetbond). The mice were placed on a heating pad until fully recovered and returned to the isolation room. Carprofen (5 mg/kg, Sigma Aldrich) was administered intraperitoneally once per day for at least 3 days to reduce pain. Two-photon Laser Scanning Microscopy (2PLSM) Imaging of Mitochondrial Functions in Brain Slices The brain slices were positioned within a recording chamber and superfused with oxygenated aCSF at a flow rate of 1.0 mL/min. Optical imaging of florescent signals were acquired using an Ultima multiphoton laser scanner (Bruker) for BX51/61WI, Olympus microscope with a Titanium-sapphire laser (Chameleon-Ultra2, Coherent Laser Group), equipped with a 20 × 1.0 NA water immersion objective (XLUMPLFL20XW, Olympus). The average laser power for imaging was less than 50 mW. Images were captured in 8-bit resolution and 4 µs dwell time, with regions of interest set at 512 × 512 pixels. All experiments were conducted at 34–35°C. Mitochondrial roGFP Imaging Acute brain slices with roGFP expressed in mitochondria were put and anchored under the microscope with the oxygenated aCSF perfusion at physiological temperatures (34–35°C). The optimal excitation wavelength of roGFP signals were measured at different conditions: physiological, fully reduced and fully oxidized. And the excitation wavelength (900 nm and 800 nm) was chosen to excite roGFP protein with a pixel size between 0.16 and 0.23 µm and a 4 µs pixel dwell time. roGFP fluorescence (490–560 nm) was differentiated and collected by PMT detector. Laser intensity and PMT gain were kept consistent or adjusted in proportion. Records with a drifting baseline were excluded for data analysis. 2PLSM cyto-GCaMP6 and mito-GCaMP6 Imaging Mitochondrial Ca 2+ levels were measured with the mitochondrially targeted Ca 2+ -sensitive probe mito-GCaMP6. Two-three weeks after AAV virus injection, mice were prepared for coronal brain slice sectioning following transcardiac perfusion with ice-cold, oxygenated cutting solution. After a recovery period of 30–45 minutes, the coronal brain slices were placed in a chamber perfused with oxygenated aCSF. To measure free Ca 2+ levels in mitochondria, the slices were sequentially treated with the following solutions: (1) regular aCSF, (2) 500 µM EGTA + aCSF without Ca 2+ for 30–40 minutes, (3) 500 µM EGTA + 1 µM ionomycin + aCSF without Ca 2+ for 30 minutes, and (4) 1 µM ionomycin + aCSF with high Ca 2+ ( 3 mM) for 20 minutes. Time series images were acquired every 5 minutes to determine the minimal and maximal fluorescence intensity. The fluorescence intensity at the end of treatment (2) was defined as the minimum fluorescence (F min ), and the fluorescence intensity at the end of treatment (4) was defined as the maximum fluorescence (F max ). The relative free calcium level was calculated using the equation: (F - F min ) / (F max - F min ). Mitochondrial TMRM imaging Brain slices from LRRK2 BAC-hR1441G with TH-GFP expression were incubated in 4 µM TMRM for 30 min at 34–35°C; excess dye was washed out with a TMRM-free ACSF solution. Brain slices were put in the chamber under the microscope for imaging following aCSF solution perfusion at physiological temperatures (34–35°C). Fluorescence (550–640 nm) was collected using an 830-nm excitation beam. Time-series scanning (300 frames) was performed with a 4-µs dwell time per pixel and 2–3 frames per second scanning rate. The duration of drug applications, including MPG, genipin and isradipine, was controlled at 30 mins. Image Data Analysis Images were processed using open-source software Fiji (NIH) and commercial software Matlab (Version 8.5.0 R2015a, Mathworks). Registration had been taken to perform the intensity-based alignment of images at the different time point. DA terminals in the striatum and DA soma in SNc area were segmented and regarded as the regions of interest (ROIs), the ratio of fluorescence intensity in these ROIs excited by 800nm beam divided by corresponding ROIs excited by 900nm beam was used to measure the level of oxidation stress. Flickering area of TMRM labeling were selected as ROIs and the flickering frequency in the ROIs was determined by counting the number of transitions in 100-s epochs. The change in mitochondrial membrane potential during flickering was estimated from fluorescence in ROIs. Digital Spatial Profiling and scRNA Sequencing Formalin-fixed paraffin-embedded (FFPE) sections were processed and subjected to GeoMx RNA profiling (Nanostring Technologies, Seattle, WA, USA). ROIs/AOIs were defined using TH and IBA1 markers, and gene set enrichment analysis (GSEA) was performed to identify enriched pathways in LRRK2 mutant microglia. Further methodological details are detailed below. FFPE Tissue Preparation : Formalin-fixed paraffin-embedded (FFPE) tissues were prepared as follows: mice were anesthetized, and brains were fixed via transcardial perfusion with 10% neutral buffered formalin (Sigma-Aldrich). Brains were subsequently removed, post-fixed in the same formalin solution for 24 hours at 4°C and immersed in 70% ethanol for at least 1 hour. Tissues were processed and embedded in paraffin using an automated tissue processor (Tissue-Tek VIP, Sakura Finetek USA Inc.) following the programmed protocol: 95% ethanol for 1h15m, 100% ethanol for 1h15m, 100% ethanol for 1h30m, 100% xylene for 1h, 100% xylene for 1h30m, 100% xylene for 1h30m, paraffin for 1h30m at 58°C, and paraffin for 2h at 58°C. FFPE tissues were then immersed in molten paraffin at 60°C in a metal mold to form FFPE blocks. These blocks were cooled at 4°C and stored at the same temperature until further use. Tissue Sectioning and Slide Preparation The midbrains of FFPE mouse brains were coronally sectioned at 5 µm using a rotary microtome. Sections containing the substantia nigra (SN) and ventral tegmental area (VTA) were mounted on Leica BOND Plus microscope slides, with each slide holding 6 sections—3 from wild-type mice and 3 from transgenic mice. The slides were submitted to the Flow Cytometry and Human Immune Monitoring Core at Thomas Jefferson University for RNA profiling via the GeoMx RNA assay (Nanostring). ROI and AOI Selection Tissue sections were stained with fluorescent morphology markers and nuclear counterstain for the identification of regions of interest (ROIs) and areas of interest (AOIs). The morphology markers included an anti-tyrosine hydroxylase (TH) antibody conjugated with Alexa 488 (dopaminergic neuron marker, Sigma #MAB5280X), an anti-GFAP antibody conjugated with Alexa 594 (astrocyte marker), and an anti-Iba1 antibody conjugated with Alexa 647 (microglia marker, Millipore #MABN92-AF647). The nucleus marker was Syto-13. For each tissue section, 2–3 ROIs were selected within the SN or VTA, and each ROI was subdivided into 1–3 AOIs representing TH+, GFAP+, or Iba1 + cell populations. Each AOI contained a minimum of 20 cells. Quality Control Raw counts from GeoMxTM Digital Spatial Profiling (DSP) were processed using GeoMxTM Software. Out of 95 segments collected from 6 mice (3 harboring hLRRK2 R1441G mutations and 3 wild-type), 11 segments were excluded due to failure in quality control (QC) analysis. Following QC, 8021 out of 20175 gene targets in the GeoMx Mouse Whole Transcriptome Atlas passed QC and were retained for downstream analyses. Data Normalization and Analysis To address systematic variability between AOIs, GeoMxTM DSP raw counts were normalized to the 75th percentile of expression for each AOI, as described in the NanoString GeoMxTM Data Analysis User Manual. Differential expression analysis was performed using a negative binomial model, implemented in the DESeq2 package in R. Gene Set Enrichment Analysis (GSEA) Gene Set Enrichment Analysis (GSEA) was carried out to identify dysregulated pathways in dopaminergic neurons between mice carrying hLRRK2 R1441G mutations and wild-type controls. GSEA was conducted using the ClusterProfiler package (version 4.12) in R, with gene sets ranging in size from 10 to 500 genes. Enrichment terms with p-values below 0.05 were considered significantly enriched. Additionally, GSEA was extended using gene set signatures from the Reactome pathway database and the KEGG dataset respectively, with normalized enrichment scores (NES) calculated to identify biological pathways linked to hLRRK2 R1441G mutations in dopaminergic neurons. Statistical Analysis Data are presented as mean ± standard deviation (SD) where applicable. Statistical analysis was performed with GraphPad Prism 8 (GraphPad software Inc.). Unpaired Mann-Whitney test, one-way ANOV, and two-way ANOVA, were applied, with a P-value of < 0.05, considered statistically significant. Results LRRK2-hR1441G mutation disrupts mitochondrial morphology and impairs respiratory function in dopaminergic terminals within the striatum Mutations in LRRK2 represent the most common genetic cause of both familial and sporadic Parkinson’s disease (PD). Li et al. (2009) reported age-dependent motor deficits in LRRK2 BAC-hR1441G mice, implicating this mutation in PD pathogenesis. Mitochondrial dysfunction is a key driver of dopaminergic neuron degeneration in the substantia nigra pars compacta (SNc), with striatal terminal loss preceding neuronal loss in the SNc. To determine whether mitochondrial dysfunction occurs specifically at dopaminergic terminals, we employed tyrosine hydroxylase (TH) immunostaining combined with electron microscopy (EM) to assess mitochondrial morphology. In 10-month-old BAC-hR1441G mice, mitochondria in TH-positive regions exhibited abnormal structural features, including cristae loss and irregular oval-shaped morphology (Fig. 1 a, b). In contrast, wild-type (WT) mice displayed predominantly healthy mitochondria with regular tubular morphology in TH-positive terminals (Fig. 1 c). Quantitative analysis of mitochondrial aspect ratio (i.e., major axis length divided by minor axis length) further revealed that mitochondria in BAC-hR1441G mice were closer to unity, suggesting increased mitochondrial fission (Fig. 1 d). Despite these qualitative changes, the overall striatal distribution of healthy mitochondria did not differ significantly between BAC-hR1441G and WT mice. These findings indicate that the hR1441G mutation leads to abnormal mitochondrial morphology only in dopaminergic terminals, which may contribute to early synaptic dysfunction in PD. To assess whether the LRRK2-hR1441G mutation impairs mitochondrial respiration, we performed Seahorse respirometry on acutely prepared striatal slices sequentially treated with 10 mM pyruvate, 10 µM oligomycin, 10 µM FCCP, and 20 µM antimycin [ 18 ]. In 10-month-old BAC-hR1441G transgenic mice, we observed a significant reduction in basal oxygen consumption rate (OCR), ATP production, and maximal respiratory capacity (Fig. 1 e, f; Extended Data Fig. 1 ). However, no significant differences in mitochondrial respiration were detected in younger (3- and 6-month-old) animals, suggesting a progressive decline in mitochondrial function with aging. hR1441G mutation induces age-Dependent mitochondrial oxidative stress in SNc dopaminergic neurons and striatal terminals The autonomous pace-making activity of substantia nigra pars compacta (SNc) dopaminergic neurons regulate dopamine release, which is essential for striatal function. This process depends on ATP production via mitochondrial oxidative phosphorylation, which concurrently generates superoxide and reactive oxygen species (ROS), leading to mitochondrial oxidative stress. To assess basal oxidative stress levels in the SNc and striatum of an LRRK2 BAC-hR1441G PD model, we crossed these mice with TH-mito-roGFP reporter mice, which express a mitochondria-targeted, redox-sensitive green fluorescent protein under the control of the TH promoter, generating LRRK2 BAC-hR1441G/TH-mito-roGFP mice. Using two-photon laser scanning microscopy (2PLSM) combined with a ratiometric imaging approach (Fig. 2 a-c; Extended Data Fig. 1 – 4 ; details in Supplementary Materials), we assessed mitochondrial redox states in dopaminergic neurons in acute brain slices. BAC-hR1441G mice exhibited significantly increased mitochondrial oxidation levels in the SNc and dorsal striatum, particularly at 6 and 12 months of age (Fig. 2 d–f; Extended Data Fig. 5 – 6 ). Notably, in 3-month-old BAC-hR1441G mice, oxidative stress was already elevated in striatal terminals, suggesting early mitochondrial dysfunction at presynaptic sites. This oxidative stress increase followed an age-dependent pattern. In SNc dopaminergic neurons, oxidation levels progressively increased from 3 to 6 months and further at 12 months. In contrast, in striatal terminals, oxidative stress rose significantly between 3 and 6 months but plateaued thereafter, with no further increase between 6 and 12 months in BAC-hR1441G mice. No significant differences in mitochondrial redox states were detected in the ventral tegmental area (VTA) between 6-month-old WT and BAC-hR1441G mice (Fig. 2 g; Extended Data Fig. 7 ) (Mann-Whitney test, P = 0.8981). These findings demonstrate that the LRRK2-hR1441G mutation induces region-specific and age-dependent increases in mitochondrial oxidative stress, particularly in the SNc and dorsal striatum, but not in the VTA. This suggests that SNc DA neurons and their striatal projections are more vulnerable to oxidative stress, which may contribute to their selective degeneration in PD. Cytosolic and mitochondrial Ca 2+ are overloaded in BAC-hR1441G mice To investigate whether the elevated oxidative stress in BAC-hR1441G mice results from altered calcium homeostasis, we injected AAV-GCaMP6 under the control of the tyrosine hydroxylase (TH) promoter into the substantia nigra pars compacta (SNc) to selectively target dopaminergic neurons. Quantification of cytosolic calcium levels revealed a significant increase in BAC-hR1441G mice, with fluorescence intensity normalized to its maximum value rising from 19.71% in WT mice to 75.75% in BAC-RG mice, indicating a substantial elevation in cytosolic calcium induced by the LRRK2-hR1441G mutation (Fig. 3 a-b; Mann-Whitney test, P = 0.0012; WT: N = 3, n = 7; BAC-RG: N = 3, n = 6). To determine whether ROS elevation was linked to L-type calcium channel activity, we administered isradipine, an L-type calcium channel inhibitor, to BAC-hR1441G mice. Redox level measurements in SNc dopaminergic neurons demonstrated that isradipine significantly reduced ROS levels, supporting a direct link between calcium dysregulation and oxidative stress (Fig. 3 c-d; two-way ANOVA; WT, P = 0.0047; BAC-RG, P < 0.0001). To further assess mitochondrial calcium levels, we injected AAV vectors expressing a mitochondria-targeted calcium indicator under the TH-mito-matrix promoter into the SNc of WT and BAC-RG mice. The hR1441G mutation significantly increased mitochondrial calcium concentrations (Fig. 3 e-f; Mann-Whitney test, P = 0.0012; WT: N = 3, n = 6; BAC-RG: N = 4, n = 7). Western blot analysis further revealed upregulation of the mitochondrial calcium uniporter (MCU), a key regulator of calcium influx into the mitochondria, in BAC-RG mice, supporting a role for MCU-mediated calcium overload in mitochondrial dysfunction (Fig. 3 g). Collectively, these findings demonstrate that calcium overload, driven by increased mitochondrial calcium uptake and elevated MCU expression, contributes to excessive ROS production in LRRK2-hR1441G mutant dopaminergic neurons, establishing a mechanistic link between calcium dysregulation and oxidative stress in PD pathogenesis. Mitochondrial membrane potential flickering reflects oxidative stress and is attenuated in LRRK2 BAC-hR1441G dopaminergic neurons The mitochondrial membrane potential (MMP) plays a critical role in regulating ATP production and reactive oxygen species (ROS) generation [ 16 ]. To investigate whether elevated oxidative stress in BAC-hR1441G mice is associated with alterations in MMP, we employed tetramethylrhodamine methyl ester (TMRM, 2–4 µM), a dye that selectively accumulates within mitochondria to measure MMP. Since TMRM labeling is not cell-type specific, we crossed BAC-hR1441G mice with TH-GFP reporter mice to selectively identify dopaminergic neurons among TMRM-labeled populations (Extended Data Fig. 8). In both WT and BAC-hR1441G mice, DA neurons exhibited periodic oscillations in TMRM fluorescence, indicating transient depolarization and repolarization events of the MMP (Fig. 4 a; Extended Data Video 1). However, the frequency, amplitude, and overall occurrence of MMP transients were significantly reduced in SNc DA neurons from BAC-hR1441G mice compared to WT controls (Fig. 4 b, c). Notably, MMP flickering events—reflecting transient mitochondrial depolarizations—were more prominent in WT DA neurons (Fig. 4 c). The frequency of MMP transients exhibited an age-dependent decline, decreasing progressively from 3 to 6 to 12 months in both genotypes. However, BAC-RG mice showed significantly reduced MMP transient frequencies at 6 and 12 months compared to WT mice, with no significant differences observed at 3 months (Extended Data Fig. 9). To determine whether oxidative stress contributes to MMP flickering, we treated brain slices with N-(2-mercaptopropionyl) glycine (MPG), a cell-permeable antioxidant. MPG treatment reduced MMP flickering and decreased MMP amplitudes (Fig. 4 d-f; Extended Data Video 2). Collectively, these findings suggest that MMP flickering is associated with oxidative stress and that the R1441G mutation impairs MMP homeostasis in an age- and oxidative stress-dependent manner. Uncoupling protein is linked to mitochondrial flickering events Calcium overload has been shown to elevate oxidative levels. To determine whether calcium activity influences MMP dynamics, we applied isradipine, an L-type calcium channel antagonist, to assess the relationship between calcium influx and MMP flickering events in SNc dopaminergic neurons. Isradipine treatment significantly diminished MMP transients and reduced MMP amplitudes (Fig. 5 a-d; Extended Data Video 3), indicating that MMP flickering events are tightly associated with calcium influx. Uncoupling proteins (UCPs) are ion channels in the inner mitochondrial membrane that mitigate oxidative stress by dissipating the proton gradient across the membrane. In the brain, UCPs reduce superoxide production, serving as a negative-feedback mechanism to limit reactive oxygen species (ROS) generation [ 16 , 17 ]. Elevated oxidative stress can increase UCP activation, thereby reducing the IMM potential. To investigate whether MMP flickering is influenced by UCP activity, we applied genipin, a UCP inhibitor, to brain slices containing SNc neurons exhibiting MMP flickering. Genipin significantly attenuated the frequency of MMP flickering events (Fig. 5 e-h;), suggesting that UCP activity directly contributes to MMP dynamics within the mitochondrial IMM. To examine whether the LRRK2 hR1441G mutation affects UCP expression, we isolated mRNA from mitochondria from SNc dopaminergic neurons using laser microdissection and quantified mRNA levels of UCP components. Compared to WT mice, BAC-hR1441G mice exhibited significantly reduced mRNA levels of UCP4 and UCP5 (Fig. 5 i). This finding was further corroborated by western blot analysis, which revealed a decrease in UCP4 protein expression in BAC-hR1441G mice (Fig. 5 j). These results suggest that the hR1441G mutation impairs UCP expression, contributing to altered mitochondrial membrane potential and oxidative stress. Digital spatial profiling (DSP) reveals LRRK2 hR1441G mutation induced elevation of ROS in dopaminergic neuron in SNc. To elucidate the molecular pathways disrupted by the LRRK2 hR1441G mutation, we performed GeoMx digital spatial profiler (DSP) analysis on dopaminergic neurons in the SNc, comparing gene expression profiles between BAC-hR1441G Tg and WT mice. Uniform Manifold Approximation and Projection (UMAP) analysis confirmed clear segregation of DA neurons from other types of cells: microglia and astrocytes in the SNc (Fig. 6 a-b). The analysis identified 19 significantly upregulated and 9 downregulated genes in mutant DA neurons (Fig. 6 c). Volcano plots further highlighted the differentially expressed genes (DEGs) in the transcriptional profiles caused by the LRRK2 hR1441G mutation (Fig. 6 d). Functional enrichment analysis of DEGs revealed significant upregulation of pathways related to complex I biogenesis, mitochondrial calcium ion transport, respiratory electron transport, and heat production mediated by uncoupling proteins (UCPs) in LRRK2 hR1441G mutant DA neurons (Fig. 6 e). Among the top 16 significantly enriched terms, the majority were associated with elevated redox activity, including “Complex I biogenesis,” “The citric acid (TCA) cycle and respiratory electron transport,” and “Oxidative phosphorylation – Mus musculus (house mouse)” (Fig. 6 f-g; Extended Data Fig. 10a-c). Gene association analyses further revealed that most DEGs contributing to elevated ROS generation were related to mitochondrial function in origin (Fig. 6 h; Extended Data Fig. 10d-e). These findings underscore that the LRRK2 hR1441G mutation profoundly disrupts mitochondrial function and exacerbates pathways linked to ROS production in SNc DA neurons. Our findings provide the first direct evidence linking oxidative stress to the LRRK2 hR1441G mutation. As illustrated in Fig. 7 , this mutation disrupts calcium homeostasis, leading to elevated cytosolic and mitochondrial calcium levels, increased basal oxidative stress, and a reduction in mild uncoupling events, likely due to UCP dysfunction or decreased expression. These results suggest potential new therapeutic strategies for LRRK2-associated PD, including enhancing UCP expression or targeting UCP activity with agonists, inhibiting MCU functions, mitigating oxidative stress and restore mitochondrial function, in addition to blocking L-type channels. Mitochondrial dysfunction and oxidative stress are recognized as key drivers of dopaminergic neurodegeneration in PD. However, the mechanisms underlying LRRK2-mediated mitochondrial impairment remain incompletely understood. Here, we provide direct evidence that the LRRK2 hR1441G mutation induces mitochondrial oxidative stress, disrupts calcium homeostasis, and impairs mitochondrial function in an age-dependent manner. Our findings highlight a mechanistic link between pathogenic LRRK2 mutation, oxidative stress, and calcium dysregulation, offering potential targets for therapeutic intervention in PD. Discussion Our study demonstrates that LRRK2 BAC-hR1441G mice exhibit progressive mitochondrial oxidative stress in SNc DA neurons and their striatal projections. Using two-photon ratiometric imaging of TH-mito-roGFP mice, we show that oxidative stress is elevated at dopaminergic terminals as early as 3 months of age, preceding significant neurite loss. This finding supports the hypothesis that presynaptic mitochondrial dysfunction is an early event in PD and may contribute to progressive neurodegeneration. We also observed that mitochondrial oxidative stress increased progressively in SNc DA neurons from 3 to 12 months of age, whereas oxidative stress in striatal terminals plateaued after 6 months. This suggests that early presynaptic mitochondrial dysfunction may initiate the disease process, with somatic mitochondrial stress accumulating later, consistent with axon-first degeneration models of PD [ 19 , 20 ]. In contrast, no significant oxidative stress changes were observed in the VTA, reinforcing the selective vulnerability of SNc DA neurons to mitochondrial dysfunction. A key finding of our study is that LRRK2 hR1441G mutant DA neurons exhibit calcium overload, which contributes to mitochondrial dysfunction. Cytosolic calcium levels were significantly elevated, and mitochondrial calcium uptake was markedly increased, correlating with increased expression of the MCU. Pharmacological inhibition of L-type calcium channels with isradipine significantly reduced oxidative levels, implicating excessive calcium influx as a key driver of oxidative stress. These findings support a pathogenic model in which LRRK2 mutations impair calcium homeostasis, leading to mitochondrial calcium overload, respiratory dysfunction, and ROS accumulation. This is particularly relevant given evidence that Ca²⁺ overload sensitizes DA neurons to oxidative damage, driving mitochondrial permeability transition pore (mPTP) opening and cell death. Our results further implicate UCP dysfunction in exacerbating oxidative stress, as LRRK2 hR1441G DA neurons exhibited reduced UCP4/UCP5 expression, impairing mitochondrial membrane potential flickering, a mechanism that protects against excessive ROS buildup. Digital spatial profiling (DSP) added an important molecular dimension to our findings, revealing that dopaminergic neurons in BAC-RG mice exhibit widespread upregulation of genes involved in oxidative phosphorylation (OXPHOS), mitochondrial calcium transport, and ROS production. This analysis also highlighted the role of uncoupling proteins (UCPs), which were downregulated in BAC-RG mice, leading to impaired mitochondrial membrane potential regulation and further exacerbation of oxidative stress. Our data confirms that UCP dysfunction contributes to ROS generation, offering a new mechanistic understanding of how LRRK2 mutations promote mitochondrial dysregulation. Given the strong link between LRRK2 mutations, oxidative stress, and calcium dysregulation, our findings highlight several potential therapeutic strategies. First, enhancing UCP function through pharmacological activation or gene therapy may help restore mitochondrial homeostasis and reduce ROS accumulation. Second, targeting MCU to limit mitochondrial calcium overload could mitigate oxidative stress-induced damage. Importantly, our results support the use of isradipine (an L-type calcium channel blocker) as a potential neuroprotective strategy in LRRK2-related PD [ 16 , 21 ]. While the STEADY-PD III clinical trial failed to demonstrate significant benefits in idiopathic PD, this is likely due to the intervention occurring at an irreversible stage of the disease, when over 80% of dopaminergic neurons have already been lost. The lack of efficacy does not rule out its potential in earlier stages. Future studies should focus on early intervention, particularly in high-risk individuals, such as genetically defined LRRK2-PD carriers, before significant neuronal loss occurs. Finally, Future studies should assess whether selective MCU inhibitors or UCP agonists can provide neuroprotection in LRRK2-associated PD models. Conclusion Our study provides the first direct evidence that R1441G mutation drives mitochondrial oxidative stress through calcium dysregulation and impaired UCP function in SNc DA neurons. We demonstrate early oxidative stress in presynaptic terminals, followed by age-dependent mitochondrial dysfunction in SNc DA neurons, highlighting a potential axon-first degeneration model in PD. Our findings suggest that targeting MCU, L-type calcium channels, and UCPs may provide novel therapeutic strategies for LRRK2-associated PD. Declarations Supplementary information Supplementary material is available online. Author contributions H.Z. conceived of and supervised the project. Y.X.C. and H.Z. wrote the paper. Y.X.C. and H.Z. analyzed the data, with input from all authors. Y.X.C. performed 2p experiments. L.T.Z performed the Seahorse assays, and the quantitative real-time RT-PCR (qPCR). S.Q.C. performed WB. C.B.Z and H.X.W. prepared the samples for spatial digital profiling experiment and C.B.Z. performed the experiment. Funding This work was supported by the National Institute of Neurological Disorders and Stroke (NINDS) (Grant NS098393, NS097530 and NS128005 to H.Z.), and startup funds from Thomas Jefferson University (H.Z.) and the University of Georgia (H.Z.). Availability of data and materials The authors declare that all data supporting the findings of this study are available within the article and its Supplementary Information files or from the corresponding author upon reasonable request. Declaration of Interests The authors declare no competing interests. Acknowledgments We thank Dr. D. James Surmeirer at Northwestern University for providing the TH-mito-roGFP mice and the AAV-TH-GCamp6 virus. We also thank Dr. Susan R. Sesack at the University of Pittsburgh who prepared tissue from wild-type and LRRK2 BAC-hR1441G mice for immunogold labeling and performed photographic sampling of striatal sections under electron microscopy. This work was supported by the National Institute of Neurological Disorders and Stroke (NINDS) (Grant NS098393, NS097530 and NS128005 to H.Z.), and startup funds from Thomas Jefferson University (H.Z.) and the University of Georgia (H.Z.). References Surmeier DJ. Determinants of dopaminergic neuron loss in Parkinson’s disease. FEBS J. 2018;285:3657–68. Lashuel HA, Petre BM, Wall J, Simon M, Nowak RJ, Walz T et al. α-synuclein, especially the parkinson’s disease-associated mutants, forms pore-like annular and tubular protofibrils. J Mol Biol [Internet]. 2002 [cited 2025 Mar 19];322:1089–102. Available from: https://pubmed.ncbi.nlm.nih.gov/12367530/ Dauer W, Przedborski S. Parkinson’s Disease: Mechanisms and Models. Neuron. 2003;39:889–909. Fearnley JM, Lees AJ, AGEING AND PARKINSON’S DISEASE:. SUBSTANTIA NIGRA REGIONAL SELECTIVITY. Brain [Internet]. 1991 [cited 2025 Mar 19];114:2283–301. Available from: https://dx.doi.org/10.1093/brain/114.5.2283 Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S et al. Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron [Internet]. 2004 [cited 2025 Mar 19];44:601–7. Available from: https://pubmed.ncbi.nlm.nih.gov/15541309/ West AB, Moore DJ, Biskup S, Bugayenko A, Smith WW, Ross CA et al. Parkinson’s disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A [Internet]. 2005 [cited 2025 Mar 19];102:16842–7. Available from: https://pubmed.ncbi.nlm.nih.gov/16269541/ Kluss JH, Mamais A, Cookson MR. LRRK2 links genetic and sporadic Parkinson’s disease. Biochem Soc Trans [Internet]. 2019 [cited 2025 Apr 2];47:651–61. Available from: / biochemsoctrans/article/47/2/651/219650/LRRK2-links-genetic-and-sporadic-Parkinson-s Healy DG, Falchi M, O’Sullivan SS, Bonifati V, Durr A, Bressman S et al. Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson’s disease: a case-control study. Lancet Neurol [Internet]. 2008 [cited 2025 Mar 19];7:583–90. Available from: https://pubmed.ncbi.nlm.nih.gov/18539534/ Cookson MR. The role of leucine-rich repeat kinase 2 (LRRK2) in Parkinson’s disease. Nat Rev Neurosci [Internet]. 2010 [cited 2025 Mar 19];11:791. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC4662256/ Cherra SJ, Steer E, Gusdon AM, Kiselyov K, Chu CT. Mutant LRRK2 Elicits Calcium Imbalance and Depletion of Dendritic Mitochondria in Neurons. Am J Pathol. 2013;182:474–84. Wang X, Yan MH, Fujioka H, Liu J, Wilson-delfosse A, Chen SG et al. LRRK2 regulates mitochondrial dynamics and function through direct interaction with DLP1. Hum Mol Genet [Internet]. 2012 [cited 2025 Mar 19];21:1931–44. Available from: https://dx.doi.org/10.1093/hmg/dds003 Sheu SS, Nauduri D, Anders MW. Targeting antioxidants to mitochondria: a new therapeutic direction. Biochim Biophys Acta [Internet]. 2006 [cited 2025 Mar 19];1762:256–65. Available from: https://pubmed.ncbi.nlm.nih.gov/16352423/ Csordás G, Hajnóczky G. SR/ER–mitochondrial local communication: Calcium and ROS. Biochimica et Biophysica Acta (BBA). - Bioenergetics. 2009;1787:1352–62. Chan CS, Gertler TS, Surmeier DJ. Calcium homeostasis, selective vulnerability and Parkinson’s disease. Trends Neurosci [Internet]. 2009 [cited 2025 Mar 19];32:249–56. Available from: https://pubmed.ncbi.nlm.nih.gov/19307031/ Li Y, Liu W, Oo TF, Wang L, Tang Y, Jackson-Lewis V et al. Mutant LRRK2R1441G BAC transgenic mice recapitulate cardinal features of Parkinson’s disease. Nature Neuroscience. 2009 12:7 [Internet]. 2009 [cited 2025 Mar 19];12:826–8. Available from: https://www.nature.com/articles/nn.2349 Guzman JN, Sanchez-Padilla J, Wokosin D, Kondapalli J, Ilijic E, Schumacker PT et al. Oxidant stress evoked by pacemaking in dopaminergic neurons is attenuated by DJ-1. Nature [Internet]. 2010 [cited 2025 Mar 19];468:696–700. Available from: https://pubmed.ncbi.nlm.nih.gov/21068725/ Kim-Han JS, Dugan LL. Mitochondrial Uncoupling Proteins in the Central Nervous System. https://home.liebertpub.com/ars [Internet]. 2005 [cited 2025 Mar 19];7:1173–81. Available from: https://www.liebertpub.com/doi/ 10.1089/ars.2005.7.1173 Zhi L, Qin Q, Muqeem T, Seifert EL, Liu W, Zheng S et al. Loss of PINK1 causes age-dependent decrease of dopamine release and mitochondrial dysfunction. Neurobiol Aging [Internet]. 2019 [cited 2025 Mar 19];75:1–10. Available from: https://pubmed.ncbi.nlm.nih.gov/30504091/ Burke RE, O’Malley K. Axon degeneration in Parkinson’s disease. Exp Neurol [Internet]. 2013 [cited 2025 Mar 19];246:72–83. Available from: https://pubmed.ncbi.nlm.nih.gov/22285449/ Hattori N, Mizuno Y. Mitochondrial Dysfunction in Parkinson’s Disease. Exp Neurobiol [Internet]. 2015 [cited 2025 Mar 19];24:103. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC4479806/ Guzman JN, Ilijic E, Yang B, Sanchez-Padilla J, Wokosin D, Galtieri D et al. Systemic isradipine treatment diminishes calcium-dependent mitochondrial oxidant stress. J Clin Invest [Internet]. 2018 [cited 2025 Mar 19];128:2266–80. Available from: https://doi.org/10.1172/JCI95898 Additional Declarations No competing interests reported. Supplementary Files ChenROSSupplementary202500821.docx VideoS1WTMMP.avi VideoS1TGMMP.avi VideoS2CTR.avi VideoS2MPG.avi VideoS3CTR.avi VideoS3Isradipine.avi Zhanglab2024052411h53m36sucp4gel1Chemiluminescence.jpg Zhanglab2024052513h03m19sgel1actinChemiluminescence.jpg Zhanglab2024082111h26m20smcuChemiluminescence.jpg Zhanglab2024082210h48m10sactinChemiluminescence.jpg Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 18 Jan, 2026 Reviews received at journal 16 Jan, 2026 Reviews received at journal 17 Dec, 2025 Reviewers agreed at journal 14 Dec, 2025 Reviews received at journal 02 Dec, 2025 Reviewers agreed at journal 01 Dec, 2025 Reviewers agreed at journal 01 Dec, 2025 Reviewers invited by journal 30 Nov, 2025 Editor assigned by journal 28 Nov, 2025 Submission checks completed at journal 27 Nov, 2025 First submitted to journal 21 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8177400","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":554184140,"identity":"3006c146-9be5-45ac-ac82-0e9c0171130f","order_by":0,"name":"Yuanxin Chen","email":"","orcid":"","institution":"The University of Georgia","correspondingAuthor":false,"prefix":"","firstName":"Yuanxin","middleName":"","lastName":"Chen","suffix":""},{"id":554184141,"identity":"b54964ee-9105-485f-b1c5-24432634869a","order_by":1,"name":"Lianteng Zhi","email":"","orcid":"","institution":"Thomas Jefferson University","correspondingAuthor":false,"prefix":"","firstName":"Lianteng","middleName":"","lastName":"Zhi","suffix":""},{"id":554184142,"identity":"cfc1cd2c-b1b5-4958-904e-fed8d39e5a48","order_by":2,"name":"Shiquan Cui","email":"","orcid":"","institution":"The University of Georgia","correspondingAuthor":false,"prefix":"","firstName":"Shiquan","middleName":"","lastName":"Cui","suffix":""},{"id":554184143,"identity":"3beb6699-05c6-4c09-83dd-f5552a9c960a","order_by":3,"name":"Huaixin Wang","email":"","orcid":"","institution":"The University of Georgia","correspondingAuthor":false,"prefix":"","firstName":"Huaixin","middleName":"","lastName":"Wang","suffix":""},{"id":554184144,"identity":"8ef078ba-e41e-472f-9967-088058d32cf6","order_by":4,"name":"Chenbo Zeng","email":"","orcid":"","institution":"Thomas Jefferson University","correspondingAuthor":false,"prefix":"","firstName":"Chenbo","middleName":"","lastName":"Zeng","suffix":""},{"id":554184145,"identity":"ffc38817-5f3c-4f2f-a330-590710ec5d0c","order_by":5,"name":"Hui Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIiWNgGAWjYBACgwOMDcw/G4AsZuYDEKEDRGhhkARpYWdLIFYLkABr4ecxIFLLjeQGBsMddnnyzjzfJL/UMMjx3UjAr8X+RmIDQ+KZ5GLDw7zbpGWOMRhLEtJiANJysI05cWMzUIsEG0PiBmK0MDa21QO18DyTlvjHUE+UFmbGtsOJ85l52CQ/tjEkGBDUcuZhw2HGtuOJG5jZjK0Z+yQMZ555QEDL8fSHj3+2VSfO7z/88OaPbzbyfMcJ2AICB8B6gSQzD4MEYeVwIN/AwMD4gwQNo2AUjIJRMHIAAH0BTKoQev1pAAAAAElFTkSuQmCC","orcid":"","institution":"The University of Georgia","correspondingAuthor":true,"prefix":"","firstName":"Hui","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-11-22 02:53:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8177400/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8177400/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97343148,"identity":"2d31b2bc-8894-4de1-b0fa-f8ffa8bc0b87","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3071803,"visible":true,"origin":"","legend":"","description":"","filename":"ChenROS20250821irisV2.2clean.docx","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/b1b0501ce2d36136370c566a.docx"},{"id":97343143,"identity":"87d9a362-4680-4fc3-b2e7-2988f7011426","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8142,"visible":true,"origin":"","legend":"","description":"","filename":"10670ebbeb4440a9ac546a964795fa15.json","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/c2f9f3e86844c0a7f1b9483c.json"},{"id":97371049,"identity":"f1b0d5dc-b9a0-4ca5-8c91-b08d3e8fb72f","added_by":"auto","created_at":"2025-12-03 16:28:21","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2345811,"visible":true,"origin":"","legend":"","description":"","filename":"ChenROSSupplementary202500821.docx","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/8663536f668d8aeac0c4a484.docx"},{"id":97343159,"identity":"687976ba-45c7-476b-95ac-280fe4ed3d40","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"avi","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2470154,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS1TGMMP.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/62ee9ba2f2a36121f956edf9.avi"},{"id":97370907,"identity":"a0e19ac7-3a07-4ef8-b030-1dafa82c276c","added_by":"auto","created_at":"2025-12-03 16:28:08","extension":"avi","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3764980,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS1WTMMP.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/c918394b10a3f7c924cbc7ea.avi"},{"id":97370327,"identity":"be7a3383-9e46-45e6-8ec6-621c4464d5fc","added_by":"auto","created_at":"2025-12-03 16:27:10","extension":"avi","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1043720,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS2CTR.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/120d730246eb9edd86f1cc6e.avi"},{"id":97370569,"identity":"33d12100-29ab-41b7-a5ab-92c53c009162","added_by":"auto","created_at":"2025-12-03 16:27:36","extension":"avi","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":966106,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS2MPG.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/e34e65069f388e56c8af15b8.avi"},{"id":97343163,"identity":"d0727c6f-7441-47e8-bb22-9df3999dcd8a","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"avi","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7524566,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS3CTR.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/3b3b33c61a1c038f6efd5bd6.avi"},{"id":97343176,"identity":"fb20d14b-6329-4884-bcb7-ec8c1fa4e0ea","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"avi","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7332084,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS3Isradipine.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/ff3455751617e433c4fca6a6.avi"},{"id":97343174,"identity":"f11fcc59-de77-404e-9c1b-a0df469fad5f","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"jpg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111139,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024052411h53m36sucp4gel1Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/7aff329a24f3190a03282fa6.jpg"},{"id":97343170,"identity":"094fc80d-ed74-4744-a0ec-380432028ad1","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76514,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024052513h03m19sgel1actinChemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/ffa958463a4c799fb2ef51ca.jpg"},{"id":97343178,"identity":"61041f5b-ace6-4aac-8e01-70ae615f5cc2","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82382,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024082111h26m20smcuChemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/c196a3e5528b5a5cf3ed30a7.jpg"},{"id":97343183,"identity":"95f79b61-e3a3-4686-9287-a1a1a3c1deec","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":265380,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024082210h48m10sactinChemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/c882b9d5c0f24c04da6134bf.jpg"},{"id":97343180,"identity":"25c57952-7c77-492f-80c6-f665ca65d2ad","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":123127,"visible":true,"origin":"","legend":"","description":"","filename":"10670ebbeb4440a9ac546a964795fa151enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/893b1e56c14ccae6eb5f4551.xml"},{"id":97370897,"identity":"04a0ee87-fb00-403a-9cca-0f038d306511","added_by":"auto","created_at":"2025-12-03 16:28:07","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":913050,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/2398c2125b41be40a06ec143.jpeg"},{"id":97343182,"identity":"bc0d6d70-a730-41fc-b198-6e9f6a86f464","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":910215,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/4137eed19ccd3119d6912ccf.jpeg"},{"id":97343175,"identity":"b1f849a7-a0d6-49e1-bccb-3251a2a77b47","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1438721,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/3221d960984ac6b497434728.jpeg"},{"id":97343165,"identity":"dada7a35-4e15-43cf-be19-27b6374a32a9","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":302154,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/edcf0266e9a35ea1a2dc35c0.jpeg"},{"id":97370227,"identity":"66094a42-c9d5-4bcb-8b40-6f65c6a5d953","added_by":"auto","created_at":"2025-12-03 16:26:56","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":192982,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/b60f0635d3a6d3322cf31d25.png"},{"id":97369927,"identity":"639aae43-9f2c-4ca1-a9b5-0a62e8f57c98","added_by":"auto","created_at":"2025-12-03 16:26:06","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":202826,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/2ac6acc7a47c2acc76d295b0.png"},{"id":97343177,"identity":"3eef325e-7bc2-4441-bd84-bc7256e08a22","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":365422,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/42744a8875e1268b80f3b64c.png"},{"id":97370457,"identity":"d4cc8755-e047-477b-ad3a-1019a9dc278c","added_by":"auto","created_at":"2025-12-03 16:27:25","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":75966,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/7d251677f7505b8e2e30ff84.png"},{"id":97343172,"identity":"721ee254-00d5-4a60-b314-071c42c66514","added_by":"auto","created_at":"2025-12-03 11:36:44","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120489,"visible":true,"origin":"","legend":"","description":"","filename":"10670ebbeb4440a9ac546a964795fa151structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/f7d21d9dc8ec0940af0ad74f.xml"},{"id":97343168,"identity":"9335e3f4-d5dc-4f76-b8e3-e45d3123acf0","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134496,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/0517ad57eed86d2adcce82d3.html"},{"id":97343142,"identity":"c1cc6667-c3be-4ac9-9d38-6e46f05fe394","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":38978,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMitochondria respiration in LRRK2 WT and BAC-hR1441G striatum slices.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea, b\u003c/strong\u003eRepresentative EM images of mitochondria after TH immunogold staining in striatal slices from age matched LRRK2 WT and BAC-RG mice, respectively. Red arrows indicated tyrosine hydroxylase (TH)-positive signals within dopamine terminals. White arrows pointed to mitochondria located within or around the dopamine terminals. \u003cstrong\u003ec\u003c/strong\u003e Quantification of mitochondrial density in the striatum and in proximity to dopaminergic (DA) terminals. Compared to WT controls, BAC-RG mice displayed a significant increase in the proportion of unhealthy mitochondria near DA terminals (striatum: WT, \u003cem\u003eN \u003c/em\u003e= 4, \u003cem\u003en\u003c/em\u003e= 1300; BAC-RG, \u003cem\u003eN\u003c/em\u003e= 4, \u003cem\u003en\u003c/em\u003e = 1231; DA terminal: WT, \u003cem\u003en\u003c/em\u003e = 52; BAC-RG, \u003cem\u003en\u003c/em\u003e = 67, *\u003cem\u003eP\u003c/em\u003e= 0.0225). \u003cstrong\u003ed\u003c/strong\u003e Mitochondrial aspect ratio, an indicator of morphology, was significantly higher in WT mice compared to BAC-RG mice (unpaired Mann-Whitney test, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001). \u003cstrong\u003ee\u003c/strong\u003e Acute striatal slices from WT and BAC-RG mice were sequentially treated with 10 mM pyruvate (A), 10 µM oligomycin (B), 10 µM FCCP (C), and 20 µM antimycin A (D). Real-time oxygen consumption rates (OCR), indicative of oxidative phosphorylation, were measured. \u003cstrong\u003ef\u003c/strong\u003e BAC-RG mice exhibited a significant reduction in basal respiration, ATP production, and maximal respiration, while proton leakage and non-mitochondrial respiration remained unaltered (two-way ANOVA test, Basal, WT \u003cem\u003evs\u003c/em\u003e BAC-RG, ***\u003cem\u003eP \u003c/em\u003e= 0.0006; ATP production, WT \u003cem\u003evs\u003c/em\u003e BAC-RG *\u003cem\u003eP \u003c/em\u003e= 0.0478; Max. Respiration, WT \u003cem\u003evs\u003c/em\u003e BAC-RG, ***\u003cem\u003eP \u003c/em\u003e= 0.0006; Proton Leakage, \u003cem\u003eP\u003c/em\u003e= 0.5808; non-mitochondrial Respiration, \u003cem\u003eP\u003c/em\u003e = 0.9972).\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/cbc84e1a0ce06a3769aa7a65.jpg"},{"id":97369717,"identity":"b8d79a68-7bd3-4900-a4b2-0556c78468b8","added_by":"auto","created_at":"2025-12-03 16:25:36","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":47576,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAged-dependent oxidative stress of LRRK2 WT and BAC-hR1441G animal model\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Visualization of substantia nigra pars compacta (SNc) dopaminergic (DA) neurons expressing roGFP under different conditions: control, dithiothreitol (DTT), and aldehyde (Ald) treatments. \u003cstrong\u003eb\u003c/strong\u003e Quantitative analysis of roGFP fluorescence intensity over time following sequential treatment with DTT and Ald. \u003cstrong\u003ec\u003c/strong\u003e Statistical analysis of the effects of DTT and Ald on roGFP fluorescence intensity (\u003cem\u003eN\u003c/em\u003e= 4, \u003cem\u003en\u003c/em\u003e = 6, Wilcoxon matched pairs signed rank test; CTR \u003cem\u003evs\u003c/em\u003e DTT, *\u003cem\u003eP\u003c/em\u003e = 0.0313; CTR \u003cem\u003evs\u003c/em\u003e Ald, *\u003cem\u003eP\u003c/em\u003e = 0.0313). \u003cstrong\u003ed \u003c/strong\u003eRepresentative images of SNc DA neurons expressing roGFP in 6-month-old LRRK2 WT and BAC-RG mice under two excitation wavelengths (900 nm and 800 nm) and across different brain regions (striatum, SNc, and VTA). \u003cstrong\u003ee\u003c/strong\u003e Oxidative stress levels in the striatum also showed an age-dependent increase, with hLRRK2 BAC-RG mice demonstrating elevated oxidative stress at 3 month (*\u003cem\u003eP\u003c/em\u003e = 0.0140), 6 months (***\u003cem\u003eP\u003c/em\u003e = 0.0008) and over 12 months (**\u003cem\u003eP\u003c/em\u003e = 0.0051) compared to WT controls (3 pairs for 3-month-old WT, \u003cem\u003en\u003c/em\u003e = 10; BAC-RG, \u003cem\u003en\u003c/em\u003e = 7; 4 pairs for 6-month-old WT, \u003cem\u003en\u003c/em\u003e = 11; BAC-RG, \u003cem\u003en\u003c/em\u003e = 8; 3 pairs for over 12-month-old WT, \u003cem\u003en\u003c/em\u003e = 12; BAC-RG, \u003cem\u003en\u003c/em\u003e = 20). \u003cstrong\u003ef\u003c/strong\u003e Oxidative stress levels in SNc DA neurons increased with age, with hLRRK2 BAC-RG mice exhibiting significantly higher oxidative stress at 6 months (**\u003cem\u003eP\u003c/em\u003e = 0.005) and 12 months (****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001) compared to WT controls (3 pairs; DA neurons: 3-month-old WT, \u003cem\u003en\u003c/em\u003e = 18; BAC-RG, \u003cem\u003en\u003c/em\u003e = 21; 6-month-old WT, \u003cem\u003en\u003c/em\u003e = 18; BAC-RG, \u003cem\u003en\u003c/em\u003e = 21; 12-month-old WT, \u003cem\u003en\u003c/em\u003e= 24; BAC-RG, \u003cem\u003en\u003c/em\u003e = 25). \u003cstrong\u003eg\u003c/strong\u003e No significant difference in oxidative stress was observed in VTA DA neurons between 6-month-old LRRK2 WT and BAC-RG mice (3 pairs; DA neurons: WT, \u003cem\u003en\u003c/em\u003e = 9; BAC-RG, \u003cem\u003en\u003c/em\u003e = 5; Mann-Whitney test, \u003cem\u003eP\u003c/em\u003e = 0.8981).\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/732f7b958309839ffcafe4be.jpg"},{"id":97343145,"identity":"3bdb1837-6360-4575-a1c0-fb1041fd4e10","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39217,"visible":true,"origin":"","legend":"\u003cp\u003eLRRK2 BAC-hR1441G Mutation Elevates Cytosolic and Mitochondrial Calcium Levels in 5-Month-Old Mice\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Pseudo-colored representative images of cytosolic calcium levels in striatal slices from LRRK2 WT and BAC-hR1441G mice under varying perfusion conditions: regular artificial cerebrospinal fluid (ACSF), ACSF with 0 mM Ca²⁺ + EGTA + 1 μM ionomycin, and ACSF with 3 mM Ca²⁺ + 1 μM ionomycin. \u003cstrong\u003eb\u003c/strong\u003e Quantification of cytosolic calcium levels revealed that the LRRK2 BAC-hR1441G mutation significantly increased cytosolic calcium concentration compared to WT mice (Mann-Whitney test, **\u003cem\u003eP\u003c/em\u003e = 0.0012; WT: \u003cem\u003eN\u003c/em\u003e = 3, \u003cem\u003en\u003c/em\u003e = 7; BAC-RG: \u003cem\u003eN\u003c/em\u003e = 3, \u003cem\u003en\u003c/em\u003e= 6). \u003cstrong\u003ec \u003c/strong\u003eRepresentative images illustrating the effect of the L-type calcium channel blocker Isradipine on redox levels in SNc dopaminergic neurons. \u003cstrong\u003ed\u003c/strong\u003e Isradipine treatment significantly reduced redox levels in SNc dopaminergic neurons (two-way ANOA, WT \u003cem\u003evs\u003c/em\u003e BAC-RG + Isra., *\u003cem\u003eP\u003c/em\u003e = 0.0427, BAC-RG \u003cem\u003evs\u003c/em\u003e BAC-RG + Isra., ****\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.0001). \u003cstrong\u003ee\u003c/strong\u003ePseudo-colored representative images of mitochondrial calcium levels in LRRK2 WT and BAC-RG mice under different perfusion conditions: regular ACSF, ACSF with 0 mM Ca²⁺ + EGTA + 1 μM ionomycin, and ACSF with 3 mM Ca²⁺ + 1 μM ionomycin. \u003cstrong\u003ef\u003c/strong\u003e Quantification of mitochondrial calcium indicated that LRRK2 BAC-hR1441G mutation significantly increased mitochondrial calcium concentration (Mann Whitney test, **\u003cem\u003eP\u003c/em\u003e = 0.0012; WT, \u003cem\u003eN\u003c/em\u003e = 3 \u003cem\u003en\u003c/em\u003e= 6; BAC-RG, \u003cem\u003eN\u003c/em\u003e = 4, \u003cem\u003en\u003c/em\u003e = 7). \u003cstrong\u003eg\u003c/strong\u003e Top: Representative Western blot analysis of mitochondrial calcium uniporter (MCU) expression in the substantia nigra (SN) of LRRK2 WT and BAC-RG mice. Bottom: Quantitative analysis revealed a significant elevation in MCU expression levels in LRRK2 BAC-hR1441G mice (3 pairs, Mann-Whitney test, *\u003cem\u003eP \u003c/em\u003e= 0.0138).\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/28aaef383a9e83de542c02e0.jpg"},{"id":97343146,"identity":"b2182b8e-e16e-4213-85b8-1c33bfc8a25d","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":47040,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMitochondrial membrane potential (MMP) transient is linked to oxidative stress.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Left, Representative images of mitochondria in SNc dopaminergic neurons in brain slices labeled with TMRM at the different time (0 sec and 25 sec) from LRRK2 WT and BAC-hR1441G mice. Right: Time series of TMRM fluorescence intensity in a region of interest (ROI, white circle) from the left panel, illustrating the difference of MMP dynamics between LRRK2 WT and BAC-RG. \u003cstrong\u003eb\u003c/strong\u003e \u003cstrong\u003eLeft\u003c/strong\u003e, Box plot showing a significant reduction in MMP amplitude in LRRK2 BAC-RG mice compared to WT (Mann-Whitney test, **\u003cem\u003eP\u003c/em\u003e = 0.0073). \u003cstrong\u003eRight\u003c/strong\u003e, Box plot demonstrated that flickering frequency was significantly higher in LRRK2 BAC-RG mice than in WT (Mann-Whitney test, **\u003cem\u003eP\u003c/em\u003e = 0.0011). \u003cstrong\u003ec\u003c/strong\u003e Bar graph summarizing the number of SNc dopaminergic neurons with observable MMP flickering events, indicating a lower number of neurons exhibiting flickering in LRRK2 BAC-RG mice. \u003cstrong\u003ed\u003c/strong\u003e Representative images of SNc dopaminergic neurons labeled with TMRM before and after the bath treatment of an antioxidant, N-(2-mercaptopropionyl)-glycine (MPG). \u003cstrong\u003ee\u003c/strong\u003e Time series of TMRM fluorescence intensity before and after MPG application, showing a decrease in flickering events following MPG treatment. \u003cstrong\u003ef\u003c/strong\u003e Box plot summarizing flickering frequency (left) and amplitude (right) of flickering events after MPG treatment (\u003cem\u003eN\u003c/em\u003e = 3, \u003cem\u003en\u003c/em\u003e = 9), indicating that MPG effectively mitigates flickering events associated with oxidative stress (Mann-Whitney test, *\u003cem\u003eP\u003c/em\u003e = 0.0260).\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/4b2b7d3817eb1e6a36502b2a.jpg"},{"id":97343157,"identity":"400dcfb5-afbd-4704-b9d5-dd893e0fa748","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":58094,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUncoupling protein is linked to mitochondrial flickering events.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Representative TMRM fluorescence images of SNc dopaminergic neurons before and after treatment with Isradipine. \u003cstrong\u003eb\u003c/strong\u003e Isradipine significantly reduces mitochondrial flickering frequency. \u003cstrong\u003ec\u003c/strong\u003e, \u003cstrong\u003ed\u003c/strong\u003e Quantitative analysis of Isradipine’s effects on flickering frequency and amplitude in SNc dopaminergic neurons, demonstrating a significant reduction in flickering events following treatment (\u003cem\u003eN\u003c/em\u003e = 4, \u003cem\u003en\u003c/em\u003e= 8; Mann-Whitney test, ***\u003cem\u003eP\u003c/em\u003e = 0.0010). \u003cstrong\u003ee\u003c/strong\u003e, \u003cstrong\u003ef\u003c/strong\u003eRepresentative TMRM fluorescence time-series images of SNc dopaminergic neurons before and after genipin treatment, respectively, indicating a decrease in mitochondrial flickering frequency after genipin application. \u003cstrong\u003eg\u003c/strong\u003e, \u003cstrong\u003eh\u003c/strong\u003eQuantitative analysis of genipin’s effects on flickering frequency and amplitude in SNc dopaminergic neurons, respectively, showing a significant reduction in flickering events following treatment (\u003cem\u003eN\u003c/em\u003e = 6, \u003cem\u003en\u003c/em\u003e = 10; Mann-Whitney test, **\u003cem\u003eP \u003c/em\u003e= 0.0052). \u003cstrong\u003ei\u003c/strong\u003e mRNA expression analysis of uncoupling proteins (UCPs) reveals that UCP4 and UCP5 levels are significantly reduced in BAC-RG mice compared to WT (4 pairs, two-way ANOVA, WT vs BAC-RG, UCP4, *\u003cem\u003eP \u003c/em\u003e= 0.0397, UCP5, **\u003cem\u003eP \u003c/em\u003e= 0.0019). \u003cstrong\u003ej\u003c/strong\u003e Top: Representative Western blot showing UCP4 expression levels in the substantia nigra (SN) of LRRK2 BAC-hR1441G mice. Bottom: Quantitative analysis indicated a significant reduction in UCP4 expression in the SN of LRRK2 BAC-hR1441G mice compared to WT (4 pairs; Mann-Whitney test, **\u003cem\u003eP\u003c/em\u003e = 0.0022).\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/8c95b48adbd1dc3b7ab1bbe2.jpg"},{"id":97343158,"identity":"7b5f7814-5b38-4280-9beb-3f3fa0aa61ba","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":49997,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDigital Spatial Profiling of Dopaminergic (DA) Neurons in the Substantia Nigra (SN)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Representative coronal brain sections displaying the spatial distribution of three cell markers: tyrosine hydroxylase (TH), GFAP, and IBA1, used for digital spatial profiling in the brain region SNc. \u003cstrong\u003eb\u003c/strong\u003e UMAP clustering reveals distinct cell types. \u003cstrong\u003ec\u003c/strong\u003e Heatmap displaying significant differentially expressed genes (DEGs) in DA neurons between LRRK2 BAC-RG and WT mice within the SN region. \u003cstrong\u003ed\u003c/strong\u003e Volcano plots visualizing DEGs distribution in DA neurons between LRRK2 BAC-RG and WT mice, with Log\u003csub\u003e2\u003c/sub\u003e fold changes plotted against -Log\u003csub\u003e10\u003c/sub\u003e of the adjusted p-value for each gene. \u003cstrong\u003ee\u003c/strong\u003e Enrichment plot showing upregulation of gene sets in DA neurons from LRRK2 BAC-RG mice relative to WT, associated with terms: respiratory electron transport, ATP synthesis via chemiosmotic coupling, and heat production by uncoupling proteins. \u003cstrong\u003ef\u003c/strong\u003e Bar plot depicting the top 16 enrichment terms derived from the DEGs of DA neurons, ranked by statistical significance. \u003cstrong\u003eg\u003c/strong\u003e, Gene set enrichment analysis (GSEA) in DA neurons is presented as a hierarchically clustered heatmap. The color key represents the -Log10 p-value for the enrichment score, while the circle size reflects the number of leading genes associated with each enrichment term. \u003cstrong\u003eh\u003c/strong\u003e CNETplot visualizing the complex associations between genes and significantly enriched GO terms in DA neurons. Node size corresponds to the statistical significance (adjusted p-value) of the term, while gene node colors indicate their fold change values. Edges denote the relationship between genes and their associated enrichment terms.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/70b4d57c04d1a35c283a7015.jpg"},{"id":97370624,"identity":"adae725e-197c-4085-b1a5-de39e7ec2250","added_by":"auto","created_at":"2025-12-03 16:27:42","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":28704,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSummary of findings linking hLRRK2 mutation to elevated mitochondrial oxidative stress\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eThe LRRK2 hR1441G mutation contributes to heightened mitochondrial oxidative stress in dopaminergic neurons within the substantia nigra pars compacta (SNc). This mutation facilitates increased cytosolic calcium influx and enhances mitochondrial calcium accumulation, mediated by the upregulation of mitochondrial calcium uniporter (MCU) protein. Elevated mitochondrial calcium concentrations drive an upregulation of oxidative phosphorylation (OXPHOS), leading to increased production of reactive oxygen species (ROS). Furthermore, the LRRK2 hR1441G mutation downregulates uncoupling proteins (UCPs), impairing the degradation and clearance of ROS. This imbalance exacerbates oxidative stress, promoting synaptic dysfunction and axonal degeneration in SNc dopaminergic neurons. These pathological processes highlight the critical role of LRRK2 hR1441G in mitochondrial dysfunction and neurodegeneration.\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/fc9c7e7cc7dbceb6daed45ac.jpg"},{"id":97373156,"identity":"86795f1f-f60d-413c-829a-98db1f9664e4","added_by":"auto","created_at":"2025-12-03 16:34:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1859551,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/92ad59fa-b318-4338-9587-20b0566e01a9.pdf"},{"id":97343147,"identity":"23ffc392-4a07-46cd-9986-d8b8f611c61d","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":2345811,"visible":true,"origin":"","legend":"","description":"","filename":"ChenROSSupplementary202500821.docx","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/359a9702373cc4d00cea522c.docx"},{"id":97371416,"identity":"ed710ca7-f183-4d1e-9e33-335941ec6510","added_by":"auto","created_at":"2025-12-03 16:28:53","extension":"avi","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3764980,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS1WTMMP.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/6a95bdcd54f84721f3afc18b.avi"},{"id":97343150,"identity":"34a9ab52-b894-41b8-b4d0-d00ba3709cb7","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"avi","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2470154,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS1TGMMP.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/f77fb9b9a84804e980fe94de.avi"},{"id":97343152,"identity":"a4d93a2e-114a-4b79-888c-0f2055f4374f","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"avi","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1043720,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS2CTR.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/af4669729f806d66eae4e626.avi"},{"id":97343161,"identity":"c4484ba3-7ff8-40bb-8035-0fabce026303","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"avi","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":966106,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS2MPG.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/12e4ca054e641386f463b432.avi"},{"id":97370932,"identity":"c4b6bda4-7ac1-4f4d-bcad-33643b73ad85","added_by":"auto","created_at":"2025-12-03 16:28:09","extension":"avi","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":7524566,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS3CTR.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/7a869d81e0914cbd0d68ca1e.avi"},{"id":97370928,"identity":"6e36235c-b4c4-4460-bf0d-b5acc6c75398","added_by":"auto","created_at":"2025-12-03 16:28:09","extension":"avi","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":7332084,"visible":true,"origin":"","legend":"","description":"","filename":"VideoS3Isradipine.avi","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/3867e39429cd504b64a68129.avi"},{"id":97343164,"identity":"ea3ccf7b-e34d-4110-9e0d-e9ed733fba0e","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":111139,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024052411h53m36sucp4gel1Chemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/1e83298ad18639f02f54fde8.jpg"},{"id":97371088,"identity":"c2ba5b01-86f5-4327-a3c6-448a70203a05","added_by":"auto","created_at":"2025-12-03 16:28:24","extension":"jpg","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":76514,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024052513h03m19sgel1actinChemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/d1da39813cdf000d26a82814.jpg"},{"id":97343154,"identity":"8246d419-9a69-49cb-a97e-c8c05e359e2f","added_by":"auto","created_at":"2025-12-03 11:36:43","extension":"jpg","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":82382,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024082111h26m20smcuChemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/53b2a2ec08f24486b4e28544.jpg"},{"id":97370947,"identity":"af3e10bf-6297-4cbb-8d63-bebc724b6fcf","added_by":"auto","created_at":"2025-12-03 16:28:11","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":265380,"visible":true,"origin":"","legend":"","description":"","filename":"Zhanglab2024082210h48m10sactinChemiluminescence.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8177400/v1/82e20db0628f1a1855b825ea.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Human LRRK2-R1441G Mutation Drives Age-Dependent Oxidative Stress and Mitochondrial Dysfunction in Dopaminergic Neurons","fulltext":[{"header":"Background","content":"\u003cp\u003eParkinson\u0026rsquo;s disease (PD) is a progressive neurodegenerative disorder characterized by the selective loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNc) and the accumulation of α-synuclein pathology [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. While both genetic and environmental factors contribute to PD, aging remains the greatest risk factor [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, the mechanisms by which age-related cellular dysfunctions drive PD pathogenesis remain poorly understood. Among the most implicated factors, mitochondrial dysfunction and oxidative stress have emerged as critical contributors to dopaminergic neurodegeneration.\u003c/p\u003e\u003cp\u003eMutations in leucine-rich repeat kinase 2 (LRRK2) are the most common genetic cause of both familial and sporadic PD [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Among these, the R1441G mutation disrupts the GTPase function of LRRK2, leading to aberrant kinase activity and pathological consequences, including abnormal mitochondrial function, oxidative stress, and calcium dysregulation [\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Although mitochondrial dysfunction has been implicated in PD, whether and how the LRRK2-R1441G mutation directly contributes to mitochondrial abnormalities, oxidative stress, and neurodegeneration in an age-dependent manner remains unresolved.\u003c/p\u003e\u003cp\u003eMitochondria are essential for ATP production, calcium buffering, and reactive oxygen species (ROS) regulation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In DA neurons, which exhibit high metabolic demands due to autonomous pacemaking activity, mitochondrial health is particularly critical. Dysfunctional mitochondria lead to energy deficits, excessive ROS production, and oxidative damage, all of which are known contributors to neuronal vulnerability in PD [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Notably, mitochondrial oxidative stress can be exacerbated by dysregulated calcium homeostasis, as excessive cytosolic and mitochondrial calcium levels further impair mitochondrial respiration and trigger cell death pathways.\u003c/p\u003e\u003cp\u003eHere, we investigate the role of mitochondrial dysfunction and oxidative stress in LRRK2-R1441G-associated PD using a BAC transgenic mouse model that overexpresses human LRRK2-R1441G. This model exhibits progressive motor, neurochemical, and pathological deficits, closely mirroring human PD [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. By crossing these mice with TH-mito-roGFP reporters and applying two-photon ratiometric imaging, we uncovered age-dependent mitochondrial impairment marked by early oxidative stress in striatal DA terminals and calcium overload driven by increased MCU expression. These deficits were mitigated by L-type calcium channel blockade, implicating calcium dysregulation as a driver of oxidative stress. Furthermore, we observed impaired mitochondrial membrane potential (MMP) flickering and reduced UCP4/UCP5 expression, exacerbating ROS accumulation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] was significantly impaired in hR1441G DA neurons. Spatial transcriptomics of the substantia nigra further confirmed the upregulation of redox stress pathways in LRRK2-R1441G DA neurons. Taking together, our study provides the first direct mechanistic link between hLRRK2-R1441G, mitochondrial oxidative stress, and calcium dysregulation in PD, highlighting UCPs, MCU, and L-type calcium channels as potential therapeutic targets in PD.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eAnimals\u003c/h2\u003e\u003cp\u003eBAC LRRK2(hR1441G) transgenic mice (Stock #009604, The Jackson Laboratory) were obtained from Dr. Chenjian Li\u0026rsquo;s laboratory at Weill Medical College of Cornell University and maintained on a Taconic FVB/N genetic background. Transgenic mice expressing a roGFP construct under the tyrosine hydroxylase (TH) promoter, with a mitochondria-targeting matrix sequence, were acquired from Dr. James Surmeier\u0026rsquo;s laboratory at Northwestern University. These mice were backcrossed onto the FVB/N background for eight generations before being crossed with hLRRK2-R1441G mice, generating GFP-expressing hR1441G and non-transgenic (nTg) lines. All mice were maintained on an FVB/N background (Taconic).\u003c/p\u003e\u003cp\u003eThe animals were housed in a temperature- and humidity-controlled environment with a 12-hour light/dark cycle and provided ad libitum access to food and water in a specific pathogen-free facility. All experimental procedures involving animals were conducted in accordance with the National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committees (IACUC) of Thomas Jefferson University and The University of Georgia.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eEthics declaration\u003c/h3\u003e\n\u003cp\u003e All animal experiments were conducted in accordance with the National Institutes of Health guidelines. Experimental procedures were approved by the Institutional Animal Care and Use Committees (IACUC) of Thomas Jefferson University (Protocol \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:01452\\)\u003c/span\u003e\u003c/span\u003e) and the University of Georgia (Protocol \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\#\\:\\text{A}2023\\:05-031-\\text{Y}1-\\text{A}1\\)\u003c/span\u003e\u003c/span\u003e). All efforts were made to minimize animal suffering and to reduce the number of animals used.\u003c/p\u003e\u003cp\u003eFor most of the experiments, mice were coded so investigators were blinded to genotype.\u003c/p\u003e\n\u003ch3\u003eBrain Slice Preparation\u003c/h3\u003e\n\u003cp\u003eMice were anesthetized using a ketamine/xylazine mixture, followed by transcardial perfusion with ice-cold, oxygenated cutting solution containing (in mM): 125 NaCl, 2.5 KCl, 26 NaHCO3, 3.7 MgSO4, 0.3 KH2PO4, and 10 glucose (pH 7.4). Following perfusion, the mice were decapitated, and the brains were immediately removed and sectioned in ice-cold, oxygenated cutting solution using a vibratome (VT1000S, Leica Microsystems, Germany). Brain slices, 250 \u0026micro;m in thickness, were recovered at 34\u0026deg;C in oxygenated artificial cerebrospinal fluid (aCSF; in mM: 125 NaCl, 2.5 KCl, 26 NaHCO3, 2.4 CaCl2, 1.3 MgSO4, 0.3 KH2PO4, 10 glucose, 2 HEPES, pH 7.4) for 30 minutes and then maintained at room temperature.\u003c/p\u003e\u003cp\u003eFor oxygen consumption rate (OCR) measurements, 160 \u0026micro;m-thick slices of the striatum were prepared and transferred to respiration buffer composed of preoxygenated aCSF supplemented with 25 mM glucose, 2 mM L-glutamine, and 4 mg/mL bovine serum albumin (BSA), freshly added before use (pH 7.4, 37\u0026deg;C). Tissue punches were immediately taken from the slices for subsequent respiration studies.\u003c/p\u003e\n\u003ch3\u003eTH-Immunogold Labeling and Electron Microscopy\u003c/h3\u003e\n\u003cp\u003eLRRK2 WT and BAC-RG mice were perfused transcardially with 3.75% acrolein and 2% paraformaldehyde in 0.1 M sodium phosphate buffer (PB, pH 7.4). Brains were removed and post-fixed for 30 min in 2% paraformaldehyde before being transferred to PB. Brains were coded so investigators were blinded to genotype. Brains were sectioned into 50 \u0026micro;m slices in PB using a vibratome. Sections were then treated with 1% sodium borohydride in PB for 30 minutes to reduce free aldehydes, followed by extensive rinsing in PB. The tissue was subsequently transferred to 0.01 M tris-buffered saline (TBS), pH 7.6. Some sections were further processed by transferring them to a cryoprotectant solution and frozen for future use, while the remaining sections were immediately processed for immunogold-silver labeling of tyrosine hydroxylase (TH).\u003c/p\u003e\u003cp\u003eBlocking solution was prepared in TBS containing 3% goat serum, 1% bovine serum albumin (BSA), and 0.04% Triton X-100, and applied to the tissue for 30 minutes to enhance antibody penetration. The primary antibody, mouse anti-TH (Chemicon), was diluted 1:5000 in the blocking solution and incubated with the tissue overnight at room temperature. After incubation, sections were washed in TBS, followed by 0.01 M phosphate-buffered saline (PBS), pH 7.4. They were then incubated for 30 minutes in a washing buffer consisting of PBS, 0.8% BSA, 0.1% fish gelatin, and 3% goat serum.\u003c/p\u003e\u003cp\u003eNext, sections were transferred to a solution containing 0.8 nm gold-conjugated anti-mouse secondary antibody, diluted 1:50 in the washing buffer, and incubated overnight at room temperature. The following day, the sections were rinsed thoroughly in washing buffer, followed by PBS, and incubated for 10 minutes in 2.5% glutaraldehyde in PBS to stabilize the gold particles. After rinsing in PBS, sections were treated with the proprietary Enhancement Conditioning Solution (ECS; Aurion/Electron Microscopy Sciences). The sections were then incubated in Aurion R-Gent SE-EM kit reagents at room temperature for an empirically determined time of approximately 90\u0026ndash;120 minutes. After further rinsing in ECS, the sections were transferred to PB.\u003c/p\u003e\u003cp\u003eFor electron microscopic visualization, immunogold-silver labeled tissue was subjected to osmication, dehydration, and plastic embedding. Sections were incubated in 2% osmium tetroxide in PB for 30 minutes, followed by rinsing in PB. The tissue was then sequentially dehydrated in 30%, 50%, 70%, and 95% ethanol solutions, and subsequently exposed twice to 100% ethanol for 10 minutes each, followed by two 10-minute exposures to propylene oxide. The sections were incubated overnight in a 1:1 mixture of epoxy resin (Epon; EMBed-812, Electron Microscopy Sciences) and propylene oxide before being transferred to pure Epon for 2 hours. The sections were embedded in Epon between sheets of commercial plastic and polymerized under heavy lead weights at 62\u0026deg;C for 72 hours.\u003c/p\u003e\u003cp\u003eThe embedded tissue sections containing the dorsal striatum were mounted on plastic blocks, and excess tissue was trimmed, leaving a trapezoidal region within the dorsolateral striatum. This region of interest was then sectioned into ultrathin (50\u0026ndash;60 nm) slices using an ultramicrotome and collected onto copper-400 mesh grids. The ultrathin sections were counterstained with uranyl acetate and lead citrate.\u003c/p\u003e\u003cp\u003eUltrathin tissue sections were examined using a Morgagni FEI transmission electron microscope at 36,000X magnification. Sampling of TH-immunolabeled profiles was done near the interface between tissue and epoxy resin, where maximal antibody penetration occurred. To decrease the collection of false positive results, TH-labeled axons were defined as profiles containing a minimum of three gold-silver particles, with many axons exhibiting considerably more than three particles.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMeasurement of Real-Time Oxygen Consumption Rate (OCR\u003c/b\u003e)\u003c/p\u003e\u003cp\u003eReal-time oxygen consumption rate (OCR) in acute brain slices was measured using a Seahorse XF24 analyzer (Seahorse Bioscience) with minor modifications to the manufacturer\u0026rsquo;s protocol. To optimize conditions for OCR measurement, various combinations of slice thickness (150 \u0026micro;m or 200 \u0026micro;m) and punch size (1.0 mm, 1.5 mm, and 2.0 mm) were tested. Brain slices were secured to the center of the mesh in an islet capture plate as described previously [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The microplate was then incubated at 37\u0026deg;C for 1 hour to equilibrate temperature and pH.\u003c/p\u003e\u003cp\u003eDrugs and inhibitors were diluted in prewarmed (37\u0026deg;C) respiration buffer to stock concentrations (10\u0026times;, 11\u0026times;, 12\u0026times;, and 13\u0026times; the working concentrations for ports A, B, C, and D, respectively) and preloaded into the reagent ports of a sensor cartridge. The sensor cartridge had been hydrated overnight in Seahorse calibration solution at 37\u0026deg;C without CO\u003csub\u003e2\u003c/sub\u003e. Each injection had a volume of 75 \u0026micro;L. Following a 30-minute calibration and equilibration period, OCR was measured in each well of the plate using a program consisting of 3-minute mixing, 3-minute waiting, and 2-minute measurement cycles. Baseline OCR was determined with four measurements, followed by sequential injections of port A (10 mM pyruvate, 3 X measurements), port B (20 mM oligomycin, 8 X measurements), port C (10 mM or other concentrations of FCCP, 5X measurements), and port D (20 mM antimycin A, 6 X measurements). The parameters for load, measure, and calibration distance of probe head were set to 27,800. Reagents used in Seahorse experiments included bovine serum albumin (BSA) (A6003), glucose (G8270), sodium pyruvate (P2256), L-glutamine (C3126), oligomycin from streptomyces diastatochromogenes (O4876), carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) (C2920), antimycin A from streptomyces sp. (A8674), which were purchased from Sigma Aldrich (St. Louis, MO) and rotenone (3616, Tocris). In addition, stainless steel biopsy punches were purchased from Miltex (York, PA); and XF24 Islet Flux-Paks from Seahorse Bioscience (Billerica, MA). Details of key resources and reagents are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eKey Source and reagent\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent or Resource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIdentifier\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTetramethylrhodamine methyl ester (TMRM)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInvitrogen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #T668\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDithiothreitol (DTT)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #D0632\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAldrithiol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #143049\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenipin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #G4796\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIsradipine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTocris\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #2004\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eN-(2-mercaptopropionyl)-glycine (MPG)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #M6635\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBovine serum albumin (BSA)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #A6003\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSodium pyruvate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #P2256\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eL-glutamine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #C3126\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOligomycin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #O4876\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCarbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #C2920\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntimycin A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #A8674\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRotenone\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTocris\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #3616\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eSource\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eXF24 Islet capture microplate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAgilent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #101122-100\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eXF24 Islet capture FluxPaks\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAgilent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCat #101174\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eTMRM Dye Labeling\u003c/h3\u003e\n\u003cp\u003eTetramethylrhodamine methyl ester (TMRM; Invitrogen) was used to monitor mitochondrial membrane potential. A 10 mM TMRM stock solution prepared in DMSO was diluted in oxygenated artificial cerebrospinal fluid (aCSF) to a final working concentration of 4 \u0026micro;M. Brain slices were incubated in the oxygenated TMRM-containing aCSF at 37\u0026deg;C for 30 minutes to allow for dye equilibration and accumulation within the mitochondrial matrix. Following incubation, the slices were transferred to oxygenated TMRM-free aCSF and washed for 30 minutes to remove excess dye.\u003c/p\u003e\u003cp\u003eTo assess the sensitivity of roGFP protein to oxidative stress, brain slices expressing roGFP were sequentially perfused with aCSF containing the reductant dithiothreitol (DTT, 2 mM, Sigma) for 45 minutes, followed by the oxidant aldrithiol (Ald, 100 \u0026micro;M, Sigma) for an additional 45 minutes. To investigate the effects of uncoupling proteins (UCPs), L-type calcium channel blockers, and antioxidants on mitochondrial membrane potential (MMP) \u003cem\u003eex vivo\u003c/em\u003e, brain slices were incubated in oxygenated aCSF containing genipin (Sigma), isradipine (Tocris-Cookson, 10 \u0026micro;M), or N-(2-mercaptopropionyl)-glycine (MPG, 10 \u0026micro;M, Sigma) for 30 minutes, respectively. To examine whether L-type calcium channel inhibition reduce or diminish calcium-dependent mitochondrial oxidant stress in the animal, we administered intraperitoneally isradipine (3 mg/kg body weight) daily for 7\u0026ndash;10 days. Details of key resources and reagents are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eReal-Time PCR\u003c/h2\u003e\u003cp\u003eFollowing the protocol described by Guzman et al., total RNA from the substantia nigra (SN) region was extracted for quantification of uncoupling protein (UCP) mRNA levels. (Primer sequence are provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Ventral midbrain regions, encompassing the SNc and VTA, were micro-dissected from 10-month-old LRRK2 wild-type (WT) and BAC-R1441G mice. Total RNA was extracted using TRIzol reagent (Invitrogen), and cDNA synthesis was performed via reverse transcription (Quanta Biosciences) using oligo-(dT)15 primers.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eqPCR primer\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSense/anti-sense\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emUCP4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTAAAGCTGTGGCAAGGAG\u003c/p\u003e\u003cp\u003eCAATGACCGATTTCCAGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emUCP5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGCTGCAATCGTTGTGGGAGT\u003c/p\u003e\u003cp\u003eGCCAAACCACAGGTGAAACTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emUCP2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTAAAGGTCCGCTTCCAGGCTCA\u003c/p\u003e\u003cp\u003eACGGGCAACATTGGGAGAAGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emActin-\u0026szlig;\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATTGCTGACAGGATGCAGAAGG\u003c/p\u003e\u003cp\u003eTGCTGGAAGGTGGACAGTGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eQuantitative PCR (qPCR) was carried out to analyze cDNA from each sample, employing SYBR Green as the fluorescent dye and sense/antisense primers synthesized by Integrated DNA Technologies. The qPCR cycling parameters included an initial denaturation step at 95\u0026deg;C for 3 minutes, followed by 40 cycles of 15 seconds at 94\u0026deg;C, 1 minute at 60\u0026deg;C, and 30 seconds at 72\u0026deg;C. SYBR Green fluorescence was measured after each cycle.\u003c/p\u003e\u003cp\u003eRelative mRNA expression levels were calculated using the comparative CT (ΔΔCT) method. Gene-specific mRNA expression was normalized to β-actin levels to obtain Δ\u003cem\u003eC\u003c/em\u003e\u003csub\u003eT\u003c/sub\u003e values (Δ\u003cem\u003eC\u003c/em\u003e\u003csub\u003eT\u003c/sub\u003e = \u003cem\u003eC\u003c/em\u003e\u003csub\u003eT\u003c/sub\u003e(UCP4/5)\u0026thinsp;\u0026minus;\u0026thinsp;\u003cem\u003eC\u003c/em\u003e\u003csub\u003eT\u003c/sub\u003e(\u0026szlig;-actin)). Paired Δ\u003cem\u003eC\u003c/em\u003e\u003csub\u003eT\u003c/sub\u003es for WT and BAC-R1441G groups and the mRNA abundance were calculated from the Eq.\u0026nbsp;2 \u003csup\u003e\u0026minus;∆∆ CT\u003c/sup\u003e. All samples were analyzed in triplicate to ensure accuracy.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eWestern Blot\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern Blot\u003c/div\u003e\u003cp\u003eMouse SN slices were homogenized in RIPA lysis buffer containing 1X protease inhibitor cocktail and centrifuged at 21,000g for 30 minutes at 4\u0026deg;C. Protein concentration was determined using the BCA protein assay kit. A total of 200 \u0026micro;g of protein was mixed with 4X Laemmli buffer and β-mercaptoethanol to achieve a final concentration of 1 \u0026micro;g/\u0026micro;l in 1X Laemmli buffer and 10% β-mercaptoethanol, then boiled for 5 minutes at 95\u0026deg;C. A total of 10\u0026ndash;20 \u0026micro;g of protein per lane was loaded onto 10% polyacrylamide gels and electrophoresis in Tris/glycine buffer, followed by transfer to 0.2 \u0026micro;m PVDF membranes. The PVDFs were blocked with 5% non-fat dry milk in TBS containing 0.05% Tween-20 (TBST) for 1\u0026ndash;2 hours at room temperature with gentle shaking at 20 rpm, and then incubated with primary antibodies overnight at 4\u0026deg;C. After washing TBST three times, the PVDFs were incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody for 1 hour at room temperature with gentle shaking at 20 rpm. The PVDFs were then washed three times with TBST, developed using Femto Sensitivity Substrate, and imaged using a ChemiDoc MP Imager (Bio-Rad). Antibodies, protein assay kits, and buffer solutions are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntibody List\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCompany\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCatLog\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eDilution\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eUCP4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSanta Cruz\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003esc-365295\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMCU\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e14997S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMICU1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003esigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003erabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHPA037480\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMICU2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eabcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003erabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eab101465\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMICU3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003esigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003erabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHPA024771\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHRP Goat Anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eJACKSON IMMUNO RESEARCH LABORATORIES INC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e115-035-166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:10000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHRP Goat Anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eJACKSON IMMUNO RESEARCH LABORATORIES INC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e111-035-144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:10000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGoat anti-Mouse IgG, IgM (H\u0026thinsp;+\u0026thinsp;L) Cross-Adsorbed Secondary Antibody, HRP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInvitrogen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e31446\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:10000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSuperSignal\u0026trade; West Femto Maximum Sensitivity Substrate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eThermo Scientific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e34096\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePierce\u0026trade; BCA Protein Assay Kits\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eThermo Scientific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e23227\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eImmun-Blot PVDF Membrane, Roll, 26 cm x 3.3 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBio-rad\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1620177\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRIPA Lysis and Extraction Buffer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eThermo Scientific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e89900\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePierce Protease and Phosphatase Inhibitor Mini Tablets, EDTA-free\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eThermo Scientific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eA32961\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eStereotaxic Injection of AAV\u003c/h3\u003e\n\u003cp\u003eMice were anesthetized with isoflurane (1\u0026ndash;2%) or ketamine/xylazine (100 mg/10 mg/kg). A small craniotomy, approximately 0.8 mm in diameter, was made over the right midbrain (\u0026minus;\u0026thinsp;3.4 mm caudal, +\u0026thinsp;1.0 mm lateral). To achieve expression of cyto-GCaMP6 or mito-GCaMP6 in dopaminergic neurons, 0.1\u0026ndash;0.2 \u0026micro;l of AAV-GCaMP6-mito virus (10^13 vg/ml, a gift from Dr. James Surmeier\u0026rsquo;s lab at Northwestern University) was pressure-injected through a syringe into the midbrain at a depth of -4.2 mm ventral from the dura surface. Following the injections, the incisional wound on the skull was sealed with tissue adhesive (3M Vetbond). The mice were placed on a heating pad until fully recovered and returned to the isolation room. Carprofen (5 mg/kg, Sigma Aldrich) was administered intraperitoneally once per day for at least 3 days to reduce pain.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eTwo-photon Laser Scanning Microscopy (2PLSM) Imaging of Mitochondrial Functions in Brain Slices\u003c/h2\u003e\u003cp\u003eThe brain slices were positioned within a recording chamber and superfused with oxygenated aCSF at a flow rate of 1.0 mL/min. Optical imaging of florescent signals were acquired using an Ultima multiphoton laser scanner (Bruker) for BX51/61WI, Olympus microscope with a Titanium-sapphire laser (Chameleon-Ultra2, Coherent Laser Group), equipped with a 20 \u0026times; 1.0 NA water immersion objective (XLUMPLFL20XW, Olympus). The average laser power for imaging was less than 50 mW. Images were captured in 8-bit resolution and 4 \u0026micro;s dwell time, with regions of interest set at 512 \u0026times; 512 pixels. All experiments were conducted at 34\u0026ndash;35\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eMitochondrial roGFP Imaging\u003c/h2\u003e\u003cp\u003eAcute brain slices with roGFP expressed in mitochondria were put and anchored under the microscope with the oxygenated aCSF perfusion at physiological temperatures (34\u0026ndash;35\u0026deg;C). The optimal excitation wavelength of roGFP signals were measured at different conditions: physiological, fully reduced and fully oxidized. And the excitation wavelength (900 nm and 800 nm) was chosen to excite roGFP protein with a pixel size between 0.16 and 0.23 \u0026micro;m and a 4 \u0026micro;s pixel dwell time. roGFP fluorescence (490\u0026ndash;560 nm) was differentiated and collected by PMT detector. Laser intensity and PMT gain were kept consistent or adjusted in proportion. Records with a drifting baseline were excluded for data analysis.\u003c/p\u003e\u003cp\u003e\u003cb\u003e2PLSM cyto-GCaMP6 and mito-GCaMP6 Imaging\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e levels were measured with the mitochondrially targeted Ca\u003csup\u003e2+\u003c/sup\u003e-sensitive probe mito-GCaMP6. Two-three weeks after AAV virus injection, mice were prepared for coronal brain slice sectioning following transcardiac perfusion with ice-cold, oxygenated cutting solution. After a recovery period of 30\u0026ndash;45 minutes, the coronal brain slices were placed in a chamber perfused with oxygenated aCSF. To measure free Ca\u003csup\u003e2+\u003c/sup\u003e levels in mitochondria, the slices were sequentially treated with the following solutions: (1) regular aCSF, (2) 500 \u0026micro;M EGTA\u0026thinsp;+\u0026thinsp;aCSF without Ca\u003csup\u003e2+\u003c/sup\u003e for 30\u0026ndash;40 minutes, (3) 500 \u0026micro;M EGTA\u0026thinsp;+\u0026thinsp;1 \u0026micro;M ionomycin\u0026thinsp;+\u0026thinsp;aCSF without Ca\u003csup\u003e2+\u003c/sup\u003e for 30 minutes, and (4) 1 \u0026micro;M ionomycin\u0026thinsp;+\u0026thinsp;aCSF with high Ca\u003csup\u003e2+ (\u003c/sup\u003e3 mM) for 20 minutes. Time series images were acquired every 5 minutes to determine the minimal and maximal fluorescence intensity. The fluorescence intensity at the end of treatment (2) was defined as the minimum fluorescence (F\u003csub\u003emin\u003c/sub\u003e), and the fluorescence intensity at the end of treatment (4) was defined as the maximum fluorescence (F\u003csub\u003emax\u003c/sub\u003e). The relative free calcium level was calculated using the equation: (F - F\u003csub\u003emin\u003c/sub\u003e) / (F\u003csub\u003emax\u003c/sub\u003e - F\u003csub\u003emin\u003c/sub\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eMitochondrial TMRM imaging\u003c/h2\u003e\u003cp\u003eBrain slices from LRRK2 BAC-hR1441G with TH-GFP expression were incubated in 4 \u0026micro;M TMRM for 30 min at 34\u0026ndash;35\u0026deg;C; excess dye was washed out with a TMRM-free ACSF solution. Brain slices were put in the chamber under the microscope for imaging following aCSF solution perfusion at physiological temperatures (34\u0026ndash;35\u0026deg;C). Fluorescence (550\u0026ndash;640 nm) was collected using an 830-nm excitation beam. Time-series scanning (300 frames) was performed with a 4-\u0026micro;s dwell time per pixel and 2\u0026ndash;3 frames per second scanning rate. The duration of drug applications, including MPG, genipin and isradipine, was controlled at 30 mins.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eImage Data Analysis\u003c/h2\u003e\u003cp\u003eImages were processed using open-source software Fiji (NIH) and commercial software Matlab (Version 8.5.0 R2015a, Mathworks). Registration had been taken to perform the intensity-based alignment of images at the different time point. DA terminals in the striatum and DA soma in SNc area were segmented and regarded as the regions of interest (ROIs), the ratio of fluorescence intensity in these ROIs excited by 800nm beam divided by corresponding ROIs excited by 900nm beam was used to measure the level of oxidation stress. Flickering area of TMRM labeling were selected as ROIs and the flickering frequency in the ROIs was determined by counting the number of transitions in 100-s epochs. The change in mitochondrial membrane potential during flickering was estimated from fluorescence in ROIs.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eDigital Spatial Profiling and scRNA Sequencing\u003c/h2\u003e\u003cp\u003eFormalin-fixed paraffin-embedded (FFPE) sections were processed and subjected to GeoMx RNA profiling (Nanostring Technologies, Seattle, WA, USA). ROIs/AOIs were defined using TH and IBA1 markers, and gene set enrichment analysis (GSEA) was performed to identify enriched pathways in LRRK2 mutant microglia. Further methodological details are detailed below.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFFPE Tissue Preparation\u003c/b\u003e: Formalin-fixed paraffin-embedded (FFPE) tissues were prepared as follows: mice were anesthetized, and brains were fixed via transcardial perfusion with 10% neutral buffered formalin (Sigma-Aldrich). Brains were subsequently removed, post-fixed in the same formalin solution for 24 hours at 4\u0026deg;C and immersed in 70% ethanol for at least 1 hour. Tissues were processed and embedded in paraffin using an automated tissue processor (Tissue-Tek VIP, Sakura Finetek USA Inc.) following the programmed protocol: 95% ethanol for 1h15m, 100% ethanol for 1h15m, 100% ethanol for 1h30m, 100% xylene for 1h, 100% xylene for 1h30m, 100% xylene for 1h30m, paraffin for 1h30m at 58\u0026deg;C, and paraffin for 2h at 58\u0026deg;C. FFPE tissues were then immersed in molten paraffin at 60\u0026deg;C in a metal mold to form FFPE blocks. These blocks were cooled at 4\u0026deg;C and stored at the same temperature until further use.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eTissue Sectioning and Slide Preparation\u003c/strong\u003e\u003cp\u003eThe midbrains of FFPE mouse brains were coronally sectioned at 5 \u0026micro;m using a rotary microtome. Sections containing the substantia nigra (SN) and ventral tegmental area (VTA) were mounted on Leica BOND Plus microscope slides, with each slide holding 6 sections\u0026mdash;3 from wild-type mice and 3 from transgenic mice. The slides were submitted to the Flow Cytometry and Human Immune Monitoring Core at Thomas Jefferson University for RNA profiling via the GeoMx RNA assay (Nanostring).\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eROI and AOI Selection\u003c/strong\u003e\u003cp\u003eTissue sections were stained with fluorescent morphology markers and nuclear counterstain for the identification of regions of interest (ROIs) and areas of interest (AOIs). The morphology markers included an anti-tyrosine hydroxylase (TH) antibody conjugated with Alexa 488 (dopaminergic neuron marker, Sigma #MAB5280X), an anti-GFAP antibody conjugated with Alexa 594 (astrocyte marker), and an anti-Iba1 antibody conjugated with Alexa 647 (microglia marker, Millipore #MABN92-AF647). The nucleus marker was Syto-13. For each tissue section, 2\u0026ndash;3 ROIs were selected within the SN or VTA, and each ROI was subdivided into 1\u0026ndash;3 AOIs representing TH+, GFAP+, or Iba1\u0026thinsp;+\u0026thinsp;cell populations. Each AOI contained a minimum of 20 cells.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eQuality Control\u003c/strong\u003e\u003cp\u003eRaw counts from GeoMxTM Digital Spatial Profiling (DSP) were processed using GeoMxTM Software. Out of 95 segments collected from 6 mice (3 harboring hLRRK2 R1441G mutations and 3 wild-type), 11 segments were excluded due to failure in quality control (QC) analysis. Following QC, 8021 out of 20175 gene targets in the GeoMx Mouse Whole Transcriptome Atlas passed QC and were retained for downstream analyses.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eData Normalization and Analysis\u003c/strong\u003e\u003cp\u003eTo address systematic variability between AOIs, GeoMxTM DSP raw counts were normalized to the 75th percentile of expression for each AOI, as described in the NanoString GeoMxTM Data Analysis User Manual. Differential expression analysis was performed using a negative binomial model, implemented in the DESeq2 package in R.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eGene Set Enrichment Analysis (GSEA)\u003c/strong\u003e\u003cp\u003eGene Set Enrichment Analysis (GSEA) was carried out to identify dysregulated pathways in dopaminergic neurons between mice carrying hLRRK2 R1441G mutations and wild-type controls. GSEA was conducted using the ClusterProfiler package (version 4.12) in R, with gene sets ranging in size from 10 to 500 genes. Enrichment terms with p-values below 0.05 were considered significantly enriched. Additionally, GSEA was extended using gene set signatures from the Reactome pathway database and the KEGG dataset respectively, with normalized enrichment scores (NES) calculated to identify biological pathways linked to hLRRK2 R1441G mutations in dopaminergic neurons.\u003c/p\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) where applicable. Statistical analysis was performed with GraphPad Prism 8 (GraphPad software Inc.). Unpaired Mann-Whitney test, one-way ANOV, and two-way ANOVA, were applied, with a P-value of \u0026lt;\u0026thinsp;0.05, considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eLRRK2-hR1441G mutation disrupts mitochondrial morphology and impairs respiratory function in dopaminergic terminals within the striatum\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eMutations in \u003cem\u003eLRRK2\u003c/em\u003e represent the most common genetic cause of both familial and sporadic Parkinson\u0026rsquo;s disease (PD). Li et al. (2009) reported age-dependent motor deficits in LRRK2 BAC-hR1441G mice, implicating this mutation in PD pathogenesis. Mitochondrial dysfunction is a key driver of dopaminergic neuron degeneration in the substantia nigra pars compacta (SNc), with striatal terminal loss preceding neuronal loss in the SNc. To determine whether mitochondrial dysfunction occurs specifically at dopaminergic terminals, we employed tyrosine hydroxylase (TH) immunostaining combined with electron microscopy (EM) to assess mitochondrial morphology. In 10-month-old BAC-hR1441G mice, mitochondria in TH-positive regions exhibited abnormal structural features, including cristae loss and irregular oval-shaped morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). In contrast, wild-type (WT) mice displayed predominantly healthy mitochondria with regular tubular morphology in TH-positive terminals (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Quantitative analysis of mitochondrial aspect ratio (i.e., major axis length divided by minor axis length) further revealed that mitochondria in BAC-hR1441G mice were closer to unity, suggesting increased mitochondrial fission (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Despite these qualitative changes, the overall striatal distribution of healthy mitochondria did not differ significantly between BAC-hR1441G and WT mice. These findings indicate that the hR1441G mutation leads to abnormal mitochondrial morphology only in dopaminergic terminals, which may contribute to early synaptic dysfunction in PD.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTo assess whether the LRRK2-hR1441G mutation impairs mitochondrial respiration, we performed Seahorse respirometry on acutely prepared striatal slices sequentially treated with 10 mM pyruvate, 10 \u0026micro;M oligomycin, 10 \u0026micro;M FCCP, and 20 \u0026micro;M antimycin [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In 10-month-old BAC-hR1441G transgenic mice, we observed a significant reduction in basal oxygen consumption rate (OCR), ATP production, and maximal respiratory capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee, f; Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, no significant differences in mitochondrial respiration were detected in younger (3- and 6-month-old) animals, suggesting a progressive decline in mitochondrial function with aging.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003ehR1441G mutation induces age-Dependent mitochondrial oxidative stress in SNc dopaminergic neurons and striatal terminals\u003c/h2\u003e\u003cp\u003eThe autonomous pace-making activity of substantia nigra pars compacta (SNc) dopaminergic neurons regulate dopamine release, which is essential for striatal function. This process depends on ATP production via mitochondrial oxidative phosphorylation, which concurrently generates superoxide and reactive oxygen species (ROS), leading to mitochondrial oxidative stress.\u003c/p\u003e\u003cp\u003eTo assess basal oxidative stress levels in the SNc and striatum of an LRRK2 BAC-hR1441G PD model, we crossed these mice with TH-mito-roGFP reporter mice, which express a mitochondria-targeted, redox-sensitive green fluorescent protein under the control of the TH promoter, generating LRRK2 BAC-hR1441G/TH-mito-roGFP mice. Using two-photon laser scanning microscopy (2PLSM) combined with a ratiometric imaging approach (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c; Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; details in Supplementary Materials), we assessed mitochondrial redox states in dopaminergic neurons in acute brain slices. BAC-hR1441G mice exhibited significantly increased mitochondrial oxidation levels in the SNc and dorsal striatum, particularly at 6 and 12 months of age (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed\u0026ndash;f; Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Notably, in 3-month-old BAC-hR1441G mice, oxidative stress was already elevated in striatal terminals, suggesting early mitochondrial dysfunction at presynaptic sites. This oxidative stress increase followed an age-dependent pattern. In SNc dopaminergic neurons, oxidation levels progressively increased from 3 to 6 months and further at 12 months. In contrast, in striatal terminals, oxidative stress rose significantly between 3 and 6 months but plateaued thereafter, with no further increase between 6 and 12 months in BAC-hR1441G mice. No significant differences in mitochondrial redox states were detected in the ventral tegmental area (VTA) between 6-month-old WT and BAC-hR1441G mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg; Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) (Mann-Whitney test, P\u0026thinsp;=\u0026thinsp;0.8981).\u003c/p\u003e\u003cp\u003eThese findings demonstrate that the LRRK2-hR1441G mutation induces region-specific and age-dependent increases in mitochondrial oxidative stress, particularly in the SNc and dorsal striatum, but not in the VTA. This suggests that SNc DA neurons and their striatal projections are more vulnerable to oxidative stress, which may contribute to their selective degeneration in PD.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e\u003cb\u003eCytosolic and mitochondrial Ca\u003c/b\u003e\u003csup\u003e\u003cb\u003e2+\u003c/b\u003e\u003c/sup\u003e \u003cb\u003eare overloaded in BAC-hR1441G mice\u003c/b\u003e\u003c/h2\u003e\u003cp\u003eTo investigate whether the elevated oxidative stress in BAC-hR1441G mice results from altered calcium homeostasis, we injected AAV-GCaMP6 under the control of the tyrosine hydroxylase (TH) promoter into the substantia nigra pars compacta (SNc) to selectively target dopaminergic neurons. Quantification of cytosolic calcium levels revealed a significant increase in BAC-hR1441G mice, with fluorescence intensity normalized to its maximum value rising from 19.71% in WT mice to 75.75% in BAC-RG mice, indicating a substantial elevation in cytosolic calcium induced by the LRRK2-hR1441G mutation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-b; Mann-Whitney test, P\u0026thinsp;=\u0026thinsp;0.0012; WT: N\u0026thinsp;=\u0026thinsp;3, n\u0026thinsp;=\u0026thinsp;7; BAC-RG: N\u0026thinsp;=\u0026thinsp;3, n\u0026thinsp;=\u0026thinsp;6).\u003c/p\u003e\u003cp\u003eTo determine whether ROS elevation was linked to L-type calcium channel activity, we administered isradipine, an L-type calcium channel inhibitor, to BAC-hR1441G mice. Redox level measurements in SNc dopaminergic neurons demonstrated that isradipine significantly reduced ROS levels, supporting a direct link between calcium dysregulation and oxidative stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec-d; two-way ANOVA; WT, P\u0026thinsp;=\u0026thinsp;0.0047; BAC-RG, P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e\u003cp\u003eTo further assess mitochondrial calcium levels, we injected AAV vectors expressing a mitochondria-targeted calcium indicator under the TH-mito-matrix promoter into the SNc of WT and BAC-RG mice. The hR1441G mutation significantly increased mitochondrial calcium concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee-f; Mann-Whitney test, P\u0026thinsp;=\u0026thinsp;0.0012; WT: N\u0026thinsp;=\u0026thinsp;3, n\u0026thinsp;=\u0026thinsp;6; BAC-RG: N\u0026thinsp;=\u0026thinsp;4, n\u0026thinsp;=\u0026thinsp;7). Western blot analysis further revealed upregulation of the mitochondrial calcium uniporter (MCU), a key regulator of calcium influx into the mitochondria, in BAC-RG mice, supporting a role for MCU-mediated calcium overload in mitochondrial dysfunction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg).\u003c/p\u003e\u003cp\u003eCollectively, these findings demonstrate that calcium overload, driven by increased mitochondrial calcium uptake and elevated MCU expression, contributes to excessive ROS production in LRRK2-hR1441G mutant dopaminergic neurons, establishing a mechanistic link between calcium dysregulation and oxidative stress in PD pathogenesis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eMitochondrial membrane potential flickering reflects oxidative stress and is attenuated in LRRK2 BAC-hR1441G dopaminergic neurons\u003c/h2\u003e\u003cp\u003eThe mitochondrial membrane potential (MMP) plays a critical role in regulating ATP production and reactive oxygen species (ROS) generation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. To investigate whether elevated oxidative stress in BAC-hR1441G mice is associated with alterations in MMP, we employed tetramethylrhodamine methyl ester (TMRM, 2\u0026ndash;4 \u0026micro;M), a dye that selectively accumulates within mitochondria to measure MMP. Since TMRM labeling is not cell-type specific, we crossed BAC-hR1441G mice with TH-GFP reporter mice to selectively identify dopaminergic neurons among TMRM-labeled populations (Extended Data Fig.\u0026nbsp;8). In both WT and BAC-hR1441G mice, DA neurons exhibited periodic oscillations in TMRM fluorescence, indicating transient depolarization and repolarization events of the MMP (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea; Extended Data Video 1). However, the frequency, amplitude, and overall occurrence of MMP transients were significantly reduced in SNc DA neurons from BAC-hR1441G mice compared to WT controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, c). Notably, MMP flickering events\u0026mdash;reflecting transient mitochondrial depolarizations\u0026mdash;were more prominent in WT DA neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). The frequency of MMP transients exhibited an age-dependent decline, decreasing progressively from 3 to 6 to 12 months in both genotypes. However, BAC-RG mice showed significantly reduced MMP transient frequencies at 6 and 12 months compared to WT mice, with no significant differences observed at 3 months (Extended Data Fig.\u0026nbsp;9).\u003c/p\u003e\u003cp\u003eTo determine whether oxidative stress contributes to MMP flickering, we treated brain slices with N-(2-mercaptopropionyl) glycine (MPG), a cell-permeable antioxidant. MPG treatment reduced MMP flickering and decreased MMP amplitudes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed-f; Extended Data Video 2).\u003c/p\u003e\u003cp\u003eCollectively, these findings suggest that MMP flickering is associated with oxidative stress and that the R1441G mutation impairs MMP homeostasis in an age- and oxidative stress-dependent manner.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eUncoupling protein is linked to mitochondrial flickering events\u003c/h2\u003e\u003cp\u003eCalcium overload has been shown to elevate oxidative levels. To determine whether calcium activity influences MMP dynamics, we applied isradipine, an L-type calcium channel antagonist, to assess the relationship between calcium influx and MMP flickering events in SNc dopaminergic neurons. Isradipine treatment significantly diminished MMP transients and reduced MMP amplitudes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-d; Extended Data Video 3), indicating that MMP flickering events are tightly associated with calcium influx.\u003c/p\u003e\u003cp\u003eUncoupling proteins (UCPs) are ion channels in the inner mitochondrial membrane that mitigate oxidative stress by dissipating the proton gradient across the membrane. In the brain, UCPs reduce superoxide production, serving as a negative-feedback mechanism to limit reactive oxygen species (ROS) generation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Elevated oxidative stress can increase UCP activation, thereby reducing the IMM potential. To investigate whether MMP flickering is influenced by UCP activity, we applied genipin, a UCP inhibitor, to brain slices containing SNc neurons exhibiting MMP flickering. Genipin significantly attenuated the frequency of MMP flickering events (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee-h;), suggesting that UCP activity directly contributes to MMP dynamics within the mitochondrial IMM.\u003c/p\u003e\u003cp\u003eTo examine whether the LRRK2 hR1441G mutation affects UCP expression, we isolated mRNA from mitochondria from SNc dopaminergic neurons using laser microdissection and quantified mRNA levels of UCP components. Compared to WT mice, BAC-hR1441G mice exhibited significantly reduced mRNA levels of UCP4 and UCP5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ei). This finding was further corroborated by western blot analysis, which revealed a decrease in UCP4 protein expression in BAC-hR1441G mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ej).\u003c/p\u003e\u003cp\u003eThese results suggest that the hR1441G mutation impairs UCP expression, contributing to altered mitochondrial membrane potential and oxidative stress.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDigital spatial profiling (DSP) reveals LRRK2 hR1441G mutation induced elevation of ROS in dopaminergic neuron in SNc.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo elucidate the molecular pathways disrupted by the \u003cem\u003eLRRK2\u003c/em\u003e hR1441G mutation, we performed GeoMx digital spatial profiler (DSP) analysis on dopaminergic neurons in the SNc, comparing gene expression profiles between BAC-hR1441G Tg and WT mice. Uniform Manifold Approximation and Projection (UMAP) analysis confirmed clear segregation of DA neurons from other types of cells: microglia and astrocytes in the SNc (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea-b). The analysis identified 19 significantly upregulated and 9 downregulated genes in mutant DA neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). Volcano plots further highlighted the differentially expressed genes (DEGs) in the transcriptional profiles caused by the LRRK2 hR1441G mutation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed).\u003c/p\u003e\u003cp\u003eFunctional enrichment analysis of DEGs revealed significant upregulation of pathways related to complex I biogenesis, mitochondrial calcium ion transport, respiratory electron transport, and heat production mediated by uncoupling proteins (UCPs) in LRRK2 hR1441G mutant DA neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee). Among the top 16 significantly enriched terms, the majority were associated with elevated redox activity, including \u0026ldquo;Complex I biogenesis,\u0026rdquo; \u0026ldquo;The citric acid (TCA) cycle and respiratory electron transport,\u0026rdquo; and \u0026ldquo;Oxidative phosphorylation \u0026ndash; Mus musculus (house mouse)\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef-g; Extended Data Fig.\u0026nbsp;10a-c). Gene association analyses further revealed that most DEGs contributing to elevated ROS generation were related to mitochondrial function in origin (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh; Extended Data Fig.\u0026nbsp;10d-e). These findings underscore that the LRRK2 hR1441G mutation profoundly disrupts mitochondrial function and exacerbates pathways linked to ROS production in SNc DA neurons.\u003c/p\u003e\u003cp\u003eOur findings provide the first direct evidence linking oxidative stress to the LRRK2 hR1441G mutation. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, this mutation disrupts calcium homeostasis, leading to elevated cytosolic and mitochondrial calcium levels, increased basal oxidative stress, and a reduction in mild uncoupling events, likely due to UCP dysfunction or decreased expression. These results suggest potential new therapeutic strategies for LRRK2-associated PD, including enhancing UCP expression or targeting UCP activity with agonists, inhibiting MCU functions, mitigating oxidative stress and restore mitochondrial function, in addition to blocking L-type channels. Mitochondrial dysfunction and oxidative stress are recognized as key drivers of dopaminergic neurodegeneration in PD. However, the mechanisms underlying LRRK2-mediated mitochondrial impairment remain incompletely understood. Here, we provide direct evidence that the LRRK2 hR1441G mutation induces mitochondrial oxidative stress, disrupts calcium homeostasis, and impairs mitochondrial function in an age-dependent manner. Our findings highlight a mechanistic link between pathogenic LRRK2 mutation, oxidative stress, and calcium dysregulation, offering potential targets for therapeutic intervention in PD.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study demonstrates that LRRK2 BAC-hR1441G mice exhibit progressive mitochondrial oxidative stress in SNc DA neurons and their striatal projections. Using two-photon ratiometric imaging of TH-mito-roGFP mice, we show that oxidative stress is elevated at dopaminergic terminals as early as 3 months of age, preceding significant neurite loss. This finding supports the hypothesis that presynaptic mitochondrial dysfunction is an early event in PD and may contribute to progressive neurodegeneration.\u003c/p\u003e\u003cp\u003eWe also observed that mitochondrial oxidative stress increased progressively in SNc DA neurons from 3 to 12 months of age, whereas oxidative stress in striatal terminals plateaued after 6 months. This suggests that early presynaptic mitochondrial dysfunction may initiate the disease process, with somatic mitochondrial stress accumulating later, consistent with axon-first degeneration models of PD [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In contrast, no significant oxidative stress changes were observed in the VTA, reinforcing the selective vulnerability of SNc DA neurons to mitochondrial dysfunction.\u003c/p\u003e\u003cp\u003eA key finding of our study is that LRRK2 hR1441G mutant DA neurons exhibit calcium overload, which contributes to mitochondrial dysfunction. Cytosolic calcium levels were significantly elevated, and mitochondrial calcium uptake was markedly increased, correlating with increased expression of the MCU. Pharmacological inhibition of L-type calcium channels with isradipine significantly reduced oxidative levels, implicating excessive calcium influx as a key driver of oxidative stress.\u003c/p\u003e\u003cp\u003eThese findings support a pathogenic model in which LRRK2 mutations impair calcium homeostasis, leading to mitochondrial calcium overload, respiratory dysfunction, and ROS accumulation. This is particularly relevant given evidence that Ca\u0026sup2;⁺ overload sensitizes DA neurons to oxidative damage, driving mitochondrial permeability transition pore (mPTP) opening and cell death. Our results further implicate UCP dysfunction in exacerbating oxidative stress, as LRRK2 hR1441G DA neurons exhibited reduced UCP4/UCP5 expression, impairing mitochondrial membrane potential flickering, a mechanism that protects against excessive ROS buildup.\u003c/p\u003e\u003cp\u003eDigital spatial profiling (DSP) added an important molecular dimension to our findings, revealing that dopaminergic neurons in BAC-RG mice exhibit widespread upregulation of genes involved in oxidative phosphorylation (OXPHOS), mitochondrial calcium transport, and ROS production. This analysis also highlighted the role of uncoupling proteins (UCPs), which were downregulated in BAC-RG mice, leading to impaired mitochondrial membrane potential regulation and further exacerbation of oxidative stress. Our data confirms that UCP dysfunction contributes to ROS generation, offering a new mechanistic understanding of how LRRK2 mutations promote mitochondrial dysregulation.\u003c/p\u003e\u003cp\u003eGiven the strong link between LRRK2 mutations, oxidative stress, and calcium dysregulation, our findings highlight several potential therapeutic strategies. First, enhancing UCP function through pharmacological activation or gene therapy may help restore mitochondrial homeostasis and reduce ROS accumulation. Second, targeting MCU to limit mitochondrial calcium overload could mitigate oxidative stress-induced damage.\u003c/p\u003e\u003cp\u003eImportantly, our results support the use of isradipine (an L-type calcium channel blocker) as a potential neuroprotective strategy in LRRK2-related PD [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. While the STEADY-PD III clinical trial failed to demonstrate significant benefits in idiopathic PD, this is likely due to the intervention occurring at an irreversible stage of the disease, when over 80% of dopaminergic neurons have already been lost. The lack of efficacy does not rule out its potential in earlier stages. Future studies should focus on early intervention, particularly in high-risk individuals, such as genetically defined LRRK2-PD carriers, before significant neuronal loss occurs. Finally, Future studies should assess whether selective MCU inhibitors or UCP agonists can provide neuroprotection in LRRK2-associated PD models.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur study provides the first direct evidence that R1441G mutation drives mitochondrial oxidative stress through calcium dysregulation and impaired UCP function in SNc DA neurons. We demonstrate early oxidative stress in presynaptic terminals, followed by age-dependent mitochondrial dysfunction in SNc DA neurons, highlighting a potential axon-first degeneration model in PD. Our findings suggest that targeting MCU, L-type calcium channels, and UCPs may provide novel therapeutic strategies for LRRK2-associated PD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary material is available online.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH.Z. conceived of and supervised the project. Y.X.C. and H.Z. wrote the paper. \u0026nbsp;Y.X.C. and H.Z. analyzed the data, with input from all authors. Y.X.C. performed 2p experiments. L.T.Z performed the Seahorse assays, and the quantitative real-time RT-PCR (qPCR). \u0026nbsp;S.Q.C. performed WB. C.B.Z and H.X.W. prepared the samples for spatial digital profiling experiment and C.B.Z. performed the experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Institute of Neurological Disorders and Stroke (NINDS) (Grant NS098393, NS097530 and NS128005 to H.Z.), and startup funds from Thomas Jefferson University (H.Z.) and the University of Georgia (H.Z.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that all data supporting the findings of this study are available within the article and its Supplementary Information files or from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;We thank Dr. D. James Surmeirer at Northwestern University for providing the TH-mito-roGFP mice and the AAV-TH-GCamp6 virus. We also thank Dr. Susan R. Sesack at the University of Pittsburgh who prepared tissue from wild-type and LRRK2 BAC-hR1441G mice for immunogold labeling and performed photographic sampling of striatal sections under electron microscopy. This work was supported by the National Institute of Neurological Disorders and Stroke (NINDS) (Grant NS098393, NS097530 and NS128005 to H.Z.), and startup funds from Thomas Jefferson University (H.Z.) and the University of Georgia (H.Z.).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSurmeier DJ. Determinants of dopaminergic neuron loss in Parkinson\u0026rsquo;s disease. FEBS J. 2018;285:3657\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLashuel HA, Petre BM, Wall J, Simon M, Nowak RJ, Walz T et al. α-synuclein, especially the parkinson\u0026rsquo;s disease-associated mutants, forms pore-like annular and tubular protofibrils. J Mol Biol [Internet]. 2002 [cited 2025 Mar 19];322:1089\u0026ndash;102. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/12367530/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/12367530/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDauer W, Przedborski S. Parkinson\u0026rsquo;s Disease: Mechanisms and Models. Neuron. 2003;39:889\u0026ndash;909.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFearnley JM, Lees AJ, AGEING AND PARKINSON\u0026rsquo;S DISEASE:. SUBSTANTIA NIGRA REGIONAL SELECTIVITY. Brain [Internet]. 1991 [cited 2025 Mar 19];114:2283\u0026ndash;301. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dx.doi.org/10.1093/brain/114.5.2283\u003c/span\u003e\u003cspan address=\"10.1093/brain/114.5.2283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S et al. Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron [Internet]. 2004 [cited 2025 Mar 19];44:601\u0026ndash;7. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/15541309/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/15541309/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWest AB, Moore DJ, Biskup S, Bugayenko A, Smith WW, Ross CA et al. Parkinson\u0026rsquo;s disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A [Internet]. 2005 [cited 2025 Mar 19];102:16842\u0026ndash;7. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/16269541/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/16269541/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKluss JH, Mamais A, Cookson MR. LRRK2 links genetic and sporadic Parkinson\u0026rsquo;s disease. Biochem Soc Trans [Internet]. 2019 [cited 2025 Apr 2];47:651\u0026ndash;61. Available from: /\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ebiochemsoctrans/article/47/2/651/219650/LRRK2-links-genetic-and-sporadic-Parkinson-s\u003c/span\u003e\u003cspan address=\"http://biochemsoctrans/article/47/2/651/219650/LRRK2-links-genetic-and-sporadic-Parkinson-s\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHealy DG, Falchi M, O\u0026rsquo;Sullivan SS, Bonifati V, Durr A, Bressman S et al. Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson\u0026rsquo;s disease: a case-control study. Lancet Neurol [Internet]. 2008 [cited 2025 Mar 19];7:583\u0026ndash;90. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/18539534/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/18539534/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCookson MR. The role of leucine-rich repeat kinase 2 (LRRK2) in Parkinson\u0026rsquo;s disease. Nat Rev Neurosci [Internet]. 2010 [cited 2025 Mar 19];11:791. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pmc.ncbi.nlm.nih.gov/articles/PMC4662256/\u003c/span\u003e\u003cspan address=\"https://pmc.ncbi.nlm.nih.gov/articles/PMC4662256/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCherra SJ, Steer E, Gusdon AM, Kiselyov K, Chu CT. Mutant LRRK2 Elicits Calcium Imbalance and Depletion of Dendritic Mitochondria in Neurons. Am J Pathol. 2013;182:474\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Yan MH, Fujioka H, Liu J, Wilson-delfosse A, Chen SG et al. LRRK2 regulates mitochondrial dynamics and function through direct interaction with DLP1. Hum Mol Genet [Internet]. 2012 [cited 2025 Mar 19];21:1931\u0026ndash;44. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dx.doi.org/10.1093/hmg/dds003\u003c/span\u003e\u003cspan address=\"10.1093/hmg/dds003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSheu SS, Nauduri D, Anders MW. Targeting antioxidants to mitochondria: a new therapeutic direction. Biochim Biophys Acta [Internet]. 2006 [cited 2025 Mar 19];1762:256\u0026ndash;65. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/16352423/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/16352423/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCsord\u0026aacute;s G, Hajn\u0026oacute;czky G. SR/ER\u0026ndash;mitochondrial local communication: Calcium and ROS. Biochimica et Biophysica Acta (BBA). - Bioenergetics. 2009;1787:1352\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChan CS, Gertler TS, Surmeier DJ. Calcium homeostasis, selective vulnerability and Parkinson\u0026rsquo;s disease. Trends Neurosci [Internet]. 2009 [cited 2025 Mar 19];32:249\u0026ndash;56. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/19307031/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/19307031/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Liu W, Oo TF, Wang L, Tang Y, Jackson-Lewis V et al. Mutant LRRK2R1441G BAC transgenic mice recapitulate cardinal features of Parkinson\u0026rsquo;s disease. Nature Neuroscience. 2009 12:7 [Internet]. 2009 [cited 2025 Mar 19];12:826\u0026ndash;8. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.nature.com/articles/nn.2349\u003c/span\u003e\u003cspan address=\"https://www.nature.com/articles/nn.2349\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuzman JN, Sanchez-Padilla J, Wokosin D, Kondapalli J, Ilijic E, Schumacker PT et al. Oxidant stress evoked by pacemaking in dopaminergic neurons is attenuated by DJ-1. Nature [Internet]. 2010 [cited 2025 Mar 19];468:696\u0026ndash;700. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/21068725/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/21068725/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim-Han JS, Dugan LL. Mitochondrial Uncoupling Proteins in the Central Nervous System. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://home.liebertpub.com/ars\u003c/span\u003e\u003cspan address=\"https://home.liebertpub.com/ars\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [Internet]. 2005 [cited 2025 Mar 19];7:1173\u0026ndash;81. Available from: https://www.liebertpub.com/doi/\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/ars.2005.7.1173\u003c/span\u003e\u003cspan address=\"10.1089/ars.2005.7.1173\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhi L, Qin Q, Muqeem T, Seifert EL, Liu W, Zheng S et al. Loss of PINK1 causes age-dependent decrease of dopamine release and mitochondrial dysfunction. Neurobiol Aging [Internet]. 2019 [cited 2025 Mar 19];75:1\u0026ndash;10. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/30504091/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/30504091/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurke RE, O\u0026rsquo;Malley K. Axon degeneration in Parkinson\u0026rsquo;s disease. Exp Neurol [Internet]. 2013 [cited 2025 Mar 19];246:72\u0026ndash;83. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/22285449/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/22285449/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHattori N, Mizuno Y. Mitochondrial Dysfunction in Parkinson\u0026rsquo;s Disease. Exp Neurobiol [Internet]. 2015 [cited 2025 Mar 19];24:103. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pmc.ncbi.nlm.nih.gov/articles/PMC4479806/\u003c/span\u003e\u003cspan address=\"https://pmc.ncbi.nlm.nih.gov/articles/PMC4479806/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuzman JN, Ilijic E, Yang B, Sanchez-Padilla J, Wokosin D, Galtieri D et al. Systemic isradipine treatment diminishes calcium-dependent mitochondrial oxidant stress. J Clin Invest [Internet]. 2018 [cited 2025 Mar 19];128:2266\u0026ndash;80. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI95898\u003c/span\u003e\u003cspan address=\"10.1172/JCI95898\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-neurodegeneration","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mond","sideBox":"Learn more about [Molecular Neurodegeneration](http://molecularneurodegeneration.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mond/default.aspx","title":"Molecular Neurodegeneration","twitterHandle":"@MolNeuro","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Parkinson’s disease, LRRK2, Mitochondrial dysfunction, oxidative stress, mitochondria membrane potential (MMP), Uncoupling protein (UCP)","lastPublishedDoi":"10.21203/rs.3.rs-8177400/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8177400/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eMitochondrial dysfunction and oxidative stress are central to the pathogenesis of Parkinson\u0026rsquo;s disease (PD), particularly affecting substantia nigra pars compacta (SNc) dopamine (DA) neurons. Here, we investigate how the R1441G mutation in leucine-rich repeat kinase 2 (LRRK2), a key genetic contributor to familial and sporadic PD, impacts mitochondrial function in midbrain DA neurons.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eWe employed a BAC transgenic mouse model overexpressing human LRRK2-R1441G and crossed it with TH-mito-roGFP mice to enable mitochondria-targeted redox imaging specifically in DA neurons. Acute midbrain slices from 3-, 6-, and 10-month-old mice were imaged using two-photon microscopy to assess mitochondrial oxidative stress. In parallel, mitochondrial respiratory function, membrane potential flickering events, and expression of uncoupling proteins (UCP4/UCP5) were analyzed. Spatial transcriptomic profiling was performed using the GeoMx\u0026reg; Digital Spatial Profiler to uncover associated molecular alterations.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eWe observed a progressive increase in mitochondrial oxidative stress in SNc DA neurons of LRRK2 BAC-hR1441G mice at 3, 6, and 10 months of age. This was accompanied by reduced respiratory complex activity, attenuated mitochondrial membrane potential flickering, and diminished expression of UCP4 and UCP5. Spatial transcriptomic analysis revealed dysregulation of genes linked to mitochondrial uncoupling, calcium signaling, and redox regulation in LRRK2-R1441G SNc tissue.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThese findings reveal an age-dependent progression of mitochondrial dysfunction in LRRK2-R1441G SNc DA neurons. Dysregulation of calcium channels and uncoupling proteins emerges as a key mechanism contributing to bioenergetic failure, suggesting potential therapeutic targets to mitigate PD progression.\u003c/p\u003e","manuscriptTitle":"The Human LRRK2-R1441G Mutation Drives Age-Dependent Oxidative Stress and Mitochondrial Dysfunction in Dopaminergic Neurons","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-03 11:36:38","doi":"10.21203/rs.3.rs-8177400/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-18T21:03:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-16T15:55:20+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-17T17:39:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"323644461936919579774066153078928963224","date":"2025-12-14T18:04:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-02T15:55:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"286841068111753853096643577538943429446","date":"2025-12-02T02:47:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"159276139065624613286602503046139919687","date":"2025-12-01T14:16:43+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-30T20:14:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-28T19:10:32+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-27T11:59:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Neurodegeneration","date":"2025-11-22T02:46:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-neurodegeneration","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mond","sideBox":"Learn more about [Molecular Neurodegeneration](http://molecularneurodegeneration.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mond/default.aspx","title":"Molecular Neurodegeneration","twitterHandle":"@MolNeuro","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"517997e8-67ea-426e-b9f9-a71ea0054924","owner":[],"postedDate":"December 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-01-18T21:08:39+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-03 11:36:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8177400","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8177400","identity":"rs-8177400","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}