MiR-145-5p regulates granulosa cell proliferation by targeting the SET gene in KGN cells.

To validate whether miR-145-5p and SET were associated with PCOS, luteinized human granulosa cells were isolated from the follicular fluid of women with PCOS and control women who underwent in vitro fertilization because of male or tubal factor infertility. The expression levels of miR-145-5p and SET in granulosa cells from patients with PCOS and healthy women were measured using real-time PCR. As depicted in Fig. 1A Fig. 1. The expression of miR-145-5p and SET in granulosa cells from patients with PCOS and control individuals. (A) Real-time PCR analysis of miR-145-5p in granulosa cells from patients with PCOS and control individuals. The expression of miR-145 is significantly declined in PCOS granulosa cells compared to that in the controls (P < 0.05). (B) Real-time PCR analysis of SET in granulosa cells from patients with PCOS and control individuals. The expression of SET in PCOS granulosa cells is increased compared to that in the controls. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. , the expression of miR-145-5p was significantly lower in PCOS granulosa cells than in the controls (P < 0.05). The expression of SET in PCOS granulosa cells was higher than that in the controls ( Fig. 1B ). The expression of miR-145-5p and SET in granulosa cells from patients with PCOS and control individuals. (A) Real-time PCR analysis of miR-145-5p in granulosa cells from patients with PCOS and control individuals. The expression of miR-145 is significantly declined in PCOS granulosa cells compared to that in the controls (P < 0.05). (B) Real-time PCR analysis of SET in granulosa cells from patients with PCOS and control individuals. The expression of SET in PCOS granulosa cells is increased compared to that in the controls. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. To explore the function of miR-145-5p in granulosa cells, miR-145-5p mimics and inhibitor were used to overexpress and knockdown its expression in KGN cells, respectively. The CCK-8 assay showed that the viability was significantly decreased in KGN cells transfected with miR-145-5p mimics 72 h post-transfection ( Fig. 2A Fig. 2. Effect of miR-145-5p on granulosa cell proliferation. (A) KGN cells were transfected with miR-145-5p mimics or miR-control. The cell viability is significantly decreased in KGN cells transfected with miR-145-5p mimics compared with that in KGN cells transfected with miR-control, at 72 h post-transfection, according to CCK-8 assay. (B) KGN cells were transfected with miR-145-5p inhibitor or miR-control. The cell viability is significantly decreased in KGN cells transfected with miR-145-5p inhibitor compared with that in KGN cells transfected with miR-control, at 48 h and 72 h post-transfection, according to CCK-8 assay. (C) KGN cells were transfected with miR-145-5p mimics or miR-control for 48 h. The cell proliferation is significantly decreased in KGN cells transfected with miR-145-5p mimics compared with that in KGN cells transfected with miR-control, according to EdU assay. The cell proliferation is significantly increased in KGN cells transfected with miR-145-5p inhibitor compared with that in KGN cells transfected with miR-control, according to EdU assay. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’ t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. ), whereas the miR-145-5p inhibitor significantly increased viability in KGN cells 48 h and 72 h post-transfection ( Fig. 2B ). The EdU assay was performed to validate the results of the CCK-8 assay. Consistent with the CCK-8 assay results, cell proliferation was decreased in KGN cells treated with miR-145-5p mimics and was increased in cells treated with the miR-145-5p inhibitor 48 h post-transfection ( Fig. 2C ). Collectively, these results suggest that miR-145-5p suppressed KGN cell proliferation. Effect of miR-145-5p on granulosa cell proliferation. (A) KGN cells were transfected with miR-145-5p mimics or miR-control. The cell viability is significantly decreased in KGN cells transfected with miR-145-5p mimics compared with that in KGN cells transfected with miR-control, at 72 h post-transfection, according to CCK-8 assay. (B) KGN cells were transfected with miR-145-5p inhibitor or miR-control. The cell viability is significantly decreased in KGN cells transfected with miR-145-5p inhibitor compared with that in KGN cells transfected with miR-control, at 48 h and 72 h post-transfection, according to CCK-8 assay. (C) KGN cells were transfected with miR-145-5p mimics or miR-control for 48 h. The cell proliferation is significantly decreased in KGN cells transfected with miR-145-5p mimics compared with that in KGN cells transfected with miR-control, according to EdU assay. The cell proliferation is significantly increased in KGN cells transfected with miR-145-5p inhibitor compared with that in KGN cells transfected with miR-control, according to EdU assay. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’ t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. Bioinformatics analysis predicted that SET could be a target gene of miR-145-5p ( Fig. 3A Fig. 3. MiR-145-5p directly inhibits SET expression by binding to its 3′ UTR. (A) Putative binding sites for human miR-145-5p in the 3′ UTR of SET mRNA, seed match region, and seed mutant region are shown in red. (B) KGN cells were transfected with miR-145-5p mimics or miR-145-5p control. The luciferase activity of the human SET gene 3′ UTR is inhibited by miR-145-5p mimics, whereas they have no effect on the activity of luciferase fused with the SET 3′ UTR mutant. (C) SET mRNA expression is down-regulated in KGN cells transfected with miR-145-5p mimics for 24 h compared to that in the miR-control group. Similarly, SET mRNA expression is increased in KGN cells transfected with miR-145-5p inhibitor compared to that in the miR-control group. (D) SET protein expression is reduced in KGN cells transfected with miR-145-5p mimics for 48 h compared to that in the miR-control group. Similarly, SET protein expression is elevated in KGN cells transfected with miR-145-5p inhibitor compared to that in the miR-control group. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. , TargetScan and miRDB databases). To explore whether miR-145-5p directly targets and regulates SET expression in granulosa cells, dual-luciferase reporter assay, real-time PCR, and western blotting were performed. The relative luciferase activity of the pGL3-SET-3′ UTR-WT in 293T cells transfected with miR-145-5p mimics was markedly declined compared with that of the scramble control ( Fig. 3B ). In contrast, no significant change was observed in the relative luciferase activity between the 293T cells transfected with pGL3-SET-3′ UTR-Mut and those transfected with miR-145-5p mimics. Moreover, miR-145-5p mimics significantly reduced SET mRNA expression, whereas the miR-145-5p inhibitor increased SET mRNA expression ( Fig. 3C ). Similarly, miR-145-5p mimics markedly reduced SET protein expression, whereas the miR-145-5p inhibitor elevated SET protein expression ( Fig. 3D ) in KGN cells. These findings suggested that the SET is a direct target of miR-145-5p. MiR-145-5p directly inhibits SET expression by binding to its 3′ UTR. (A) Putative binding sites for human miR-145-5p in the 3′ UTR of SET mRNA, seed match region, and seed mutant region are shown in red. (B) KGN cells were transfected with miR-145-5p mimics or miR-145-5p control. The luciferase activity of the human SET gene 3′ UTR is inhibited by miR-145-5p mimics, whereas they have no effect on the activity of luciferase fused with the SET 3′ UTR mutant. (C) SET mRNA expression is down-regulated in KGN cells transfected with miR-145-5p mimics for 24 h compared to that in the miR-control group. Similarly, SET mRNA expression is increased in KGN cells transfected with miR-145-5p inhibitor compared to that in the miR-control group. (D) SET protein expression is reduced in KGN cells transfected with miR-145-5p mimics for 48 h compared to that in the miR-control group. Similarly, SET protein expression is elevated in KGN cells transfected with miR-145-5p inhibitor compared to that in the miR-control group. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. To assess the impact of SET on human granulosa cells, AdCMV-SET and AdH1-SiRNA/SET adenoviruses were used to overexpress and knockdown SET expression in KGN cells, respectively. CCK-8 and EdU assays were performed to evaluate the effect of SET on granulosa cell proliferation. AdCMV-SET and AdH1-SiRNA/SET adenoviruses effectively elevated and decreased SET protein levels in KGN cells, respectively, after 48 h of infection ( Fig. 4A Fig. 4. Effect of SET on granulosa cell proliferation. (A) KGN cells were infected with AdCMV- SET or AdCMV-GFP adenoviruses for 48 h. AdCMV-SET adenoviruses effectively elevate SET protein levels in KGN cells, according to western blot analysis. KGN cells were infected with AdH1-SiRNA/ SET or AdH1-SiRNA/NS adenoviruses for 48 h. AdH1-SiRNA/SET adenoviruses effectively decrease SET protein levels, according to western blot analysis. (B) The cell viability is elevated in KGN cells infected with AdCMV- SET adenoviruses compared with that in KGN cells infected with AdCMV-GFP adenoviruses, according to CCK-8 assay. The cell viability is decreased in KGN cells infected with AdH1-SiRNA/ SET adenoviruses compared with that in KGN cells infected with AdH1-SiRNA/NS adenoviruses after 48 h, according to CCK-8 assay. (C) EdU-positive cells are increased in KGN cells infected with AdCMV- SET adenoviruses compared to those infected with AdCMV-GFP, according to EdU assay. EdU-positive cells are reduced in KGN cells infected with AdH1-SiRNA/ SET adenoviruses compared to those infected with AdH1-SiRNA/NS, according to EdU assay. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. ). As expected, viability was significantly increased in KGN cells infected with AdCMV-SET adenoviruses but was significantly decreased in those infected with AdH1-SiRNA/SET adenoviruses ( Fig. 4B ). Furthermore, KGN cells infected with AdCMV-SET adenoviruses exhibited an increase in EdU-positive cells compared with those infected with AdCMV-GFP. Conversely, KGN cells infected with AdH1-siRNA/SET adenoviruses displayed a decrease in the number of EdU-positive cells compared to those infected with AdH1-siRNA/NS ( Fig. 4C ). These results suggested that SET promoted the proliferation of KGN cells. Effect of SET on granulosa cell proliferation. (A) KGN cells were infected with AdCMV- SET or AdCMV-GFP adenoviruses for 48 h. AdCMV-SET adenoviruses effectively elevate SET protein levels in KGN cells, according to western blot analysis. KGN cells were infected with AdH1-SiRNA/ SET or AdH1-SiRNA/NS adenoviruses for 48 h. AdH1-SiRNA/SET adenoviruses effectively decrease SET protein levels, according to western blot analysis. (B) The cell viability is elevated in KGN cells infected with AdCMV- SET adenoviruses compared with that in KGN cells infected with AdCMV-GFP adenoviruses, according to CCK-8 assay. The cell viability is decreased in KGN cells infected with AdH1-SiRNA/ SET adenoviruses compared with that in KGN cells infected with AdH1-SiRNA/NS adenoviruses after 48 h, according to CCK-8 assay. (C) EdU-positive cells are increased in KGN cells infected with AdCMV- SET adenoviruses compared to those infected with AdCMV-GFP, according to EdU assay. EdU-positive cells are reduced in KGN cells infected with AdH1-SiRNA/ SET adenoviruses compared to those infected with AdH1-SiRNA/NS, according to EdU assay. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. To further determine the functional relationship between the miR-145-5p/ SET axis and granulosa cell proliferation, miR-inhibitor-treated KGN cells were infected with AdH1-SiRNA/SET or AdH1-SiRNA/NS adenoviruses. The knockdown of miR-145-5p markedly elevated the protein level of SET in KGN cells, whereas co-infection with AdH1-SiRNA/SET adenoviruses reversed this effect ( Fig. 5A Fig. 5. Knockdown of SET restores the effects of miR-145-5p inhibitor on cell proliferation. (A) MiR-inhibitor-treated KGN cells were infected with AdH1-SiRNA/SET or AdH1-SiRNA/NS adenoviruses for 48 h. Knockdown of miR-145-5p markedly elevates the protein level of SET in KGN cells, while co-infection with AdH1-SiRNA/SET adenoviruses reverses this effect. (B) CCK-8 assay shows that the effect of miR-145-5p inhibitor on cell viability is reversed by SET knockdown. (C) EdU assay shows that the effect of miR-145-5p inhibitor on DNA synthesis levels is significantly abrogated by SET knockdown. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01. ). Furthermore, the effect of miR-145-5p inhibitor on cell viability was significantly reversed by SET knockdown ( Fig. 5B ). Similarly, the effect of the miR-145-5p inhibitor on DNA synthesis was significantly abrogated by SET knockdown ( Fig. 5C ). These results indicate that the ability of miR-145-5p to regulate cell proliferation in human granulosa cells is specifically attributed to its ability to inhibit SET . Knockdown of SET restores the effects of miR-145-5p inhibitor on cell proliferation. (A) MiR-inhibitor-treated KGN cells were infected with AdH1-SiRNA/SET or AdH1-SiRNA/NS adenoviruses for 48 h. Knockdown of miR-145-5p markedly elevates the protein level of SET in KGN cells, while co-infection with AdH1-SiRNA/SET adenoviruses reverses this effect. (B) CCK-8 assay shows that the effect of miR-145-5p inhibitor on cell viability is reversed by SET knockdown. (C) EdU assay shows that the effect of miR-145-5p inhibitor on DNA synthesis levels is significantly abrogated by SET knockdown. Results are presented as the mean ± SD from at least 3 independent experiments. The Student’s t -test was used to compare the mRNA levels. * P < 0.05 and ** P < 0.01.

MiR-145-5p is encoded by the MIR145 gene, which is located on Chromosome 5: 149,430,646–149,430,733 forward strand and reported to play a role in the onset and progression of various disorders. This miRNA is mainly recognized as a tumor suppressor in numerous types of cancers. In a previous study, miR-145-5p expression was found to be decreased in bladder cancer; when its expression was restored, it inhibited cell growth, migration, and invasion while promoting apoptosis by targeting UHRF1 [ 18 ]. Similarly, in breast cancer, miR-145-5p expression has been shown to be downregulated, with restoration of its expression leading to Ago2 induction and inhibition of cell migration [ 19 ]. According to another study, miR-145-5p showed decreased levels in cervical cancer, and the restoration of its expression suppressed cell proliferation, migration, and invasion by downregulating KLF5 [ 20 ]. Furthermore, it has been reported to be decreased in esophageal carcinoma, and upregulation of miR-145-5p via ABRACL targeting has been shown to suppress cell proliferation, migration, and invasion [ 21 ]. Moreover, miR-145-5p has been shown to affect the pathogenesis of several non-malignant conditions such as asthma, aplastic anemia, diabetic nephropathy, and rheumatoid arthritis. In a study on aplastic anemia, miR-145–5p expression was downregulated, which led to increased T cell activation through upregulation of MYC expression and promotion of T cell proliferation [ 22 ]. In asthmatic mice, miR-145–5p levels were elevated, thereby promoting chemokine and inflammatory factor release while inhibiting epithelial repair by targeting KIF3A [ 23 ]. In mouse granulosa cells, microRNA-145 has been confirmed to inhibit cell proliferation by targeting activin receptor IB [ 24 ]. Moreover, microRNA-145 negatively regulated cell proliferation by targeting IRS1 in ovarian granulosa cells isolated from patients with PCOS [ 25 ]. In our study, we validated that microRNA-145-5p suppressed the proliferation of human granulosa cells by directly targeting SET , which suggests that microRNA-145-5p can regulate cell proliferation by targeting different downstream genes. The SET gene, which is involved in various cellular processes including cell proliferation and apoptosis, has been implicated in several cancers and other diseases. In a previous study, when the expression of SET gene was suppressed in glioblastoma cells, apoptosis was significantly increased, accompanied by a notable inhibition of cell proliferation and a marked decrease in cell migration [ 26 ]. Accumulation of the SET protein was found to increase cellular proliferation in HEK293 and HNSCC cell lines [ 27 ]. Introducing exogenous SET into HTO cells led to the suppression of cell proliferation. Similarly, depletion of SET through siRNA resulted in enhanced cell proliferation [ 28 ]. The present study demonstrated that SET promoted the proliferation of KGN cells. Furthermore, this study expands the understanding of the function of SET by demonstrating its regulation by miRNA-145-5p in granulosa cells. MiR-145-5p has been shown to be sponged by several lncRNAs and circRNAs. CircRNAs are a family of non-coding RNAs with covalently closed loop structures that participate in gene expression regulation at both the transcriptional and post-transcriptional levels by serving as miRNA sponges, interacting with RNA-binding proteins, and regulating host gene expression. Among them, most circRNAs act as miRNA sponges along the circRNA–miRNA axis. CircSTAG2 has been confirmed to modulate the progression of bladder cancer cell lines by sponging the tumor suppressor miR-145-5p, resulting in the activation of TAGLN2 [ 29 ]. CircCPA4 has been found to bind to miR-145-5p, thereby regulating cell proliferation, migration, invasion, and apoptosis in non-small cell lung cancer in vitro [ 30 ]. CircRNA-02191 has been reported to regulate unsaturated fatty acid synthesis by adsorbing miR-145 to enhance CD36 expression in the bovine mammary gland [ 31 ]. Hsa_circ_0001326 has been shown to inhibit the proliferation, migration, and invasion of trophoblasts via the miR-145-5p/TGFB2 axis [ 32 ]. Circ_0015756 has been found to promote ovarian cancer progression by sponging miR-145-5p [ 33 ]. Currently, only a few circRNAs have been identified to be aberrantly expressed in PCOS and involved in its pathological processes. Previous studies have shown that circ_0118530 was upregulated in the granulosa cells of patients with PCOS and that downregulation of circ_0118530 in the KGN cell line inhibits cell viability and migration by selectively adsorbing miR-136, leading to apoptosis [ 34 ]. Additionally, circ_0043532 expression has been reported to be elevated in patients with PCOS, and interference with circ_0043532 has been shown to inhibit cell proliferation and induce cell-cycle arrest and apoptosis by regulating the miR-182/SGK3 axis [ 7 ]. CircPUM1 has been shown to be strongly expressed in the granulosa cells of patients with PCOS and to regulate granulosa cell proliferation and apoptosis by sponging miR-760 [ 35 ]. Microarray analysis has shown that circ_0043314 is significantly upregulated in the granulosa cells of patients with PCOS [ 36 ]. Bioinformatics predictions have suggested that miR-145-5p could serve as a target gene of circ_0043314. Therefore, our future studies will aim to validate whether circ_0043314 participates in the regulation of granulosa cell function by acting as a sponge for miR-145-5p. MiR-145-5p has been observed to modulate apoptosis in various cell types. Overexpression of miR-145-5p repressed apoptosis in high-glucose-induced HK-2 cells by targeting VASN [ 37 ]. Additionally, miRNA-145-5p has been shown to suppress apoptotic responses in LPS-activated Caco-2 cells [ 38 ]. Decreased levels of miRNA-145-5p have been associated with prostate cancer bone metastasis, where miRNA-145-5p induction promoted apoptosis [ 39 ]. Similarly, high expression of miRNA-145 in thyroid cancer cells has been reported to inhibit cell proliferation and migration, while promoting apoptosis [ 40 ]. However, reports are unclear on whether miR-145-5p is involved in granulosa apoptosis. Further experiments will be conducted to address this question. Dysregulation of granulosa cell proliferation is a hallmark of PCOS, and it contributes to the characteristic follicular abnormalities observed in affected individuals. By exploring the potential role of miRNA-145-5p and its target gene SET in this process, our findings provide insights into the molecular mechanisms that may contribute to the pathogenesis of PCOS. Furthermore, our study contributes to the broader understanding of miRNA-mediated gene regulation in reproductive biology. The identification of miRNA-145-5p as a regulator of granulosa cell proliferation highlights the intricate network of molecular interactions involved in ovarian function. Future research directions include investigating the therapeutic potential of targeting miRNA-145-5p or the SET gene in the management of PCOS. Further studies are warranted to explore the downstream and upstream signaling pathways and molecular targets influenced by miRNA-145-5p-mediated regulation of granulosa cell proliferation. In conclusion, our findings provide novel insights into the molecular mechanisms underlying granulosa cell proliferation in PCOS, implicating miRNA-145-5p and its target gene SET as potential key regulators of this process. This study contributes to the growing body of knowledge regarding the role of miRNAs in the pathogenesis of PCOS and may pave the way for the development of targeted therapeutic interventions for this common endocrine disorder.

The authors declare no conflict of interests.

The follicular fluid samples from patients with PCOS and control individuals were collected at the Northern Jiangsu People’s Hospital Affiliated to Yangzhou University. All patients underwent in vitro fertilization, and oocyte retrieval was performed under transvaginal ultrasound guidance to collect follicular fluid. Patients with PCOS were diagnosed on the basis of the Rotterdam criteria. The control group consisted of patients undergoing in vitro fertilization owing to male factor infertility or isolated tubal factor infertility who exhibited normal ovarian function, regular menstrual cycles, normal basal hormone levels, and normal follicular numbers in both ovaries. The following patients were excluded: those over 35 years of age and those with ovarian cysts; ovarian tumors; or a history of ovarian surgery, ovarian radiotherapy or chemotherapy, endometriosis, thyroid dysfunction, hyperprolactinemia, or other endocrine diseases and chromosomal abnormalities. All patients signed informed consent forms that were approved by the hospital’s ethics committee. Human granulosa cells were obtained from the follicular fluid of patients undergoing in vitro fertilization. Granulosa cells were isolated according to a previously established protocol [ 16 ]. Briefly, granulosa cells were separated from red blood cells in follicular aspirates using centrifugation in 50% Percoll solution (Sigma, St. Louis, MO, USA), followed by washing and suspension in DMEM/F12 medium (HyClone, Logan, UT, USA). Cell viability was assessed using the trypan blue (Beyotime, Shanghai, China) exclusion method to ensure that the percentage of live cells exceeded 90% in each experiment. The human granulosa cells (with a purity exceeding 95%) were subsequently seeded into culture plates (Corning, Corning, NY, USA) containing DMEM/F12 medium (HyClone) supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, and 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA). The cells were incubated in a humidified atmosphere with 5% CO 2 at 37°C. KGN cells were purchased from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and cultured in DMEM/F12 medium with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin in a 37°C humidified environment with 5% CO 2 . AdCMV-SET and AdH1-SiRNA/SET adenoviruses were constructed as described in our previous work to overexpress or knockdown SET expression, respectively. The efficacies of SET knockdown and overexpression have been validated at both mRNA and protein levels [ 17 ]. AdCMV-GFP was used as the control for AdCMV-SET and AdH1-SiRNA/NS as the control for AdH1-SiRNA/SET. Cell proliferation was assessed using the Cell Counting Kit-8 (CCK-8; Beyotime) according to the manufacturer’s instructions. To determine the effect of miR-145-5p or SET on cell proliferation, cells were seeded in 96-well plates at approximately 1 × 10 4 /150 μl/well and transfected or infected. After culturing for 48 h, the CCK-8 solution was added to each well. After incubation for another 3 h, the absorbance was measured using a microplate reader at 450 nm. This assay was performed in triplicate and repeated three times. To assess the effect of miR-145-5p and SET on the DNA synthesis capability of granulosa cells, BrdU incorporation was performed using a BrdU cell proliferation enzyme-linked immunosorbent assay kit (BeyoClick, Shanghai, China). Briefly, cells treated with miRNAs or adenoviruses were seeded into 96-well plates and cultured for 24 h. Subsequently, BrdU solution (10 ml/well), fixing/denaturing solution (100 ml/well), peroxidase-labeled sheep anti-mouse IgG solution (100 ml/well), and tetramethylbenzidine substrate (100 ml) were added sequentially. The mixtures were incubated according to the manufacturer’s instructions. After the indicated incubation period, BrdU incorporation into the cells was quantified at 450 nm using a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA). Each experiment was repeated three times in triplicate. The SET-3′ UTR and the SET-mutated-3′ UTR fragments were amplified by PCR. Subsequently, the fragments were cloned into the pGL3 luciferase promoter vector (Promega, Madison, Wisconsin, USA) to construct the Luc-pGL3-SET-3′ UTR and Luc pGL3-SET-mut-3′ UTR vectors. The putative binding site for human miR-145-5p in the 3′ UTR of SET mRNA is 3′ UGACCU. The seed match region of SET-WT was 5′ ACUGGAA, and seed mutant region of SET-Mut was designed as 5′ CGAUUG. 293T cells were used for the luciferase assay. Cells seeded in 24-well plates were co-transfected with Luc-pGL3-SET-3′ UTR or Luc-pGL3-SET-mut-3′ UTR vector, along with miR-145-5p mimics or scrambled miRNA, using Lipofectamine 2000 reagent (Invitrogen), following the manufacturer’s instructions. After 48 h post-transfection, firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay kit (Promega). The results are expressed as relative luciferase activity (firefly luciferase/Renilla luciferase). Each experiment was conducted three times with triplicate samples. Total mRNA was extracted using the TRIZOL reagent (Invitrogen). Total RNA was reverse-transcribed using the PrimeScript Reverse Transcription Reagent Kit (Perfect Real Time, Takara, Dalian, China) according to the manufacturer’s instructions. The primers for the human miR-145-5p, U6, SET , and GAPDH gene were as follows: 5′miR-145-5p: ACACTCCAGCTGGGGTCCAGTTTTCCCAGGAA, 3′miR-145-5p: GTTCGCTGAGATGAAGCACTG, 5′U6: CTCGCTTCGGCAGCACA, 3′U6: TGGTGTCGTGGAGTCG, 5′SET: GTCCACCGAAATCAAATGGAAATC, 3′SET: GCACCTGCATCAGAATGGTCA; 5′GAPDH: AGGTTGTCTCCTGCGACTTCA, 3′GAPDH: GGGTGGTCCAGGGTTTCTTACT. Real-time PCR was performed using an ABI Prism 7300 Sequence Detection System (PerkinElmer Applied Biosystems, Foster City, CA, USA). Melting curve analysis was performed to confirm product specificity. Data were calculated according to the 2 −ΔΔCT method and presented as the fold change relative to the corresponding data for the GAPDH internal reference gene. Cells from different treatment groups were collected and immediately sonicated in lysis buffer containing 50 mM Tris-HCl (pH 7.4), 0.1% Triton X-100, 5 mM EDTA, 150 mM NaCl, 1 mM PMSF, and 1% protease inhibitor cocktail (Pierce Biotechnology, Rockford, IL, USA). After 30 min of incubation on ice with intermittent agitation, the lysates were centrifuged at 12000 g at 4°C for 10 min. The suspended proteins were collected, separated by SDS-PAGE, and transferred onto a polyvinylidene difluoride membrane (GE Healthcare, San Francisco, CA, USA). Following the transfer, the membranes were blocked in Tris-buffered saline (TBS) containing 5% skim milk for 1 h and incubated overnight at 4°C with 1:1000 rabbit anti-SET polyclonal antibody (sc-25564, Santa Cruz Biotechnology, Santa Cruz, CA, USA). Loading levels were normalized using a 1:2000 rabbit anti-tubulin antibody (ab6046; Abcam, Cambridge, MA, USA). The results were analyzed using Quantity One version 4.62 (Bio-Rad). All data were expressed as the means ± SD, which were calculated from at least three independent experiments. Normal distribution was assessed using the Shapiro–Wilk test. Statistical analyses were performed using the Stata 10 software (StataCorp LP, College Station, TX, USA). Differential analysis was performed using Student’s t -test or one-way analysis of variance. Quantitative differences were considered statistically significant if the p-value reached P < 0.05.