Synergistic Role of CSPBP and SGS1 in Sporozoite Entry into Aedes aegypti Salivary Glands

Synergistic Role of CSPBP and SGS1 in Sporozoite Entry into Aedes aegypti Salivary Glands | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Synergistic Role of CSPBP and SGS1 in Sporozoite Entry into Aedes aegypti Salivary Glands Alec Morvay, Helena R. C. Araújo, Margareth L. Capurro, Bianca Correa Burini This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7530159/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Apr, 2026 Read the published version in Scientific Reports → Version 1 posted 12 You are reading this latest preprint version Abstract Vector-borne diseases, particularly malaria, continue to pose a major global health challenge, underscoring the urgent need for innovative and sustainable vector control strategies. Among emerging solutions, genetic control holds great promise for interrupting disease transmission at its source. Malaria transmission relies on the parasite’s ability to overcome multiple barriers within the mosquito and ultimately invade the salivary glands during the sporozoite stage. Using Plasmodium gallinaceum as a model parasite, this study investigates two Aedes aegypti proteins, the salivary gland surface protein 1 (SGS1) and the putative ortholog of circumsporozoite protein-binding protein (AaCSPBP), that are involved in this critical step. We identified AaCSPBP through in silico homology and structural analyses and achieved gene knockdown via RNA interference. Knockdown of AaCSPBP alone resulted in a ~ 62% reduction in salivary gland sporozoite numbers and increased accumulation in the hemolymph, indicating impaired gland invasion. Dual knockdown of AaCSPBP and SGS1 produced a synergistic effect, reducing salivary gland sporozoites by ~ 94%, a significantly greater reduction than the sum of individual effects. These findings suggest that AaCSPBP and SGS1 act cooperatively to mediate sporozoite invasion of mosquito salivary glands. Targeting this interaction offers a promising genetically based approach to disrupting malaria transmission. Health sciences/Diseases Biological sciences/Microbiology Biological sciences/Molecular biology Circumsporozoite Protein Binding Protein CSP SGS1 Aedes aegypti sporozoite salivary gland Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Accounting for 17% of all infectious diseases and more than 700,000 deaths annually, vector-borne diseases are a significant detriment to human health[ 1 ]. Mosquitoes are perhaps the most dangerous vector, transmitting viruses and parasites, including but not limited to malaria, dengue, yellow fever, and Zika[ 1 ]. Of these pathogens, malaria is undeniably the deadliest, accounting for 597,000 deaths in 2023 alone[ 2 ]. The global incidence rate stayed relatively stable between 2015 and 2022 after dropping between 2000 and 2015, but slightly increased in 2023, indicating the ever-growing complications with current forms of disease control[ 2 ]. Malaria prevention will become increasingly difficult due to the effects of climate change[ 3 ], the challenges associated with current malaria vaccines[ 4 ], the growing mosquito resistance to insecticides[ 5 ], and anti-malarial drug resistance in parasites[ 6 ]. Given these challenges, an investigation into other forms of vector control is imperative. While current approaches have certainly mitigated the mortality of malaria, they are far from eliminating its effects. Current vaccines are somewhat efficacious, but their immunity is short-lived, and they do not provide sufficient defense against the disease in endemic areas[ 4 ]. Additionally, while chemical suppression of mosquito populations and antimalarial drugs targeting Plasmodium have contributed to malaria control, both approaches have also led to the development of resistance in mosquitoes and parasites, respectively[ 5 , 6 ]. Population replacement, through genetic control, is an alternative intervention that seeks to propagate mosquitoes that are refractory to malaria by coupling genes that inhibit transmission with gene drives (genetic elements with > 50% inheritance)[ 7 ]. If mosquitoes are developed through genetic intervention that are incapable of malaria transmission and have minimal fitness impact, population replacement could serve to eradicate the transmission of malaria altogether. A thorough understanding of mosquito-parasite interactions is imperative to genetic control design, and thus to human health worldwide. The parasite responsible for avian malaria, Plasmodium gallinaceum , shares many structural and developmental characteristics with the human strain Plasmodium falciparum [ 8 , 9 ] and is therefore a suitable laboratory model for understanding parasitic propagation and migration throughout the mosquito[ 10 ]. The Plasmodium parasites begin their life cycles through the ingestion of their gametocytes by a female mosquito, which acquires them via an infected blood meal[ 8 ]. In the midgut lumen, gametogenesis (the development of gametocytes into male and female gametes) is triggered after a pH increase, temperature decrease, and the presence of xanthurenic acid[ 11 ]. Male gametes then fertilize female gametes, resulting in the development of a zygote. The differentiation of the zygote sparks its conversion into an ookinete (a motile, elongated cell capable of tissue invasion), which penetrates and crosses the midgut epithelium, entering a sessile state attached to the midgut wall where it becomes an oocyst[ 11 ]. Oocysts then develop and release sporozoites into the hemolymph, which must enter the salivary glands to transmit the parasite to other organisms the next time blood feeding occurs[ 11 ]. While there is limited knowledge regarding the specific interactions undergone by mosquito protein receptors during sporozoite invasion of the salivary gland, a few molecules have been identified that seemingly play an important role in this process. Salivary gland surface protein 1 (SGS1) in Aedes aegypti is one of these compounds, occupying regions associated with sporozoite salivary gland invasion and inducing an immune response in mosquitoes after secretion into their saliva[ 12 ]. Furthermore, the introduction of anti-SGS1 immunoglobulin in P. gallinaceum -infected Ae. aegypti before the burst of oocysts substantially decreased salivary sporozoite numbers[ 13 ], and the knockdown and knockout of SGS1 have been shown to significantly reduce the number of sporozoites in infected salivary glands by 67% and 64% respectively[ 14 ]. There is additional evidence that SGS1 has a subsequent purpose in the Plasmodium life cycle, with its knockout reducing oocyst development in the midgut[ 14 ]. Little is known of SGS1’s function outside of parasitic development, but preliminary investigation shows no statistically significant difference in fitness between SGS1 knockout and control mosquitoes[ 14 ]. Possibly functioning in addition to SGS1 is the circumsporozoite protein-binding protein (CSPBP). CSPBP is the associated receptor of the circumsporozoite protein (CSP), the most abundant surface protein in the Plasmodium parasite. CSP has long been known as essential for sporozoite invasion of the salivary glands, and its knockout in Plasmodium berghei has been shown to significantly inhibit sporozoite production[ 15 , 16 ]. Subsequently, CSPBP antibodies have been shown to reduce sporozoite abundance by 25% and 90% in P. berghei- infected Anopheles gambiae after 14 and 18 days, respectively, with CSPBP knockdown preventing 75% of sporozoites in the hemolymph from entering the salivary glands of an infected mosquito[ 16 ]. The effects resulting from the suppression of the orthologous protein to CSPBP in Ae. aegypti (AaCSPBP) are uncertain, as is the extent to which its role parallels that of CSPBP in An. gambiae . The orthologous nature of CSPBP and Drosophila UPF3 domain implicates a role in nonsense-mediated mRNA decay (NMD), providing a possible mechanism for the prevention of sporozoite invasion through the dysregulation of NMD and the disruption of homeostatic processes in the salivary glands[ 17 ]. This, in conjunction with CSPBP being expressed in regions outside of the salivary glands[ 16 ], could result in knockout having a detrimental effect on fitness, although there is currently insufficient evidence to support this possibility. In this study, we identified and knocked down the putative Ae. aegypti ortholog of CSPBP in P. gallinaceum -infected mosquitoes to assess its role in sporozoite invasion of the salivary glands. Additionally, we performed a dual knockdown of both SGS1 and AaCSPBP to evaluate whether combined suppression would lead to a more pronounced reduction in sporozoite abundance. Notably, the greatest decrease in salivary gland invasion was observed in mosquitoes with both genes silenced, suggesting a synergistic effect. These findings highlight the potential of targeting mosquito-parasite interactions through genetic engineering as a novel strategy to disrupt malaria transmission and underscore the importance of further molecular studies to identify key factors in this complex interface. Methods In silico Search and Analyses Using VectorBase (https://vectorbase.org/vectorbase/app)[18],the known protein sequence of An. gambiae CSPBP (AGAP006649) was used to run a BLASTP[19,20] search against the proteome of Ae. aegypti. The results were used to determine the possible orthologs of CSPBP in Ae. aegypti (AAEL003735). Results with an E-value of < 1e -10 were considered as signifying homology. A structural comparison of the AlphaFold-predicted three-dimensional structures[18,21,22] of AGAP006649 and AAEL003735 was performed using the distance matrix alignment (Dali) tool[23],which can be accessed through the server at http://ekhidna.biocenter.helsinki.fi/dali. The AlphaFold-predicted structures were retrieved from VectorBase and uploaded to the pairwise structure comparison tool on the Dali server. A superimposed picture of the proteins was generated, and the structural comparison tool was used to highlight areas of structural conservation between the structures. A Z-score above 2.4 was considered to be significant. A low Root Mean Square Deviation (RMSD) (< 3 Å) coupled with a significant Z-score indicates high overall fold similarity, while a significant Z-score with a high RMSD indicates more investigation into the aligned structures is necessary[24]. Mosquitoes Rearing The Ae. aegypti Higgs white-eyed strain[25]was used in all experiments. Rearing and infection procedures were performed according to Kojin et al., 2021[26].Briefly, the Ae. aegypti Higgs white-eyed strain was maintained in the insectary at the Institute of Biomedical Sciences II, University of São Paulo, Brazil, at a temperature of 27 ± 2 °C and a relative humidity of 80%, along with a 12-hour light:12-hour dark cycle. The food provided to the adult mosquitoes was a 10% sucrose solution, which was available ad libitum . Adult females had access to anesthetized mice for blood feeding and egg production, and larvae were fed on a solution of Tetramin ® and water. Mosquito Infection with Plasmodium gallinaceum To infect chickens, an aliquot of P. gallinaceum (strain 8A, obtained from A. Krettli, René Rachou Institute of Research, FIOCRUZ, MG, Brazil) infected blood was transfused into 7-day-old Gallus gallus chicks (Granja Kunitomo, Mogi Das Cruzes, Brazil). To verify that the chickens were sufficiently infected, a drop of blood was taken from the foot of each inoculated chicken, where it was further smeared with Giemsa and examined to determine parasitemia. Chickens deemed to be acceptable for blood feeding contained between 5-9% parasitemia. All infected chickens were exposed to both the control and experimental groups simultaneously. Five-to-seven-day-old female mosquitoes from both groups were deprived of the 10% sucrose solution for 16 hours and then allowed to feed on the infected chickens for 15 minutes until satiation. Exclusively fully engorged mosquitoes were used for the following experiments, where each group had three biological replicates. For work with chickens at the Universidade de São Paulo, work was approved by Comissão de Etica no Uso de Animais (CEUA-ICB/USP) (equivalent to the Institutional Animal Care and Use Committee (IACUC) in the United States); 188/2012 extended until 03/12/2020 and done in accordance with CEUA-ICB/USP regulations. Generation of double-stranded RNA and Gene Silencing Assays A 534bp fragment from the AaCSPBP gene (AAEL003735) was amplified using a primer designed using E-RNAi Webservice (www.dkfz.de/signaling/e-rnai3/idseq.php) that incorporates T7 minimum promoter sequence at its 5’ end. The primer sequences were as follows: AaCSPBP - forward 5’TAATACGACTCACTATAGGGAGAGGAAAAAGACACGGCTGGTA3’ and reverse 5’TAATACGACTCACTATAGGGAGAGGTACCTCTCCTGAAGCTTTCTT3’. eGFP was used as a control and was amplified using the following primers: T7-EGFP-FWD (5’TAATACGACTCACTATAGGGAGAGAACTGTTCACCGGAGTGGT3’) and T7-EGFP-REV (5’TAATACGACTCACTATAGGGAGATCACCAGGGTATCTCCTTCG3’). The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN), and double-stranded (ds) RNA was synthesized and cleaned using the MEGAscript T7 Transcription kit (Ambion) following the manufacturer’s protocol. The dsRNA for SGS1 was synthesized using the same methodology previously described for CSPBP. This approach, including primer design and in vitro transcription, followed the protocol published in [14], ensuring consistency and reproducibility across both gene targets. Four-day-old adult females were allowed to feed on P. gallinaceum -infected chickens, and after 6 days, infected females were injected in the thorax with 3 µg of dsAaCSPBP or dsGFP, and 2 days after double-stranded RNA injection (8 days after P. gallinaceum blood meal), the salivary gland or hemolymph of individual females was dissected, and the number of sporozoites was determined. For the dual AaCSPBP/SGS1 genes knockdown experiment, dsAaCSPBP or dsGFP was injected on the 6th day post-infected blood meal. The injected females were allowed to rest for 24 h, followed by a second injection with dsSGS1 or dsGFP, and the number of sporozoites was determined in the salivary gland or hemolymph in the same way as in the single dsRNA injection experiment. Figure 1 shows a schematic representation of the timeline for the experiments. mRNA Expression Analyses Reverse transcriptase PCR (RT-PCR) was performed using whole-body total RNA extracted from Ae. aegypti with TRIzol reagent (Invitrogen) and treated with DNase I (Invitrogen) to remove genomic DNA contamination. The amplification of diagnostic products was done using the OneStep RT-PCR kit (Qiagen) and primers. The reaction mixture was incubated at 50 o C for 30 min and 95 o C for 15 min. Amplification conditions were 94 o C for 1 min followed by 30 cycles of 94 o C for 1 min, 60 o C for 1 min, and 72 o C for 1 min, and a final step of 10 min at 72 o C. The primer sequences were as follows: for AaCSPBP, the forward primer used was: 5’AAGAACTTACGCCAGCTCCA3’, and the reverse was 5’GGACGATTTTTGTTGCGAAT3’. The forward actin primer used was: 5’GAGCGTGGCTACTCCTTCAC 3’ and the reverse was: 5’AGTTTCGTGGATACCGCAAG3’. Amplification products were visualized on a 1% agarose gel stained with ethidium bromide, and bands were observed under UV light using a gel documentation system to assess the size and specificity of the PCR products. Mosquito Hemolymph Extraction To quantify sporozoites in mosquito hemolymph, one set of legs was removed from a single cold anesthetized female, and 1–5 μL of PBS was intrathoracically injected from the opposite side. A small volume (0.4–1 μL) of diluted hemolymph was then collected from the leg stumps using a sterile pipette. Hemolymph from multiple mosquitoes was pooled until a total volume of 10 μL was obtained. The pooled sample was placed in a hemocytometer, and sporozoite counts were determined using phase-contrast microscopy. Hemolymph collection was performed 8 days after the infected blood meal, and sporozoite quantification was performed. Mosquito salivary gland extraction Adult females injected with dsAaCSPBP and/or dsSGS1, or dsGFP (negative control) were cold anesthetized, and their salivary gland pairs were individually dissected using forceps and a probe under a stereoscope equipped with bottom lighting to enhance gland visibility. Dissections were performed in a drop of 100 μL of Phosphate-Buffered Saline (PBS). Following dissection, each salivary gland pair was transferred to a fresh drop of PBS and gently rinsed to minimize tissue disruption while ensuring the removal of sporozoites adhering to the gland surface. The glands were then individually homogenized by pipetting up and down multiple times in PBS. Only intact salivary glands were used in the experiment. Sporozoite Quantification from Mosquito Salivary Glands and Hemolymph Immediately following dissection, the recovered hemolymph or isolated salivary glands were transferred to a hemocytometer chamber, where sporozoite counts were conducted under phase-contrast microscopy. This approach enabled direct visualization and quantification of sporozoites for consistent assessment of parasite load across experimental groups. Statistical analysis The D’Agostino-Pearson omnibus normality test was applied to assess whether sporozoite counts followed a normal distribution. Based on the results, either an unpaired t-test or a Mann–Whitney test was used to evaluate statistical differences between control and experimental groups. The percentage reduction in sporozoite numbers was calculated using the formula: 100 × [1 − (median parasite count in the experimental group / median parasite count in the control group)]. The Wilcoxon one-sample signed-rank test was applied to assess whether the median observed reduction in sporozoite count for the dual knockdown of AaCSPBP and SGS1 differed from the theoretical reduction determined by the Bliss model of independence. All tests were performed using GraphPad Prism (version 10.5.0 for Windows, GraphPad Software, La Jolla, USA, www.graphpad.com). Statistical significance is indicated in figures as follows: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****); ns denotes not significant. Results Gene transcript and protein structure of putative AaCSPBP. A Reciprocal BLASTP search was conducted against the whole genome of the Ae. aegypti Liverpool strain (AaegL3 assembly) to identify a putative ortholog. The protein alignment showed 42.77% similarity between the An. gambiae CSPBP gene sequence (AGAP006649) and the putative ortholog in Ae. aegypti (AAEL003735) over a 621 amino acid sequence, with an E-value of 5e − 113 , and a bit score of 355 (Fig. 2 A). No other matches were found in the Ae. aegypti genome for the protein sequence. The retrieved gene contains two coding exons, with a genomic sequence of 2,365 bp, including 5′ and 3′ untranslated regions, introns, and exons (Fig. 2 B). The corresponding transcript is 2,300 bp in length, and the predicted protein comprises 685 amino acid residues, as annotated in VectorBase.org. The three-dimensional protein structures for both Ae. aegypti and An. gambiae CSPBP predicted by AlphaFold were compared using the pairwise alignment tool on the Dali server, which returned a Z-score of 16.9 and RMSD of 36.0 Å. This indicates that while the structural similarities were very unlikely to occur randomly, at least some structurally similar regions occupied meaningfully different relative places in space. The structures were superimposed onto one another ( Fig. 3 A) to visualize the three-dimensional similarities. Superimposition revealed that the N-termini of the proteins occupied similar places in space, while the proteins were spatially distant beyond this region. A second image was generated to compare regions of structural conservation between the two proteins, where conserved areas were highlighted in blue on the three-dimensional prediction of AgCSPBP (Fig. 3 B). There was significant structural conservation at the N-termini, which was the region where AlphaFold was most confident in its prediction. The secondary structure that each amino acid inhabits in its respective protein was further aligned by residue to showcase regional similarity (Fig. 3 C). The percentage of amino acids occupying an identical secondary structure between the proteins was 32%. Amino acids in both proteins from residues 105 to 184 were structurally identical, with smaller regions of structural similarity throughout the proteins. This, in conjunction with the structural similarity in the three-dimensional models over this region, indicates potential functional similarity in the two proteins. AaCSPBP gene silencing is rapid in Aedes aegypti. To analyze the potential to silence AaCSPBP and how long this silence would last, RT-PCR was performed in pools of 5 females, and transcript presence was verified in samples prepared 2, 3, 4, 5, and 6 days after thoracic injections of dsRNA. We observed a significant decrease in AaCSPBP transcript levels in samples prepared 2 and 3 days post-injection, but the transcript levels were back to the same level as the control on the 4th day, as shown in Fig. 4 . For clarity, images of the agarose gels were cropped to highlight the relevant bands, and the full, uncropped images are provided in Supplementary Fig. S1 . The SGS1 knockdown was previously demonstrated in [ 14 ], where a significant reduction in transcript levels was observed on day 2 post-injection. Although mRNA levels began to recover by day 3, they remained below control levels, with full expression restored by day 4 14 . Together, these results highlighted a short period of knockdown and indicated the optimal window to perform gene knockdown injections in coordination with Plasmodium infection, as shown in Fig. 1 in the methods section. Knockdown of AaCSPBP lowers the number of sporozoites invading the salivary gland. To evaluate whether AaCSPBP plays a role in P. gallinaceum invasion of Ae. aegypti salivary glands, similar to the function reported for its ortholog in An. gambiae during P. berghei infection, dsRNA targeting AaCSPBP and GFP (as a control) was initially synthesized at a concentration of 1,500 ng/µL. These were intrathoracically injected into P. gallinaceum -infected Ae. aegypti females on the sixth day post-infection. Two days later, salivary glands were dissected, and sporozoite numbers were quantified. No significant difference was observed between the experimental and control groups using this initial concentration of dsRNA ( Supplementary Fig. S2 ). To enhance gene silencing efficacy, the experiment was adjusted and conducted using a doubled dsRNA concentration (3,000 ng/µL of dsAaCSPBP and dsGFP), following the same injection timeline. The experimental design (Fig. 1 ) was guided by the developmental timeline of P. gallinaceum in Ae. aegypti [ 27 ] and by the rapid silencing kinetics previously observed for AaCSPBP (Fig. 4 ). In this optimized experiment, the number of salivary gland-associated sporozoites in dsAaCSPBP-injected mosquitoes was reduced by 68%, 71%, and 33% across three independent replicates, yielding an average reduction of 62% (Fig. 5 ). Notably, in the replicate with the lowest reduction (33%), the parasitemia level in the infected chicken host was the highest, suggesting that a high parasite load may partially overcome the effects of AaCSPBP knockdown. To further investigate whether the reduced sporozoite invasion observed following AaCSPBP knockdown was due to a direct blocking effect rather than other factors, we quantified the number of sporozoites present in the hemolymph. These counts were performed using the same timeline as the salivary gland dissections, ensuring consistency with the window of parasite migration. Across three independent experiments, mosquitoes injected with dsAaCSPBP showed significantly higher numbers of sporozoites in the hemolymph, with 1.50-, 2.00-, and 3.83-, fold increases compared to the control group (Fig. 6 ). These findings suggest that silencing AaCSPBP impairs the ability of sporozoites to invade the salivary glands, resulting in their accumulation in the hemolymph. The raw sporozoite counts for each replicate are presented in Table 1 . Table 1 Summary of sporozoite load in hemolymph and fold increase following dsAaCSPBP knockdown Experiment Number of hemolymph sporozoites (n) Number of mosquitoes in the pool Chicken parasitemia Fold increase dsGFP dsAaCSPBP 1 100 200 10 6% 2.00 2 78 117 14 6% 1.50 3 300 1150 13 9% 3.83 Dual knockdown of AaCSPBP and SGS1 synergistically enhances the reduction of sporozoite invasion in Aedes aegypti salivary glands. We further proceeded to investigate if knocking down both AaCSPBP and SGS1 could potentially lead to an increase in the blocking effect of the sporozoite penetration in the salivary gland. This dual knockdown approach was designed to ensure that both AaCSPBP and SGS1 were effectively silenced at the time sporozoites began invading the salivary glands. The strategy also accounted for mosquito survival, as delivering the necessary concentrations of dsRNA required relatively high injection volumes. Through the optimization of the injection time and combination of the gene targets, we aimed to achieve robust knockdown of both genes without compromising female viability, thereby enabling a reliable assessment of their synergistic role in mediating sporozoite invasion. We observed a drastic reduction in the number of sporozoites in the salivary glands of P. gallinaceum -infected females following the dual knockdown of AaCSPBP and SGS1. Specifically, sporozoite counts were reduced by 93% in the first replicate, 92% in the second, and 92% in the third. Across the three replicates, the median number of salivary gland sporozoites showed a consistent 94% reduction, strongly indicating a synergistic effect of the dual knockdown on blocking sporozoite invasion. Discussion Over the past years, exorbitant time and effort have been dedicated to understanding the mechanisms involved in the Plasmodium sporozoite invasion of mosquito salivary glands. Despite this, the amount of insight we have regarding this process has remained relatively stagnant. While the field is aware that proteins like CSPBP and SGS1 are somehow involved in the invasion, their specific purpose in this pathway and their general role in mosquito biology remain uncertain. This lack of knowledge could serve as a barrier to a fully efficacious development of genetic control strategies for defense against malaria. This paper seeks to provide some much-needed insight into sporozoite salivary gland invasion, both through an investigation into the similarities of CSPBP proteins in different malaria vectors and the effects of CSPBP knockdown, both alone and with SGS1, in Ae. aegypti . Structural and sequence similarity can both independently function as strong indicators of shared protein function[ 28 , 29 ], as a high sequence similarity typically leads to a similar structure, and a similar structure typically results in similar function and interaction with the analogous downstream proteins involved in the biological process. However, some similar sequences lead to differing structures and functions, while others with dissimilar structures can have similar sequences and functions[ 30 , 31 ]. Therefore, we analyzed both the sequence and structure of CSPBP to guide the identification of its potential ortholog in Ae. aegypti . Given the E- and Z-scores returned by our analysis, the similarities between AaCSPBP and AgCSPBP in amino acid sequence, secondary structure, and predicted three-dimensional structure are unlikely to have arisen by chance and give us sufficient statistical evidence to infer orthology[ 28 , 32 ]. The region from residues 70 to 184 in both proteins is highly similar in secondary and three-dimensional structure. This residue region, as well as the others that were structurally similar between the two proteins, falls within the larger region that is likely involved in NMD, as indicated by InterPro[ 33 ] analysis. These other structurally similar regions had fewer residues with structural similarity and were much more distant from one another spatially, which provides an explanation for the unusually high RMSD. The similarity between P. gallinaceum and P. falciparum [ 34 ] and the fact that P. falciparum CSP binds to the N-terminus of AgCSPBP indicate the possibility that this highly similar region could be an important binding site for CSP across the CSPBP protein family. RT-PCR testing of the total RNA extracted from mosquitoes injected with dsAaCSPBP and dsSGS1 14 indicated that while a significant reduction in transcript levels was observed 2 and 3 days after injection, transcript levels returned to those of the control after 4 days. Therefore, the optimal window for injection of dsRNA for Plasmodium infections is the period from 6 to 7 days after infection. An injection any earlier than this period would be subject to transcript levels for the gene of interest returning to normal, with injections any later only stopping expression after salivary gland invasion has occurred. Injections of dsAaCSPBP and dsSGS1 had to be administered on sequential days, as delivering both on the same day caused overflow at the injection site and increased mosquito mortality. Previous knockdown of An. gambiae CSPBP was achieved through thoracic injection of 1000 ng/µL dsRNA 16 . In contrast, in our experiments with Ae. aegypti , 1500 ng/µL was insufficient, and a concentration of 3000 ng/µL was required to achieve knockdown. This reflects the higher dsRNA concentration necessary for CSPBP knockdown in Ae. aegypti , corroborating reports from other studies that have encountered similar challenges across mosquito species[ 14 , 35 ]. Compared to our control, the knockdown of AaCSPBP reduced salivary gland sporozoite concentration by an average of 62% across three replicates. Additionally, AaCSPBP knockdown mosquitoes had, on average, 2.44 times more sporozoites in their hemolymph than the control mosquitoes. The reduction in salivary sporozoite count supports the idea that AaCSPBP is involved specifically in salivary gland invasion, as the number of sporozoites in both tissues combined remains relatively constant between knockdown and control mosquitoes. In addition, since the dsRNA was injected after the release of sporozoites from the oocysts, the observed impact could not have resulted from interactions with earlier stages of the parasite's life cycle. If the mechanism of action involved killing, we would expect to observe an overall decrease in the total number of sporozoites. Furthermore, the limited period of knockdown and the excessive concentration necessary for silencing could mean that AaCSPBP expression was not fully prevented. As a result of these factors, we may have obtained a smaller percentage reduction than would be observed with the complete abolition of AaCSPBP. Furthermore, the knockdown of both AaCSPBP and SGS1 resulted in an even greater decrease in the number of sporozoites in the salivary gland, with an average of a 94% decrease across three replicates compared to the control. This combined trial could be subject to the same possible underestimation of percentage reduction as the trial with AaCSPBP silencing alone for the reasons identified above. Due to the high degree of reduction in the dual knockdown experiment, we questioned whether AaCSPBP and SGS1 function independently in mediating sporozoite invasion of the salivary glands. We used the equation defined in the methods section to determine the percentage reduction in sporozoite count for each mosquito in the experimental group for the AaCSPBP and SGS1 dual knockdown. By recontextualizing percentage reduction as the probability of sporozoite salivary gland entrance inhibition relative to the control, we can use the rules of probability to determine the expected reduction if the knockdowns were acting independently, using the equation: Expected Reduction = 100% - (1-X) *(1-Y) where 100% is the percentage of sporozoites present in the corresponding control mosquitoes, X is the observed average percentage reduction for AaCSPBP knockdown, and Y is the observed average percentage reduction for SGS1 knockdown. Essentially, this equation is using the probability of sporozoite entry for dsAaCSPBP mosquitoes relative to the control (1-X) and the probability of sporozoite entry for dsSGS1 mosquitoes relative to the control (1-Y) to determine the probability of sporozoite entry in a mosquito where both proteins are knocked down and function independently, as the probability of entry across the two independent events occurring can be determined by the equation P(A∩B) = P(A)P(B). Then, this probability is subtracted from 100% (the likelihood of control sporozoite entry relative to itself) to determine the expected probability of inhibition for the dual knockdown trial, otherwise known as the percentage reduction. This equation is algebraically identical to the Bliss independence model[ 36 ]. Using the average percent reduction for the AaCSPBP and SGS1 trials, the corresponding percent reductions were input into this equation, resulting in a theoretical percent reduction of 100% - (1-0.62) *(1-0.67)[ 14 ], or 87.46%. Taking the null hypothesis that there is no difference between the theoretical (independent) group and the observed group, we ran a Wilcoxon one-sample signed-rank test using the observed group and this theoretical percentage reduction. It was determined that the average reduction in the observed group was greater than that of the theoretical prediction, and that this difference was statistically significant (P = .0130). This means that we can reject the null hypothesis and conclude that the observed reduction is greater than the theoretical reduction. Since the theoretical reduction represents the independent functioning of AaCSPBP and SGS1 knockdown, and the observed reduction is greater than the theoretical reduction, we can conclude that the knockdowns are operating synergistically. What is causing this difference between the observed and theoretical groups? It could be the case that the efficacy of knockdown in the combined trial was simply greater than that of the independent trials. We don’t have evidence to suggest that this is the case, but the possibility cannot be excluded entirely. Perhaps AaCSPBP and SGS1 share some sort of overlapping function in the original process of invasion, and dual knockdown prevents the other protein from partially substituting for the other in said function. They could form a complex to permit sporozoite entry, where there is a greater than additive increase for additional binding. Regardless, if other factors are ruled out, they serve some synergistic role in sporozoite invasion. Despite this, the knockdown did not fully eliminate sporozoite invasion. If the knockdown was fully efficacious, then these results indicate that these synergistic proteins are not the only receptors involved in the invasion, which is consistent with current understanding in the field[ 17 ] Although CSPBP contains an NMD-associated domain, that doesn’t mean it functions strictly in decay. Domains can be repurposed, especially in complex interactions like host–parasite dynamics. Our finding, which is consistent with other malaria vectors, shows that CSPBP may act as a host cofactor or entry mediator at the salivary gland level, regardless of its original evolutionary function. This work supports the idea that SGS1 and AaCSPBP function synergistically in the process of P. gallinaceum sporozoite invasion of Ae. aegypti salivary glands. Future experiments that knock out the genes encoding these proteins will help elucidate whether the differences between the theoretical and observed effects of the dual knockdown are due solely to the synergistic interaction of SGS1 and AaCSPBP knockdown. They will also clarify whether these proteins have a greater impact on sporozoite invasion than was observed in this experiment. This work serves as a step forward in our understanding of sporozoite invasion and in producing effective genetic controls against malaria. Declarations Acknowledgements The graphical representation in Figure 1 was generated using Biorender.com. Financial support was provided by grants from the National Council for Scientific and Technological Development (CNPq, #555648/2009-5), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, #1497027), and startup funds from the University of Florida. The funders played no role in the design of the study and collection, analysis, and interpretation of data, and in writing the manuscript. Authors' contributions Conceived and designed the experiments: BB. Performed the experiments: AM, HC, BB. Analyzed the data: AM, BB. Contributed reagents/materials/analysis tools: BB, MC; Wrote the paper: AM, BB. All authors reviewed and approved the manuscript. Data availability statement All data generated or analyzed during this study are included in this published article (and its Supplementary Information files). Competing interest statement The authors declare no competing interests. References World Health Organization. Vector-borne diseases. World Health Organization (2024). Available at: https://www.who.int/news-room/fact-sheets/detail/vector-borne-diseases. World Health Organization. World Malaria Report 2024: Addressing Inequity in the Global Malaria Response . (2024). Colón-González, F. J. et al. Projecting the risk of mosquito-borne diseases in a warmer and more populated world: a multi-model, multi-scenario intercomparison modelling study. Lancet Planet Health 5 , e404–e414 (2021). https://doi.org/10.1016/S2542-5196(21)00132-7 Chatterjee, D. & Cockburn, I. A. The challenges of a circumsporozoite protein-based malaria vaccine. Expert Rev Vaccines 20 , 113–125 (2021). https://doi.org/10.1080/14760584.2021.1874924 Pryce, J., Richardson, M. & Lengeler, C. Insecticide-treated nets for preventing malaria. Cochrane Database Syst Rev 2018 , CD000363 (2018). https://doi.org/10.1002/14651858.CD000363.pub3 Cui, L., Mharakurwa, S., Ndiaye, D., Rathod, P. K. & Rosenthal, P. J. Antimalarial drug resistance: literature review and activities and findings of the ICEMR network. Am J Trop Med Hyg 93 , 57–68 (2015). https://doi.org/10.4269/ajtmh.15-0007 Bier, E. Gene drives gaining speed. Nat Rev Genet 23 , 5–22 (2022). https://doi.org/10.1038/s41576-021-00386-0 Aly, A. S. I., Vaughan, A. M. & Kappe, S. H. I. Malaria parasite development in the mosquito and infection of the mammalian host. Annu Rev Microbiol 63 , 195–221 (2009). https://doi.org/10.1146/annurev.micro.091208.073403 Kaslow, D. C., Syin, C., McCutchan, T. F. & Miller, L. H. Comparison of the primary structure of the 25 kDa ookinete surface antigens of Plasmodium falciparum and Plasmodium gallinaceum reveal six conserved regions. Mol Biochem Parasitol 33 , 283–287 (1989). https://doi.org/10.1016/0166-6851(89)90090-x Silva, A. F. et al. Antiplasmodial activity study of angiotensin II via Ala scan analogs. J Pept Sci 20 , 640–648 (2014). https://doi.org/10.1002/psc.2641 Guttery, D. S., Zeeshan, M., Ferguson, D. J. P., Holder, A. A. & Tewari, R. Division and transmission: malaria parasite development in the mosquito. Annu Rev Microbiol 76 , 113–134 (2022). https://doi.org/10.1146/annurev-micro-041320-010046 Korochkina, S. et al. A mosquito-specific protein family includes candidate receptors for malaria sporozoite invasion of salivary glands. Cell Microbiol 8 , 163–175 (2006). https://doi.org/10.1111/j.1462-5822.2005.00611.x Orlandi-Pradines, E. et al. Antibody response against saliva antigens of Anopheles gambiae and Aedes aegypti in travellers in tropical Africa. Microbes Infect 9 , 1454–1462 (2007). https://doi.org/10.1016/j.micinf.2007.07.012 Kojin, B. B. et al. Aedes aegypti SGS1 is critical for Plasmodium gallinaceum infection of both the mosquito midgut and salivary glands. Malar J 20 , 11 (2021). https://doi.org/10.1186/s12936-020-03537-6 Ghosh, A. K. & Jacobs-Lorena, M. Plasmodium sporozoite invasion of the mosquito salivary gland. Curr Opin Microbiol 12 , 394–400 (2009). Wang, J. et al. Anopheles gambiae Circumsporozoite Protein–Binding Protein facilitates Plasmodium infection of mosquito salivary glands. J Infect Dis 208 , 1161–1169 (2013). https://doi.org/10.1093/infdis/jit284 Kojin, B. B. & Adelman, Z. N. The sporozoite’s journey through the mosquito: a critical examination of host and parasite factors required for salivary gland invasion. Front Ecol Evol 7 , 1–13 (2019). https://doi.org/10.3389/fevo.2019.00284 Giraldo-Calderón, G. I. et al. VectorBase.org updates: bioinformatic resources for invertebrate vectors of human pathogens and related organisms. Curr Opin Insect Sci 50 , 100860 (2022). https://doi.org/10.1016/j.cois.2021.11.008 Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J Mol Biol 215 , 403–410 (1990). https://doi.org/10.1016/S0022-2836(05)80360-2 Altschul, S. et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25 , 3389–3402 (1997). https://doi.org/10.1093/nar/25.17.3389 Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596 , 583–589 (2021). https://doi.org/10.1038/s41586-021-03819-2 Varadi, M. et al. AlphaFold Protein Structure Database: massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res 50 , D439–D444 (2022). https://doi.org/10.1093/nar/gkab1061 Holm, L., Laiho, A., Törönen, P. & Salgado, M. DALI shines a light on remote homologs: one hundred discoveries. Protein Sci 32 , 1–16 (2023). https://doi.org/10.1002/pro.4519 Holm, L., Kääriäinen, S., Wilton, C. & Plewczynski, D. Using Dali for structural comparison of proteins. Curr Protoc Bioinform 14 , 1–14 (2006). https://doi.org/10.1002/0471250953.bi0505s14 Higgs, S. et al. Green fluorescent protein expressed in living mosquitoes—without the requirement of transformation. Biotechniques 21 , 660–666 (1996). https://doi.org/10.2144/96214st03 Kojin, B. B. et al. Endogenously-expressed NH2-terminus of circumsporozoite protein interferes with sporozoite invasion of mosquito salivary glands. Malar J 15 , 153 (2016). https://doi.org/10.1186/s12936-016-1207-8 Araujo, R. V., Maciel, C., Hartfelder, K. & Capurro, M. L. Effects of Plasmodium gallinaceum on hemolymph physiology of Aedes aegypti during parasite development. J Insect Physiol 57 , 265–273 (2011). https://doi.org/10.1016/j.jinsphys.2010.11.016 Louie, B., Higdon, R. & Kolker, E. A statistical model of protein sequence similarity and function similarity reveals overly-specific function predictions. PLoS ONE 4 , e7546 (2009). https://doi.org/10.1371/journal.pone.0007546 Krissinel, E. On the relationship between sequence and structure similarities in proteomics. Bioinformatics 23 , 717–723 (2007). https://doi.org/10.1093/bioinformatics/btm006 Kosloff, M. & Kolodny, R. Sequence-similar, structure-dissimilar protein pairs in the PDB. Proteins 71 , 891–902 (2008). https://doi.org/10.1002/prot.21770 Williams, S. G. & Lovell, S. C. The effect of sequence evolution on protein structural divergence. Mol. Biol. Evol. 26 , 1055–1065 (2009). https://doi.org/10.1093/molbev/msp020 Holm, L. DALI and the persistence of protein shape. Protein Sci. 29 , 128–140 (2020). https://doi.org/10.1002/pro.3749 Blum, M. et al. InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res. 53 , D444–D456 (2025). https://doi.org/10.1093/nar/gkae1082 Lauron, E. J., Aw Yeang, H. X., Taffner, S. M. & Sehgal, R. N. M. De novo assembly and transcriptome analysis of Plasmodium gallinaceum identifies the Rh5 interacting protein (ripr), and reveals a lack of EBL and RH gene family diversification. Malar. J. 14 , 296 (2015). https://doi.org/10.1186/s12936-015-0814-0 Boisson, B. et al. Gene silencing in mosquito salivary glands by RNAi. FEBS Lett. 580 , 1988–1992 (2006). https://doi.org/10.1016/j.febslet.2006.02.069 Demidenko, E. & Miller, T. W. Statistical determination of synergy based on Bliss definition of drugs independence. PLoS ONE 14 , e0224137 (2019). https://doi.org/10.1371/journal.pone.0224137 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigS1.jpg Supplementary Fig. S1. Original uncropped version of Figure 4. DNA fragments were separated on a 1% agarose gel, stained with ethidium bromide, and visualized under UV illumination. The 1 kb Plus DNA Ladder (Invitrogen) was used as a molecular weight marker, with arrows indicating the approximate base pair (bp) positions relative to the amplification product. Lanes marked with an ‘X’ covered samples unrelated to this study. SupplementaryFigS2.jpg Supplementary Fig S2. Sporozoite load in Aedes aegypti salivary glands after thoracic injection of 1500ng of AaCSPBP or GFP dsRNA. Aedes aegypti mosquitoes were infected with Plasmodium gallinaceum and subsequently injected with 1500 ng of either dsAaCSPBP or control dsGFP. Salivary glands were dissected 8 days post-infection, and sporozoite numbers were quantified. The sporozoite load in dsAaCSPBP-injected mosquitoes was compared to that of dsGFP-injected controls. ns indicates the difference was not statistically significant. Cite Share Download PDF Status: Published Journal Publication published 03 Apr, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 12 Nov, 2025 Reviews received at journal 06 Nov, 2025 Reviews received at journal 22 Oct, 2025 Reviewers agreed at journal 12 Oct, 2025 Reviewers agreed at journal 10 Oct, 2025 Reviewers agreed at journal 10 Oct, 2025 Reviewers agreed at journal 10 Oct, 2025 Reviewers invited by journal 10 Oct, 2025 Editor assigned by journal 10 Oct, 2025 Editor invited by journal 11 Sep, 2025 Submission checks completed at journal 10 Sep, 2025 First submitted to journal 10 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7530159","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":533602413,"identity":"00946fc8-af06-4d45-8240-7a932e2fd16a","order_by":0,"name":"Alec Morvay","email":"","orcid":"","institution":"University of Florida","correspondingAuthor":false,"prefix":"","firstName":"Alec","middleName":"","lastName":"Morvay","suffix":""},{"id":533602415,"identity":"ca26eab7-6326-476b-b2b6-f59183fa53e8","order_by":1,"name":"Helena R. C. Araújo","email":"","orcid":"","institution":"Instituto de Pesquisas Tecnológicas","correspondingAuthor":false,"prefix":"","firstName":"Helena","middleName":"R. C.","lastName":"Araújo","suffix":""},{"id":533602417,"identity":"a6fb7b3e-93f2-46b0-9d54-9bf48f99ca85","order_by":2,"name":"Margareth L. Capurro","email":"","orcid":"","institution":"Universidade de São Paulo","correspondingAuthor":false,"prefix":"","firstName":"Margareth","middleName":"L.","lastName":"Capurro","suffix":""},{"id":533602419,"identity":"2df48432-3195-4dd6-87f2-a2fa8d20eb24","order_by":3,"name":"Bianca Correa Burini","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIie3PuwrCMBSA4VMK6XKga0pFXyFSSC3U13HSSejkUCjExcvqa7g4Wwp1c3YUBCcHJ+kgYmszOKUdBfMvSeB8JAHQ6X4wZsoVII3hDt1OfWhLjA142Ey+VxPbEN8yr+diBp5tZOIyFAzBSnZURYKE+P1FDtyJ07k3qQjmkZKwDLgLBEK2T4U7EU8EOuYNxHq48JIkqG7p3ZoIctcQwD/EqAhFNQkSjJzlinrlX4SzODIkOJoOVMS3DztaPML+mh6utIhY17ay7UlFZOVL6L7ekhbjMjtuP6vT6XT/1Rv63D33adnrcwAAAABJRU5ErkJggg==","orcid":"","institution":"University of Florida","correspondingAuthor":true,"prefix":"","firstName":"Bianca","middleName":"Correa","lastName":"Burini","suffix":""}],"badges":[],"createdAt":"2025-09-03 20:38:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7530159/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7530159/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-46444-7","type":"published","date":"2026-04-03T15:59:42+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94364583,"identity":"7ca62c9c-02bb-4fd9-bf09-5081b774d757","added_by":"auto","created_at":"2025-10-27 13:07:13","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2124632,"visible":true,"origin":"","legend":"","description":"","filename":"Morvayetal2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/c03b57cdc8bb9a70feb103c4.docx"},{"id":94364845,"identity":"c7d37f1b-7e08-45ab-89f9-48cd698c1a8e","added_by":"auto","created_at":"2025-10-27 13:07:47","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6285,"visible":true,"origin":"","legend":"","description":"","filename":"f3c8260633cd4e59a068c06f8b5fe2d0.json","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/18c208ba0b8466334b9c566b.json"},{"id":94365026,"identity":"c90564c7-8a1a-4157-b3dd-5a3cc77ab64d","added_by":"auto","created_at":"2025-10-27 13:08:05","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":308936,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/fb5ce2706b021151248d33f8.jpg"},{"id":94365050,"identity":"4da939a4-3c16-48d0-b713-dc25b620bc50","added_by":"auto","created_at":"2025-10-27 13:08:11","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":67474,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/bfb74f930c1a8d77d29c30fa.jpg"},{"id":94364821,"identity":"d781d698-69db-4442-95bb-85759abbf50a","added_by":"auto","created_at":"2025-10-27 13:07:46","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124027,"visible":true,"origin":"","legend":"","description":"","filename":"f3c8260633cd4e59a068c06f8b5fe2d01enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/465a7eb16fe30dd823800cc3.xml"},{"id":94365057,"identity":"c4c2b534-e09b-47d9-a6f6-7ea81bf4e4b5","added_by":"auto","created_at":"2025-10-27 13:08:12","extension":"eps","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":186395,"visible":true,"origin":"","legend":"","description":"","filename":"drawingimage1.eps","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/64ae233b247763e7069e73b3.eps"},{"id":94365005,"identity":"21dcc5bf-7059-4de0-882c-07350e588740","added_by":"auto","created_at":"2025-10-27 13:08:03","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":581137,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/32e65b964c03dd2def088544.jpeg"},{"id":94365147,"identity":"2bc720ac-63e2-4a84-b7cc-bce001d9e0e0","added_by":"auto","created_at":"2025-10-27 13:08:20","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1328752,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/09c6c26d41e971d1fe6e5729.jpeg"},{"id":94364751,"identity":"5c156fd6-a4ce-4b77-8398-3bd3a3bac902","added_by":"auto","created_at":"2025-10-27 13:07:38","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":774414,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/f079cf51c59981bd746c0fe7.jpeg"},{"id":94364750,"identity":"3bd99724-60d9-4b38-a948-35f2abb3ada4","added_by":"auto","created_at":"2025-10-27 13:07:38","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":236006,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/58c817bd94fa69e5cbb2b83e.jpeg"},{"id":94365042,"identity":"6cc13b9b-a407-4947-ada9-1d80891dba2c","added_by":"auto","created_at":"2025-10-27 13:08:08","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":199630,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/9489fe21767a44d6552a992b.jpeg"},{"id":94365151,"identity":"aee300de-219c-446b-b244-e01438afa0c7","added_by":"auto","created_at":"2025-10-27 13:08:21","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/c627564a386421fa0428d5e6.jpeg"},{"id":94365001,"identity":"175be401-3b9e-4718-b281-8e9dd000fa44","added_by":"auto","created_at":"2025-10-27 13:08:03","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":384015,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/f472da3f6bf3076c64bc16ba.jpeg"},{"id":94364814,"identity":"a932178e-a0a6-4cc5-8882-7ae796e31e97","added_by":"auto","created_at":"2025-10-27 13:07:45","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101879,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/e4dcff32a40e2fa369958010.jpeg"},{"id":94365030,"identity":"6fa29a0e-f0c7-4475-b8d9-74ea0c563480","added_by":"auto","created_at":"2025-10-27 13:08:06","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":375730,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/38294c0c794a634fee4bebe3.jpeg"},{"id":94365160,"identity":"bfb135ea-7833-414a-a43f-fb699a0678ab","added_by":"auto","created_at":"2025-10-27 13:08:22","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12400,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/9127ff8240cc3255a9848964.jpeg"},{"id":94365104,"identity":"ed589c6c-a374-4a8a-a4c8-3c5e232a59a9","added_by":"auto","created_at":"2025-10-27 13:08:18","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":131735,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/54067495dfa77283ac87e8c9.png"},{"id":94364860,"identity":"a47943c5-6ac2-4ba2-b9f1-cc26dc9876a2","added_by":"auto","created_at":"2025-10-27 13:07:49","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":261123,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/82578ca5156442ebb0154028.png"},{"id":94364594,"identity":"6a95a37e-b2d5-46a5-9478-9fb887b87c26","added_by":"auto","created_at":"2025-10-27 13:07:14","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156139,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/5bd63dfdee48197bf848c9a3.png"},{"id":94365029,"identity":"20dec5e0-4e00-4098-9254-44d9d2211b99","added_by":"auto","created_at":"2025-10-27 13:08:06","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53419,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/fe25076b7b15d164f8b9203e.png"},{"id":94364693,"identity":"3746d64f-7b6c-44f6-9914-7b2c5a42f28e","added_by":"auto","created_at":"2025-10-27 13:07:25","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":75492,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/e7e3329b989009bf4382eedb.png"},{"id":94364745,"identity":"96e4abe7-6bf4-4502-aba4-7e1f883f93f1","added_by":"auto","created_at":"2025-10-27 13:07:36","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/ed4a329423382c48f0fb6615.png"},{"id":94364911,"identity":"d04c4cb3-377e-4142-b6d9-345f96154ea7","added_by":"auto","created_at":"2025-10-27 13:07:56","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59931,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/1f3b822efb4fda89aa19b4b7.png"},{"id":94364696,"identity":"045f0a04-90c4-4e1e-8acc-d0d7e6862e12","added_by":"auto","created_at":"2025-10-27 13:07:25","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14519,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/6711de20f3296f5dd6536349.png"},{"id":94364851,"identity":"12a7f6bf-edb7-4fd3-870c-da3fac8bbd01","added_by":"auto","created_at":"2025-10-27 13:07:48","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59684,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/c63562fa7d0a3b50b1a0c020.png"},{"id":94364747,"identity":"8599c0f0-9ade-4315-92b0-15f1f63a96e8","added_by":"auto","created_at":"2025-10-27 13:07:37","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4684,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/d8ed16ae344c4ce104a06f11.png"},{"id":94365105,"identity":"642955a4-48f0-4401-9ac0-c32ea59101e5","added_by":"auto","created_at":"2025-10-27 13:08:18","extension":"xml","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122544,"visible":true,"origin":"","legend":"","description":"","filename":"f3c8260633cd4e59a068c06f8b5fe2d01structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/5a5493a1c7023eb489118e1e.xml"},{"id":94365034,"identity":"897ff617-7f75-4847-8dd6-df9660d950a9","added_by":"auto","created_at":"2025-10-27 13:08:07","extension":"html","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138734,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/25d284ac6fc3f49f2545e633.html"},{"id":94364739,"identity":"1eef2a69-d9c3-4cfe-939a-443fd0c8398f","added_by":"auto","created_at":"2025-10-27 13:07:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":238479,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of the experimental timeline for single and dual knockdown assays targeting AaCSPBP, SGS1, or both genes simultaneously.\u003c/strong\u003e\u003cbr\u003e\n \u003cem\u003eAedes aegypti\u003c/em\u003e females were fed a \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e-infected blood meal. For single knockdown, six days post-infection, females were injected in the thorax with either dsAaCSPBP or dsGFP (negative control). Two days after injection (i.e., 8 days post-infected blood meal), salivary glands or hemolymph from females were dissected or extracted, and the number of sporozoites was quantified. For the double knockdown experiment (dsAaCSPBP/dsSGS1), females were first injected with dsAaCSPBP or dsGFP on day 6 post-infection, allowed to rest for 24 hours, and then injected a second time with dsSGS1 or dsGFP. Sporozoite numbers in the salivary gland were determined on day 8 using the same procedure as for the single knockdown experiments.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/ebfcf78804750fb6ecde2049.png"},{"id":94365048,"identity":"9f4ef4b6-28d0-4cd2-9816-35cfbc7b1916","added_by":"auto","created_at":"2025-10-27 13:08:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":567014,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProtein alignment and gene structure of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAedes aegypti\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e CSPBP ortholog.\u003c/strong\u003e (\u003cstrong\u003eA)\u003c/strong\u003e Protein sequence alignment between \u003cem\u003eAnopheles gambiae\u003c/em\u003e CSPBP (AGAP006649) and its putative \u003cem\u003eAedes aegypti\u003c/em\u003e ortholog (AAEL003735), with asterisks highlighting conserved regions, and results from BLASTP analysis (VectorBase), including gene ID, bit score, and E-value. (\u003cstrong\u003eB)\u003c/strong\u003e Schematic representation of the \u003cem\u003eAe. aegypti\u003c/em\u003eCSPBP gene structure. Blue boxes indicate the two coding exons, orange boxes represent the 5′ and 3′ untranslated regions (UTRs), and the orange line denotes the intron.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/a943980463d5123b3a93eb6b.png"},{"id":94365158,"identity":"cca3d18c-bc27-4a95-8c85-b4e5d7fab805","added_by":"auto","created_at":"2025-10-27 13:08:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":327158,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStructural comparison of the putative \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAedes aegypti\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnopheles gambiae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eCSPBP.\u003c/strong\u003e (\u003cstrong\u003eA)\u003c/strong\u003eAn image of protein AgCSPBP (green) with protein AaCSPBP (orange) superimposed onto it. (\u003cstrong\u003eB\u003c/strong\u003e) The protein produced by AGAP006649, where blue-highlighted areas indicate structural conservation, and green areas indicate structural divergence. (\u003cstrong\u003eC)\u003c/strong\u003e A comparison of the secondary structures of AgCSPBP and AaCSPBP, where each letter indicates what secondary structure the amino acid in said position belongs to. Helices are indicated by H, strands by E, and coils by L. Hyphens indicate inserted segments relative to AaCSPBP, and the inserted segments relative to AgCSPBP are not displayed. Highlighted in yellow are the regions of overlapping secondary structure between the proteins.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/60a9c76c59b065a77744713f.png"},{"id":94365040,"identity":"04b28ad5-1416-46f4-8fa4-51fc7d344680","added_by":"auto","created_at":"2025-10-27 13:08:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":100483,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDownregulation of the AaCSPBP in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAedes aegypti\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e by thoracic injection of double-stranded RNA.\u003c/strong\u003eTotal RNA was extracted from pools of 5 females at 2, 3, 4, 5, 6 days post-injection (dpi) of dsGFP or dsAaCSPBP, and used in an RT-PCR reaction with specific primers for the AaCSPBP sequence. The same RNA samples were also analyzed by actin-specific primers. The amplicons were visualized on a 1% agarose gel stained with ethidium bromide under UV illumination, and the displayed images are cropped images of the agarose gel.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/ab9e1abf0a9e1a4d3fbaa290.png"},{"id":94365051,"identity":"e939d92e-cc5f-4d56-b246-074665658715","added_by":"auto","created_at":"2025-10-27 13:08:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":140124,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSingle knockdown of AaCSPBP reduces \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePlasmodium gallinaceum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sporozoite numbers in the salivary glands of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAedes aegypti\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003cem\u003eAe. aegypti \u003c/em\u003emosquitoes injected with dsAaCSPBP or dsGFP infected with \u003cem\u003eP. gallinaceum\u003c/em\u003e had their salivary glands dissected 8 days post-infection. The number of sporozoites contained in the salivary glands of dsAaCSPBP-injected mosquitoes was compared to the number in dsGFP-injected mosquitoes in three independent replicates. Median was used as the measure of average due to the data following a non-normal distribution.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/a8815d410f4d5e27435d4706.png"},{"id":94364906,"identity":"1adeefa1-b7a6-4c0c-8962-945627298120","added_by":"auto","created_at":"2025-10-27 13:07:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":8904,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of dsAaCSPBP knockdown on sporozoite abundance in the hemolymph. \u003c/strong\u003e\u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e-infected \u003cem\u003eAedes aegypti \u003c/em\u003emosquitoes injected with dsAaCSPBP or dsGFP had their hemolymph dissected 8 days post-infection. The number of sporozoites contained in the hemolymph of dsAaCSPBP-injected mosquitoes was compared to the number in dsGFP-injected mosquitoes in three independent replicates. A 2.00-, 1.50-, and 3.83-fold increase in the number of sporozoites contained in the hemolymph was observed for dsAaCSPBP-injected mosquitoes for each trial, respectively.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/ce81b1151ffb015c6c1383dc.png"},{"id":94365156,"identity":"1b7c6614-4b25-43e9-bc9c-c2979145b830","added_by":"auto","created_at":"2025-10-27 13:08:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":146874,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDual knockdown of AaCSPBP and SGS1 drastically reduces \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePlasmodium gallinaceum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sporozoite invasion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAedes aegypti\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e salivary glands, indicating they act synergistically. \u003c/strong\u003e\u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e-infected\u003cem\u003e Aedes aegypti\u003c/em\u003emosquitoes injected with dsAaCSPBP together with dsSGS1 or dsGFP (control) had their salivary glands dissected 8 days post-infection. The number of sporozoites contained in the salivary glands of dsAaCSPBP/dsSGS1-injected mosquitoes was compared to the number in dsGFP-injected mosquitoes in three independent replicates. Median was used as a measure of average due to the data following a non-normal distribution.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/d19640d84786c8eb5ce98433.png"},{"id":106344075,"identity":"01a943ef-770d-401e-aca1-c709cf7bf9d7","added_by":"auto","created_at":"2026-04-07 16:12:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2565146,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/7289f0ec-2556-4e5f-86f9-25912f991d69.pdf"},{"id":94364907,"identity":"0e8f6cb4-30b9-4cf7-8540-580d422d0ca5","added_by":"auto","created_at":"2025-10-27 13:07:55","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":308936,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Fig. S1. Original uncropped version of Figure 4\u003c/strong\u003e. DNA fragments were separated on a 1% agarose gel, stained with ethidium bromide, and visualized under UV illumination. The 1 kb Plus DNA Ladder (Invitrogen) was used as a molecular weight marker, with arrows indicating the approximate base pair (bp) positions relative to the amplification product. Lanes marked with an ‘X’ covered samples unrelated to this study.\u003c/p\u003e","description":"","filename":"SupplementaryFigS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/848b69c40f7d97aacce20d1e.jpg"},{"id":94489515,"identity":"8764d595-279f-4fd3-9191-b8d6a087479e","added_by":"auto","created_at":"2025-10-27 17:04:59","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":67474,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Fig S2. Sporozoite load in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAedes aegypti\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e salivary glands after thoracic injection of 1500ng of AaCSPBP or GFP dsRNA.\u003c/strong\u003e \u003cem\u003eAedes aegypti\u003c/em\u003e mosquitoes were infected with \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e and subsequently injected with 1500 ng of either dsAaCSPBP or control dsGFP. Salivary glands were dissected 8 days post-infection, and sporozoite numbers were quantified. The sporozoite load in dsAaCSPBP-injected mosquitoes was compared to that of dsGFP-injected controls. ns indicates the difference was not statistically significant.\u003c/p\u003e","description":"","filename":"SupplementaryFigS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7530159/v1/8c047c720a979eac7a989115.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Synergistic Role of CSPBP and SGS1 in Sporozoite Entry into Aedes aegypti Salivary Glands","fulltext":[{"header":"Background","content":"\u003cp\u003eAccounting for 17% of all infectious diseases and more than 700,000 deaths annually, vector-borne diseases are a significant detriment to human health[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Mosquitoes are perhaps the most dangerous vector, transmitting viruses and parasites, including but not limited to malaria, dengue, yellow fever, and Zika[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Of these pathogens, malaria is undeniably the deadliest, accounting for 597,000 deaths in 2023 alone[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The global incidence rate stayed relatively stable between 2015 and 2022 after dropping between 2000 and 2015, but slightly increased in 2023, indicating the ever-growing complications with current forms of disease control[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Malaria prevention will become increasingly difficult due to the effects of climate change[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], the challenges associated with current malaria vaccines[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], the growing mosquito resistance to insecticides[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], and anti-malarial drug resistance in parasites[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Given these challenges, an investigation into other forms of vector control is imperative.\u003c/p\u003e\u003cp\u003eWhile current approaches have certainly mitigated the mortality of malaria, they are far from eliminating its effects. Current vaccines are somewhat efficacious, but their immunity is short-lived, and they do not provide sufficient defense against the disease in endemic areas[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Additionally, while chemical suppression of mosquito populations and antimalarial drugs targeting \u003cem\u003ePlasmodium\u003c/em\u003e have contributed to malaria control, both approaches have also led to the development of resistance in mosquitoes and parasites, respectively[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Population replacement, through genetic control, is an alternative intervention that seeks to propagate mosquitoes that are refractory to malaria by coupling genes that inhibit transmission with gene drives (genetic elements with \u0026gt;\u0026thinsp;50% inheritance)[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. If mosquitoes are developed through genetic intervention that are incapable of malaria transmission and have minimal fitness impact, population replacement could serve to eradicate the transmission of malaria altogether. A thorough understanding of mosquito-parasite interactions is imperative to genetic control design, and thus to human health worldwide.\u003c/p\u003e\u003cp\u003eThe parasite responsible for avian malaria, \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e, shares many structural and developmental characteristics with the human strain \u003cem\u003ePlasmodium falciparum\u003c/em\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] and is therefore a suitable laboratory model for understanding parasitic propagation and migration throughout the mosquito[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The \u003cem\u003ePlasmodium\u003c/em\u003e parasites begin their life cycles through the ingestion of their gametocytes by a female mosquito, which acquires them via an infected blood meal[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In the midgut lumen, gametogenesis (the development of gametocytes into male and female gametes) is triggered after a pH increase, temperature decrease, and the presence of xanthurenic acid[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Male gametes then fertilize female gametes, resulting in the development of a zygote. The differentiation of the zygote sparks its conversion into an ookinete (a motile, elongated cell capable of tissue invasion), which penetrates and crosses the midgut epithelium, entering a sessile state attached to the midgut wall where it becomes an oocyst[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Oocysts then develop and release sporozoites into the hemolymph, which must enter the salivary glands to transmit the parasite to other organisms the next time blood feeding occurs[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWhile there is limited knowledge regarding the specific interactions undergone by mosquito protein receptors during sporozoite invasion of the salivary gland, a few molecules have been identified that seemingly play an important role in this process. Salivary gland surface protein 1 (SGS1) in \u003cem\u003eAedes aegypti\u003c/em\u003e is one of these compounds, occupying regions associated with sporozoite salivary gland invasion and inducing an immune response in mosquitoes after secretion into their saliva[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Furthermore, the introduction of anti-SGS1 immunoglobulin in \u003cem\u003eP. gallinaceum\u003c/em\u003e-infected \u003cem\u003eAe. aegypti\u003c/em\u003e before the burst of oocysts substantially decreased salivary sporozoite numbers[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], and the knockdown and knockout of SGS1 have been shown to significantly reduce the number of sporozoites in infected salivary glands by 67% and 64% respectively[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. There is additional evidence that SGS1 has a subsequent purpose in the \u003cem\u003ePlasmodium\u003c/em\u003e life cycle, with its knockout reducing oocyst development in the midgut[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Little is known of SGS1\u0026rsquo;s function outside of parasitic development, but preliminary investigation shows no statistically significant difference in fitness between SGS1 knockout and control mosquitoes[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Possibly functioning in addition to SGS1 is the circumsporozoite protein-binding protein (CSPBP). CSPBP is the associated receptor of the circumsporozoite protein (CSP), the most abundant surface protein in the \u003cem\u003ePlasmodium\u003c/em\u003e parasite. CSP has long been known as essential for sporozoite invasion of the salivary glands, and its knockout in \u003cem\u003ePlasmodium berghei\u003c/em\u003e has been shown to significantly inhibit sporozoite production[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Subsequently, CSPBP antibodies have been shown to reduce sporozoite abundance by 25% and 90% in \u003cem\u003eP. berghei-\u003c/em\u003einfected \u003cem\u003eAnopheles gambiae\u003c/em\u003e after 14 and 18 days, respectively, with CSPBP knockdown preventing 75% of sporozoites in the hemolymph from entering the salivary glands of an infected mosquito[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The effects resulting from the suppression of the orthologous protein to CSPBP in \u003cem\u003eAe. aegypti\u003c/em\u003e (AaCSPBP) are uncertain, as is the extent to which its role parallels that of CSPBP in \u003cem\u003eAn. gambiae\u003c/em\u003e. The orthologous nature of CSPBP and \u003cem\u003eDrosophila\u003c/em\u003e UPF3 domain implicates a role in nonsense-mediated mRNA decay (NMD), providing a possible mechanism for the prevention of sporozoite invasion through the dysregulation of NMD and the disruption of homeostatic processes in the salivary glands[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This, in conjunction with CSPBP being expressed in regions outside of the salivary glands[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], could result in knockout having a detrimental effect on fitness, although there is currently insufficient evidence to support this possibility.\u003c/p\u003e\u003cp\u003eIn this study, we identified and knocked down the putative \u003cem\u003eAe. aegypti\u003c/em\u003e ortholog of CSPBP in \u003cem\u003eP. gallinaceum\u003c/em\u003e-infected mosquitoes to assess its role in sporozoite invasion of the salivary glands. Additionally, we performed a dual knockdown of both SGS1 and AaCSPBP to evaluate whether combined suppression would lead to a more pronounced reduction in sporozoite abundance. Notably, the greatest decrease in salivary gland invasion was observed in mosquitoes with both genes silenced, suggesting a synergistic effect. These findings highlight the potential of targeting mosquito-parasite interactions through genetic engineering as a novel strategy to disrupt malaria transmission and underscore the importance of further molecular studies to identify key factors in this complex interface.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn silico\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e Search and Analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing VectorBase (https://vectorbase.org/vectorbase/app)[18],the known protein sequence of \u003cem\u003eAn. gambiae \u003c/em\u003eCSPBP (AGAP006649) was used to run a BLASTP[19,20] search against the proteome of \u003cem\u003eAe. aegypti. \u003c/em\u003eThe results were used to determine the possible orthologs of CSPBP in \u003cem\u003eAe. aegypti \u003c/em\u003e(AAEL003735). Results with an E-value of \u0026lt; 1e\u003csup\u003e-10 \u003c/sup\u003ewere considered as signifying homology.\u003c/p\u003e\n\u003cp\u003eA structural comparison of the AlphaFold-predicted three-dimensional structures[18,21,22] of AGAP006649 and AAEL003735 was performed using the distance matrix alignment (Dali) tool[23],which can be accessed through the server at http://ekhidna.biocenter.helsinki.fi/dali. The AlphaFold-predicted structures were retrieved from VectorBase and uploaded to the pairwise structure comparison tool on the Dali server. A superimposed picture of the proteins was generated, and the structural comparison tool was used to highlight areas of structural conservation between the structures. A Z-score above 2.4 was considered to be significant. A low Root Mean Square Deviation (RMSD) (\u0026lt; 3 \u0026Aring;) coupled with a significant Z-score indicates high overall fold similarity, while a significant Z-score with a high RMSD indicates more investigation into the aligned structures is necessary[24].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMosquitoes Rearing \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eAe. aegypti\u003c/em\u003e Higgs white-eyed strain[25]was used in all experiments. Rearing and infection procedures were performed according to Kojin et al., 2021[26].Briefly, the \u003cem\u003eAe. aegypti \u003c/em\u003eHiggs white-eyed strain was maintained in the insectary at the Institute of Biomedical Sciences II, University of S\u0026atilde;o Paulo, Brazil, at a temperature of 27 \u0026plusmn; 2 \u0026deg;C and a relative humidity of 80%, along with a 12-hour light:12-hour dark cycle. The food provided to the adult mosquitoes was a 10% sucrose solution, which was available \u003cem\u003ead libitum\u003c/em\u003e. Adult females had access to anesthetized mice for blood feeding and egg production, and larvae were fed on a solution of Tetramin\u003csup\u003e\u0026reg;\u003c/sup\u003e and water.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMosquito Infection with \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo infect chickens, an aliquot of \u003cem\u003eP. gallinaceum \u003c/em\u003e(strain 8A, obtained from A. Krettli, Ren\u0026eacute; Rachou Institute of Research, FIOCRUZ, MG, Brazil) infected blood was transfused into 7-day-old \u003cem\u003eGallus gallus \u003c/em\u003echicks (Granja Kunitomo, Mogi Das Cruzes, Brazil). To verify that the chickens were sufficiently infected, a drop of blood was taken from the foot of each inoculated chicken, where it was further smeared with Giemsa and examined to determine parasitemia. Chickens deemed to be acceptable for blood feeding contained between 5-9% parasitemia. All infected chickens were exposed to both the control and experimental groups simultaneously. Five-to-seven-day-old female mosquitoes from both groups were deprived of the 10% sucrose solution for 16 hours and then allowed to feed on the infected chickens for 15 minutes until satiation. Exclusively fully engorged mosquitoes were used for the following experiments, where each group had three biological replicates. For work with chickens at the Universidade de S\u0026atilde;o Paulo, work was approved by Comiss\u0026atilde;o de Etica no Uso de Animais (CEUA-ICB/USP) (equivalent to the Institutional Animal Care and Use Committee (IACUC) in the United States); 188/2012 extended until 03/12/2020 and done in accordance with CEUA-ICB/USP regulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of double-stranded RNA and Gene Silencing Assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA 534bp fragment from the AaCSPBP gene (AAEL003735) was amplified using a primer designed using E-RNAi Webservice (www.dkfz.de/signaling/e-rnai3/idseq.php) that incorporates T7 minimum promoter sequence at its 5\u0026rsquo; end. The primer sequences were as follows: AaCSPBP - forward 5\u0026rsquo;TAATACGACTCACTATAGGGAGAGGAAAAAGACACGGCTGGTA3\u0026rsquo; and reverse 5\u0026rsquo;TAATACGACTCACTATAGGGAGAGGTACCTCTCCTGAAGCTTTCTT3\u0026rsquo;. eGFP was used as a control and was amplified using the following primers: T7-EGFP-FWD (5\u0026rsquo;TAATACGACTCACTATAGGGAGAGAACTGTTCACCGGAGTGGT3\u0026rsquo;) and T7-EGFP-REV (5\u0026rsquo;TAATACGACTCACTATAGGGAGATCACCAGGGTATCTCCTTCG3\u0026rsquo;). The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN), and double-stranded (ds) RNA was synthesized and cleaned using the MEGAscript T7 Transcription kit (Ambion) following the manufacturer\u0026rsquo;s protocol. The dsRNA for SGS1 was synthesized using the same methodology previously described for CSPBP. This approach, including primer design and in vitro transcription, followed the protocol published in [14], ensuring consistency and reproducibility across both gene targets. Four-day-old adult females were allowed to feed on \u003cem\u003eP. gallinaceum\u003c/em\u003e-infected chickens, and after 6 days, infected females were injected in the thorax with 3 \u0026micro;g of dsAaCSPBP or dsGFP, and 2 days after double-stranded RNA injection (8 days after \u003cem\u003eP. gallinaceum\u003c/em\u003e blood meal), the salivary gland or hemolymph of individual females was dissected, and the number of sporozoites was determined. For the dual AaCSPBP/SGS1 genes knockdown experiment, dsAaCSPBP or dsGFP was injected on the 6th day post-infected blood meal. The injected females were allowed to rest for 24 h, followed by a second injection with dsSGS1 or dsGFP, and the number of sporozoites was determined in the salivary gland or hemolymph in the same way as in the single dsRNA injection experiment. \u003cstrong\u003eFigure 1\u003c/strong\u003e shows a schematic representation of the timeline for the experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emRNA Expression Analyses \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReverse transcriptase PCR (RT-PCR) was performed using whole-body total RNA extracted from \u003cem\u003eAe. aegypti\u003c/em\u003e with TRIzol reagent (Invitrogen) and treated with DNase I (Invitrogen) to remove genomic DNA contamination. The amplification of diagnostic products was done using the OneStep RT-PCR kit (Qiagen) and primers. The reaction mixture was incubated at 50 \u003csup\u003eo\u003c/sup\u003eC for 30 min and 95 \u003csup\u003eo\u003c/sup\u003eC for 15 min. Amplification conditions were 94 \u003csup\u003eo\u003c/sup\u003eC for 1 min followed by 30 cycles of 94 \u003csup\u003eo\u003c/sup\u003eC for 1 min, 60 \u003csup\u003eo\u003c/sup\u003eC for 1 min, and 72 \u003csup\u003eo\u003c/sup\u003eC for 1 min, and a final step of 10 min at 72 \u003csup\u003eo\u003c/sup\u003eC. The primer sequences were as follows: for AaCSPBP, the forward primer used was: 5\u0026rsquo;AAGAACTTACGCCAGCTCCA3\u0026rsquo;, and the reverse was \u003c/p\u003e\n\u003cp\u003e5\u0026rsquo;GGACGATTTTTGTTGCGAAT3\u0026rsquo;. The forward actin primer used was: 5\u0026rsquo;GAGCGTGGCTACTCCTTCAC 3\u0026rsquo; and the reverse was: 5\u0026rsquo;AGTTTCGTGGATACCGCAAG3\u0026rsquo;. Amplification products were visualized on a 1% agarose gel stained with ethidium bromide, and bands were observed under UV light using a gel documentation system to assess the size and specificity of the PCR products. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMosquito Hemolymph Extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo quantify sporozoites in mosquito hemolymph, one set of legs was removed from a single cold anesthetized female, and 1\u0026ndash;5 \u0026mu;L of PBS was intrathoracically injected from the opposite side. A small volume (0.4\u0026ndash;1 \u0026mu;L) of diluted hemolymph was then collected from the leg stumps using a sterile pipette. Hemolymph from multiple mosquitoes was pooled until a total volume of 10 \u0026mu;L was obtained. The pooled sample was placed in a hemocytometer, and sporozoite counts were determined using phase-contrast microscopy. Hemolymph collection was performed 8 days after the infected blood meal, and sporozoite quantification was performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMosquito salivary gland extraction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdult females injected with dsAaCSPBP and/or dsSGS1, or dsGFP (negative control) were cold anesthetized, and their salivary gland pairs were individually dissected using forceps and a probe under a stereoscope equipped with bottom lighting to enhance gland visibility. Dissections were performed in a drop of 100 \u0026mu;L of Phosphate-Buffered Saline (PBS). Following dissection, each salivary gland pair was transferred to a fresh drop of PBS and gently rinsed to minimize tissue disruption while ensuring the removal of sporozoites adhering to the gland surface. The glands were then individually homogenized by pipetting up and down multiple times in PBS. Only intact salivary glands were used in the experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSporozoite Quantification from Mosquito Salivary Glands and Hemolymph \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmediately following dissection, the recovered hemolymph or isolated salivary glands were transferred to a hemocytometer chamber, where sporozoite counts were conducted under phase-contrast microscopy. This approach enabled direct visualization and quantification of sporozoites for consistent assessment of parasite load across experimental groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe D\u0026rsquo;Agostino-Pearson omnibus normality test was applied to assess whether sporozoite counts followed a normal distribution. Based on the results, either an unpaired t-test or a Mann\u0026ndash;Whitney test was used to evaluate statistical differences between control and experimental groups. The percentage reduction in sporozoite numbers was calculated using the formula:\u003c/p\u003e\n\u003cp\u003e100 \u0026times; [1 \u0026minus; (median parasite count in the experimental group / median parasite count in the control group)].\u003c/p\u003e\n\u003cp\u003eThe Wilcoxon one-sample signed-rank test was applied to assess whether the median observed reduction in sporozoite count for the dual knockdown of AaCSPBP and SGS1 differed from the theoretical reduction determined by the Bliss model of independence. All tests were performed using GraphPad Prism (version 10.5.0 for Windows, GraphPad Software, La Jolla, USA, www.graphpad.com). Statistical significance is indicated in figures as follows: p \u0026lt; 0.05 (*), p \u0026lt; 0.01 (**), p \u0026lt; 0.001 (***), and p \u0026lt; 0.0001 (****); ns denotes not significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eGene transcript and protein structure of putative AaCSPBP.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA Reciprocal BLASTP search was conducted against the whole genome of the \u003cem\u003eAe. aegypti\u003c/em\u003e Liverpool strain (AaegL3 assembly) to identify a putative ortholog. The protein alignment showed 42.77% similarity between the \u003cem\u003eAn. gambiae\u003c/em\u003e CSPBP gene sequence (AGAP006649) and the putative ortholog in \u003cem\u003eAe. aegypti\u003c/em\u003e (AAEL003735) over a 621 amino acid sequence, with an E-value of 5e\u003csup\u003e\u0026minus;\u0026thinsp;113\u003c/sup\u003e, and a bit score of 355 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). No other matches were found in the \u003cem\u003eAe. aegypti\u003c/em\u003e genome for the protein sequence. The retrieved gene contains two coding exons, with a genomic sequence of 2,365 bp, including 5\u0026prime; and 3\u0026prime; untranslated regions, introns, and exons (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The corresponding transcript is 2,300 bp in length, and the predicted protein comprises 685 amino acid residues, as annotated in VectorBase.org.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe three-dimensional protein structures for both \u003cem\u003eAe. aegypti\u003c/em\u003e and \u003cem\u003eAn. gambiae\u003c/em\u003e CSPBP predicted by AlphaFold were compared using the pairwise alignment tool on the Dali server, which returned a Z-score of 16.9 and RMSD of 36.0 \u0026Aring;. This indicates that while the structural similarities were very unlikely to occur randomly, at least some structurally similar regions occupied meaningfully different relative places in space. The structures were superimposed onto one another \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) to visualize the three-dimensional similarities. Superimposition revealed that the N-termini of the proteins occupied similar places in space, while the proteins were spatially distant beyond this region. A second image was generated to compare regions of structural conservation between the two proteins, where conserved areas were highlighted in blue on the three-dimensional prediction of AgCSPBP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). There was significant structural conservation at the N-termini, which was the region where AlphaFold was most confident in its prediction. The secondary structure that each amino acid inhabits in its respective protein was further aligned by residue to showcase regional similarity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The percentage of amino acids occupying an identical secondary structure between the proteins was 32%. Amino acids in both proteins from residues 105 to 184 were structurally identical, with smaller regions of structural similarity throughout the proteins. This, in conjunction with the structural similarity in the three-dimensional models over this region, indicates potential functional similarity in the two proteins.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAaCSPBP gene silencing is rapid in\u003c/b\u003e \u003cb\u003eAedes aegypti.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo analyze the potential to silence AaCSPBP and how long this silence would last, RT-PCR was performed in pools of 5 females, and transcript presence was verified in samples prepared 2, 3, 4, 5, and 6 days after thoracic injections of dsRNA. We observed a significant decrease in AaCSPBP transcript levels in samples prepared 2 and 3 days post-injection, but the transcript levels were back to the same level as the control on the 4th day, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e. For clarity, images of the agarose gels were cropped to highlight the relevant bands, and the full, uncropped images are provided in \u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e. The SGS1 knockdown was previously demonstrated in [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], where a significant reduction in transcript levels was observed on day 2 post-injection. Although mRNA levels began to recover by day 3, they remained below control levels, with full expression restored by day 4 \u003csup\u003e14\u003c/sup\u003e. Together, these results highlighted a short period of knockdown and indicated the optimal window to perform gene knockdown injections in coordination with \u003cem\u003ePlasmodium\u003c/em\u003e infection, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e in the methods section.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eKnockdown of AaCSPBP lowers the number of sporozoites invading the salivary gland.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo evaluate whether \u003cb\u003eAaCSPBP\u003c/b\u003e plays a role in \u003cem\u003eP. gallinaceum\u003c/em\u003e invasion of \u003cem\u003eAe. aegypti\u003c/em\u003e salivary glands, similar to the function reported for its ortholog in \u003cem\u003eAn. gambiae\u003c/em\u003e during \u003cem\u003eP. berghei\u003c/em\u003e infection, dsRNA targeting \u003cb\u003eAaCSPBP\u003c/b\u003e and \u003cb\u003eGFP\u003c/b\u003e (as a control) was initially synthesized at a concentration of 1,500 ng/\u0026micro;L. These were intrathoracically injected into \u003cem\u003eP. gallinaceum\u003c/em\u003e-infected \u003cem\u003eAe. aegypti\u003c/em\u003e females on the sixth day post-infection. Two days later, salivary glands were dissected, and sporozoite numbers were quantified. No significant difference was observed between the experimental and control groups using this initial concentration of dsRNA (\u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo enhance gene silencing efficacy, the experiment was adjusted and conducted using a doubled dsRNA concentration (3,000 ng/\u0026micro;L of dsAaCSPBP and dsGFP), following the same injection timeline. The experimental design (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e) was guided by the developmental timeline of \u003cem\u003eP. gallinaceum\u003c/em\u003e in \u003cem\u003eAe. aegypti\u003c/em\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] and by the rapid silencing kinetics previously observed for AaCSPBP (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In this optimized experiment, the number of salivary gland-associated sporozoites in dsAaCSPBP-injected mosquitoes was reduced by 68%, 71%, and 33% across three independent replicates, yielding an average reduction of 62% (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Notably, in the replicate with the lowest reduction (33%), the parasitemia level in the infected chicken host was the highest, suggesting that a high parasite load may partially overcome the effects of \u003cb\u003eAaCSPBP\u003c/b\u003e knockdown.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further investigate whether the reduced sporozoite invasion observed following AaCSPBP knockdown was due to a direct blocking effect rather than other factors, we quantified the number of sporozoites present in the hemolymph. These counts were performed using the same timeline as the salivary gland dissections, ensuring consistency with the window of parasite migration. Across three independent experiments, mosquitoes injected with dsAaCSPBP showed significantly higher numbers of sporozoites in the hemolymph, with 1.50-, 2.00-, and 3.83-, fold increases compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These findings suggest that silencing AaCSPBP impairs the ability of sporozoites to invade the salivary glands, resulting in their accumulation in the hemolymph. The raw sporozoite counts for each replicate are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSummary of sporozoite load in hemolymph and fold increase following dsAaCSPBP knockdown\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eExperiment\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eNumber of hemolymph sporozoites (n)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eNumber of mosquitoes in the pool\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eChicken parasitemia\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eFold increase\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003edsGFP\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003edsAaCSPBP\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e6%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e2.00\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e117\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e6%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e1.50\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e300\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e9%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e3.83\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDual knockdown of AaCSPBP and SGS1 synergistically enhances the reduction of sporozoite invasion in\u003c/b\u003e \u003cb\u003eAedes aegypti\u003c/b\u003e \u003cb\u003esalivary glands.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe further proceeded to investigate if knocking down both AaCSPBP and SGS1 could potentially lead to an increase in the blocking effect of the sporozoite penetration in the salivary gland. This dual knockdown approach was designed to ensure that both AaCSPBP and SGS1 were effectively silenced at the time sporozoites began invading the salivary glands. The strategy also accounted for mosquito survival, as delivering the necessary concentrations of dsRNA required relatively high injection volumes. Through the optimization of the injection time and combination of the gene targets, we aimed to achieve robust knockdown of both genes without compromising female viability, thereby enabling a reliable assessment of their synergistic role in mediating sporozoite invasion.\u003c/p\u003e\u003cp\u003eWe observed a drastic reduction in the number of sporozoites in the salivary glands of \u003cem\u003eP. gallinaceum\u003c/em\u003e-infected females following the dual knockdown of AaCSPBP and SGS1. Specifically, sporozoite counts were reduced by 93% in the first replicate, 92% in the second, and 92% in the third. Across the three replicates, the median number of salivary gland sporozoites showed a consistent 94% reduction, strongly indicating a synergistic effect of the dual knockdown on blocking sporozoite invasion.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOver the past years, exorbitant time and effort have been dedicated to understanding the mechanisms involved in the \u003cem\u003ePlasmodium\u003c/em\u003e sporozoite invasion of mosquito salivary glands. Despite this, the amount of insight we have regarding this process has remained relatively stagnant. While the field is aware that proteins like CSPBP and SGS1 are somehow involved in the invasion, their specific purpose in this pathway and their general role in mosquito biology remain uncertain. This lack of knowledge could serve as a barrier to a fully efficacious development of genetic control strategies for defense against malaria. This paper seeks to provide some much-needed insight into sporozoite salivary gland invasion, both through an investigation into the similarities of CSPBP proteins in different malaria vectors and the effects of CSPBP knockdown, both alone and with SGS1, in \u003cem\u003eAe. aegypti\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eStructural and sequence similarity can both independently function as strong indicators of shared protein function[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], as a high sequence similarity typically leads to a similar structure, and a similar structure typically results in similar function and interaction with the analogous downstream proteins involved in the biological process. However, some similar sequences lead to differing structures and functions, while others with dissimilar structures can have similar sequences and functions[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Therefore, we analyzed both the sequence and structure of CSPBP to guide the identification of its potential ortholog in \u003cem\u003eAe. aegypti\u003c/em\u003e. Given the E- and Z-scores returned by our analysis, the similarities between AaCSPBP and AgCSPBP in amino acid sequence, secondary structure, and predicted three-dimensional structure are unlikely to have arisen by chance and give us sufficient statistical evidence to infer orthology[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The region from residues 70 to 184 in both proteins is highly similar in secondary and three-dimensional structure. This residue region, as well as the others that were structurally similar between the two proteins, falls within the larger region that is likely involved in NMD, as indicated by InterPro[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] analysis. These other structurally similar regions had fewer residues with structural similarity and were much more distant from one another spatially, which provides an explanation for the unusually high RMSD. The similarity between \u003cem\u003eP. gallinaceum and P. falciparum\u003c/em\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and the fact that \u003cem\u003eP. falciparum\u003c/em\u003e CSP binds to the N-terminus of AgCSPBP indicate the possibility that this highly similar region could be an important binding site for CSP across the CSPBP protein family.\u003c/p\u003e\u003cp\u003eRT-PCR testing of the total RNA extracted from mosquitoes injected with dsAaCSPBP and dsSGS1\u003csup\u003e14\u003c/sup\u003e indicated that while a significant reduction in transcript levels was observed 2 and 3 days after injection, transcript levels returned to those of the control after 4 days. Therefore, the optimal window for injection of dsRNA for \u003cem\u003ePlasmodium\u003c/em\u003e infections is the period from 6 to 7 days after infection. An injection any earlier than this period would be subject to transcript levels for the gene of interest returning to normal, with injections any later only stopping expression after salivary gland invasion has occurred. Injections of dsAaCSPBP and dsSGS1 had to be administered on sequential days, as delivering both on the same day caused overflow at the injection site and increased mosquito mortality. Previous knockdown of \u003cem\u003eAn. gambiae\u003c/em\u003e CSPBP was achieved through thoracic injection of 1000 ng/\u0026micro;L dsRNA\u003csup\u003e16\u003c/sup\u003e. In contrast, in our experiments with \u003cem\u003eAe. aegypti\u003c/em\u003e, 1500 ng/\u0026micro;L was insufficient, and a concentration of 3000 ng/\u0026micro;L was required to achieve knockdown. This reflects the higher dsRNA concentration necessary for CSPBP knockdown in \u003cem\u003eAe. aegypti\u003c/em\u003e, corroborating reports from other studies that have encountered similar challenges across mosquito species[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCompared to our control, the knockdown of AaCSPBP reduced salivary gland sporozoite concentration by an average of 62% across three replicates. Additionally, AaCSPBP knockdown mosquitoes had, on average, 2.44 times more sporozoites in their hemolymph than the control mosquitoes. The reduction in salivary sporozoite count supports the idea that AaCSPBP is involved specifically in salivary gland invasion, as the number of sporozoites in both tissues combined remains relatively constant between knockdown and control mosquitoes. In addition, since the dsRNA was injected after the release of sporozoites from the oocysts, the observed impact could not have resulted from interactions with earlier stages of the parasite's life cycle. If the mechanism of action involved killing, we would expect to observe an overall decrease in the total number of sporozoites. Furthermore, the limited period of knockdown and the excessive concentration necessary for silencing could mean that AaCSPBP expression was not fully prevented. As a result of these factors, we may have obtained a smaller percentage reduction than would be observed with the complete abolition of AaCSPBP.\u003c/p\u003e\u003cp\u003eFurthermore, the knockdown of both AaCSPBP and SGS1 resulted in an even greater decrease in the number of sporozoites in the salivary gland, with an average of a 94% decrease across three replicates compared to the control. This combined trial could be subject to the same possible underestimation of percentage reduction as the trial with AaCSPBP silencing alone for the reasons identified above.\u003c/p\u003e\u003cp\u003eDue to the high degree of reduction in the dual knockdown experiment, we questioned whether AaCSPBP and SGS1 function independently in mediating sporozoite invasion of the salivary glands. We used the equation defined in the methods section to determine the percentage reduction in sporozoite count for each mosquito in the experimental group for the AaCSPBP and SGS1 dual knockdown. By recontextualizing percentage reduction as the probability of sporozoite salivary gland entrance inhibition relative to the control, we can use the rules of probability to determine the expected reduction if the knockdowns were acting independently, using the equation:\u003c/p\u003e\u003cp\u003eExpected Reduction\u0026thinsp;=\u0026thinsp;100% - (1-X) *(1-Y)\u003c/p\u003e\u003cp\u003ewhere 100% is the percentage of sporozoites present in the corresponding control mosquitoes, X is the observed average percentage reduction for AaCSPBP knockdown, and Y is the observed average percentage reduction for SGS1 knockdown. Essentially, this equation is using the probability of sporozoite entry for dsAaCSPBP mosquitoes relative to the control (1-X) and the probability of sporozoite entry for dsSGS1 mosquitoes relative to the control (1-Y) to determine the probability of sporozoite entry in a mosquito where both proteins are knocked down and function independently, as the probability of entry across the two independent events occurring can be determined by the equation P(A\u0026cap;B)\u0026thinsp;=\u0026thinsp;P(A)P(B). Then, this probability is subtracted from 100% (the likelihood of control sporozoite entry relative to itself) to determine the expected probability of inhibition for the dual knockdown trial, otherwise known as the percentage reduction. This equation is algebraically identical to the Bliss independence model[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eUsing the average percent reduction for the AaCSPBP and SGS1 trials, the corresponding percent reductions were input into this equation, resulting in a theoretical percent reduction of 100% - (1-0.62) *(1-0.67)[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], or 87.46%. Taking the null hypothesis that there is no difference between the theoretical (independent) group and the observed group, we ran a Wilcoxon one-sample signed-rank test using the observed group and this theoretical percentage reduction. It was determined that the average reduction in the observed group was greater than that of the theoretical prediction, and that this difference was statistically significant (P\u0026thinsp;=\u0026thinsp;.0130). This means that we can reject the null hypothesis and conclude that the observed reduction is greater than the theoretical reduction. Since the theoretical reduction represents the independent functioning of AaCSPBP and SGS1 knockdown, and the observed reduction is greater than the theoretical reduction, we can conclude that the knockdowns are operating synergistically.\u003c/p\u003e\u003cp\u003eWhat is causing this difference between the observed and theoretical groups? It could be the case that the efficacy of knockdown in the combined trial was simply greater than that of the independent trials. We don\u0026rsquo;t have evidence to suggest that this is the case, but the possibility cannot be excluded entirely. Perhaps AaCSPBP and SGS1 share some sort of overlapping function in the original process of invasion, and dual knockdown prevents the other protein from partially substituting for the other in said function. They could form a complex to permit sporozoite entry, where there is a greater than additive increase for additional binding. Regardless, if other factors are ruled out, they serve some synergistic role in sporozoite invasion. Despite this, the knockdown did not fully eliminate sporozoite invasion. If the knockdown was fully efficacious, then these results indicate that these synergistic proteins are not the only receptors involved in the invasion, which is consistent with current understanding in the field[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e\u003cp\u003eAlthough CSPBP contains an NMD-associated domain, that doesn\u0026rsquo;t mean it functions strictly in decay. Domains can be repurposed, especially in complex interactions like host\u0026ndash;parasite dynamics. Our finding, which is consistent with other malaria vectors, shows that CSPBP may act as a host cofactor or entry mediator at the salivary gland level, regardless of its original evolutionary function.\u003c/p\u003e\u003cp\u003eThis work supports the idea that SGS1 and AaCSPBP function synergistically in the process of \u003cem\u003eP. gallinaceum\u003c/em\u003e sporozoite invasion of \u003cem\u003eAe. aegypti\u003c/em\u003e salivary glands. Future experiments that knock out the genes encoding these proteins will help elucidate whether the differences between the theoretical and observed effects of the dual knockdown are due solely to the synergistic interaction of SGS1 and AaCSPBP knockdown. They will also clarify whether these proteins have a greater impact on sporozoite invasion than was observed in this experiment. This work serves as a step forward in our understanding of sporozoite invasion and in producing effective genetic controls against malaria.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe graphical representation in Figure 1 was generated using Biorender.com. Financial support was provided by grants from the National Council for Scientific and Technological Development (CNPq, #555648/2009-5), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, #1497027), and startup funds from the University of Florida. The funders played no role in the design of the study and collection, analysis, and interpretation of data, and in writing the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceived and designed the experiments: BB. Performed the experiments: AM, HC, BB. Analyzed the data: AM, BB. Contributed reagents/materials/analysis tools: BB, MC; Wrote the paper: AM, BB. All authors reviewed and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article (and its Supplementary Information files).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cstrong\u003eWorld Health Organization.\u003c/strong\u003e Vector-borne diseases. \u003cem\u003eWorld Health Organization\u003c/em\u003e (2024). Available at: https://www.who.int/news-room/fact-sheets/detail/vector-borne-diseases.\u003c/li\u003e\n \u003cli\u003eWorld Health Organization. \u003cem\u003eWorld Malaria Report 2024: Addressing Inequity in the Global Malaria Response\u003c/em\u003e. (2024).\u003c/li\u003e\n \u003cli\u003eCol\u0026oacute;n-Gonz\u0026aacute;lez, F. J. \u003cem\u003eet al.\u003c/em\u003e Projecting the risk of mosquito-borne diseases in a warmer and more populated world: a multi-model, multi-scenario intercomparison modelling study. \u003cem\u003eLancet Planet Health\u003c/em\u003e\u003cstrong\u003e5\u003c/strong\u003e, e404\u0026ndash;e414 (2021). https://doi.org/10.1016/S2542-5196(21)00132-7\u003c/li\u003e\n \u003cli\u003eChatterjee, D. \u0026amp; Cockburn, I. A. The challenges of a circumsporozoite protein-based malaria vaccine. \u003cem\u003eExpert Rev Vaccines\u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, 113\u0026ndash;125 (2021). https://doi.org/10.1080/14760584.2021.1874924\u003c/li\u003e\n \u003cli\u003ePryce, J., Richardson, M. \u0026amp; Lengeler, C. Insecticide-treated nets for preventing malaria. \u003cem\u003eCochrane Database Syst Rev\u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, CD000363 (2018). https://doi.org/10.1002/14651858.CD000363.pub3\u003c/li\u003e\n \u003cli\u003eCui, L., Mharakurwa, S., Ndiaye, D., Rathod, P. K. \u0026amp; Rosenthal, P. J. Antimalarial drug resistance: literature review and activities and findings of the ICEMR network. \u003cem\u003eAm J Trop Med Hyg\u003c/em\u003e\u003cstrong\u003e93\u003c/strong\u003e, 57\u0026ndash;68 (2015). https://doi.org/10.4269/ajtmh.15-0007\u003c/li\u003e\n \u003cli\u003eBier, E. Gene drives gaining speed. \u003cem\u003eNat Rev Genet\u003c/em\u003e\u003cstrong\u003e23\u003c/strong\u003e, 5\u0026ndash;22 (2022). https://doi.org/10.1038/s41576-021-00386-0\u003c/li\u003e\n \u003cli\u003eAly, A. S. I., Vaughan, A. M. \u0026amp; Kappe, S. H. I. Malaria parasite development in the mosquito and infection of the mammalian host. \u003cem\u003eAnnu Rev Microbiol\u003c/em\u003e\u003cstrong\u003e63\u003c/strong\u003e, 195\u0026ndash;221 (2009). https://doi.org/10.1146/annurev.micro.091208.073403\u003c/li\u003e\n \u003cli\u003eKaslow, D. C., Syin, C., McCutchan, T. F. \u0026amp; Miller, L. H. Comparison of the primary structure of the 25 kDa ookinete surface antigens of \u003cem\u003ePlasmodium falciparum\u003c/em\u003e and \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e reveal six conserved regions. \u003cem\u003eMol Biochem Parasitol\u003c/em\u003e\u003cstrong\u003e33\u003c/strong\u003e, 283\u0026ndash;287 (1989). https://doi.org/10.1016/0166-6851(89)90090-x\u003c/li\u003e\n \u003cli\u003eSilva, A. F. \u003cem\u003eet al.\u003c/em\u003e Antiplasmodial activity study of angiotensin II via Ala scan analogs. \u003cem\u003eJ Pept Sci\u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, 640\u0026ndash;648 (2014). https://doi.org/10.1002/psc.2641\u003c/li\u003e\n \u003cli\u003eGuttery, D. S., Zeeshan, M., Ferguson, D. J. P., Holder, A. A. \u0026amp; Tewari, R. Division and transmission: malaria parasite development in the mosquito. \u003cem\u003eAnnu Rev Microbiol\u003c/em\u003e\u003cstrong\u003e76\u003c/strong\u003e, 113\u0026ndash;134 (2022). https://doi.org/10.1146/annurev-micro-041320-010046\u003c/li\u003e\n \u003cli\u003eKorochkina, S. \u003cem\u003eet al.\u003c/em\u003e A mosquito-specific protein family includes candidate receptors for malaria sporozoite invasion of salivary glands. \u003cem\u003eCell Microbiol\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 163\u0026ndash;175 (2006). https://doi.org/10.1111/j.1462-5822.2005.00611.x\u003c/li\u003e\n \u003cli\u003eOrlandi-Pradines, E. \u003cem\u003eet al.\u003c/em\u003e Antibody response against saliva antigens of \u003cem\u003eAnopheles gambiae\u003c/em\u003e and \u003cem\u003eAedes aegypti\u003c/em\u003e in travellers in tropical Africa. \u003cem\u003eMicrobes Infect\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e, 1454\u0026ndash;1462 (2007). https://doi.org/10.1016/j.micinf.2007.07.012\u003c/li\u003e\n \u003cli\u003eKojin, B. B. \u003cem\u003eet al.\u003c/em\u003e\u003cem\u003eAedes aegypti\u003c/em\u003e SGS1 is critical for \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e infection of both the mosquito midgut and salivary glands. \u003cem\u003eMalar J\u003c/em\u003e\u003cstrong\u003e20\u003c/strong\u003e, 11 (2021). https://doi.org/10.1186/s12936-020-03537-6\u003c/li\u003e\n \u003cli\u003eGhosh, A. K. \u0026amp; Jacobs-Lorena, M. \u003cem\u003ePlasmodium\u003c/em\u003e sporozoite invasion of the mosquito salivary gland. \u003cem\u003eCurr Opin Microbiol\u003c/em\u003e\u003cstrong\u003e12\u003c/strong\u003e, 394\u0026ndash;400 (2009).\u003c/li\u003e\n \u003cli\u003eWang, J. \u003cem\u003eet al.\u003c/em\u003e\u003cem\u003eAnopheles gambiae\u003c/em\u003e Circumsporozoite Protein\u0026ndash;Binding Protein facilitates \u003cem\u003ePlasmodium\u003c/em\u003e infection of mosquito salivary glands. \u003cem\u003eJ Infect Dis\u003c/em\u003e\u003cstrong\u003e208\u003c/strong\u003e, 1161\u0026ndash;1169 (2013). https://doi.org/10.1093/infdis/jit284\u003c/li\u003e\n \u003cli\u003eKojin, B. B. \u0026amp; Adelman, Z. N. The sporozoite\u0026rsquo;s journey through the mosquito: a critical examination of host and parasite factors required for salivary gland invasion. \u003cem\u003eFront Ecol Evol\u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, 1\u0026ndash;13 (2019). https://doi.org/10.3389/fevo.2019.00284\u003c/li\u003e\n \u003cli\u003eGiraldo-Calder\u0026oacute;n, G. I. \u003cem\u003eet al.\u003c/em\u003e VectorBase.org updates: bioinformatic resources for invertebrate vectors of human pathogens and related organisms. \u003cem\u003eCurr Opin Insect Sci\u003c/em\u003e\u003cstrong\u003e50\u003c/strong\u003e, 100860 (2022). https://doi.org/10.1016/j.cois.2021.11.008\u003c/li\u003e\n \u003cli\u003eAltschul, S. F., Gish, W., Miller, W., Myers, E. W. \u0026amp; Lipman, D. J. Basic local alignment search tool. \u003cem\u003eJ Mol Biol\u003c/em\u003e\u003cstrong\u003e215\u003c/strong\u003e, 403\u0026ndash;410 (1990). https://doi.org/10.1016/S0022-2836(05)80360-2\u003c/li\u003e\n \u003cli\u003eAltschul, S. \u003cem\u003eet al.\u003c/em\u003e Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. \u003cem\u003eNucleic Acids Res\u003c/em\u003e\u003cstrong\u003e25\u003c/strong\u003e, 3389\u0026ndash;3402 (1997). https://doi.org/10.1093/nar/25.17.3389\u003c/li\u003e\n \u003cli\u003eJumper, J. \u003cem\u003eet al.\u003c/em\u003e Highly accurate protein structure prediction with AlphaFold. \u003cem\u003eNature\u003c/em\u003e\u003cstrong\u003e596\u003c/strong\u003e, 583\u0026ndash;589 (2021). https://doi.org/10.1038/s41586-021-03819-2\u003c/li\u003e\n \u003cli\u003eVaradi, M. \u003cem\u003eet al.\u003c/em\u003e AlphaFold Protein Structure Database: massively expanding the structural coverage of protein-sequence space with high-accuracy models. \u003cem\u003eNucleic Acids Res\u003c/em\u003e\u003cstrong\u003e50\u003c/strong\u003e, D439\u0026ndash;D444 (2022). https://doi.org/10.1093/nar/gkab1061\u003c/li\u003e\n \u003cli\u003eHolm, L., Laiho, A., T\u0026ouml;r\u0026ouml;nen, P. \u0026amp; Salgado, M. DALI shines a light on remote homologs: one hundred discoveries. \u003cem\u003eProtein Sci\u003c/em\u003e\u003cstrong\u003e32\u003c/strong\u003e, 1\u0026ndash;16 (2023). https://doi.org/10.1002/pro.4519\u003c/li\u003e\n \u003cli\u003eHolm, L., K\u0026auml;\u0026auml;ri\u0026auml;inen, S., Wilton, C. \u0026amp; Plewczynski, D. Using Dali for structural comparison of proteins. \u003cem\u003eCurr Protoc Bioinform\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 1\u0026ndash;14 (2006). https://doi.org/10.1002/0471250953.bi0505s14\u003c/li\u003e\n \u003cli\u003eHiggs, S. \u003cem\u003eet al.\u003c/em\u003e Green fluorescent protein expressed in living mosquitoes\u0026mdash;without the requirement of transformation. \u003cem\u003eBiotechniques\u003c/em\u003e\u003cstrong\u003e21\u003c/strong\u003e, 660\u0026ndash;666 (1996). https://doi.org/10.2144/96214st03\u003c/li\u003e\n \u003cli\u003eKojin, B. B. \u003cem\u003eet al.\u003c/em\u003e Endogenously-expressed NH2-terminus of circumsporozoite protein interferes with sporozoite invasion of mosquito salivary glands. \u003cem\u003eMalar J\u003c/em\u003e\u003cstrong\u003e15\u003c/strong\u003e, 153 (2016). https://doi.org/10.1186/s12936-016-1207-8\u003c/li\u003e\n \u003cli\u003eAraujo, R. V., Maciel, C., Hartfelder, K. \u0026amp; Capurro, M. L. Effects of \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e on hemolymph physiology of \u003cem\u003eAedes aegypti\u003c/em\u003e during parasite development. \u003cem\u003eJ Insect Physiol\u003c/em\u003e\u003cstrong\u003e57\u003c/strong\u003e, 265\u0026ndash;273 (2011). https://doi.org/10.1016/j.jinsphys.2010.11.016\u003c/li\u003e\n \u003cli\u003eLouie, B., Higdon, R. \u0026amp; Kolker, E. A statistical model of protein sequence similarity and function similarity reveals overly-specific function predictions. \u003cem\u003ePLoS ONE\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, e7546 (2009). https://doi.org/10.1371/journal.pone.0007546\u003c/li\u003e\n \u003cli\u003eKrissinel, E. On the relationship between sequence and structure similarities in proteomics. \u003cem\u003eBioinformatics\u003c/em\u003e\u003cstrong\u003e23\u003c/strong\u003e, 717\u0026ndash;723 (2007). https://doi.org/10.1093/bioinformatics/btm006\u003c/li\u003e\n \u003cli\u003eKosloff, M. \u0026amp; Kolodny, R. Sequence-similar, structure-dissimilar protein pairs in the PDB. \u003cem\u003eProteins\u003c/em\u003e\u003cstrong\u003e71\u003c/strong\u003e, 891\u0026ndash;902 (2008). https://doi.org/10.1002/prot.21770\u003c/li\u003e\n \u003cli\u003eWilliams, S. G. \u0026amp; Lovell, S. C. The effect of sequence evolution on protein structural divergence. \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e\u003cstrong\u003e26\u003c/strong\u003e, 1055\u0026ndash;1065 (2009). https://doi.org/10.1093/molbev/msp020\u003c/li\u003e\n \u003cli\u003eHolm, L. DALI and the persistence of protein shape. \u003cem\u003eProtein Sci.\u003c/em\u003e\u003cstrong\u003e29\u003c/strong\u003e, 128\u0026ndash;140 (2020). https://doi.org/10.1002/pro.3749\u003c/li\u003e\n \u003cli\u003eBlum, M. et al. InterPro: the protein sequence classification resource in 2025. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e\u003cstrong\u003e53\u003c/strong\u003e, D444\u0026ndash;D456 (2025). https://doi.org/10.1093/nar/gkae1082\u003c/li\u003e\n \u003cli\u003eLauron, E. J., Aw Yeang, H. X., Taffner, S. M. \u0026amp; Sehgal, R. N. M. De novo assembly and transcriptome analysis of \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e identifies the Rh5 interacting protein (ripr), and reveals a lack of EBL and RH gene family diversification. \u003cem\u003eMalar. J.\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 296 (2015). https://doi.org/10.1186/s12936-015-0814-0\u003c/li\u003e\n \u003cli\u003eBoisson, B. et al. Gene silencing in mosquito salivary glands by RNAi. \u003cem\u003eFEBS Lett.\u003c/em\u003e\u003cstrong\u003e580\u003c/strong\u003e, 1988\u0026ndash;1992 (2006). https://doi.org/10.1016/j.febslet.2006.02.069\u003c/li\u003e\n \u003cli\u003eDemidenko, E. \u0026amp; Miller, T. W. Statistical determination of synergy based on Bliss definition of drugs independence. \u003cem\u003ePLoS ONE\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, e0224137 (2019). https://doi.org/10.1371/journal.pone.0224137\u003cstrong\u003e\u003cu\u003e\u003c/u\u003e\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Circumsporozoite Protein Binding Protein, CSP, SGS1, Aedes aegypti, sporozoite, salivary gland","lastPublishedDoi":"10.21203/rs.3.rs-7530159/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7530159/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eVector-borne diseases, particularly malaria, continue to pose a major global health challenge, underscoring the urgent need for innovative and sustainable vector control strategies. Among emerging solutions, genetic control holds great promise for interrupting disease transmission at its source. Malaria transmission relies on the parasite\u0026rsquo;s ability to overcome multiple barriers within the mosquito and ultimately invade the salivary glands during the sporozoite stage. Using \u003cem\u003ePlasmodium gallinaceum\u003c/em\u003e as a model parasite, this study investigates two \u003cem\u003eAedes aegypti\u003c/em\u003e proteins, the salivary gland surface protein 1 (SGS1) and the putative ortholog of circumsporozoite protein-binding protein (AaCSPBP), that are involved in this critical step. We identified AaCSPBP through \u003cem\u003ein silico\u003c/em\u003e homology and structural analyses and achieved gene knockdown via RNA interference. Knockdown of AaCSPBP alone resulted in a\u0026thinsp;~\u0026thinsp;62% reduction in salivary gland sporozoite numbers and increased accumulation in the hemolymph, indicating impaired gland invasion. Dual knockdown of AaCSPBP and SGS1 produced a synergistic effect, reducing salivary gland sporozoites by ~\u0026thinsp;94%, a significantly greater reduction than the sum of individual effects. These findings suggest that AaCSPBP and SGS1 act cooperatively to mediate sporozoite invasion of mosquito salivary glands. Targeting this interaction offers a promising genetically based approach to disrupting malaria transmission.\u003c/p\u003e","manuscriptTitle":"Synergistic Role of CSPBP and SGS1 in Sporozoite Entry into Aedes aegypti Salivary Glands","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-24 19:28:35","doi":"10.21203/rs.3.rs-7530159/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-12T06:54:10+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-06T15:27:38+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-22T21:27:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"174977312547865779253578156110241899789","date":"2025-10-12T10:10:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"80762301895121568295457392324528400533","date":"2025-10-10T14:48:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"242550094991689970717789172168769307730","date":"2025-10-10T13:51:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"132184300673591951837765023568281815345","date":"2025-10-10T13:15:59+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-10T09:54:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-10T09:17:45+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-09-11T07:35:35+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-10T13:19:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-09-10T13:15:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fbca6edc-2731-4734-8a4d-d4fe303f93df","owner":[],"postedDate":"October 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":56734092,"name":"Health sciences/Diseases"},{"id":56734093,"name":"Biological sciences/Microbiology"},{"id":56734094,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-04-07T16:08:52+00:00","versionOfRecord":{"articleIdentity":"rs-7530159","link":"https://doi.org/10.1038/s41598-026-46444-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-04-03 15:59:42","publishedOnDateReadable":"April 3rd, 2026"},"versionCreatedAt":"2025-10-24 19:28:35","video":"","vorDoi":"10.1038/s41598-026-46444-7","vorDoiUrl":"https://doi.org/10.1038/s41598-026-46444-7","workflowStages":[]},"version":"v1","identity":"rs-7530159","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7530159","identity":"rs-7530159","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}