In silico analysis and validation the cancer- associated fibroblasts related gene CAMK4 promotes bladder cancer progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article In silico analysis and validation the cancer- associated fibroblasts related gene CAMK4 promotes bladder cancer progression Xiaokang Su, Yi Guo, Youkong Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4438820/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Cancer-associated fibroblasts (CAFs) are crucial in the regulation of cancer cell biological properties through complex and dynamic communication networks. However, the mechanism of action of CAFs in bladder cancer (BCa) remains elusive. Results: This study integrated transcriptome data from multiple datasets and constructed an ensemble of genes associated with CAFs through a series of algorithms. It further categorized BCa into two molecular subtypes, distinguished by their immune cell infiltration and immune-related characteristics. CAMK4 was subsequently selected for further validation, and it was found that CAMK4 promoted the tumor-promoting ability of BCa specifically in terms of proliferative, migratory, and invasive capacities and also facilitated the development of epithelial-mesenchymal transition (EMT). Conclusions: To sum up, our signature and its derived subtype facilitates a more accurate identification of potential candidates for immunotherapy among BCa patients. In addition, CAMK4 may be a promising target for BCa therapy. Biological sciences/Genetics/Cancer genomics Biological sciences/Cancer/Tumour biomarkers CAFs bladder cancer CAMK4 EMT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Bladder cancer (BCa) is a highly prevalent cancer globally, with 57,3278 new diagnoses and 21,2526 fatalities in 2020. Among these cases, males constitute 74.7% of the overall burden [ 1 ]. At the time of diagnosis, 70% of individuals were diagnosed with non-muscle-invasive BCa (NMIBCa), whereas 25% presented with muscle-invasive BCa (MIBCa), and 5% exhibited distant metastases, each with different molecular drivers[ 2 , 3 ]. Although little advancements have been made in the clinical treatment of BCa in the preceding three decades, there has been a substantial shift in this trajectory in recent years[ 4 ]. The utilization of sequencing and gene expression investigations has led to the identification of DNA, RNA, and protein biomarkers for numerous BCa. This offers an opportunity for a structural shift in the approach to BCa diagnosis and the detection of recurrences. Despite the development of novel therapies, such as small molecule drugs targeting fibroblast growth factor receptors, anti-PD- (L) 1 antibodies, and drug-antibody conjugates in recent years, first-line treatments have not changed. In the last decade, substantial attention has been directed toward comprehending the significance of the tumor microenvironment (TME) in cancer development. Basic histological examination has revealed that papillary low-grade tumors exhibit a lower proportion of stromal cells, a proportion that escalates with advancing stage and grade. The TME encompasses components like the extracellular matrix (ECM), adipocytes, carcinoma-associated fibroblasts (CAFs), blood vessels, smooth muscle, nerves, and immune cells. BCa transcriptome analysis showed that the abundance ratio of immune and stromal cells was directly associated with reduced survival times in the Cancer Genome Atlas (TCGA) cohort[ 5 , 6 ]. CAFs represents a heterogeneous group of cells with an origin that remains a subject of debate. They can potentially emerge from resident tissue cells or circulating precursor cells derived from the bone marrow. These precursor cells undergo differentiation into CAF upon reaggregation at the tumor site[ 7 ]. Furthermore, CAF-like phenotypes can arise through transdifferentiation of pericytes, endothelial cells, and epithelial cells[ 8 , 9 ]. CAFs is closely associated with tumorigenesis by secreting various factors, including collagen, matrix metalloproteinases (MMPs), and chemokines. In spite of the wide relevance of CAFs in the field of cancer biology, research on their role in BCa remains limited. In this study, a robust correlation between CAFs and BCa stage was initially discerned through an analysis of BCa transcriptome data derived from the publicly available Gene Expression Overview (GEO) and TCGA databases. Subsequently, by applying the WGCNA algorithm, the HUB gene exhibiting the closest relationship with CAFs-matrix score was identified. Significantly, the key gene, CAMK4, was identified through predictive analysis. The expression of CAMK4 in BCa cells was subsequently regulated, and related cellular experiments were validated, along with the preliminary exploration of mechanistic experiments. The outcomes of the current research highlight that CAMK4 could potentially be a novel target for predicting BCa progression and efficacy. Materials and methods 2.1 Acquisition and Processing of Raw Data Data was retrieved from the Cancer Genome Atlas (TCGA) database, comprising the Fragments Per Kilobase of Transcript Per Million Mapped Reads (FPKM) format RNA-seq data for 424 patients with BCa and their associated clinical features (TCGA-BCa)[ 10 ]. In cases where multiple Ensembl IDs were mapped to the same gene, the data were averaged. GEO database downloads data obtained normalized expression data and clinical features in GSE13507 versus GSE31684 datasets. All sequencing data acquired from the GEO database underwent processing involving log-quadratic transformation, background adjustment, and normalization. Subsequently, following the exclusion of individuals lacking survival information, a total of 407, 166, and 93 patients with BCa were retained for further analysis in the TCGA database, GSE13507 and GSE31684, respectively. 2.2 CAF Infiltration and Immune Score Calculation CAF abundance scores were calculated from Estimate the Proportion of Immune and Cancer cells (EPIC) and MCPcounter algorithms[ 11 ]. The determination of immune scores and immune cell scores was performed with the "gene signature enrichment–based xCell algorithm (xCELL)"[ 12 ], all implemented through the R package IOBR (v0.99.9). 2.3 WCGNA Analysis Weighted gene co-expression network analysis (WGCNA), also referred to as Weighted correlation network analysis, is a systems biology technique employed to characterize the patterns of gene associations across various samples. This method facilitates the identification of highly synergistically changing gene sets for mining co-expressed coding genes and co-expression modules [ 13 ]. Initially, the expression profiles of protein-coding genes were isolated from the expression data available in the TCGA-BCa and GSE13507 databases. Subsequently, adjacency matrices were clustered utilizing topological overlap measure (TOM) and dissimilarity (1-TOM) between genes. Additionally, the Pearson correlation coefficient was employed to compute the Pearson correlation between modules and CAF infiltration and immune scores. Modules with the highest correlation between the two were selected, and the genes within these modules from both TCGA-BCa and GSE13507 were intersected to obtain hub genes. 2.4 Molecular Subtype Identification Based on CAFs-immune Related Genes Consistency clustering is a resampling-based method used to identify individual members, assign them to respective subgroup numbers, and validate the resulting clusters. To discover molecular subtypes based on CAFs-immune-related important genes, the ConensusClusterPlus package in R was used [ 14 ]. 2.5 Immunocorrelation Analysis of Molecular Subtypes The expression data of TCGA-BCa and GSE13507 datasets were analyzed using ssGSEA and ESTIMATE with the "GSVA" and "ESTIMATE" packages. Differences in the expression of different subtypes in related immune cells, immune function, and immune checkpoints were then compared. 2.6 Screening Prognostic Related Baseline Factors Genes significant for survival were selected through one-way COX survival analysis using the ‘'Limma'' package. 2.7 RT-qPCR Total RNA extraction from tissues and cells involved the use of TRIzol reagent (R0016, Beyotime, China), followed by reverse transcription into cDNA utilizing the Hifair® II 1st Strand cDNA Synthesis Kit (gDNA digester plus) (11121ES60, YEASEN, China). The RNA was diluted tenfold, and 2 µL of the cDNA product served as the template for PCR amplification, employing Hieff® qPCR SYBR Green Master Mix (No Rox) (11201ES03, YEASEN, China). Gene quantification was normalized to GAPDH utilizing the 2-ΔΔCt approach. The primers (as stated below) were retrieved from the PrimerBank database: human CAMK4, forward (F) 5′- AGTTCTTCTTCGCCTCTCACA − 3′; reverse (R): 5′- CATCTCGCTCACTGTAATATCCC − 3′; human GAPDH, forward (F) 5′- CTGGGCTACACTGAGCACC − 3′; reverse (R): 5′- AAGTGGTCGTTGAGGGCAATG − 3′; human CDH1, forward (F) 5′- CGAGAGCTACACGTTCACGG − 3′; reverse (R): 5′- GGGTGTCGAGGGAAAAATAGG − 3′; human CDH2, forward (F) 5′- AGCCAACCTTAACTGAGGAGT − 3′; reverse (R): 5′- GGCAAGTTGATTGGAGGGATG-3′; human VIM, forward (F) 5′- GACGCCATCAACACCGAGTT − 3′; reverse (R): 5′- CTTTGTCGTTGGTTAGCTGGT-3′. 2.8 Cell culture and transfection For this study, healthy bladder epithelial cell lines (SV-HUC-1) and BCa cell lines (UMUC3, T24, 5637) were chosen. These cell lines were procured from Procell Life Science&Technology Co.,Ltd. (Wuhan, China). Cells were grown in RPMI-1640 medium (Gibco, Carlsbad, CA) comprising 10% FBS, 10 µg/mL streptomycin, and 100 U/mL penicillin and maintained at 37°C in a 5% CO2 atmosphere. Transfection of the cells was executed utilizing Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) once they reached a confluence of 75%. Transfection efficiency was subsequently verified by RT-qPCR 48 hours after transfection. The CAMK4 overexpression plasmid and siRNA were procured from GenePharma (Shanghai, China) at a 50 ng/mL concentration. 2.9 Western blot analysis Cells were lysed utilizing an enhanced RIPA lysis buffer that contained protease inhibitors. Protein concentrations were subsequently assessed utilizing the BCA Kit (Beyotime, China). Proteins were separated through electrophoresis on 10% sodium dodecyl sulfate-polyacrylamide gels and subsequently electrotransferred onto polyvinylidene fluoride membranes. Membranes were blocked using 5% BSA and diluted CAMK4 (Rb, 4032, 1:1000, CST), E-cadherin (Rb, 24E10, 1:1000, CST), N-cadherin (Rb, D4R1H, 1:1000, CST), vimentin (Rb, 5741, 1:1000, CST), and GAPDH (Rb, 5174, 1:3000, CST). The following day, membranes were incubated once more, this time with HRP-labeled goat anti-mouse secondary antibody (ab205719; 1:1000; CST) or goat anti-rabbit secondary antibody (ab205718, 1:2000, CST) for one hour at room temperature. Immune complexes on the membrane were visualized using an ECL reagent (P0018s, Beyotime, China). 2.10 EdU assay Cells to be detected were placed in 24-well plates. After incubation with 100µL of staining solution (C0071S, Beyotime, China) for 30 min, the nuclei were visualized using DAPI and filmed with a fluorescence microscope. 2.11 Wound healing assay Cells to be examined were cultured in a 6-well plate. When the cell density reached 90%, a wound of uniform thickness was created between them. Subsequently, images were acquired using an inverted microscope. The cells were then cultured with 1% FBS medium for 48 hours, followed by additional photographs to observe the wound healing process. 2.12 Transwell assay Matrigel was applied to coat the bottom membrane surface of the transwell upper chamber. A medium comprising 10% FBS was introduced into the lower chamber. A 100µL of serum-free cell suspension was introduced to the upper chamber for 24 hours at 37 ℃, enabling the removal of non-invading cells from the Matrigel membrane surface. Cells underwent fixation with 4% paraformaldehyde and were subjected to staining with 1% purple crystals. The cells were then observed and quantified under an inverted light microscope. 2.13 Ethical statement The Ethics Committee of Jingzhou Hospital Affiliated to Yangtze University reviewed and approved the study in strict accordance with the Declaration of Helsinki. Prior to sample collection, informed consent was obtained from all participants or their respective families. 2.14 Clinical sample collection Cancer tissue and adjacent healthy tissue were surgically obtained from 12 individuals with BCa at Jingzhou Hospital Affiliated to Yangtze University from April 2023 to October 2023. This group comprised nine males and three females, with ages ranging from 42 to 79 years and a mean age of (62.54 ± 11.20) years. Four pairs of BCa tissue and adjacent healthy tissue samples were chosen for mRNA and protein analysis. The selection of these samples was verified through postoperative pathological experiments. It is important to note that none of the patients had undergone antineoplastic therapy before their surgical procedures. 2.15 Statistical analysis Data were processed employing SPSS 21.0 software (IBM Corp., Armonk, NY). Measured data are expressed as ± standard deviation. Paired or unpaired t-test was employed to compare data between the two groups. One-way analysis of variance (ANOVA) and Tukey's posttest were employed for comparison of data between multiple groups. Data from different time points were compared utilizing Bonferroni corrected repeated measures analysis of variance. Pearson correlation was utilized to assess the correlation of outcome measures. In all statistical analyses, P < 0.05 was deemed as a statistically significant value. Results 3.1 Positive Correlation Between CAF Score and T Stage in BCa Patients Initially, CAF infiltration scores were computed using EPIC and MCPcounter methods in the GSE13507, GSE31684 and TCGA databases. Subsequently, CAF scores of BCa patients with varying T stages in these three datasets were compared, revealing a direct relationship, i.e., the higher the CAF score, the higher the T stage (Fig. 1 ). 3.2 Analysis of the correlation between CAFs score and immune cells Pearson correlation analysis was performed between CAFs scores and immune cell scores for TCGA-BCa, GSE13507, and GSE31684, and it was found that CAFs was positively correlated with important immune cells, particularly B cells, and CD4 + cells (Fig. 2 A- 2 C). 3.3 WGCNA analysis and identification of hub module gene. The expression matrix of mRNA from BCa patients was extracted from TCGA-BCa and GSE13507, and both were analyzed using the WGCNA method. A scale-free network was constructed, with the soft threshold (β) of 6 and a scale-free index of 0.9 in TCGA-BCa (Fig. 3 A), and the same threshold of 6 with a scale-free index of 0.9 was applied in GSE13507 (Fig. 3 B), as well as a favorable mean value. After applying the criteria for dynamic shear trees, each network yielded a minimum connectivity module of 60 genes. Once the gene modules were determined through the dynamic shearing method, signature genes for each module were computed. Subsequently, the modules were subjected to clustering, merging closer modules into new ones. The final hierarchical clustering tree in TCGA-BCA showed that 12 co-expression modules co-clustered (Fig. 3 C), and the brown module exhibited positive association with CAFs score (Cor = 0.46, P = 2e-22), and ImmuneScore (Cor = 0.78, P = 9e-83) (Fig. 3 E). Twenty-two co-expression modules were co-clustered in GSE13507 (Fig. 3 D), and the brown module was positively correlated with CAFs score (Cor = 0.86, P = 4e-57), and ImmuneScore (Cor = 0.51, P = 9e-14) (Fig. 3 F). Two brown modules yielded 1645 and 1696 genes, respectively. The gene sets in the two modules were intersected to yield 146 common genes (Supplementary table 1 ). Following this, subsequent analysis was conducted on these 146 genes. 3.4 HUB Gene-based Molecular Subtype and Immunocorrelation Analysis Utilizing the 146 hub genes for cluster analysis, the most optimal clustering was achieved by segregating BCa patients into two subgroups within GSE13507 cohort. This division exhibited improved internal consistency and stability in the subgroups (Fig. 4 A). Subsequently, differences in immune infiltration between the two subtypes were analyzed using different algorithms. Significant differences were identified between the two clusters in immune cells and immune-related functions or pathways (Fig. 4 B- 4 D). The findings indicated that subtype B was associated with more immune cell infiltration, such as B cells, CD8 + T cells, dendritic cells, and macrophages. Similarly, subtype B exhibited heightened immune function, along with higher expression levels of immune checkpoints compared to subtype 1. The same result was found in the TCGA-BCa (Fig. 4 E). Interestingly, it was observed that BCa patients in the B subtype were much more sensitive to immunotherapy than those in the A subtype in both cohorts (P < 0.001; Fig. 4 F- 4 H). These findings underscore the reference significance associated with the HUB gene-based classification. 3.5 Screening Critical Genes and Verifying Their Expression To identify genes warranting further investigation, univariate Cox survival analysis was conducted on the 146 HUB genes in both the TCGA and GSE13507 cohorts. The intersection of the results revealed three common genes (ALDH1A1, CAMK4, DEGS1) characterized by comprehensive HR and P-values (Supplementary table 2 ). Ultimately, CAMK4 was chosen for an in-depth study. Initially, the clinical relevance of CAMK4 in human BCa was evaluated. The mRNA level of CAMK4 expression in cancer tissues (T) and their corresponding non-tumor adjacent tissues (N) from BCa patients was evaluated utilizing qPCR. The outcomes demonstrated a considerable elevation in CAMK4 expression in cancer tissues as opposed to adjacent non-cancerous tissues (Fig. 5 A). Elevated CAMK4 expression was additionally corroborated at the protein level through western blot analysis (Fig. 5 B). Similarly, BCa cells cultured in vitro were examined. The outcomes demonstrated considerable elevation in CAMK4 expression in BCa cells when compared to SVHUC1 human ureteral epithelial cells (Fig. 5 C, 5 D). In conclusion, CAMK4 exhibits abnormally high expression in BCa tissues and cells, indicating a potential association with an unfavorable prognosis in individuals with BCa. 3.6 CAMK4 overexpression promotes BCa cell proliferation, migration, and invasion To further validate the role of CAMK4 on the advancement of BCa, CAMK4 was transfected for overexpression in UMUC3 and T24 cells, respectively. The proliferation rate of CAMK4-overexpressing BCa cells was assessed using a CCK8 assay. The findings revealed that the elevated expression of CAMK4 considerably enhanced the proliferative ability of UMUC3 and T24 cells (Fig. 6 A). The elevated expression of CAMK4 also promoted proliferative ability of UMUC3 and T24 cells in colony-forming assays (Fig. 6 B). Furthermore, validation was carried out using an EDU assay, and the results similarly demonstrated that elevated CAMK4 expression could enhance the proliferation of BCa cells (Fig. 6 C). Collectively, these findings highlight that CAMK4 can enhance the proliferation of BCa cells in vitro. Subsequently, the migration and invasion of BCa cells were examined. Initially, the migratory ability of BCa cells was verified using a wound healing assay, which revealed that BCa cells overexpressing CAMK4 exhibited improved wound healing after 48 hours of culture (Fig. 6 D). Additionally, the results from the transwell assay indicated that BCa cells, following CAMK4 overexpression, displayed increased invasion capabilities (Fig. 6 E). These pieces of evidence indicate that CAMK4 can facilitate the migration and metastasis of BCa cells in vitro, suggesting a positive association between CAMK4 and the progression of BCa. 3.7 Knockdown of CAMK4 suppressed proliferative, migratory, and invasive capacities of BCa cells To further examine the role of CAMK in BCa cells, CAMK4 expression was knocked down using siRNA in BCa cells 5637 and T24. Similar to the previous overexpression experiments, the study assessed the migratory, invasive, and proliferative capacities of BCa cells after CAMK4 knockdown. The outcomes revealed that the proliferative capacity of BCa cells was considerably inhibited following silencing of CAMK4 (Fig. 7 A- 7 C). Similarly, the invasive and migratory abilities of BCa cells were also considerably reduced upon knockdown of CAMK4 (Fig. 7 D, 7 E). These results collectively indicate that silencing of CAMK4 can considerably suppress migratory, invasive, and proliferative abilities of BCa cells in vitro. (A) The cell proliferation of 5637and T24 cells after CAMK4 knockdown determined with CCK8 assay. (B) The cell proliferation of 5637 and T24 cells after CAMK4 knockdown determined with colony formation assay. (C) The cell proliferation of 5637 and T24 cells after CAMK4 knockdown determined with EDU assay. (D) The cell migration of 5637 and T24 cells after CAMK4 knockdown determined with wound healing assay. (E) The cell invasion of 5637 and T24 cells after CAMK4 knockdown determined with Transwell assay. * p < 0.05, ** p < 0.01, *** p < 0.001. 3.8 CAMK4 Upregulates EMT-Related Genes The evidence suggests that epithelial-mesenchymal transition (EMT) is a pivotal process in tumor metastasis. Several proteins, including E-cadherin (CDH1), N-cadherin (CDH2), and vimentin (VIM), are utilized as markers of EMT[ 15 ]. To investigate the association between CAMK4 and EMT, analysis was conducted using BCa data from the TCGA database. The findings revealed a negative association between CAMK4 and CDH1, along with a positive association with CDH2 and VIM (Fig. 8 A), implying that CAMK4 may contribute to the development of EMT. Validation was subsequently conducted using in vitro BCa cells. RT-qPCR results showed that CAMK4 overexpression decreased gene expression of CDH1 while promoting gene expression of CDH2 and VIM(Fig. 8 B). In contrast, the knockdown of CAMK4 increased CDH1 gene expression and suppressed CDH2 and VIM gene expression (Fig. 8 C). In addition, Western blot results also showed that CAMK4 was able to increase the protein levels of N-cadherin and vimentin and inhibit E-cadherin protein expression levels (Fig. 8 D). The above outcomes indicated that CAMK4 could increase the expression of EMT markers, highlighting that CAMK4 might facilitate the advancement of BCa by upregulating EMT. Discussion Over the last three to four decades, patients with minimally progressive survival outcomes have been diagnosed with BCa. In fact, the 5-year survival rate following radical cystectomy or chemoradiotherapy is approximately 50%[ 16 ]. Therefore, a better understanding of BCa biology is urgently needed to help discover more efficacious treatments. Through comprehensive analysis of gene expression data, multiple research groups have performed many analyses on molecular typing and molecular subtype identification of BCa[ 17 , 18 ]. In a recent consensus classification, six distinct subtypes have been defined: luminal papillary, luminal non-specified, luminal unstable, stroma-rich, basal/squamous, and neuroendocrine-like [ 19 ]. Although neuroendocrine-like subtypes are linked to a poorer prognosis, it is intriguing to note that stroma-rich subtypes appear to exhibit notably poor responses to neoadjuvant chemotherapy [ 19 ]. In addition, stroma-rich isoforms exhibit overexpression of gene signatures related to smooth muscle, endothelial cells, fibroblasts, and myofibroblasts [ 20 ]. Recently, the stromal cell population in the solid TME, known as CAFs, has gained attention as an important cell type affecting the survival outcome of BCa. Within the TME, CAFs plays a pivotal role in establishing a structural framework, notably the ECM, where various other TME cells reside. These cells encompass, but are not restricted to, cancer cells, cytotoxic and regulatory immune cells, antigen-presenting cells, and vascular cells such as endothelial cells[ 20 ]. Additionally, it was observed that CAFs in multiple datasets exhibited a robust correlation with tumor stage and displayed a positive association with immune score. Simultaneously, a close association was identified between CAFs and immune cells, particularly B cells and CD4 + cells. Although tumor antigen presentation to T cells and production of antitumor immunoglobulins may visually indicate significant tumor suppression, specific B lymphocyte subsets can secrete tumor cell growth factors and immunosuppressive cytokines, thereby promoting evasion of immune surveillance and cancer progression [ 21 ]. The reticular organization of CAFs is mediated by CD8 T cells, whereas the accumulation of CAFs depends on the recruitment of B cells [ 22 ]. In recent years, it has been found that CAFs can directly connect and induce naive CD4 + T cells into regulatory T cells (Tregs) in an antigen-specific manner to regulate tumor immunity [ 23 ]. Hence, the co-expression network between CAFs and immune scores in two BCa cohorts was systematically investigated using WGCNA and various algorithms. Immune correlation analysis was subsequently conducted after typing the datasets via cluster analysis. These results indicated the instructive nature of this classification, with immunocompetent individuals predominantly clustering in subtype B. Additionally, the effectiveness of immunotherapy was confirmed in patients classified under subtype B. Following this, three genes, namely ALDH1A1, DEGS1, and CAMK4, were screened through prognostic analysis. Notably, these three genes have been the subject of previous studies. Aldehyde dehydrogenase 1A1 (ALDH1A1) assumes a pivotal role in cellular detoxification and ROS clearance [ 24 ], and it serves as a marker of cancer stem cells (CSCs)[ 25 ]. ALDH1A1 is critically involved in self-renewal, differentiation, and self-protection in various cancers, including lung, liver, ovarian, pancreatic, and breast cancers[ 26 – 28 ]. ALDH1A1 has also been found to be an important gene associated with CAFs in ovarian and prostate cancers[ 29 , 30 ]. Dihydroceramide desaturase 1 (DEGS1) plays a role in ceramide biosynthesis at the final step of the sphingolipid pathway[ 31 ]. Knockdown of the DEGS1 gene utilizing small inhibitor RNA in neuroblastoma cells leads to the accumulation of endogenous dihydroceramide, reduced cell growth, and G1 cell cycle arrest[ 32 ]. Elevated DEGS1 expression contributes to tumor progression in the tuberous sclerosis complex[ 33 ]. In addition, embryonic fibroblast cells knocked down for DEGS1 are defective in proliferation[ 34 ]. Overexpression of CAMK4 in polycystic kidney disease facilitates mTOR-mediated cell proliferation[ 35 ]. Moreover, CAMK4 has been associated with the malignant potential of tumors in liver cancer [ 36 ]. Combining HR values with P values, CAMK4 was ultimately chosen for further cell experimental validation. The function of CAMK4 in enhancing the proliferation, migratory capacity, and invasive behavior of BCa cells was tested. Notably, it was observed that CAMK4 could promote the advancement of BCa by promoting EMT development. This is justified because it has been shown that CAFs can induce the development of EMT and enrichment of CSCs[ 37 ]. Furthermore, the expression of CAFs markers in the interstitial space exhibits a strong correlation with the expression of EMT markers in cancer cells. Notably, in vitro stimulation of fibroblasts has been shown to induce the development of EMT in cancer cells [ 38 ]. However, this study does have certain limitations. For instance, there are alternative methods for calculating CAFs and immune scores, and bolstering the findings with validation in additional datasets could enhance the persuasiveness of the results. Second, the study lacks extensive mechanistic experiments, but the strong association between CAMK4 and EMT-related proteins may serve as a valuable guide for future mechanistic exploration. Moreover, validating these findings through in vivo experiments would provide more compelling results and underscore their therapeutic significance. Conclusion In conclusion, a CAFs-derived signature was constructed using transcriptome data from multiple datasets and through a variety of bioinformatics analyses. This signature allowed the division of BCa into two distinct subtypes characterized by differences in immune cell infiltration landscapes and immune-related characteristics. Notably, it was found that SUBTYPE B immunotherapy is more effective. Hub gene CAMK4 demonstrated its oncogenic effect by promoting the migratory, invasive, and proliferative abilities of BCa cell lines. The research findings serve as a foundation for further elucidating the mechanisms by which CAFs promotes BCa progression. Moreover, they offer valuable insights into potential therapeutic targets and new clinical treatments for BCa. Declarations Ethics approval and consent to participate: This study were reviewed and approved by the ethics committee of Jingzhou Hospital Affiliated to Yangyze University (Number:2023-084-01). The written informed consent of all patients in this study was consistent with the Helsinki Declaration. Consent for publication: Not applicable. Competing interests: The authors declare no competing interests. Author details: 1 Department of Urology, Jingzhou Hospital Affiliated to Yangtze University, Jingzhou, Hubei. Acknowledgments: The authors sincerely thank all of the members of the laboratory for their valuable suggestions and appreciate TCGA and GEO for their data sharing. Consent to Participate: Twelve patients gave informed consent and agreed to participate in the study. Authors’ Contributions: Y.L. conceived and designed the experiments; X.S. and Y. G. performed the experiments; X.S. and Y. G. analyzed and interpreted the data; X.S. and Y. G. wrote the paper; All authors reviewed the manuscript. Funding: This work was no Funding. Data Availability: The datasets generated and/or analysed during the current study are available in the TCGA and GSE repository, [https://portal.gdc.cancer.gov/],[https://www.ncbi.nlm.nih.gov/geo/]. References Zhang Y, Rumgay H, Li M, Yu H, Pan H, Ni J. The global landscape of bladder cancer incidence and mortality in 2020 and projections to 2040. J Glob Health. 2023;13: 04109. Tran L, Xiao J-F, Agarwal N, Duex JE, Theodorescu D. Advances in bladder cancer biology and therapy. Nat Rev Cancer. 2021;21: 104–121. Jordan B, Meeks JJ. T1 bladder cancer: current considerations for diagnosis and management. Nat Rev Urol. 2019;16: 23–34. Lenis AT, Lec PM, Chamie K, Mshs MD. Bladder Cancer: A Review. JAMA. 2020;324: 1980–1991. Cao J, Yang X, Li J, Wu H, Li P, Yao Z, et al. Screening and Identifying Immune-Related Cells and Genes in the Tumor Microenvironment of Bladder Urothelial Carcinoma: Based on TCGA Database and Bioinformatics. Front Oncol. 2019;9: 1533. Xu N, Ke Z-B, Lin X-D, Chen Y-H, Wu Y-P, Chen Y, et al. Development and validation of a molecular prognostic index of bladder cancer based on immunogenomic landscape analysis. Cancer Cell Int. 2020;20: 302. Bröcker V, Länger F, Fellous TG, Mengel M, Brittan M, Bredt M, et al. Fibroblasts of recipient origin contribute to bronchiolitis obliterans in human lung transplants. Am J Respir Crit Care Med. 2006;173: 1276–1282. Zeisberg EM, Potenta S, Xie L, Zeisberg M, Kalluri R. Discovery of endothelial to mesenchymal transition as a source for carcinoma-associated fibroblasts. Cancer Res. 2007;67: 10123–10128. Zhou H, Li R, Liu J, Long J, Chen T. Characterization and verification of CAF-relevant prognostic gene signature to aid therapy in bladder cancer. Heliyon. 2024;10(3):e23873. Goldman MJ, Craft B, Hastie M, Repečka K, McDade F, Kamath A, et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol. 2020;38: 675–678. Racle J, de Jonge K, Baumgaertner P, Speiser DE, Gfeller D. Simultaneous enumeration of cancer and immune cell types from bulk tumor gene expression data. Elife. 2017;6: e26476. Aran D, Hu Z, Butte AJ. xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol. 2017;18: 220. Langfelder P, Horvath S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9: 559. Wilkerson MD, Hayes DN. ConsensusClusterPlus: a class discovery tool with confidence assessments and item tracking. Bioinformatics. 2010;26: 1572–1573. Monteiro-Reis S, Lobo J, Henrique R, Jerónimo C. Epigenetic Mechanisms Influencing Epithelial to Mesenchymal Transition in Bladder Cancer. Int J Mol Sci. 2019;20: E297. Teoh JY-C, Huang J, Ko WY-K, Lok V, Choi P, Ng C-F, et al. Global Trends of Bladder Cancer Incidence and Mortality, and Their Associations with Tobacco Use and Gross Domestic Product Per Capita. Eur Urol. 2020;78: 893–906. Mo Q, Nikolos F, Chen F, Tramel Z, Lee Y-C, Hayashi K, et al. Prognostic Power of a Tumor Differentiation Gene Signature for Bladder Urothelial Carcinomas. J Natl Cancer Inst. 2018;110: 448–459. Marzouka N-A-D, Eriksson P, Rovira C, Liedberg F, Sjödahl G, Höglund M. A validation and extended description of the Lund taxonomy for urothelial carcinoma using the TCGA cohort. Sci Rep. 2018;8: 3737. Kamoun A, de Reyniès A, Allory Y, Sjödahl G, Robertson AG, Seiler R, et al. A Consensus Molecular Classification of Muscle-invasive Bladder Cancer. Eur Urol. 2020;77: 420–433. Burley A, Rullan A, Wilkins A. A review of the biology and therapeutic implications of cancer-associated fibroblasts (CAFs) in muscle-invasive bladder cancer. Front Oncol. 2022;12: 1000888. Minici C, Testoni S, Della-Torre E. B-Lymphocytes in the Pathophysiology of Pancreatic Adenocarcinoma. Front Immunol. 2022;13: 867902. Rodriguez AB, Peske JD, Woods AN, Leick KM, Mauldin IS, Meneveau MO, et al. Immune mechanisms orchestrate tertiary lymphoid structures in tumors via cancer-associated fibroblasts. Cell Rep. 2021;36: 109422. Huang H, Wang Z, Zhang Y, Pradhan RN, Ganguly D, Chandra R, et al. Mesothelial cell-derived antigen-presenting cancer-associated fibroblasts induce expansion of regulatory T cells in pancreatic cancer. Cancer Cell. 2022;40: 656–673.e7. Pereira F, Rosenmann E, Nylen E, Kaufman M, Pinsky L, Wrogemann K. The 56 kDa androgen binding protein is an aldehyde dehydrogenase. Biochem Biophys Res Commun. 1991;175: 831–838. Tomita H, Tanaka K, Tanaka T, Hara A. Aldehyde dehydrogenase 1A1 in stem cells and cancer. Oncotarget. 2016;7: 11018–11032. Jiang F, Qiu Q, Khanna A, Todd NW, Deepak J, Xing L, et al. Aldehyde dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer. Mol Cancer Res. 2009;7: 330–338. Wang Y-C, Yo Y-T, Lee H-Y, Liao Y-P, Chao T-K, Su P-H, et al. ALDH1-bright epithelial ovarian cancer cells are associated with CD44 expression, drug resistance, and poor clinical outcome. Am J Pathol. 2012;180: 1159–1169. Liu C, Qiang J, Deng Q, Xia J, Deng L, Zhou L, et al. ALDH1A1 Activity in Tumor-Initiating Cells Remodels Myeloid-Derived Suppressor Cells to Promote Breast Cancer Progression. Cancer Res. 2021;81: 5919–5934. Loret N, Vandamme N, De Coninck J, Taminau J, De Clercq K, Blancke G, et al. Distinct Transcriptional Programs in Ascitic and Solid Cancer Cells Induce Different Responses to Chemotherapy in High-Grade Serous Ovarian Cancer. Mol Cancer Res. 2022;20: 1532–1547. Liu W, Wang M, Wang M, Liu M. Single-cell and bulk RNA sequencing reveal cancer-associated fibroblast heterogeneity and a prognostic signature in prostate cancer. Medicine (Baltimore). 2023;102: e34611. Planas-Serra L, Launay N, Goicoechea L, Heron B, Jou C, Juliá-Palacios N, et al. Sphingolipid desaturase DEGS1 is essential for mitochondria-associated membrane integrity. J Clin Invest. 2023;133: e162957. Kraveka JM, Li L, Szulc ZM, Bielawski J, Ogretmen B, Hannun YA, et al. Involvement of dihydroceramide desaturase in cell cycle progression in human neuroblastoma cells. J Biol Chem. 2007;282: 16718–16728. Astrinidis A, Li C, Zhang EY, Zhao X, Zhao S, Guo M, et al. Upregulation of acid ceramidase contributes to tumor progression in tuberous sclerosis complex. JCI Insight. 2023;8: e166850. Barbarroja N, Rodriguez-Cuenca S, Nygren H, Camargo A, Pirraco A, Relat J, et al. Increased dihydroceramide/ceramide ratio mediated by defective expression of degs1 impairs adipocyte differentiation and function. Diabetes. 2015;64: 1180–1192. Zhang Y, Daniel EA, Metcalf J, Dai Y, Reif GA, Wallace DP. CaMK4 overexpression in polycystic kidney disease promotes mTOR-mediated cell proliferation. J Mol Cell Biol. 2022;14: mjac050. Li Z, Lu J, Zeng G, Pang J, Zheng X, Feng J, Zhang J. MiR-129-5p inhibits liver cancer growth by targeting calcium calmodulin-dependent protein kinase IV (CAMK4). Cell Death Dis. 2019;10(11):789. Özdemir BC, Pentcheva-Hoang T, Carstens JL, Zheng X, Wu C-C, Simpson TR, et al. Depletion of carcinoma-associated fibroblasts and fibrosis induces immunosuppression and accelerates pancreas cancer with reduced survival. Cancer Cell. 2014;25: 719–734. Schulte J, Weidig M, Balzer P, Richter P, Franz M, Junker K, et al. Expression of the E-cadherin repressors Snail, Slug and Zeb1 in urothelial carcinoma of the urinary bladder: relation to stromal fibroblast activation and invasive behaviour of carcinoma cells. Histochem Cell Biol. 2012;138: 847–860. Additional Declarations No competing interests reported. Supplementary Files ConsenttoParticipatedeclaration.docx OriginalImagesforBlots.pdf declarationStatement.docx supplementarytable1.txt supplementarytable2.txt Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4438820","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":312310410,"identity":"3969d33a-3c89-4c48-92a7-e33507a73e4e","order_by":0,"name":"Xiaokang Su","email":"","orcid":"","institution":"Jingzhou Hospital Affiliated to Yangtze University","correspondingAuthor":false,"prefix":"","firstName":"Xiaokang","middleName":"","lastName":"Su","suffix":""},{"id":312310411,"identity":"2c9db298-9d28-4722-a9d2-f340d34daf6e","order_by":1,"name":"Yi Guo","email":"","orcid":"","institution":"Jingzhou Hospital Affiliated to Yangtze University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Guo","suffix":""},{"id":312310412,"identity":"26a6dc67-df85-4daf-8e2e-9d795023a4b1","order_by":2,"name":"Youkong Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYBACPmYQeQCI2RsbH3wgRgsbXAvP4WbDGURpYYBpkUhvk+YgSgs7j+FjnjM2efKRDxukGRjs5HQbCDqMx9iY50ZaseHtxAbjAoZkY7MDhLWYSfN8OJy4cXZiQ/IMhgOJ24jXMvNgw2Ee4rXcOJw4X4KxsZlILWzFhnPOpCVu4ElsZpxhQIRf+PkPb3zw5phN4vz2489/fKiwkyOohYGBwwBMGYBVGhBUDgLsD8CUfANRqkfBKBgFo2AkAgBTu0ECSZarNwAAAABJRU5ErkJggg==","orcid":"","institution":"Jingzhou Hospital Affiliated to Yangtze University","correspondingAuthor":true,"prefix":"","firstName":"Youkong","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-05-17 23:23:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4438820/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4438820/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58250110,"identity":"a1969be0-e617-4b94-aa38-7e585cb288d5","added_by":"auto","created_at":"2024-06-13 03:04:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":290534,"visible":true,"origin":"","legend":"\u003cp\u003eThe Relationship Between CAFs and T Stage. CAFs infiltration score and T stage. Within the GSE13507(A-B), GSE31684(C-D) and TCGA(E-F) dataset, the infiltration score of CAFs increased with higher T staging. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/9010a6dfcf7449474e3b9a19.png"},{"id":58248798,"identity":"30cea75e-2aea-4c2b-97c8-15deced41d26","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":752125,"visible":true,"origin":"","legend":"\u003cp\u003eThe relationship between CAFs and immune cells populations revealed. Analysis of Pearson Correlation between CAFs and Immune Cells In GSE13507 cohort(A), GSE31684 cohort(B), TCGA-BCa cohort(C).\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/d46e0dee4153c7606e5b856e.png"},{"id":58248795,"identity":"c1b252e5-71f8-41be-8ace-090a2d40bfcb","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1358914,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of Co-Expression Hub Modules Involving CAFs and ImmuneScores. (A-B) Examination of the scale-free fit index across different soft-threshold powers and mean connectivity in the GSE13507 and TCGA-BCa cohorts. (C-D) Dendrograms displaying the clustering of genes with similar expression patterns into co-expression modules within the GSE13507 and TCGA-BCa cohorts.(E-F) Assessment of correlations between each gene module and the corresponding phenotype in the GSE13507 and TCGA-BCa cohorts.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/fcc350ca5f1a45b1e81f54d6.png"},{"id":58249591,"identity":"b7f8d257-76a7-46bb-971d-2715103bc08f","added_by":"auto","created_at":"2024-06-13 02:56:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1006371,"visible":true,"origin":"","legend":"\u003cp\u003eImmune checkpoints, cells and functions were enriched in the B subtype group. (A) Cluster analysis in GSE13507, (B-D) Immunocorrelation analysis in GSE13507. (E) Cluster analysis in TCGA-BCa, (F-H) Immunocorrelation analysis in TCGA-BCa. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **p\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/316921a634436b590e670168.png"},{"id":58250109,"identity":"18c89c61-cc68-4ecd-b5a2-7bd5900f3199","added_by":"auto","created_at":"2024-06-13 03:04:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":411931,"visible":true,"origin":"","legend":"\u003cp\u003eCAMK4 is highly expressed in BCa patient samples and cell lines. (A) CAMK4 mRNA levels in BCa and adjacent normal bladder tissues. (B) CAMK4 protein levels in BCa and adjacent normal bladder tissues. (C) CAMK4 mRNA levels in the indicated BCa cell lines. (D) Western-blot analysis of CAMK4 protein levels in the indicated BCa cell lines. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/bf0e962d07be63e4f79938fc.png"},{"id":58249593,"identity":"0c27d017-ffa0-441b-bfbc-45afa0b10d00","added_by":"auto","created_at":"2024-06-13 02:56:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2561701,"visible":true,"origin":"","legend":"\u003cp\u003eCAMK4 overexpression improves proliferation, migration and invasion of Bca cells. (A) The cell proliferation of 5637and T24 cells after CAMK4 overexpression determined with CCK8 assay. (B) The cell proliferation of 5637 and T24 cells after CAMK4 overexpression determined with colony formation assay. (C) The cell proliferation of 5637 and T24 cells after CAMK4 overexpression determined with EDU assay. (D) The cell migration of 5637 and T24 cells after CAMK4 overexpression determined with wound healing assay. (E) The cell invasion of 5637 and T24 cells after CAMK4 overexpression determined with transwell assay. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/e7bb0e94038f79f56cb89a50.png"},{"id":58248800,"identity":"983144e7-582d-414c-9a29-1aac6e673fc0","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2535593,"visible":true,"origin":"","legend":"\u003cp\u003eCAMK4 knockdown inhibits proliferation, migration and invasion of Bca cells.\u003c/p\u003e\n\u003cp\u003e(A) The cell proliferation of 5637and T24 cells after CAMK4 knockdown determined with CCK8 assay. (B) The cell proliferation of 5637 and T24 cells after CAMK4 knockdown determined with colony formation assay. (C) The cell proliferation of 5637 and T24 cells after CAMK4 knockdown determined with EDU assay. (D) The cell migration of 5637 and T24 cells after CAMK4 knockdown determined with wound healing assay. (E) The cell invasion of 5637 and T24 cells after CAMK4 knockdown determined with Transwell assay. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/9da2e2c7982a1ddc4df9cb5c.png"},{"id":58248804,"identity":"b52cdc84-c8d3-4a5a-9c72-27465e5fbce6","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":847529,"visible":true,"origin":"","legend":"\u003cp\u003eCAMK4 knockdown inhibits proliferation, migration and invasion of Bca cells. (A) The correlation between CAMK4 and CDH1, CDH2, VIM. (B) The expression of EMT markers E-cadherin, N-cadherin and Vimentin in umuc3 and T24 cells determined with RT-qPCR. (C) The expression of EMT markers E-cadherin, N-cadherin and Vimentin in 5637 and T24 cells determined with RT-qPCR. (D) The expression of EMT markers E-cadherin, N-cadherin and Vimentin in Bca cells determined with Western blot analysis.\u003c/p\u003e","description":"","filename":"fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/70346eb746ae920cee412951.png"},{"id":72600254,"identity":"66859f76-70e1-4633-ad5d-6c5da2a4b6c5","added_by":"auto","created_at":"2024-12-30 08:47:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13889995,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/869aa0ac-864b-4eea-b7a8-16fa79a19b6f.pdf"},{"id":58250111,"identity":"7cd35165-8f51-4a64-bb2d-baee63e21490","added_by":"auto","created_at":"2024-06-13 03:04:42","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":17258,"visible":true,"origin":"","legend":"","description":"","filename":"ConsenttoParticipatedeclaration.docx","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/965d606117f7a37e0a0ac263.docx"},{"id":58249594,"identity":"8caf9bda-83b7-4dc4-b991-171a93fe7980","added_by":"auto","created_at":"2024-06-13 02:56:42","extension":"pdf","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":120389,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalImagesforBlots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/9da95b30943c16cd5adeaf61.pdf"},{"id":58248805,"identity":"2f97d53b-d21c-4ab5-8dfb-1da7d9df3cd8","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"docx","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":17410,"visible":true,"origin":"","legend":"","description":"","filename":"declarationStatement.docx","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/352d91dac75335e8d2ecb5f3.docx"},{"id":58248803,"identity":"4a0c333f-9e9b-4408-bcc5-18cfdeddf079","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"txt","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":1078,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarytable1.txt","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/a7869a4801a6ac9ea904488a.txt"},{"id":58248802,"identity":"53d601de-4550-4781-ae36-5a2c4324bf01","added_by":"auto","created_at":"2024-06-13 02:48:42","extension":"txt","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":195,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarytable2.txt","url":"https://assets-eu.researchsquare.com/files/rs-4438820/v1/1616c68153ca23f1ef4e7804.txt"}],"financialInterests":"No competing interests reported.","formattedTitle":"In silico analysis and validation the cancer- associated fibroblasts related gene CAMK4 promotes bladder cancer progression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBladder cancer (BCa) is a highly prevalent cancer globally, with 57,3278 new diagnoses and 21,2526 fatalities in 2020. Among these cases, males constitute 74.7% of the overall burden [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. At the time of diagnosis, 70% of individuals were diagnosed with non-muscle-invasive BCa (NMIBCa), whereas 25% presented with muscle-invasive BCa (MIBCa), and 5% exhibited distant metastases, each with different molecular drivers[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Although little advancements have been made in the clinical treatment of BCa in the preceding three decades, there has been a substantial shift in this trajectory in recent years[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The utilization of sequencing and gene expression investigations has led to the identification of DNA, RNA, and protein biomarkers for numerous BCa. This offers an opportunity for a structural shift in the approach to BCa diagnosis and the detection of recurrences. Despite the development of novel therapies, such as small molecule drugs targeting fibroblast growth factor receptors, anti-PD- (L) 1 antibodies, and drug-antibody conjugates in recent years, first-line treatments have not changed.\u003c/p\u003e \u003cp\u003eIn the last decade, substantial attention has been directed toward comprehending the significance of the tumor microenvironment (TME) in cancer development. Basic histological examination has revealed that papillary low-grade tumors exhibit a lower proportion of stromal cells, a proportion that escalates with advancing stage and grade. The TME encompasses components like the extracellular matrix (ECM), adipocytes, carcinoma-associated fibroblasts (CAFs), blood vessels, smooth muscle, nerves, and immune cells. BCa transcriptome analysis showed that the abundance ratio of immune and stromal cells was directly associated with reduced survival times in the Cancer Genome Atlas (TCGA) cohort[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCAFs represents a heterogeneous group of cells with an origin that remains a subject of debate. They can potentially emerge from resident tissue cells or circulating precursor cells derived from the bone marrow. These precursor cells undergo differentiation into CAF upon reaggregation at the tumor site[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Furthermore, CAF-like phenotypes can arise through transdifferentiation of pericytes, endothelial cells, and epithelial cells[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. CAFs is closely associated with tumorigenesis by secreting various factors, including collagen, matrix metalloproteinases (MMPs), and chemokines. In spite of the wide relevance of CAFs in the field of cancer biology, research on their role in BCa remains limited.\u003c/p\u003e \u003cp\u003eIn this study, a robust correlation between CAFs and BCa stage was initially discerned through an analysis of BCa transcriptome data derived from the publicly available Gene Expression Overview (GEO) and TCGA databases. Subsequently, by applying the WGCNA algorithm, the HUB gene exhibiting the closest relationship with CAFs-matrix score was identified. Significantly, the key gene, CAMK4, was identified through predictive analysis. The expression of CAMK4 in BCa cells was subsequently regulated, and related cellular experiments were validated, along with the preliminary exploration of mechanistic experiments. The outcomes of the current research highlight that CAMK4 could potentially be a novel target for predicting BCa progression and efficacy.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e2.1 Acquisition and Processing of Raw Data\u003c/p\u003e \u003cp\u003eData was retrieved from the Cancer Genome Atlas (TCGA) database, comprising the Fragments Per Kilobase of Transcript Per Million Mapped Reads (FPKM) format RNA-seq data for 424 patients with BCa and their associated clinical features (TCGA-BCa)[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In cases where multiple Ensembl IDs were mapped to the same gene, the data were averaged. GEO database downloads data obtained normalized expression data and clinical features in GSE13507 versus GSE31684 datasets. All sequencing data acquired from the GEO database underwent processing involving log-quadratic transformation, background adjustment, and normalization. Subsequently, following the exclusion of individuals lacking survival information, a total of 407, 166, and 93 patients with BCa were retained for further analysis in the TCGA database, GSE13507 and GSE31684, respectively.\u003c/p\u003e \u003cp\u003e2.2 CAF Infiltration and Immune Score Calculation\u003c/p\u003e \u003cp\u003eCAF abundance scores were calculated from Estimate the Proportion of Immune and Cancer cells (EPIC) and MCPcounter algorithms[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The determination of immune scores and immune cell scores was performed with the \"gene signature enrichment\u0026ndash;based xCell algorithm (xCELL)\"[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], all implemented through the R package IOBR (v0.99.9).\u003c/p\u003e \u003cp\u003e2.3 WCGNA Analysis\u003c/p\u003e \u003cp\u003eWeighted gene co-expression network analysis (WGCNA), also referred to as Weighted correlation network analysis, is a systems biology technique employed to characterize the patterns of gene associations across various samples. This method facilitates the identification of highly synergistically changing gene sets for mining co-expressed coding genes and co-expression modules [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Initially, the expression profiles of protein-coding genes were isolated from the expression data available in the TCGA-BCa and GSE13507 databases. Subsequently, adjacency matrices were clustered utilizing topological overlap measure (TOM) and dissimilarity (1-TOM) between genes. Additionally, the Pearson correlation coefficient was employed to compute the Pearson correlation between modules and CAF infiltration and immune scores. Modules with the highest correlation between the two were selected, and the genes within these modules from both TCGA-BCa and GSE13507 were intersected to obtain hub genes.\u003c/p\u003e \u003cp\u003e2.4 Molecular Subtype Identification Based on CAFs-immune Related Genes\u003c/p\u003e \u003cp\u003eConsistency clustering is a resampling-based method used to identify individual members, assign them to respective subgroup numbers, and validate the resulting clusters. To discover molecular subtypes based on CAFs-immune-related important genes, the ConensusClusterPlus package in R was used [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e2.5 Immunocorrelation Analysis of Molecular Subtypes\u003c/p\u003e \u003cp\u003eThe expression data of TCGA-BCa and GSE13507 datasets were analyzed using ssGSEA and ESTIMATE with the \"GSVA\" and \"ESTIMATE\" packages. Differences in the expression of different subtypes in related immune cells, immune function, and immune checkpoints were then compared.\u003c/p\u003e \u003cp\u003e2.6 Screening Prognostic Related Baseline Factors\u003c/p\u003e \u003cp\u003eGenes significant for survival were selected through one-way COX survival analysis using the \u0026lsquo;'Limma'' package.\u003c/p\u003e \u003cp\u003e2.7 RT-qPCR\u003c/p\u003e \u003cp\u003e Total RNA extraction from tissues and cells involved the use of TRIzol reagent (R0016, Beyotime, China), followed by reverse transcription into cDNA utilizing the Hifair\u0026reg; II 1st Strand cDNA Synthesis Kit (gDNA digester plus) (11121ES60, YEASEN, China). The RNA was diluted tenfold, and 2 \u0026micro;L of the cDNA product served as the template for PCR amplification, employing Hieff\u0026reg; qPCR SYBR Green Master Mix (No Rox) (11201ES03, YEASEN, China). Gene quantification was normalized to GAPDH utilizing the 2-ΔΔCt approach. The primers (as stated below) were retrieved from the PrimerBank database: human CAMK4, forward (F) 5\u0026prime;- AGTTCTTCTTCGCCTCTCACA \u0026minus;\u0026thinsp;3\u0026prime;; reverse (R): 5\u0026prime;- CATCTCGCTCACTGTAATATCCC \u0026minus;\u0026thinsp;3\u0026prime;; human GAPDH, forward (F) 5\u0026prime;- CTGGGCTACACTGAGCACC \u0026minus;\u0026thinsp;3\u0026prime;; reverse (R): 5\u0026prime;- AAGTGGTCGTTGAGGGCAATG \u0026minus;\u0026thinsp;3\u0026prime;; human CDH1, forward (F) 5\u0026prime;- CGAGAGCTACACGTTCACGG \u0026minus;\u0026thinsp;3\u0026prime;; reverse (R): 5\u0026prime;- GGGTGTCGAGGGAAAAATAGG \u0026minus;\u0026thinsp;3\u0026prime;; human CDH2, forward (F) 5\u0026prime;- AGCCAACCTTAACTGAGGAGT \u0026minus;\u0026thinsp;3\u0026prime;; reverse (R): 5\u0026prime;- GGCAAGTTGATTGGAGGGATG-3\u0026prime;; human VIM, forward (F) 5\u0026prime;- GACGCCATCAACACCGAGTT \u0026minus;\u0026thinsp;3\u0026prime;; reverse (R): 5\u0026prime;- CTTTGTCGTTGGTTAGCTGGT-3\u0026prime;.\u003c/p\u003e \u003cp\u003e2.8 Cell culture and transfection\u003c/p\u003e \u003cp\u003eFor this study, healthy bladder epithelial cell lines (SV-HUC-1) and BCa cell lines (UMUC3, T24, 5637) were chosen. These cell lines were procured from Procell Life Science\u0026amp;Technology Co.,Ltd. (Wuhan, China). Cells were grown in RPMI-1640 medium (Gibco, Carlsbad, CA) comprising 10% FBS, 10 \u0026micro;g/mL streptomycin, and 100 U/mL penicillin and maintained at 37\u0026deg;C in a 5% CO2 atmosphere.\u003c/p\u003e \u003cp\u003eTransfection of the cells was executed utilizing Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) once they reached a confluence of 75%. Transfection efficiency was subsequently verified by RT-qPCR 48 hours after transfection. The CAMK4 overexpression plasmid and siRNA were procured from GenePharma (Shanghai, China) at a 50 ng/mL concentration.\u003c/p\u003e \u003cp\u003e2.9 Western blot analysis\u003c/p\u003e \u003cp\u003eCells were lysed utilizing an enhanced RIPA lysis buffer that contained protease inhibitors. Protein concentrations were subsequently assessed utilizing the BCA Kit (Beyotime, China). Proteins were separated through electrophoresis on 10% sodium dodecyl sulfate-polyacrylamide gels and subsequently electrotransferred onto polyvinylidene fluoride membranes. Membranes were blocked using 5% BSA and diluted CAMK4 (Rb, 4032, 1:1000, CST), E-cadherin (Rb, 24E10, 1:1000, CST), N-cadherin (Rb, D4R1H, 1:1000, CST), vimentin (Rb, 5741, 1:1000, CST), and GAPDH (Rb, 5174, 1:3000, CST). The following day, membranes were incubated once more, this time with HRP-labeled goat anti-mouse secondary antibody (ab205719; 1:1000; CST) or goat anti-rabbit secondary antibody (ab205718, 1:2000, CST) for one hour at room temperature. Immune complexes on the membrane were visualized using an ECL reagent (P0018s, Beyotime, China).\u003c/p\u003e \u003cp\u003e2.10 EdU assay\u003c/p\u003e \u003cp\u003eCells to be detected were placed in 24-well plates. After incubation with 100\u0026micro;L of staining solution (C0071S, Beyotime, China) for 30 min, the nuclei were visualized using DAPI and filmed with a fluorescence microscope.\u003c/p\u003e \u003cp\u003e2.11 Wound healing assay\u003c/p\u003e \u003cp\u003eCells to be examined were cultured in a 6-well plate. When the cell density reached 90%, a wound of uniform thickness was created between them. Subsequently, images were acquired using an inverted microscope. The cells were then cultured with 1% FBS medium for 48 hours, followed by additional photographs to observe the wound healing process.\u003c/p\u003e \u003cp\u003e2.12 Transwell assay\u003c/p\u003e \u003cp\u003eMatrigel was applied to coat the bottom membrane surface of the transwell upper chamber. A medium comprising 10% FBS was introduced into the lower chamber. A 100\u0026micro;L of serum-free cell suspension was introduced to the upper chamber for 24 hours at 37 ℃, enabling the removal of non-invading cells from the Matrigel membrane surface. Cells underwent fixation with 4% paraformaldehyde and were subjected to staining with 1% purple crystals. The cells were then observed and quantified under an inverted light microscope.\u003c/p\u003e \u003cp\u003e2.13 Ethical statement\u003c/p\u003e \u003cp\u003e The Ethics Committee of Jingzhou Hospital Affiliated to Yangtze University reviewed and approved the study in strict accordance with the Declaration of Helsinki. Prior to sample collection, informed consent was obtained from all participants or their respective families.\u003c/p\u003e \u003cp\u003e2.14 Clinical sample collection\u003c/p\u003e \u003cp\u003eCancer tissue and adjacent healthy tissue were surgically obtained from 12 individuals with BCa at Jingzhou Hospital Affiliated to Yangtze University from April 2023 to October 2023. This group comprised nine males and three females, with ages ranging from 42 to 79 years and a mean age of (62.54\u0026thinsp;\u0026plusmn;\u0026thinsp;11.20) years. Four pairs of BCa tissue and adjacent healthy tissue samples were chosen for mRNA and protein analysis. The selection of these samples was verified through postoperative pathological experiments. It is important to note that none of the patients had undergone antineoplastic therapy before their surgical procedures.\u003c/p\u003e \u003cp\u003e2.15 Statistical analysis\u003c/p\u003e \u003cp\u003eData were processed employing SPSS 21.0 software (IBM Corp., Armonk, NY). Measured data are expressed as \u0026plusmn;\u0026thinsp;standard deviation. Paired or unpaired t-test was employed to compare data between the two groups. One-way analysis of variance (ANOVA) and Tukey's posttest were employed for comparison of data between multiple groups. Data from different time points were compared utilizing Bonferroni corrected repeated measures analysis of variance. Pearson correlation was utilized to assess the correlation of outcome measures. In all statistical analyses, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was deemed as a statistically significant value.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e3.1 Positive Correlation Between CAF Score and T Stage in BCa Patients\u003c/p\u003e \u003cp\u003eInitially, CAF infiltration scores were computed using EPIC and MCPcounter methods in the GSE13507, GSE31684 and TCGA databases. Subsequently, CAF scores of BCa patients with varying T stages in these three datasets were compared, revealing a direct relationship, i.e., the higher the CAF score, the higher the T stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.2 Analysis of the correlation between CAFs score and immune cells\u003c/p\u003e \u003cp\u003ePearson correlation analysis was performed between CAFs scores and immune cell scores for TCGA-BCa, GSE13507, and GSE31684, and it was found that CAFs was positively correlated with important immune cells, particularly B cells, and CD4\u0026thinsp;+\u0026thinsp;cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.3 WGCNA analysis and identification of hub module gene.\u003c/p\u003e \u003cp\u003eThe expression matrix of mRNA from BCa patients was extracted from TCGA-BCa and GSE13507, and both were analyzed using the WGCNA method. A scale-free network was constructed, with the soft threshold (β) of 6 and a scale-free index of 0.9 in TCGA-BCa (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), and the same threshold of 6 with a scale-free index of 0.9 was applied in GSE13507 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), as well as a favorable mean value. After applying the criteria for dynamic shear trees, each network yielded a minimum connectivity module of 60 genes. Once the gene modules were determined through the dynamic shearing method, signature genes for each module were computed. Subsequently, the modules were subjected to clustering, merging closer modules into new ones. The final hierarchical clustering tree in TCGA-BCA showed that 12 co-expression modules co-clustered (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), and the brown module exhibited positive association with CAFs score (Cor\u0026thinsp;=\u0026thinsp;0.46, P\u0026thinsp;=\u0026thinsp;2e-22), and ImmuneScore (Cor\u0026thinsp;=\u0026thinsp;0.78, P\u0026thinsp;=\u0026thinsp;9e-83) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Twenty-two co-expression modules were co-clustered in GSE13507 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), and the brown module was positively correlated with CAFs score (Cor\u0026thinsp;=\u0026thinsp;0.86, P\u0026thinsp;=\u0026thinsp;4e-57), and ImmuneScore (Cor\u0026thinsp;=\u0026thinsp;0.51, P\u0026thinsp;=\u0026thinsp;9e-14) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Two brown modules yielded 1645 and 1696 genes, respectively. The gene sets in the two modules were intersected to yield 146 common genes (Supplementary table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Following this, subsequent analysis was conducted on these 146 genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.4 HUB Gene-based Molecular Subtype and Immunocorrelation Analysis\u003c/p\u003e \u003cp\u003eUtilizing the 146 hub genes for cluster analysis, the most optimal clustering was achieved by segregating BCa patients into two subgroups within GSE13507 cohort. This division exhibited improved internal consistency and stability in the subgroups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Subsequently, differences in immune infiltration between the two subtypes were analyzed using different algorithms. Significant differences were identified between the two clusters in immune cells and immune-related functions or pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The findings indicated that subtype B was associated with more immune cell infiltration, such as B cells, CD8\u0026thinsp;+\u0026thinsp;T cells, dendritic cells, and macrophages. Similarly, subtype B exhibited heightened immune function, along with higher expression levels of immune checkpoints compared to subtype 1. The same result was found in the TCGA-BCa (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Interestingly, it was observed that BCa patients in the B subtype were much more sensitive to immunotherapy than those in the A subtype in both cohorts (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). These findings underscore the reference significance associated with the HUB gene-based classification.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.5 Screening Critical Genes and Verifying Their Expression\u003c/p\u003e \u003cp\u003eTo identify genes warranting further investigation, univariate Cox survival analysis was conducted on the 146 HUB genes in both the TCGA and GSE13507 cohorts. The intersection of the results revealed three common genes (ALDH1A1, CAMK4, DEGS1) characterized by comprehensive HR and P-values (Supplementary table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Ultimately, CAMK4 was chosen for an in-depth study. Initially, the clinical relevance of CAMK4 in human BCa was evaluated. The mRNA level of CAMK4 expression in cancer tissues (T) and their corresponding non-tumor adjacent tissues (N) from BCa patients was evaluated utilizing qPCR. The outcomes demonstrated a considerable elevation in CAMK4 expression in cancer tissues as opposed to adjacent non-cancerous tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Elevated CAMK4 expression was additionally corroborated at the protein level through western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Similarly, BCa cells cultured in vitro were examined. The outcomes demonstrated considerable elevation in CAMK4 expression in BCa cells when compared to SVHUC1 human ureteral epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). In conclusion, CAMK4 exhibits abnormally high expression in BCa tissues and cells, indicating a potential association with an unfavorable prognosis in individuals with BCa.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.6 CAMK4 overexpression promotes BCa cell proliferation, migration, and invasion\u003c/p\u003e \u003cp\u003eTo further validate the role of CAMK4 on the advancement of BCa, CAMK4 was transfected for overexpression in UMUC3 and T24 cells, respectively. The proliferation rate of CAMK4-overexpressing BCa cells was assessed using a CCK8 assay. The findings revealed that the elevated expression of CAMK4 considerably enhanced the proliferative ability of UMUC3 and T24 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The elevated expression of CAMK4 also promoted proliferative ability of UMUC3 and T24 cells in colony-forming assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Furthermore, validation was carried out using an EDU assay, and the results similarly demonstrated that elevated CAMK4 expression could enhance the proliferation of BCa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Collectively, these findings highlight that CAMK4 can enhance the proliferation of BCa cells in vitro.\u003c/p\u003e \u003cp\u003eSubsequently, the migration and invasion of BCa cells were examined. Initially, the migratory ability of BCa cells was verified using a wound healing assay, which revealed that BCa cells overexpressing CAMK4 exhibited improved wound healing after 48 hours of culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Additionally, the results from the transwell assay indicated that BCa cells, following CAMK4 overexpression, displayed increased invasion capabilities (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). These pieces of evidence indicate that CAMK4 can facilitate the migration and metastasis of BCa cells in vitro, suggesting a positive association between CAMK4 and the progression of BCa.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.7 Knockdown of CAMK4 suppressed proliferative, migratory, and invasive capacities of BCa cells\u003c/p\u003e \u003cp\u003eTo further examine the role of CAMK in BCa cells, CAMK4 expression was knocked down using siRNA in BCa cells 5637 and T24. Similar to the previous overexpression experiments, the study assessed the migratory, invasive, and proliferative capacities of BCa cells after CAMK4 knockdown. The outcomes revealed that the proliferative capacity of BCa cells was considerably inhibited following silencing of CAMK4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Similarly, the invasive and migratory abilities of BCa cells were also considerably reduced upon knockdown of CAMK4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). These results collectively indicate that silencing of CAMK4 can considerably suppress migratory, invasive, and proliferative abilities of BCa cells in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e(A) The cell proliferation of 5637and T24 cells after CAMK4 knockdown determined with CCK8 assay. (B) The cell proliferation of 5637 and T24 cells after CAMK4 knockdown determined with colony formation assay. (C) The cell proliferation of 5637 and T24 cells after CAMK4 knockdown determined with EDU assay. (D) The cell migration of 5637 and T24 cells after CAMK4 knockdown determined with wound healing assay. (E) The cell invasion of 5637 and T24 cells after CAMK4 knockdown determined with Transwell assay. *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e3.8 CAMK4 Upregulates EMT-Related Genes\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe evidence suggests that epithelial-mesenchymal transition (EMT) is a pivotal process in tumor metastasis. Several proteins, including E-cadherin (CDH1), N-cadherin (CDH2), and vimentin (VIM), are utilized as markers of EMT[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. To investigate the association between CAMK4 and EMT, analysis was conducted using BCa data from the TCGA database. The findings revealed a negative association between CAMK4 and CDH1, along with a positive association with CDH2 and VIM (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), implying that CAMK4 may contribute to the development of EMT. Validation was subsequently conducted using in vitro BCa cells. RT-qPCR results showed that CAMK4 overexpression decreased gene expression of CDH1 while promoting gene expression of CDH2 and VIM(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). In contrast, the knockdown of CAMK4 increased CDH1 gene expression and suppressed CDH2 and VIM gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). In addition, Western blot results also showed that CAMK4 was able to increase the protein levels of N-cadherin and vimentin and inhibit E-cadherin protein expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). The above outcomes indicated that CAMK4 could increase the expression of EMT markers, highlighting that CAMK4 might facilitate the advancement of BCa by upregulating EMT.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOver the last three to four decades, patients with minimally progressive survival outcomes have been diagnosed with BCa. In fact, the 5-year survival rate following radical cystectomy or chemoradiotherapy is approximately 50%[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Therefore, a better understanding of BCa biology is urgently needed to help discover more efficacious treatments. Through comprehensive analysis of gene expression data, multiple research groups have performed many analyses on molecular typing and molecular subtype identification of BCa[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In a recent consensus classification, six distinct subtypes have been defined: luminal papillary, luminal non-specified, luminal unstable, stroma-rich, basal/squamous, and neuroendocrine-like [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Although neuroendocrine-like subtypes are linked to a poorer prognosis, it is intriguing to note that stroma-rich subtypes appear to exhibit notably poor responses to neoadjuvant chemotherapy [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In addition, stroma-rich isoforms exhibit overexpression of gene signatures related to smooth muscle, endothelial cells, fibroblasts, and myofibroblasts [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Recently, the stromal cell population in the solid TME, known as CAFs, has gained attention as an important cell type affecting the survival outcome of BCa.\u003c/p\u003e \u003cp\u003eWithin the TME, CAFs plays a pivotal role in establishing a structural framework, notably the ECM, where various other TME cells reside. These cells encompass, but are not restricted to, cancer cells, cytotoxic and regulatory immune cells, antigen-presenting cells, and vascular cells such as endothelial cells[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Additionally, it was observed that CAFs in multiple datasets exhibited a robust correlation with tumor stage and displayed a positive association with immune score. Simultaneously, a close association was identified between CAFs and immune cells, particularly B cells and CD4\u0026thinsp;+\u0026thinsp;cells. Although tumor antigen presentation to T cells and production of antitumor immunoglobulins may visually indicate significant tumor suppression, specific B lymphocyte subsets can secrete tumor cell growth factors and immunosuppressive cytokines, thereby promoting evasion of immune surveillance and cancer progression [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The reticular organization of CAFs is mediated by CD8 T cells, whereas the accumulation of CAFs depends on the recruitment of B cells [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In recent years, it has been found that CAFs can directly connect and induce naive CD4\u0026thinsp;+\u0026thinsp;T cells into regulatory T cells (Tregs) in an antigen-specific manner to regulate tumor immunity [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHence, the co-expression network between CAFs and immune scores in two BCa cohorts was systematically investigated using WGCNA and various algorithms. Immune correlation analysis was subsequently conducted after typing the datasets via cluster analysis. These results indicated the instructive nature of this classification, with immunocompetent individuals predominantly clustering in subtype B. Additionally, the effectiveness of immunotherapy was confirmed in patients classified under subtype B.\u003c/p\u003e \u003cp\u003eFollowing this, three genes, namely ALDH1A1, DEGS1, and CAMK4, were screened through prognostic analysis. Notably, these three genes have been the subject of previous studies. Aldehyde dehydrogenase 1A1 (ALDH1A1) assumes a pivotal role in cellular detoxification and ROS clearance [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and it serves as a marker of cancer stem cells (CSCs)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. ALDH1A1 is critically involved in self-renewal, differentiation, and self-protection in various cancers, including lung, liver, ovarian, pancreatic, and breast cancers[\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. ALDH1A1 has also been found to be an important gene associated with CAFs in ovarian and prostate cancers[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Dihydroceramide desaturase 1 (DEGS1) plays a role in ceramide biosynthesis at the final step of the sphingolipid pathway[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Knockdown of the DEGS1 gene utilizing small inhibitor RNA in neuroblastoma cells leads to the accumulation of endogenous dihydroceramide, reduced cell growth, and G1 cell cycle arrest[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Elevated DEGS1 expression contributes to tumor progression in the tuberous sclerosis complex[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In addition, embryonic fibroblast cells knocked down for DEGS1 are defective in proliferation[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Overexpression of CAMK4 in polycystic kidney disease facilitates mTOR-mediated cell proliferation[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Moreover, CAMK4 has been associated with the malignant potential of tumors in liver cancer [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCombining HR values with P values, CAMK4 was ultimately chosen for further cell experimental validation. The function of CAMK4 in enhancing the proliferation, migratory capacity, and invasive behavior of BCa cells was tested. Notably, it was observed that CAMK4 could promote the advancement of BCa by promoting EMT development. This is justified because it has been shown that CAFs can induce the development of EMT and enrichment of CSCs[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Furthermore, the expression of CAFs markers in the interstitial space exhibits a strong correlation with the expression of EMT markers in cancer cells. Notably, in vitro stimulation of fibroblasts has been shown to induce the development of EMT in cancer cells [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, this study does have certain limitations. For instance, there are alternative methods for calculating CAFs and immune scores, and bolstering the findings with validation in additional datasets could enhance the persuasiveness of the results. Second, the study lacks extensive mechanistic experiments, but the strong association between CAMK4 and EMT-related proteins may serve as a valuable guide for future mechanistic exploration. Moreover, validating these findings through in vivo experiments would provide more compelling results and underscore their therapeutic significance.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, a CAFs-derived signature was constructed using transcriptome data from multiple datasets and through a variety of bioinformatics analyses. This signature allowed the division of BCa into two distinct subtypes characterized by differences in immune cell infiltration landscapes and immune-related characteristics. Notably, it was found that SUBTYPE B immunotherapy is more effective. Hub gene CAMK4 demonstrated its oncogenic effect by promoting the migratory, invasive, and proliferative abilities of BCa cell lines. The research findings serve as a foundation for further elucidating the mechanisms by which CAFs promotes BCa progression. Moreover, they offer valuable insights into potential therapeutic targets and new clinical treatments for BCa.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study were reviewed and approved by the ethics committee of Jingzhou Hospital Affiliated to Yangyze University (Number:2023-084-01). The written informed consent of all patients in this study was consistent with the Helsinki Declaration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1 Department of Urology, Jingzhou Hospital Affiliated to Yangtze University, Jingzhou, Hubei.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors sincerely thank all of the members of the laboratory for their valuable suggestions and appreciate TCGA and GEO for their data sharing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwelve patients gave informed consent and agreed to participate in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.L. conceived and designed the experiments; X.S. and Y. G. performed the experiments; X.S. and Y. G. analyzed and interpreted the data; X.S. and Y. G. wrote the paper; All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was no Funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analysed during the current study are available in the TCGA and GSE repository, [https://portal.gdc.cancer.gov/],[https://www.ncbi.nlm.nih.gov/geo/].\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Rumgay H, Li M, Yu H, Pan H, Ni J. The global landscape of bladder cancer incidence and mortality in 2020 and projections to 2040. J Glob Health. 2023;13: 04109.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran L, Xiao J-F, Agarwal N, Duex JE, Theodorescu D. Advances in bladder cancer biology and therapy. Nat Rev Cancer. 2021;21: 104\u0026ndash;121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJordan B, Meeks JJ. T1 bladder cancer: current considerations for diagnosis and management. Nat Rev Urol. 2019;16: 23\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLenis AT, Lec PM, Chamie K, Mshs MD. Bladder Cancer: A Review. JAMA. 2020;324: 1980\u0026ndash;1991.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao J, Yang X, Li J, Wu H, Li P, Yao Z, et al. Screening and Identifying Immune-Related Cells and Genes in the Tumor Microenvironment of Bladder Urothelial Carcinoma: Based on TCGA Database and Bioinformatics. Front Oncol. 2019;9: 1533.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu N, Ke Z-B, Lin X-D, Chen Y-H, Wu Y-P, Chen Y, et al. Development and validation of a molecular prognostic index of bladder cancer based on immunogenomic landscape analysis. Cancer Cell Int. 2020;20: 302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBr\u0026ouml;cker V, L\u0026auml;nger F, Fellous TG, Mengel M, Brittan M, Bredt M, et al. Fibroblasts of recipient origin contribute to bronchiolitis obliterans in human lung transplants. Am J Respir Crit Care Med. 2006;173: 1276\u0026ndash;1282.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeisberg EM, Potenta S, Xie L, Zeisberg M, Kalluri R. Discovery of endothelial to mesenchymal transition as a source for carcinoma-associated fibroblasts. Cancer Res. 2007;67: 10123\u0026ndash;10128.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou H, Li R, Liu J, Long J, Chen T. Characterization and verification of CAF-relevant prognostic gene signature to aid therapy in bladder cancer. Heliyon. 2024;10(3):e23873.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldman MJ, Craft B, Hastie M, Repečka K, McDade F, Kamath A, et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol. 2020;38: 675\u0026ndash;678.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRacle J, de Jonge K, Baumgaertner P, Speiser DE, Gfeller D. Simultaneous enumeration of cancer and immune cell types from bulk tumor gene expression data. Elife. 2017;6: e26476.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAran D, Hu Z, Butte AJ. xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol. 2017;18: 220.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangfelder P, Horvath S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9: 559.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilkerson MD, Hayes DN. ConsensusClusterPlus: a class discovery tool with confidence assessments and item tracking. Bioinformatics. 2010;26: 1572\u0026ndash;1573.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonteiro-Reis S, Lobo J, Henrique R, Jer\u0026oacute;nimo C. Epigenetic Mechanisms Influencing Epithelial to Mesenchymal Transition in Bladder Cancer. Int J Mol Sci. 2019;20: E297.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeoh JY-C, Huang J, Ko WY-K, Lok V, Choi P, Ng C-F, et al. Global Trends of Bladder Cancer Incidence and Mortality, and Their Associations with Tobacco Use and Gross Domestic Product Per Capita. Eur Urol. 2020;78: 893\u0026ndash;906.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMo Q, Nikolos F, Chen F, Tramel Z, Lee Y-C, Hayashi K, et al. Prognostic Power of a Tumor Differentiation Gene Signature for Bladder Urothelial Carcinomas. J Natl Cancer Inst. 2018;110: 448\u0026ndash;459.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarzouka N-A-D, Eriksson P, Rovira C, Liedberg F, Sj\u0026ouml;dahl G, H\u0026ouml;glund M. A validation and extended description of the Lund taxonomy for urothelial carcinoma using the TCGA cohort. Sci Rep. 2018;8: 3737.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamoun A, de Reyni\u0026egrave;s A, Allory Y, Sj\u0026ouml;dahl G, Robertson AG, Seiler R, et al. A Consensus Molecular Classification of Muscle-invasive Bladder Cancer. Eur Urol. 2020;77: 420\u0026ndash;433.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurley A, Rullan A, Wilkins A. A review of the biology and therapeutic implications of cancer-associated fibroblasts (CAFs) in muscle-invasive bladder cancer. Front Oncol. 2022;12: 1000888.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinici C, Testoni S, Della-Torre E. B-Lymphocytes in the Pathophysiology of Pancreatic Adenocarcinoma. Front Immunol. 2022;13: 867902.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodriguez AB, Peske JD, Woods AN, Leick KM, Mauldin IS, Meneveau MO, et al. Immune mechanisms orchestrate tertiary lymphoid structures in tumors via cancer-associated fibroblasts. Cell Rep. 2021;36: 109422.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang H, Wang Z, Zhang Y, Pradhan RN, Ganguly D, Chandra R, et al. Mesothelial cell-derived antigen-presenting cancer-associated fibroblasts induce expansion of regulatory T cells in pancreatic cancer. Cancer Cell. 2022;40: 656\u0026ndash;673.e7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePereira F, Rosenmann E, Nylen E, Kaufman M, Pinsky L, Wrogemann K. The 56 kDa androgen binding protein is an aldehyde dehydrogenase. Biochem Biophys Res Commun. 1991;175: 831\u0026ndash;838.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTomita H, Tanaka K, Tanaka T, Hara A. Aldehyde dehydrogenase 1A1 in stem cells and cancer. Oncotarget. 2016;7: 11018\u0026ndash;11032.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang F, Qiu Q, Khanna A, Todd NW, Deepak J, Xing L, et al. Aldehyde dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer. Mol Cancer Res. 2009;7: 330\u0026ndash;338.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y-C, Yo Y-T, Lee H-Y, Liao Y-P, Chao T-K, Su P-H, et al. ALDH1-bright epithelial ovarian cancer cells are associated with CD44 expression, drug resistance, and poor clinical outcome. Am J Pathol. 2012;180: 1159\u0026ndash;1169.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Qiang J, Deng Q, Xia J, Deng L, Zhou L, et al. ALDH1A1 Activity in Tumor-Initiating Cells Remodels Myeloid-Derived Suppressor Cells to Promote Breast Cancer Progression. Cancer Res. 2021;81: 5919\u0026ndash;5934.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoret N, Vandamme N, De Coninck J, Taminau J, De Clercq K, Blancke G, et al. Distinct Transcriptional Programs in Ascitic and Solid Cancer Cells Induce Different Responses to Chemotherapy in High-Grade Serous Ovarian Cancer. Mol Cancer Res. 2022;20: 1532\u0026ndash;1547.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Wang M, Wang M, Liu M. Single-cell and bulk RNA sequencing reveal cancer-associated fibroblast heterogeneity and a prognostic signature in prostate cancer. Medicine (Baltimore). 2023;102: e34611.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlanas-Serra L, Launay N, Goicoechea L, Heron B, Jou C, Juli\u0026aacute;-Palacios N, et al. Sphingolipid desaturase DEGS1 is essential for mitochondria-associated membrane integrity. J Clin Invest. 2023;133: e162957.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKraveka JM, Li L, Szulc ZM, Bielawski J, Ogretmen B, Hannun YA, et al. Involvement of dihydroceramide desaturase in cell cycle progression in human neuroblastoma cells. J Biol Chem. 2007;282: 16718\u0026ndash;16728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAstrinidis A, Li C, Zhang EY, Zhao X, Zhao S, Guo M, et al. Upregulation of acid ceramidase contributes to tumor progression in tuberous sclerosis complex. JCI Insight. 2023;8: e166850.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarbarroja N, Rodriguez-Cuenca S, Nygren H, Camargo A, Pirraco A, Relat J, et al. Increased dihydroceramide/ceramide ratio mediated by defective expression of degs1 impairs adipocyte differentiation and function. Diabetes. 2015;64: 1180\u0026ndash;1192.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Daniel EA, Metcalf J, Dai Y, Reif GA, Wallace DP. CaMK4 overexpression in polycystic kidney disease promotes mTOR-mediated cell proliferation. J Mol Cell Biol. 2022;14: mjac050.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Lu J, Zeng G, Pang J, Zheng X, Feng J, Zhang J. MiR-129-5p inhibits liver cancer growth by targeting calcium calmodulin-dependent protein kinase IV (CAMK4). Cell Death Dis. 2019;10(11):789.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Ouml;zdemir BC, Pentcheva-Hoang T, Carstens JL, Zheng X, Wu C-C, Simpson TR, et al. Depletion of carcinoma-associated fibroblasts and fibrosis induces immunosuppression and accelerates pancreas cancer with reduced survival. Cancer Cell. 2014;25: 719\u0026ndash;734.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchulte J, Weidig M, Balzer P, Richter P, Franz M, Junker K, et al. Expression of the E-cadherin repressors Snail, Slug and Zeb1 in urothelial carcinoma of the urinary bladder: relation to stromal fibroblast activation and invasive behaviour of carcinoma cells. Histochem Cell Biol. 2012;138: 847\u0026ndash;860.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CAFs, bladder cancer, CAMK4, EMT","lastPublishedDoi":"10.21203/rs.3.rs-4438820/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4438820/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003eCancer-associated fibroblasts (CAFs) are crucial in the regulation of cancer cell biological properties through complex and dynamic communication networks. However, the mechanism of action of CAFs in bladder cancer (BCa) remains elusive.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003eThis study integrated transcriptome data from multiple datasets and constructed an ensemble of genes associated with CAFs through a series of algorithms. It further categorized BCa into two molecular subtypes, distinguished by their immune cell infiltration and immune-related characteristics. CAMK4 was subsequently selected for further validation, and it was found that CAMK4 promoted the tumor-promoting ability of BCa specifically in terms of proliferative, migratory, and invasive capacities and also facilitated the development of epithelial-mesenchymal transition (EMT).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eTo sum up, our signature and its derived subtype facilitates a more accurate identification of potential candidates for immunotherapy among BCa patients. In addition, CAMK4 may be a promising target for BCa therapy.\u003c/p\u003e","manuscriptTitle":"In silico analysis and validation the cancer- associated fibroblasts related gene CAMK4 promotes bladder cancer progression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-13 02:48:37","doi":"10.21203/rs.3.rs-4438820/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"996a5b8b-d8e2-4ff3-82f3-9549b6f78f8b","owner":[],"postedDate":"June 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":33010139,"name":"Biological sciences/Genetics/Cancer genomics"},{"id":33010140,"name":"Biological sciences/Cancer/Tumour biomarkers"}],"tags":[],"updatedAt":"2024-12-30T08:38:55+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-13 02:48:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4438820","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4438820","identity":"rs-4438820","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.