Virulence gene expression of halophilic variant V.parahaemolyticus and its effect on pathogenicity

preprint OA: closed
Full text JSON View at publisher
Full text 70,924 characters · extracted from preprint-html · click to expand
Virulence gene expression of halophilic variant V.parahaemolyticus and its effect on pathogenicity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Virulence gene expression of halophilic variant V.parahaemolyticus and its effect on pathogenicity Xin Dong, Dan Wu, Jia Chen, Qiang Du, Bowen Tu, Xujian Mao, Fengming Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4544828/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Vibrio parahaemolyticus (VP) is a Gram-negative halophilic bacterium that mainly infects seafood and food [ 1 ] with high salt content. Eating uncooked or contaminated by the bacteria may cause gastroenteritis symptoms, such as nausea, vomiting and diarrhea [ 2 ]. In many countries, especially in coastal [ 3 ], VP has become the leading pathogen [ 4 ] responsible for bacterial food poisoning, and foodborne diseases caused by VP have also become a public health issue of global concern. We show that halinophilia is one of the most unique biological properties of VP, [ 5 ], which can only normally grow [ 6 ] in environments with 0.5–8.0% salt content. In recent years, an increasing number of literature has reported that the prevalence of VP in inland cities gradually increases in [ 7 – 9 ]. The VP monitoring results of ready-to-eat raw aquatic products in Changzhou found that the detection rate of VP was increasing year by year, especially the proportion of VP detected in freshwater products increased significantly, and VP was detected in freshwater crayfish, freshwater fish and shellfish. The preliminary research results of this project team found that VP of fresh water products could grow normally at 0%~0.5% salt concentration, while VP of seawater products grew well at salt concentration of 1%~3%, which proved that the halinophilia of some VP was changed, and the "halophilic variant" VP appeared. Vibrio parahaemolyticus fresh water products virulence Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1 Introduction From 2015 to 2017,52.1% of the food-borne disease outbreaks in Jiangsu province were caused by VP, and from 2010 to 2020,20.41% and 15.50% of the outbreaks were caused by VP in inland and coastal areas of Jiangsu province [ 10 ]. Changzhou city belongs to the Yangtze River Delta region of Jiangsu Province, with developed aquatic products and severe disease burden caused by VP. Now, the detection of VP in aquatic products in Changzhou area from 2015 to 2022 is analyzed. The detection of V. parahaemolyticus in Changzhou from 2015 to 2022 was explored, and VP in seawater products and VP in freshwater products were tested under different salt concentration conditions. Methods:Food risk monitoring and food poisoning VP strains from 2015 to 2022, There were 48 VP strains from sea products and 46 VP strains from fresh water products were tested for VP. Results:This paper analyzed the detection of VP in food risk monitoring in Changzhou from 2015 to 2022, the detection rate increased from 2.5% in 2015 to 43% in 2022; the detection of VP of seawater products and VP of freshwater products were calculated respectively, the VP detection rate of seawater product source increased from 5–41%, the detection rate of VP from freshwater products increased from 0–45%. It is worth noting that for the first time in 2022, the VP detection rate of freshwater sources exceeded that of seawater product sources (41% and 45%, respectively); The number of food poisoning due to VP also increased year by year from 2015 to 2022. Subsequent tests found that the growth and virulence differences of VP from different aquatic products under different salt concentrations were different ( P <0.05), which proved that the halinophilia of some VP changed and the "halophilic variant" VP appeared. Conclusion:According to the statistics of the detection of VP of different aquatic products from 2015 to 2022, the growth and virulence differences of VP of different aquatic products cultured with different salt concentrations, the VP pollution rate of freshwater products sources urgently needs to be paid attention to, and further risk assessment should be carried out to provide a basis for food safety risk management. 2 Materials and methods 2.1 Sample source: VP-positive strains detected by food risk monitoring and food poisoning from 2015 to 2022, including VP strains of seawater products, such as sea cucumber, flower gum, salmon and conch, and VP strains of freshwater products, such as incense snail, river shrimp, mussel and copper rust ring snail. All VP strains were kept in the Microbank strain storage tubes and placed in the-80℃ refrigerator. 2.2 Methods 2.2.1 Analysis and screening of wild type and halophilic variant VP to obtain VP samples for study; 2.2.2 Test method According to GB 4789.7–2013 national standard of V. parahaemolyticus, all strains were tested to 99%. The olysin (tlh) gene and virulence expression regulation (toxR) gene were measured using real-time PCR. Wild-type and halophilic variant VP were grown using sodium chloride LB medium configured with nutrient broth medium with different salt concentrations and OD values were recorded at 2h intervals for 24h. Whole genome sequencing technology was used to examine the expression differences of virulence system-related T3SS1 secretion effector genes (VopQ, VopR, VopS, and VPA0450) of wild-type and halophilic variant VP. A Caco-2 intestinal cell infection model was developed and analyzed to compare the differences in the cytotoxic effects of wild-type and halophilic variant VP strains. 2.2.3 RNA extraction as well as cDNA synthesis After log growth bacteria to supernatant, add RNAiso Plus lysate, let at room temperature for 5 min (or fully ground), and transferred to RNase-free Ep tubes by centrifugation at 4℃ at 12000 rpm for 5 min. The supernatant was removed, plus 100 µL chloroform, mixed well and centrifuged at 4℃, 12000 rpm for 15 min. The supernatant was mixed with equal volume of isopropanol, mixed and let at room temperature for 10 min, centrifuged at 12000 rpm for 10 min, and then the supernatant was discarded.1 mL of 75% ethanol was added, mixed gently, centrifuged at 4℃ at 12000 rpm for 5 min, leaving the supernatant and allowed to dry at room temperature. Add 20 ~ 30µL DEPC of water to dissolve the precipitation, measure the concentration, -80℃ for storage. For reverse transcription experiments, cDNA synthesis was performed using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit (transgen) according to the instruction procedures. 2.2.4 Real-time PCR for relevant genes Real-time PCR used TransStart® Tip Green qPCR SuperMix kit (Transgen product) and the experiment was performed according to the kit instructions. Primers for ToxR, CalR, vp1667, vp1687, and 16S rRNA of the reference gene are shown in Table 1 . The sampling system is 2 TransStart® Tip Green qPCR SuperMix 10 µL, 1 µL of cDNA template, 0.5 µL of upstream and downstream primers, and ddH2O to 20 µL. The PCR procedure was set as: 95.0℃ 10 min, 95.0℃ 15s, 60.0℃ 1 min amplification for 40 cycles. Fluorescence detection read plates were set at 55.0℃ 45s stage with three replicates per sample, with different gene expression levels calculated according to formula 2- ΔΔ Ct. 2.2.5 LDH cytotoxicity test 2.2.5.1 inoculate cell suspension (100µL / well, 104–105) in a 96-well plate and place the culture plate pre-cultured in the incubator for 24h; 2.2.5.2 Add different concentrations of drugs to be tested to the culture plate; 2.2.5.3 Incubation the culture plates in the incubator for appropriate time; 2.2.5.4 10 µL Lysis Solution was added to high control blank wells, 10 µL of medium in low control wells and cultured in 37℃ CO2 incubator for 30 min; 2.2.5.5 Remove 50µL of medium supernatant from each well, take the remaining medium and cells as the detection object, add 50 µL WorkingSolution to each well, and mix well; 2.2.5.6 Incubation at room temperature for 30 min; 2.2.5.7 Absorbance at 490 nm was measured immediately 50 µL Stop Solution after addition in a microplate reader in each well. 2.3 Statistical Analysis Excel was used for data entry and collation and statistical analysis using SPSS16.0 statistical software. The measurement data are expressed as mean ± standard error (` x ± SEM); independent sample t-test (Independent-Samples T Test) between the two groups; multi-group one-way analysis (One-way ANOVA), q-test for pairwise comparisons; and α = 0.05 as the test level, and P <0.05 is considered statistically significant. Table 1 tlh, toxR and primers for 16S rRNA reference gene primer Sequence (5 '-3') 16S rRNA-RT-F GACACGGTCCAGACTCCTAC 16S rRNA-RT-R GGTGCTTCTTCTGTCGCTAAC toxR-RT-F TTGTTTGGCGTGAGCAAGG toxR-RT-R TAGCAGAGGCGTCATTGTTATC tlh -RT-F ATGAAAAGCAGTAAGTGGGC tlh -RT-R CTGAGAAGCAACAGTAAGAC 3 Results 3.1 Overview During the eight years from 2015 to 2022, the detection rate of VP increased from 2.5–43% in 2022 (Fig. 1 ); the detection rate of VP from seawater products increased from 5–41%, the detection rate of fresh water products increased from 0–45% (Fig. 2 ) for the first time in 2022; the number of food poisoning due to VP from 2015 to 2022 also increased from 0 to 6 times (Fig. 3 ). Table 2 Common genes and unique genes of freshwater products and seawater products source VP 3.3 Growth differences of VP from different sources in cultures with different salt concentrations A laboratory-preserved V. parahaemolyticus preservation tube magnetic bead (fresh water and seafood source monitored from 2015–2022) picked with a one-time inoculation ring was inoculated into BHI medium and resuscitated for 24 hours at 37℃. After activated culture, 0.1 mL of 0.5 turbidity seeds were inoculated with 0%, 0.5%, 1%, 2%, 2%, 3% and 5% sodium chloride LB medium at 37℃ constant temperature 120rpm. OD 600 light absorption values of cultures were analyzed every 2 h intervals before and during incubation. The halophilic growth curves of 0%, 0.5%, 1%, 2%, 3% and 5% sodium chloride were prepared using the absorbance value of the cultures as the abscissa. The study found that the OD of VP at 0%, 0.5% ( P <0.05), the OD of VP at 2% and 3% ( P 0.05) (Fig. 6 ). 3.4 Cytotoxic effects of halophilic variant and wild-type VP infection experiments 3.4.1 Establishment of the culture system for Caco-2 human colon cancer cells Subculture: finished Caco-2 human colon cancer cells were selected, made into cell suspensions with culture medium, inoculated in cell culture flasks, 5%CO2,37℃ for a week, changed the culture medium every 2 days, and microscopic observation, when the adherent growth reached more than 90%, passage. After absorbing the culture medium, the cultures were washed three times with PBS and pre-heated pancreatic enzyme was added for digestion for 3 min. After deremoval of the cells, the corresponding culture medium was resuspended as cell suspension and transferred to a new culture flask. Cytomorphological analysis: Inverted microscopy was performed for 1,2,4, and 7 days after one culture passage. Alveolar epithelial cells are good adherent, fusiform or spindle, no round cells are better cell cultures. Subsequently, cell membrane integrity and apoptosis were visualized by FDA / PI double staining. 3.4.2 Establishment of the infection model of the halophilic variant and wild-type Caco-2 cell lines Take 1.0-2.010 6 cells/mL(McF = 0.4–0.5) The halophilic variant and wild-type strains were infected with Caco-2 human colon cancer cells, and apoptosis or necrosis and cell activity were analyzed 3 and 6 hours after infection in culture. Cell activity was assessed by measuring the release of lactate dehydrogenase LDH from different infected experimental groups using the Cyto Tox96 kit. Cytotoxicity Cytotoxicity (%) = [(X-Z) / (Y-Z)] 100%, where X: sample hole absorbance value-background blank hole absorbance value, Y: high control hole absorbance value-high control blank hole absorbance value, Z: low control hole absorbance value-background blank hole absorbance value. Results are shown that after 3 h of infection in culture, There was no significant gap in halophilic variant and wild-type VP cytotoxicity, But in cultures with salt concentrations ranging from 0.5–1%–3%, Both the halophilic variant and the wild-type VP cytotoxicity were increased ( P <0.05) (Fig. 7 ); After 6 h of infection in the culture, There was also no significant gap in halophilic variant and wild-type VP cytotoxicity, But in cultures with salt concentrations ranging from 0.5–1%–3%, Both halophilic variant and wild-type VP cytotoxicity were reduced ( P <0.05) (Fig. 8 ); Both wild-type VP and halophilic variant VP were significantly different after infection in culture at different salt concentrations ( P <0.05) (Fig. 9 and Fig. 10). 4 Discussion This study is the first systematic study of vibrio parahaemolyticus detected in fresh water products in Changzhou area, including snails, river shrimp, mussels and copper rust snails, freshwater products, product species covering routine food risk monitoring samples from 2015–2022 and food poisoning samples from 2015–2022, the survey results are representative, and will provide certain data basis for establishing early warning system of food poisoning caused by Vibrio parahaemolyticus in the future. It is well known that when the external living environment of bacteria changes (such as PH [ 11 ], temperature [ 12 ], salt concentration [ 13 ], etc.), bacteria will quickly produce stress response, adjust their protein expression profile, and realize their adaptive [ 14 ] in adversity. The bacterial stress response to the environment is a very complex process in which most genes of the genome participate, and by regulating the expression of key proteins, it may cause changes in multiple biological properties including pathogenicity [ 15 ]. Studies have found that [ 16 ], VP grown at 1% salt concentration on Caco-2 intestinal cells toxicity significantly greater than VP grown at 3% salt concentration, we also confirmed in the experiment in 1% salt concentration infection cytotoxicity significantly higher than 3% salt concentration infection 6h of cytotoxicity, thus suggests that VP after feeling the change in external salt concentration, cytotoxic effect of pathogenic change. Whether the underlying mechanism is through differential expression at the gene level or regulation at the transcriptional level is not clear. This project early through whole genome sequencing found freshwater source VP and seawater source VP 250 kinds of common genes and 46 kinds of unique genes, and lack of VPA0450 expression in seawater source VP, thus, we concluded that different salt concentration environment formation of selective pressure, induce related gene transcription level regulation, change the expression of different virulence factors, so as to realize the adaptability of VP and pathogenicity changes. The study found that in addition to the well-known thermostable direct hemolysis toxin (Thermostable direct hemolysin, TDH) and refractory direct hemolysis-related toxin (TDH-related hemolysin, TRH), type secretion system (Type III secretion systems, T3SS) is also the main cause of VP causing diarrhea [ 17 – 19 ]. The VP has 2 T3SS systems, T3SS1 and T3SS2 [ 20 ]. T3SS1 Is ubiquitous in VP, under the external environment pressure, its effectors VopQ, VopR, VopS and VPA0450 have different degrees of activation and expression of [ 21 ], common participation and attack the host cell physiological process and induce non-apoptotic cell death, resulting in cytotoxicity, we found by whole genome sequencing in seawater products VPA0450 deletion, may be related to its weakened cytotoxicity. ToxR, a ubiquitous transmembrane regulatory protein in Vibrio, is required for bacterial survival under adverse environmental conditions and plays an important role in regulating bacterial stress tolerance and virulence expression [ 22 ]. We have shown that ToxR and another important regulator, CalR, cooperate in the VP to regulate the expression of some T3SS1 genes, [ 23 ]. CalR is a transcriptional regulator of VP0350 encoding the LysR family of regulators. The binding of ToxR to the promoter region of CalR activates the transcription of the calR gene, and calR can bind to the T3SS1 gene to alter the expression [ 24 ] of the effectors VopQ, VopR, VopS and VPA0450, thereby affecting the T3SS1-dependent cytotoxicity of V. parahaemolyticus. Previous studies have found that ToxR is involved in the regulation of the tolerance and cytotoxic effects of VP on different environmental pressures (temperature, PH, and salt concentration). Therefore, the ToxR-CalR regulatory pathway deserves further study on the expression of halophilic variant VP and its pathogenicity. 5 Discussion In view of the diversity of VP pollution routes in freshwater products, it is an urgent problem to carry out special monitoring of VP pollution routes in circulation links and catering links, so as to prevent its infection and reduce the risk. In view of the characteristics and growth laws of foodborne pathogen pollution in aquatic products, the exploration of prevention and control measures is promoted, and the construction and application of safety management system in aquaculture, storage and transportation, production and processing, and sales of aquatic products is actively promoted, so as to achieve effective control of foodborne pollution and reduce the occurrence of foodborne diseases. Declarations Author Contributions: Conceptualization, X.D. and Y.Z.; methodology, D.W, J.C. and Q.D.; validation, X.D. and D.W.; date analysis, B.T. and X.M.; investigation, F.M., B.T., X.M., J.L. and X.D. ; resources, F.W. and X.M.; data curation, X.M.; writing—original draft preparation, X.D. and Y.Z.; writing—review and editing, F.W., X.D. and Y.Z.; supervision,Y.Z.; project administration,Y.Z.; funding acquisition,Y.Z., F.W. and X.M..All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Open Research Fund Program of Changzhou Institute for Advanced Study of Public Health,Nanjing Medical University (No.CPHN202301),Changzhou Key Laboratory of Pathogen Biology (CM20223016),Changzhou Science and Technology Foundation(CJ20220237),Changzhou Health Green Seedling Talent Plan(CZQM2023026),Changzhou Science and Technology Foundation(CJ20220158),Changzhou City health Commission youth project(QN202334),Jiangsu Province key research and development plan social development surface project(BE2023694),Jiangsu Provincial health Committee project(H2023060). Institutional Review Board Statement: This study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of Changzhou Institute for Advanced Study of Public Health, Nanjing Medical University. Informed Consent Statement: Informed consent was obtained from all subjects involved in this study. Data Availability Statement: The data presented in this study are available on request from the corresponding author. Acknowledgments: The authors would like to thank friends who helped learn the cell model. We confirm that all individuals included in this section have consented to the acknowledgement. Confficts of Interest: The authors declare no confficts of interest. The funders had no role in the design of this study; in the collection, analyses, or interpretation of data; in the writing of this manuscript; or in the decision to publish the results. Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. References Jetnapang Kongrueng ,Pimonsri Mitraparp-Arthorn , Khotchawan Bangpanwimon ,et al.Isolation of Bdellovibrio and like organisms and potential to reduce acute hepatopancreatic necrosis disease caused by Vibrio parahaemolyticus.Dis Aquat Organ.2017 May 11;124(3):223-232. Craig Baker-Austin, James D Oliver, Munirul Alam,et al.Vibrio spp.infections.Nat Rev Dis Primers.2018 Jul 12;4(1):8. Ligia V da Silva , Sylvia Ossai , Paulinus Chigbu ,et al.Antimicrobial and Genetic Profiles of Vibrio vulnificus and Vibrio parahaemolyticus Isolated From the Maryland Coastal Bays, United States.Front Microbiol.2021 May 21;12:676249. Maryse Bonnin-Jusserand , Stéphanie Copin , Cédric Le Bris ,et al.Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V.parahaemolyticus and V.vulnificus): Review of microbiological versus recent molecular detection methods in seafood products.Crit Rev Food Sci Nutr.2019;59(4):597-610. Lingzhi Li , Hongmei Meng , Dan Gu ,et al.Molecular mechanisms of Vibrio parahaemolyticus pathogenesis.Microbiol Res.2019 May;222:43-51. R M Twedt , R M Novelli .Modified selective and differential isolation medium for Vibrio parahaemolyticus.Appl Microbiol.1971 Oct;22(4):593-9. Qingyao Wang , Songzhe Fu , Qian Yang ,et al.The Impact of Water Intrusion on Pathogenic Vibrio Species to Inland Brackish Waters of China.Int J Environ Res Public Health.2020 Sep 17;17(18):6781. Dongsheng Han , Fei Yu , Hui Tang ,et al.Spreading of Pandemic Vibrio parahaemolyticus O3:K6 and Its Serovariants: A Re-analysis of Strains Isolated from Multiple Studies.Front Cell Infect Microbiol.2017 May 18;7:188. Chao Yang , Xianglilan Zhang , Hang Fan ,et al.Genetic diversity, virulence factors and farm-to-table spread pattern of Vibrio parahaemolyticus food-associated isolates.Food Microbiol.2019 Dec;84:103270. Ni Yunlong, Qiao Xin, Wang Yanmei, et al. Analysis of contamination of Vibrio parahaemolyticus in Jiangsu Province from 2010 to 2020 [J]. Jiangsu Preventive Medicine, 2023,34 (1): 89-92. DOI:10.13668/j.issn.1006-9070.2023.01.026. Reham Wasfi , Ola A Abd El-Rahman , Mai M Zafer ,et al.Probiotic Lactobacillus sp.inhibit growth, biofilm formation and gene expression of caries-inducing Streptococcus mutans.J Cell Mol Med.2018 Mar;22(3):1972-1983. O I Slabova , D I Nikitin .Influence of the incubation temperature on the reaction of oligotrophic bacteria to stress.Mikrobiologiia.2004 Nov-Dec;73(6):758-62. M Cánovas , V Bernal , A Sevilla , T Torroglosa ,et al.Salt stress effects on the central and carnitine metabolisms of Escherichia coli.Biotechnol Bioeng.2007 Mar 1;96(4):722-37. Rohinishree Yadahalli Shrihari , Negi Pradeep Singh .Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.J Food Sci.2012 Feb;77(2):M95-101. B M Fredrik Pettersson , Ram G Nitharwal , Sarbashis Das ,et al.Identification and expression of stressosomal proteins in Mycobacterium marinum under various growth and stress conditions.FEMS Microbiol Lett.2013 May;342(2):98-105. W Brian Whitaker , Michelle A Parent , Lynn M Naughton ,et al.Modulation of responses of Vibrio parahaemolyticus O3:K6 to pH and temperature stresses by growth at different salt concentrations.Appl Environ Microbiol.2010 Jul;76(14):4720-9. Gururaja Perumal Pazhani, Goutam Chowdhury, Thandavarayan Ramamurthy.Adaptations of Vibrio parahaemolyticus to Stress During Environmental Survival, Host Colonization, and Infection.Front Microbiol.2021 Oct 7;12:737299. Charles R Lovell .Ecological fitness and virulence features of Vibrio parahaemolyticus in estuarine environments.Appl Microbiol Biotechnol.2017 Mar;101(5):1781-1794. Yibei Zhang, Huanhuan Liu , Dan Gu,et al.Transcriptomic analysis of PhoR reveals its role in regulation of swarming motility and T3SS expression in Vibrio parahaemolyticus.Microbiol Res.2020 May;235:126448. Toshio Kodama, Hirotaka Hiyoshi, Ryu Okada,et al.Regulation of Vibrio parahaemolyticus T3SS2 gene expression and function of T3SS2 effectors that modulate actin cytoskeleton.Cell Microbiol.2015 Feb;17(2):183-90. Anh Quoc Nguyen , Takaaki Shimohata, Sho Hatayama,et al.Type III Secretion Effector VopQ of Vibrio parahaemolyticus Modulates Central Carbon Metabolism in Epithelial Cells.mSphere.2020 Mar 18;5(2):e00960-19. Yiquan Zhang , Lingfei Hu , George Osei-Adjei ,et al.Autoregulation of toxR and Its Regulatory Actions on Major Virulence Gene Loci in Vibrio parahaemolyticus.Front Cell Infect Microbiol.2018 Sep 5;8:291. George Osei-Adjei , He Gao , Ying Zhang .Regulatory actions of ToxR and CalR on their own genes and type III secretion system 1 in Vibrio parahaemolyticus.Oncotarget.2017 Jul 22;8(39):65809-65822. Zhuoying Zhu , Lianzhi Yang , Pan Yu ,et al.Comparative Proteomics and Secretomics Revealed Virulence and Antibiotic Resistance-Associated Factors in Vibrio parahaemolyticus Recovered From Commonly Consumed Aquatic Products.Front Microbiol.2020 Jul 14;11:1453. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4544828","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":317953935,"identity":"bd222d31-9980-4c85-a771-25108d837dca","order_by":0,"name":"Xin Dong","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYDCCAyDCgKF+/2HGxgcfKiTk5InVwthwvPmw4YwzFsaGDURpYQBqOXMsTZq3rSIRJoIT8B3vPfyap+AOM+OMHDNp3nkSCYwNzA8f3cCjRfLMuTTLGQbP2Jglcowt526TyGNnYDM2zsGjxeBGjpnBB4PDPGwSOYY33m6TKGZs4GGTJqglweCwBI9EjoEE7xyJxIYDhLUYPwDaYiDBcyxJkreBCC2SZ86YMc4wOJxgwA4K5GMSxobNBPzCd7zH+DPPH6AWZlBU1tTJybM3P3yMTwsQsEmg8pnxKwcr+UBYzSgYBaNgFIxoAADzNFEA1meTxwAAAABJRU5ErkJggg==","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Dong","suffix":""},{"id":317953936,"identity":"fe141a54-8bb2-49d1-98fa-b835da4efedc","order_by":1,"name":"Dan Wu","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Wu","suffix":""},{"id":317953937,"identity":"6e37627b-3253-468f-be16-ce12ee265cd7","order_by":2,"name":"Jia Chen","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Jia","middleName":"","lastName":"Chen","suffix":""},{"id":317953938,"identity":"b7a276fd-47d7-4244-aa6d-e5e45bec70e3","order_by":3,"name":"Qiang Du","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Du","suffix":""},{"id":317953939,"identity":"8324dd73-f71e-42d1-b94c-a322be8a7785","order_by":4,"name":"Bowen Tu","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Bowen","middleName":"","lastName":"Tu","suffix":""},{"id":317953940,"identity":"4e1d04a4-20de-4e87-9e2b-c1a8078dc633","order_by":5,"name":"Xujian Mao","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Xujian","middleName":"","lastName":"Mao","suffix":""},{"id":317953941,"identity":"0374dd20-6a2d-4a1c-9ee2-c76b02907f85","order_by":6,"name":"Fengming Wang","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Fengming","middleName":"","lastName":"Wang","suffix":""},{"id":317953942,"identity":"964662a8-e41e-49f6-8016-51923ebaef9d","order_by":7,"name":"Ying Zhao","email":"","orcid":"","institution":"Changzhou Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2024-06-07 08:41:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4544828/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4544828/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58929023,"identity":"40adb0ab-c9a9-4c6d-ae06-08388dd8acf0","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":113426,"visible":true,"origin":"","legend":"\u003cp\u003eVP detection rate in food risk monitoring in Changzhou from 2015 to 2022\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/3b83ed410c545b1ba2ca7143.png"},{"id":58929973,"identity":"a28a24aa-f275-4f55-a167-eb4f57dbc467","added_by":"auto","created_at":"2024-06-24 08:56:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":156752,"visible":true,"origin":"","legend":"\u003cp\u003eDetection rate of freshwater product VP and seawater product VP from 2015 to 2022\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/acc2165e70530c0c6f885575.png"},{"id":58929030,"identity":"bf81c9cd-7170-4d33-99b6-eb527a5e2f46","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":70253,"visible":true,"origin":"","legend":"\u003cp\u003eNumber of food poisoning caused by VP from 2015 to 2022\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/9048287eb19fbf718a738c7a.png"},{"id":58929022,"identity":"07bbda4b-8567-4956-ab87-3acc29e7906a","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":61678,"visible":true,"origin":"","legend":"\u003cp\u003etoxR and tlh in freshwater product VP and seawater product VP\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/30a59d5cda861267cb00134c.png"},{"id":58929975,"identity":"1540c978-90a4-4e65-90a6-d8f58a0fa10a","added_by":"auto","created_at":"2024-06-24 08:56:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":41548,"visible":true,"origin":"","legend":"\u003cp\u003eCommon genes and unique genes of freshwater products and seawater products source VP (A-freshwater VP; B-seawater VP)\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/ac1b711f3055a66a91b0ac8a.png"},{"id":58929026,"identity":"28268a32-2479-4067-8a56-b4d62aa4ebdc","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":159444,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth differences of freshwater products and seawater product sources VP in cultures with different salt concentrations\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/b37521476079b16020343ae8.png"},{"id":58929029,"identity":"3f6c2799-de53-4a5f-949b-785398d8e5ac","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":127018,"visible":true,"origin":"","legend":"\u003cp\u003eCytotoxicity of halophilic variant and wild-type VP for 3h in cultures with different salt concentrations\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/779469e0b2fcf5e5ff6576c8.png"},{"id":58930762,"identity":"b263d710-3fe4-49b0-91ed-e3ba02f86e81","added_by":"auto","created_at":"2024-06-24 09:04:41","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":125071,"visible":true,"origin":"","legend":"\u003cp\u003e6h cytotoxicity of halophilic variant and wild-type VP in cultures with different salt concentrations\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/fb5b81eb1fb0976c6b5eac18.png"},{"id":58929024,"identity":"5c2b4123-0ca5-4f23-bf42-f5cfef84dee6","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":60979,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 8 Cytotoxicity of wild-type VP at 3 and 6 h at different salt concentrations\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/cb6884627a210751dff35a0b.png"},{"id":58929028,"identity":"e8d69385-f201-484b-88dd-332f9d38e7cd","added_by":"auto","created_at":"2024-06-24 08:48:41","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":60647,"visible":true,"origin":"","legend":"\u003cp\u003eCytotoxicity of halophilic variant VP at 3 and 6 hours at different salt concentrations\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/21154d7efd38c969537ae8db.png"},{"id":63197179,"identity":"4e47d418-05f6-40b4-b4e2-64053c2b74ba","added_by":"auto","created_at":"2024-08-24 20:46:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1562772,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4544828/v1/60f7efc8-4748-468f-a6f4-e9996c416478.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Virulence gene expression of halophilic variant V.parahaemolyticus and its effect on pathogenicity","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eFrom 2015 to 2017,52.1% of the food-borne disease outbreaks in Jiangsu province were caused by VP, and from 2010 to 2020,20.41% and 15.50% of the outbreaks were caused by VP in inland and coastal areas of Jiangsu province [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Changzhou city belongs to the Yangtze River Delta region of Jiangsu Province, with developed aquatic products and severe disease burden caused by VP. Now, the detection of VP in aquatic products in Changzhou area from 2015 to 2022 is analyzed. The detection of V. parahaemolyticus in Changzhou from 2015 to 2022 was explored, and VP in seawater products and VP in freshwater products were tested under different salt concentration conditions. Methods:Food risk monitoring and food poisoning VP strains from 2015 to 2022, There were 48 VP strains from sea products and 46 VP strains from fresh water products were tested for VP. Results:This paper analyzed the detection of VP in food risk monitoring in Changzhou from 2015 to 2022, the detection rate increased from 2.5% in 2015 to 43% in 2022; the detection of VP of seawater products and VP of freshwater products were calculated respectively, the VP detection rate of seawater product source increased from 5\u0026ndash;41%, the detection rate of VP from freshwater products increased from 0\u0026ndash;45%. It is worth noting that for the first time in 2022, the VP detection rate of freshwater sources exceeded that of seawater product sources (41% and 45%, respectively); The number of food poisoning due to VP also increased year by year from 2015 to 2022. Subsequent tests found that the growth and virulence differences of VP from different aquatic products under different salt concentrations were different (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), which proved that the halinophilia of some VP changed and the \"halophilic variant\" VP appeared. Conclusion:According to the statistics of the detection of VP of different aquatic products from 2015 to 2022, the growth and virulence differences of VP of different aquatic products cultured with different salt concentrations, the VP pollution rate of freshwater products sources urgently needs to be paid attention to, and further risk assessment should be carried out to provide a basis for food safety risk management.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cp\u003e2.1 Sample source: VP-positive strains detected by food risk monitoring and food poisoning from 2015 to 2022, including VP strains of seawater products, such as sea cucumber, flower gum, salmon and conch, and VP strains of freshwater products, such as incense snail, river shrimp, mussel and copper rust ring snail. All VP strains were kept in the Microbank strain storage tubes and placed in the-80℃ refrigerator.\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2 Methods\u003c/h2\u003e\n \u003cp\u003e\u003cspan\u003e2.2.1 Analysis and screening of wild type and halophilic variant VP to obtain VP samples for study;\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e2.2.2 Test method According to GB 4789.7\u0026ndash;2013 national standard of V. parahaemolyticus, all strains were tested to 99%. The olysin (tlh) gene and virulence expression regulation (toxR) gene were measured using real-time PCR. Wild-type and halophilic variant VP were grown using sodium chloride LB medium configured with nutrient broth medium with different salt concentrations and OD values were recorded at 2h intervals for 24h. Whole genome sequencing technology was used to examine the expression differences of virulence system-related T3SS1 secretion effector genes (VopQ, VopR, VopS, and VPA0450) of wild-type and halophilic variant VP. A Caco-2 intestinal cell infection model was developed and analyzed to compare the differences in the cytotoxic effects of wild-type and halophilic variant VP strains.\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e\n \u003ch2\u003e2.2.3 RNA extraction as well as cDNA synthesis\u003c/h2\u003e\n \u003cp\u003eAfter log growth bacteria to supernatant, add RNAiso Plus lysate, let at room temperature for 5 min (or fully ground), and transferred to RNase-free Ep tubes by centrifugation at 4℃ at 12000 rpm for 5 min. The supernatant was removed, plus 100 \u0026micro;L chloroform, mixed well and centrifuged at 4℃, 12000 rpm for 15 min. The supernatant was mixed with equal volume of isopropanol, mixed and let at room temperature for 10 min, centrifuged at 12000 rpm for 10 min, and then the supernatant was discarded.1 mL of 75% ethanol was added, mixed gently, centrifuged at 4℃ at 12000 rpm for 5 min, leaving the supernatant and allowed to dry at room temperature. Add 20\u0026thinsp;~\u0026thinsp;30\u0026micro;L DEPC of water to dissolve the precipitation, measure the concentration, -80℃ for storage. For reverse transcription experiments, cDNA synthesis was performed using the TransScript\u0026reg; One-Step gDNA Removal and cDNA Synthesis SuperMix kit (transgen) according to the instruction procedures.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e\n \u003ch2\u003e2.2.4 Real-time PCR for relevant genes\u003c/h2\u003e\n \u003cp\u003eReal-time PCR used TransStart\u0026reg; Tip Green qPCR SuperMix kit (Transgen product) and the experiment was performed according to the kit instructions. Primers for ToxR, CalR, vp1667, vp1687, and 16S rRNA of the reference gene are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The sampling system is 2 TransStart\u0026reg; Tip Green qPCR SuperMix 10 \u0026micro;L, 1 \u0026micro;L of cDNA template, 0.5 \u0026micro;L of upstream and downstream primers, and ddH2O to 20 \u0026micro;L. The PCR procedure was set as: 95.0℃ 10 min, 95.0℃ 15s, 60.0℃ 1 min amplification for 40 cycles. Fluorescence detection read plates were set at 55.0℃ 45s stage with three replicates per sample, with different gene expression levels calculated according to formula 2- \u0026Delta;\u0026Delta; Ct.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e\n \u003ch2\u003e2.2.5 LDH cytotoxicity test\u003c/h2\u003e\n \u003cp\u003e2.2.5.1 inoculate cell suspension (100\u0026micro;L / well, 104\u0026ndash;105) in a 96-well plate and place the culture plate pre-cultured in the incubator for 24h;\u003c/p\u003e\n \u003cdiv id=\"Sec7\" class=\"Section4\"\u003e\n \u003ch2\u003e2.2.5.2 Add different concentrations of drugs to be tested to the culture plate;\u003c/h2\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec8\" class=\"Section4\"\u003e\n \u003ch2\u003e2.2.5.3 Incubation the culture plates in the incubator for appropriate time;\u003c/h2\u003e\n \u003cp\u003e\u003cspan\u003e2.2.5.4 10 \u0026micro;L Lysis Solution was added to high control blank wells, 10 \u0026micro;L of medium in low control wells and cultured in 37℃ CO2 incubator for 30 min;\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e2.2.5.5 Remove 50\u0026micro;L of medium supernatant from each well, take the remaining medium and cells as the detection object, add 50 \u0026micro;L WorkingSolution to each well, and mix well;\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec9\" class=\"Section4\"\u003e\n \u003ch2\u003e2.2.5.6 Incubation at room temperature for 30 min;\u003c/h2\u003e\u003cbr\u003e\n \u003cp\u003e\u003cspan\u003e2.2.5.7 Absorbance at 490 nm was measured immediately 50 \u0026micro;L Stop Solution after addition in a microplate reader in each well.\u003cbr\u003e\u003c/span\u003e \u003cspan\u003e2.3 Statistical Analysis Excel was used for data entry and collation and statistical analysis using SPSS16.0 statistical software. The measurement data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (` x\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM); independent sample t-test (Independent-Samples T Test) between the two groups; multi-group one-way analysis (One-way ANOVA), q-test for pairwise comparisons; and \u0026alpha;\u0026thinsp;=\u0026thinsp;0.05 as the test level, and \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 is considered statistically significant.\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\u003cbr\u003e\n \u003cdiv\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003etlh, toxR and primers for 16S rRNA reference gene\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003eprimer\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003eSequence (5 \u0026apos;-3\u0026apos;)\u003cbr\u003e\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e16S rRNA-RT-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGACACGGTCCAGACTCCTAC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e16S rRNA-RT-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGGTGCTTCTTCTGTCGCTAAC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003etoxR-RT-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTTGTTTGGCGTGAGCAAGG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003etoxR-RT-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTAGCAGAGGCGTCATTGTTATC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003etlh -RT-F\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eATGAAAAGCAGTAAGTGGGC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003etlh -RT-R\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCTGAGAAGCAACAGTAAGAC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"3 Results","content":"\u003cp\u003e3.1 Overview During the eight years from 2015 to 2022, the detection rate of VP increased from 2.5\u0026ndash;43% in 2022 (Fig. \u003cspan\u003e1\u003c/span\u003e); the detection rate of VP from seawater products increased from 5\u0026ndash;41%, the detection rate of fresh water products increased from 0\u0026ndash;45% (Fig. \u003cspan\u003e2\u003c/span\u003e) for the first time in 2022; the number of food poisoning due to VP from 2015 to 2022 also increased from 0 to 6 times (Fig. \u003cspan\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eTable 2 Common genes and unique genes of freshwater products and seawater products source VP\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"https://myfiles.space/user_files/122228_c8a1650c59388082/122228_custom_files/img1719218182.png\"\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003e3.3 Growth differences of VP from different sources in cultures with different salt concentrations\u003c/h2\u003e\n \u003cp\u003eA laboratory-preserved V. parahaemolyticus preservation tube magnetic bead (fresh water and seafood source monitored from 2015\u0026ndash;2022) picked with a one-time inoculation ring was inoculated into BHI medium and resuscitated for 24 hours at 37℃. After activated culture, 0.1 mL of 0.5 turbidity seeds were inoculated with 0%, 0.5%, 1%, 2%, 2%, 3% and 5% sodium chloride LB medium at 37℃ constant temperature 120rpm. OD 600 light absorption values of cultures were analyzed every 2 h intervals before and during incubation. The halophilic growth curves of 0%, 0.5%, 1%, 2%, 3% and 5% sodium chloride were prepared using the absorbance value of the cultures as the abscissa. The study found that the OD of VP at 0%, 0.5% (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), the OD of VP at 2% and 3% (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), and no significant difference in OD at 5% (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig. \u003cspan\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\"\u003e\n \u003ch2\u003e3.4 Cytotoxic effects of halophilic variant and wild-type VP infection experiments\u003c/h2\u003e\n \u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003e3.4.1 Establishment of the culture system for Caco-2 human colon cancer cells\u003c/h2\u003e\n \u003cp\u003eSubculture: finished Caco-2 human colon cancer cells were selected, made into cell suspensions with culture medium, inoculated in cell culture flasks, 5%CO2,37℃ for a week, changed the culture medium every 2 days, and microscopic observation, when the adherent growth reached more than 90%, passage. After absorbing the culture medium, the cultures were washed three times with PBS and pre-heated pancreatic enzyme was added for digestion for 3 min. After deremoval of the cells, the corresponding culture medium was resuspended as cell suspension and transferred to a new culture flask.\u003c/p\u003e\n \u003cp\u003eCytomorphological analysis: Inverted microscopy was performed for 1,2,4, and 7 days after one culture passage. Alveolar epithelial cells are good adherent, fusiform or spindle, no round cells are better cell cultures. Subsequently, cell membrane integrity and apoptosis were visualized by FDA / PI double staining.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003e3.4.2 Establishment of the infection model of the halophilic variant and wild-type Caco-2 cell lines\u003c/h2\u003e\n \u003cp\u003eTake 1.0-2.010\u003csup\u003e6\u003c/sup\u003ecells/mL(McF\u0026thinsp;=\u0026thinsp;0.4\u0026ndash;0.5) The halophilic variant and wild-type strains were infected with Caco-2 human colon cancer cells, and apoptosis or necrosis and cell activity were analyzed 3 and 6 hours after infection in culture. Cell activity was assessed by measuring the release of lactate dehydrogenase LDH from different infected experimental groups using the Cyto Tox96 kit. Cytotoxicity Cytotoxicity (%) = [(X-Z) / (Y-Z)] 100%, where X: sample hole absorbance value-background blank hole absorbance value, Y: high control hole absorbance value-high control blank hole absorbance value, Z: low control hole absorbance value-background blank hole absorbance value. Results are shown that after 3 h of infection in culture, There was no significant gap in halophilic variant and wild-type VP cytotoxicity, But in cultures with salt concentrations ranging from 0.5\u0026ndash;1%\u0026ndash;3%, Both the halophilic variant and the wild-type VP cytotoxicity were increased (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05) (Fig. \u003cspan\u003e7\u003c/span\u003e); After 6 h of infection in the culture, There was also no significant gap in halophilic variant and wild-type VP cytotoxicity, But in cultures with salt concentrations ranging from 0.5\u0026ndash;1%\u0026ndash;3%, Both halophilic variant and wild-type VP cytotoxicity were reduced (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05) (Fig. \u003cspan\u003e8\u003c/span\u003e); Both wild-type VP and halophilic variant VP were significantly different after infection in culture at different salt concentrations (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05) (Fig. \u003cspan\u003e9\u003c/span\u003e and Fig. 10).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThis study is the first systematic study of vibrio parahaemolyticus detected in fresh water products in Changzhou area, including snails, river shrimp, mussels and copper rust snails, freshwater products, product species covering routine food risk monitoring samples from 2015\u0026ndash;2022 and food poisoning samples from 2015\u0026ndash;2022, the survey results are representative, and will provide certain data basis for establishing early warning system of food poisoning caused by Vibrio parahaemolyticus in the future.\u003c/p\u003e \u003cp\u003eIt is well known that when the external living environment of bacteria changes (such as PH [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], temperature [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], salt concentration [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], etc.), bacteria will quickly produce stress response, adjust their protein expression profile, and realize their adaptive [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] in adversity. The bacterial stress response to the environment is a very complex process in which most genes of the genome participate, and by regulating the expression of key proteins, it may cause changes in multiple biological properties including pathogenicity [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Studies have found that [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], VP grown at 1% salt concentration on Caco-2 intestinal cells toxicity significantly greater than VP grown at 3% salt concentration, we also confirmed in the experiment in 1% salt concentration infection cytotoxicity significantly higher than 3% salt concentration infection 6h of cytotoxicity, thus suggests that VP after feeling the change in external salt concentration, cytotoxic effect of pathogenic change. Whether the underlying mechanism is through differential expression at the gene level or regulation at the transcriptional level is not clear. This project early through whole genome sequencing found freshwater source VP and seawater source VP 250 kinds of common genes and 46 kinds of unique genes, and lack of VPA0450 expression in seawater source VP, thus, we concluded that different salt concentration environment formation of selective pressure, induce related gene transcription level regulation, change the expression of different virulence factors, so as to realize the adaptability of VP and pathogenicity changes.\u003c/p\u003e \u003cp\u003eThe study found that in addition to the well-known thermostable direct hemolysis toxin (Thermostable direct hemolysin, TDH) and refractory direct hemolysis-related toxin (TDH-related hemolysin, TRH), type secretion system (Type III secretion systems, T3SS) is also the main cause of VP causing diarrhea [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The VP has 2 T3SS systems, T3SS1 and T3SS2 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. T3SS1 Is ubiquitous in VP, under the external environment pressure, its effectors VopQ, VopR, VopS and VPA0450 have different degrees of activation and expression of [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], common participation and attack the host cell physiological process and induce non-apoptotic cell death, resulting in cytotoxicity, we found by whole genome sequencing in seawater products VPA0450 deletion, may be related to its weakened cytotoxicity.\u003c/p\u003e \u003cp\u003eToxR, a ubiquitous transmembrane regulatory protein in Vibrio, is required for bacterial survival under adverse environmental conditions and plays an important role in regulating bacterial stress tolerance and virulence expression [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. We have shown that ToxR and another important regulator, CalR, cooperate in the VP to regulate the expression of some T3SS1 genes, [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. CalR is a transcriptional regulator of VP0350 encoding the LysR family of regulators. The binding of ToxR to the promoter region of CalR activates the transcription of the calR gene, and calR can bind to the T3SS1 gene to alter the expression [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] of the effectors VopQ, VopR, VopS and VPA0450, thereby affecting the T3SS1-dependent cytotoxicity of V. parahaemolyticus. Previous studies have found that ToxR is involved in the regulation of the tolerance and cytotoxic effects of VP on different environmental pressures (temperature, PH, and salt concentration). Therefore, the ToxR-CalR regulatory pathway deserves further study on the expression of halophilic variant VP and its pathogenicity.\u003c/p\u003e"},{"header":"5 Discussion","content":"\u003cp\u003eIn view of the diversity of VP pollution routes in freshwater products, it is an urgent problem to carry out special monitoring of VP pollution routes in circulation links and catering links, so as to prevent its infection and reduce the risk. In view of the characteristics and growth laws of foodborne pathogen pollution in aquatic products, the exploration of prevention and control measures is promoted, and the construction and application of safety management system in aquaculture, storage and transportation, production and processing, and sales of aquatic products is actively promoted, so as to achieve effective control of foodborne pollution and reduce the occurrence of foodborne diseases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAuthor Contributions: Conceptualization, X.D. and Y.Z.; methodology, D.W, J.C. and Q.D.; validation, X.D. and D.W.; date analysis, B.T. and X.M.; investigation, F.M., B.T., X.M., J.L. and X.D. ; resources, F.W. and X.M.; data curation, X.M.; writing\u0026mdash;original draft preparation, X.D. and Y.Z.; writing\u0026mdash;review and editing, F.W., X.D. and Y.Z.; supervision,Y.Z.; project administration,Y.Z.; funding acquisition,Y.Z., F.W. and X.M..All authors have read and agreed to the published version of the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding: This research was funded by the Open Research Fund Program of Changzhou Institute for Advanced Study of Public Health,Nanjing Medical University (No.CPHN202301),Changzhou Key Laboratory of Pathogen Biology (CM20223016),Changzhou Science and Technology Foundation(CJ20220237),Changzhou Health Green Seedling Talent Plan(CZQM2023026),Changzhou Science and Technology Foundation(CJ20220158),Changzhou City health Commission youth project(QN202334),Jiangsu Province key research and development plan social development surface project(BE2023694),Jiangsu Provincial health Committee project(H2023060).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Institutional Review Board Statement: This study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of Changzhou Institute for Advanced Study of Public Health, Nanjing Medical University.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInformed Consent Statement: Informed consent was obtained from all subjects involved in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eData Availability Statement: The data presented in this study are available on request from the corresponding author.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAcknowledgments: The authors would like to thank friends who helped learn the cell model. We confirm that all individuals included in this section have consented to the acknowledgement.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConfficts of Interest: The authors declare no confficts of interest. The funders had no role in the design of this study; in the collection, analyses, or interpretation of data; in the writing of this manuscript; or in the decision to publish the results.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDisclaimer/Publisher\u0026rsquo;s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eJetnapang Kongrueng ,Pimonsri Mitraparp-Arthorn , Khotchawan Bangpanwimon ,et al.Isolation of Bdellovibrio and like organisms and potential to reduce acute hepatopancreatic necrosis disease caused by Vibrio parahaemolyticus.Dis Aquat Organ.2017 May 11;124(3):223-232.\u003c/li\u003e\n\u003cli\u003eCraig Baker-Austin, James D Oliver, Munirul Alam,et al.Vibrio spp.infections.Nat Rev Dis Primers.2018 Jul 12;4(1):8.\u003c/li\u003e\n\u003cli\u003eLigia V da Silva , Sylvia Ossai , Paulinus Chigbu ,et al.Antimicrobial and Genetic Profiles of Vibrio vulnificus and Vibrio parahaemolyticus Isolated From the Maryland Coastal Bays, United States.Front Microbiol.2021 May 21;12:676249.\u003c/li\u003e\n\u003cli\u003eMaryse Bonnin-Jusserand , St\u0026eacute;phanie Copin , C\u0026eacute;dric Le Bris ,et al.Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V.parahaemolyticus and V.vulnificus): Review of microbiological versus recent molecular detection methods in seafood products.Crit Rev Food Sci Nutr.2019;59(4):597-610.\u003c/li\u003e\n\u003cli\u003eLingzhi Li , Hongmei Meng , Dan Gu ,et al.Molecular mechanisms of Vibrio parahaemolyticus pathogenesis.Microbiol Res.2019 May;222:43-51.\u003c/li\u003e\n\u003cli\u003eR M Twedt , R M Novelli .Modified selective and differential isolation medium for Vibrio parahaemolyticus.Appl Microbiol.1971 Oct;22(4):593-9.\u003c/li\u003e\n\u003cli\u003eQingyao Wang , Songzhe Fu , Qian Yang ,et al.The Impact of Water Intrusion on Pathogenic Vibrio Species to Inland Brackish Waters of China.Int J Environ Res Public Health.2020 Sep 17;17(18):6781.\u003c/li\u003e\n\u003cli\u003eDongsheng Han , Fei Yu , Hui Tang ,et al.Spreading of Pandemic Vibrio parahaemolyticus O3:K6 and Its Serovariants: A Re-analysis of Strains Isolated from Multiple Studies.Front Cell Infect Microbiol.2017 May 18;7:188.\u003c/li\u003e\n\u003cli\u003eChao Yang , Xianglilan Zhang , Hang Fan ,et al.Genetic diversity, virulence factors and farm-to-table spread pattern of Vibrio parahaemolyticus food-associated isolates.Food Microbiol.2019 Dec;84:103270.\u003c/li\u003e\n\u003cli\u003eNi Yunlong, Qiao Xin, Wang Yanmei, et al. Analysis of contamination of Vibrio parahaemolyticus in Jiangsu Province from 2010 to 2020 [J]. Jiangsu Preventive Medicine, 2023,34 (1): 89-92. DOI:10.13668/j.issn.1006-9070.2023.01.026.\u003c/li\u003e\n\u003cli\u003eReham Wasfi , Ola A Abd El-Rahman , Mai M Zafer ,et al.Probiotic Lactobacillus sp.inhibit growth, biofilm formation and gene expression of caries-inducing Streptococcus mutans.J Cell Mol Med.2018 Mar;22(3):1972-1983.\u003c/li\u003e\n\u003cli\u003eO I Slabova , D I Nikitin .Influence of the incubation temperature on the reaction of oligotrophic bacteria to stress.Mikrobiologiia.2004 Nov-Dec;73(6):758-62.\u003c/li\u003e\n\u003cli\u003eM C\u0026aacute;novas , V Bernal , A Sevilla , T Torroglosa ,et al.Salt stress effects on the central and carnitine metabolisms of Escherichia coli.Biotechnol Bioeng.2007 Mar 1;96(4):722-37.\u003c/li\u003e\n\u003cli\u003eRohinishree Yadahalli Shrihari , Negi Pradeep Singh .Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.J Food Sci.2012 Feb;77(2):M95-101.\u003c/li\u003e\n\u003cli\u003eB M Fredrik Pettersson , Ram G Nitharwal , Sarbashis Das ,et al.Identification and expression of stressosomal proteins in Mycobacterium marinum under various growth and stress conditions.FEMS Microbiol Lett.2013 May;342(2):98-105.\u003c/li\u003e\n\u003cli\u003eW Brian Whitaker , Michelle A Parent , Lynn M Naughton ,et al.Modulation of responses of Vibrio parahaemolyticus O3:K6 to pH and temperature stresses by growth at different salt concentrations.Appl Environ Microbiol.2010 Jul;76(14):4720-9.\u003c/li\u003e\n\u003cli\u003eGururaja Perumal Pazhani, Goutam Chowdhury, Thandavarayan Ramamurthy.Adaptations of Vibrio parahaemolyticus to Stress During Environmental Survival, Host Colonization, and Infection.Front Microbiol.2021 Oct 7;12:737299.\u003c/li\u003e\n\u003cli\u003eCharles R Lovell .Ecological fitness and virulence features of Vibrio parahaemolyticus in estuarine environments.Appl Microbiol Biotechnol.2017 Mar;101(5):1781-1794.\u003c/li\u003e\n\u003cli\u003eYibei Zhang, Huanhuan Liu , Dan Gu,et al.Transcriptomic analysis of PhoR reveals its role in regulation of swarming motility and T3SS expression in Vibrio parahaemolyticus.Microbiol Res.2020 May;235:126448.\u003c/li\u003e\n\u003cli\u003eToshio Kodama, Hirotaka Hiyoshi, Ryu Okada,et al.Regulation of Vibrio parahaemolyticus T3SS2 gene expression and function of T3SS2 effectors that modulate actin cytoskeleton.Cell Microbiol.2015 Feb;17(2):183-90.\u003c/li\u003e\n\u003cli\u003eAnh Quoc Nguyen , Takaaki Shimohata, Sho Hatayama,et al.Type III Secretion Effector VopQ of Vibrio parahaemolyticus Modulates Central Carbon Metabolism in Epithelial Cells.mSphere.2020 Mar 18;5(2):e00960-19.\u003c/li\u003e\n\u003cli\u003eYiquan Zhang , Lingfei Hu , George Osei-Adjei ,et al.Autoregulation of toxR and Its Regulatory Actions on Major Virulence Gene Loci in Vibrio parahaemolyticus.Front Cell Infect Microbiol.2018 Sep 5;8:291.\u003c/li\u003e\n\u003cli\u003eGeorge Osei-Adjei , He Gao , Ying Zhang .Regulatory actions of ToxR and CalR on their own genes and type III secretion system 1 in Vibrio parahaemolyticus.Oncotarget.2017 Jul 22;8(39):65809-65822.\u003c/li\u003e\n\u003cli\u003eZhuoying Zhu , Lianzhi Yang , Pan Yu ,et al.Comparative Proteomics and Secretomics Revealed Virulence and Antibiotic Resistance-Associated Factors in Vibrio parahaemolyticus Recovered From Commonly Consumed Aquatic Products.Front Microbiol.2020 Jul 14;11:1453.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Vibrio parahaemolyticus, fresh water products, virulence","lastPublishedDoi":"10.21203/rs.3.rs-4544828/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4544828/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eVibrio parahaemolyticus (VP) is a Gram-negative halophilic bacterium that mainly infects seafood and food [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] with high salt content. Eating uncooked or contaminated by the bacteria may cause gastroenteritis symptoms, such as nausea, vomiting and diarrhea [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In many countries, especially in coastal [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], VP has become the leading pathogen [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] responsible for bacterial food poisoning, and foodborne diseases caused by VP have also become a public health issue of global concern. We show that halinophilia is one of the most unique biological properties of VP, [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], which can only normally grow [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] in environments with 0.5\u0026ndash;8.0% salt content. In recent years, an increasing number of literature has reported that the prevalence of VP in inland cities gradually increases in [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The VP monitoring results of ready-to-eat raw aquatic products in Changzhou found that the detection rate of VP was increasing year by year, especially the proportion of VP detected in freshwater products increased significantly, and VP was detected in freshwater crayfish, freshwater fish and shellfish. The preliminary research results of this project team found that VP of fresh water products could grow normally at 0%~0.5% salt concentration, while VP of seawater products grew well at salt concentration of 1%~3%, which proved that the halinophilia of some VP was changed, and the \"halophilic variant\" VP appeared.\u003c/p\u003e","manuscriptTitle":"Virulence gene expression of halophilic variant V.parahaemolyticus and its effect on pathogenicity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-24 08:48:36","doi":"10.21203/rs.3.rs-4544828/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"712538ed-5853-484e-974a-da016aadfa6e","owner":[],"postedDate":"June 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-30T01:31:45+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-24 08:48:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4544828","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4544828","identity":"rs-4544828","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00