Prediction of local failure by residual tumor cells after radical prostatectomy using retinoic acid receptor beta (RARB) promoter hypermethylation analysis

Prediction of local failure by residual tumor cells after radical prostatectomy using retinoic acid receptor beta (RARB) promoter hypermethylation analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Prediction of local failure by residual tumor cells after radical prostatectomy using retinoic acid receptor beta (RARB) promoter hypermethylation analysis Frank Christoph, Alina Riess, Burkhard Jandrig, Daniel Baumunk, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7877027/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Positive surgical margins after radical prostatectomy (RP) are an imperfect surrogate of residual tumor and do not reliably identify men who will experience biochemical recurrence (BCR). Promoter hypermethylation of retinoic acid receptor beta gene ( RARB ) is a frequent epigenetic alteration in prostate cancer (PCa). We evaluated whether intraoperative sampling of the prostatic fossa with quantitative methylation-specific PCR (qMSP) for RARB improves prediction of BCR compared with conventional histology and margin status. Methods In a dual-centre study, 176 men with biopsy-proven PCa undergoing open or robot-assisted RP had nine standardized biopsies (sites A–I) taken from the prostatic fossa before vesicourethral anastomosis; 32 cystectomy patients served as cancer-free controls. Each fossa biopsy was split for routine histology and qMSP analysis of RARB ( MYOD1 as internal control). Clinicopathologic data and PSA follow-up were prospectively recorded. BCR was defined per German S3 guideline thresholds. Statistical testing included Pearson’s χ², Fisher’s exact, McNemar, and Mann–Whitney U tests (two-sided, α = 0.05). Results Median age was 65 years; median diagnostic PSA 7.15 ng/ml. On specimen assessment, 130 men were R0 and 46 R1. Among 164 fossa samples with benign histology, 96 (59%) were RARB -positive by qMSP; among 12 histologically malignant fossa samples, 9 (75%) were RARB -positive (Table 1). RARB hypermethylation associated significantly with surgical margin status (p < 0.0001) and with BCR (p = 0.039), but not with T-stage or initial PSA; associations by ISUP grade showed a trend for ≥ 3 (p = 0.090) and significance for ≥ 4 (p = 0.029). All 160 control-fossa samples were RARB -negative, while 20 prostate cancer tissue controls were RARB -positive. During a median 60-month follow-up (n = 152), 32 men (21%) developed BCR. In the BCR subset suitable for analysis (n = 27), fossa histology was positive in 3 (11%), specimen margin status was positive in 13 (48%), and RARB was positive in 23 (85%). For predicting BCR, RARB analysis outperformed margin status and fossa histology (each p < 0.001; McNemar where applicable). Conclusions Intraoperative prostatic fossa biopsies analyzed for RARB promoter hypermethylation detect molecular residual disease that is frequently missed by routine histology and provide superior prediction of BCR compared with surgical margin status. RARB methylation may enable earlier, biologically informed selection for adjuvant or early salvage radiotherapy while avoiding overtreatment in molecularly negative patients. Prospective validation and integration with multivariable models are warranted. RARB promoter hypermethylation prostate cancer biochemical recurrence Figures Figure 1 INTRODUCTION Prostate cancer (PCa) is the most common cancer disease in men and affects 26% of all male cancer patients. Worldwide, an estimated 1,466,680 cases are diagnosed annually while 396,792 patients have died from prostate cancer in 2022[ 3 ] Adjuvant therapeutic strategies such as local external radiation therapy have helped to reduce risk from early death by tumor recurrence especially after radical prostatectomy. Therefore, it is crucial to identify those patients that are at high risk for biochemical recurrence and to separate these from patients that do not need further therapy and to avoid overtreatment. Thus far, therapeutic strategies have been based on initial histopathological staging using prostate specific antigen (PSA) as follow-up biomarker. Unfortunately, until now molecular staging is not used and we still have to rely on histopathological staging after radical resection of the prostate. There is substantial body of evidence, that epigenetic alterations may play a role in pathology detection and prognostic evaluation. Hypermethylation of the promoter region of a gene leads to transcriptional repression and subsequent transcriptional silencing of genes that may drive the cell into further tumor progression. However, genetic silencing by hypermethylation can also affect genes that are helpful and inhibit uncontrolled cell growth, such as retinoic acid, the metabolite of vitamin A that interacts with its receptor, retinoic acid receptor beta[ 20 ]. The methylation rate of RARB in prostate cancer cells was reported between 79% up to 90% in hormone-independent prostate cancer[ 12 , 25 ]. But promoter hypermethylation is not exclusively found in prostate cancer, it has been reported as well in hepatocellular, breast and non-small cell lung cancer[ 14 ]. A meta-analysis by Dou et al. has shown that RARB promoter methylation is more frequently and correlated with prostate cancer carcinogenesis as compared to benign tissue. They concluded that promoter methylation of the RARB promoter is an early and common event in tumorigenesis of prostate cancer suggesting an important role in the history of the disease. However, there have been controversial results that warranted further studies to clarify the role of RARB methylation to use it as a potential biomarker in prostate cancer[ 5 ]. With this knowledge, our goal was to identify factors and patients who will benefit from adjuvant therapies, such as radiotherapy, because of high risk of early biochemical recurrence instead of waiting until PSA relapse happens. If tumor cells are detected in the fossa, this corresponds to the definition of residual tumor according UICC. If tumor cells are found at the margin of the specimen during pathological analysis, this is called positive resection margin. In the daily practice the same Abbreviation R is used, although that doesn´t correspond to the above mentioned definition. The present work addresses this issue. Therefore, biopsy specimen from the prostatic fossa were obtained after radical prostatectomy following a specific sample pattern. The samples were analysed using methylation specific PCR for the RARB gene. To compare RARB gene promoter methylation with non prostate cancer tissue, expression analysis was also performed from patients tissue that did not suffer from prostate cancer and who served as a control. In a previous study, we analysed samples from the prostatic fossa using a methylation-specific PCR for GSTP1 [ 29 ]. The methylation-specific PCR for RARB , introduced in this publication, offers markedly improved sensitivity. Thus, the analysis of RARB methylation analysis of the fossa may contribute to identifying patients at greater risk of later biochemical recurrence. MATERIALS AND METHODS Patients and sample collection This dual centre trial included a total of 176 patients with organ confined, biopsy proven prostate cancer who underwent open or robot-assisted RPE by two experienced surgeons at the Department of Urology, University of Magdeburg, Germany or St. Antonius Hospital, Gronau, Germany. As prostate cancer negative control group, biopsies from 32 male patients who underwent radical cystectomy (RCE) for urothelial carcinoma at the Department of Urology, University of Magdeburg were used. All patients signed a written informed consent approved by the medical ethics committee of the Otto-von-Guericke University Magdeburg (# 87/11) and Westfaelische Wilhelms-University Muenster (2012-086-b-S). Analysis was carried out in accordance with the ICH-approved GCP and GLP guidelines and regulations. After completion of RPE nine specimens (A – I) were taken from defined areas in the prostatic fossa (Fig. 1 ) as described by Witt et al [ 29 ], before the urethrovesical anastomosis was reconstructed. In total 1,584 specimens were taken and bisected with a sterile scalpel. Half of each sample was sent for further conventional histopathological analysis to the Department of Pathology at the University of Magdeburg or St. Antonius Hospital in Gronau. The other half of each specimen was flash frozen in liquid nitrogen and stored at -80°C pending molecular genetic analysis. From each patient of the control group (n = 32) five tissue samples (C-G) were taken from the prostatic fossa (n = 160) after completion of RCE by the same technique and worked up as for the study samples. Methylation analyses Methylation analyses were performed according to the protocol described by Jentzmik et al. 2011[ 10 ]. Briefly, DNA was isolated from biopsies using innuPREP DNA mini Kits (Analytik Jena, Jena, Germany) following protocol 1 of the manual. DNA was eluted in 50 µl elution buffer. DNA concentration and purity were analysed by using the spectral photometer Nanodrop 2000 (Thermo Fisher Scientific, Darmstadt, Germany). DNA was bisulfite-converted using EpiTect Bisulfite kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The samples were eluted once in 20 µl elution buffer. Quantitative Methylation-Specific Polymerase chain reaction (Q-MSP) Q-MSP with specific probes was used to determine the methylation status. This was performed as a duplex PCR of the promoter regions of the genes RARB and MYOD1 (coding for the housekeeping Myoblast determination protein 1) as an internal control to estimate the amount of input template in each sample) using StepOnePlus Real-Time PCR Systems and StepOne Software v2.1 (Applied Biosystems, Darmstadt, Germany). Primers and probes used for the amplification and detection of methylated RARB were 5'-CGAGAACGCGAGCGATTC (forward primer), 5'-CAAACTTACTCGACCAATCCAACC (reverse primer) and M-RARB-TMS 5'-TCGGAACGTATTCGGAAGGTTTTTTGTAAGTATTT (Taqman probe) (Life Technologies, Darmstadt, Germany); the fluorescence dye was FAM. Primers and probe used for the amplification and detection of MYOD1 were 5'- CCAACTCCAAATCCCCTCTCTAT (forward primer), 5'- TGATTAATTTAGATTGGGTTTAGAGAAGGA (reverse primer) and M-MYOD1-TMS 5'-TCCCTTCCTATTCCTAAATCCAACCTAAATACCTCC (Taqman probe) (Life Technologies, Darmstadt, Germany); the fluorescence dye was VIC. The sequences concerning RARB are the same as described by Bastian et al. 2007[ 3 ], the sequences concerning MYOD1 are the same as described by Yegnasubramanian et al.[ 30 ] PCR was initiated at 50°C for 2 min, then 95°C for 15 min, followed by 50 cycles of 95°C for 1 min and 60°C for 1 min. Bisulfite-converted CpGenome universal methylated DNA (Merck Millipore, Darmstadt, Germany) as well as bisulfite-treated DNA of the human prostate adenocarcinoma cell line LNCaP served as a positive methylation control [ 13 ]. Blank reactions with distilled water replacing DNA were used as a negative control (non-template control, NTC). Each assay was performed twice and in duplicate as in Jentzmik et al. 2011[ 10 ]. If the MYOD1 PCR was negative the assay was regarded as unsuccessful. Clinical data acquisition The following clinicopathological data were collected prospectively according to GCP: age, preoperative PSA value, tumor classification according to UICC TNM classification 2018 (8th edition), tumor grading according to Gleason and biochemical relapse. For further analysis, the patient cohort was subdivided into the following groups: localized or advanced tumor stage (≤ pT2, pN0 vs. ≥ pT3 and/or pN1), ISUP tumor grade (ISUP < 2 vs. ≥ 2; ISUP < 3 vs. ≥ 3; ISUP < 4 vs. ≥ 4), lymph node status (N0 vs. N1) and surgical margin status based on prostatectomy specimens (R0 vs. R1). Statistical Analysis IBM SPSS Statistics Version 26 (IBM Corporation, Armonk, NY, USA) was used for statistical analysis. The statistical tests applied were Pearson’s chi-squared test, Fisher’s exact test, McNemar test, Mann–Whitney U test and Contingency Coefficient. All tests were two sided. P values < 0.05 were considered as statistically significant. RESULTS PCa patients characteristics The median age of patients (n = 176) at the time of RPE was 65 years (mean age 60.5, interquartile range 9.25, range 45–77). The TNM and grading classification showed the following subgroups distribution: Tumor stage: pT2a (n = 10), pT2b (n = 9), pT2c (n = 84), pT3a (n = 40), pT3b (n = 26) and pT4 (n = 6). Lymph node status: pN0 (n = 137), pN1 (n = 16) and pNx (n = 23). ISUP grade: grade 1 (n = 58), grade 2 (n = 46), grade 3 (n = 37), grade 4 (n = 15), grade 5 (n = 19). Gleason-Score: 3 + 3 = 6 (n = 59), 3 + 4 = 7a (n = 46), 4 + 3 = 7b (n = 38), 3 + 5 = 8a (n = 1), 5 + 3 = 8b (n = 0), 4 + 4 = 8c (n = 15), 4 + 5 = 9a (n = 12), 5 + 4 = 9b (n = 5), 5 + 5 = 10 (n = 0). The median PSA at the time of diagnosis was 7.15 ng/ml (mean PSA 11.4, interquartile range 6.49, range 0.9–115). Histological analysis of Margin Status in PCa patients In the group of patients with prostate cancer (n = 176) 130 patients were histologically classified as having a negative margin status (74%) on prostatectomy sample whereas 46 (26%) patients had a positive surgical margin classified as R1. Combining histological and molecular genetic analysis of prostatic fossa tissue samples in PCa patients Looking at the results of the patients with a combination of histologic and genetic analysis of the fossa samples and RARB methylation, the following results are shown for the histologically fossa negative (n = 164) and histologically fossa positive (n = 12) patients. A clear majority of 59% of the matched samples from the prostatic fossa, in which no cancer was detected histologically, showed molecular evidence of residual tumor cells, as indicated by positive RARB hypermethylation. Conversely, only a clear minority of 25% of the histologically positive samples were negative on molecular analysis (Table 1 ). Table 1 Histological vs. molecular genetic analyses ( RARB hypermethylation) Histological vs. molecular genetic analyses (RARB hypermethylation) Fossa biopsy with benign histology (PCa negative) Fossa biopsy with malignant histology (PCa positive) Total Fossa biopsy with negative RARB hypermethylation ( RARB negative) 68 (41%) 3 (25%) 71 Fossa biopsy with positive RARB hypermethylation ( RARB positive) 96 (59%) 9 (75%) 105 Total 164 12 176 RARB promoter hypermethylation of prostatic fossa tissue samples in PCa patients Based on the classical histological classification into R0 and R1 patients, 124 of the 130 R0 patients (95.4%) also showed negative conventional histology in the fossa, while 6 (4.6%) had a positive finding. Among the 46 patients with positive surgical margins (R1), 40 (87%) showed positive conventional histology in the fossa, whereas 6 (13%) had a negative result (Table 2 ). Table 2 Surgical margin status of the prostatectomy specimen vs. histological analysis of prostatic fossa samples Surgical margin status of the prostatectomy specimen vs. histological analysis of prostatic fossa samples Margin Status of prostatectomy specimen Total negative (R0) positive (R1) Prostatic fossa sample histologically negative 124 (95,4%) 40 (87%) 164 histologically positive 6 (4,6%) 6 (13%) 12 Total 130 46 176 Based on the classical histological classification into R0 and R1 patients, 68/164 (38%) of the R0 patients showed no promoter hypermethylation and 96/164 (54%) showed promoter hypermethylation of the RARB gene. In the group of R1 patients, 3/12 (25%) showed no and 9/12 (75%) showed hypermethylation in the RARB gene (Table 3 ). Table 3 Surgical margin status of the prostatectomy specimen vs. RARB hypermethylation analysis of prostatic fossa samples Surgical margin status of the prostatectomy specimen vs. RARB hypermethylation analysis of prostatic fossa samples Margin status of prostatectomy specimen Total negative (R0) positive (R1) Prostatic fossa sample RARB negative 62 (47,7%) 9 (19,6%) 164 RARB positive 68 (52,3%) 37 (80,43%) 12 Total 130 46 176 RARB promoter hypermethylation and clinical data There was no statistically significant correlation found for RARB promoter hypermethylation and tumour stage (pT2, pN0 vs. ≥ pT3 and/or pN1) (p = 0.481, Pearson’s chi-squared test) or ISUP tumour grade (ISUP = 1 vs. ≥ 2 p = 0.948, Pearson’s chi-squared test). There was a statistical trend for RARB promoter hypermethylation and ISUP < 3 vs. ≥ 3 (p = 0.090, Pearson’s chi-squared test) and a significant correIation for RARB promoter hypermethylation and ISUP < 4 vs. ≥ 4 (p = 0.029, Pearson’s chi-squared test). There was also found a significant correIation for RARB promoter hypermethylation, surgical margin status (p < 0.0001, Pearson’s chi-squared test) and biochemical recurrence (p = 0.039, Fisher’s exact test). The initial PSA was not associated with RARB promoter hypermethylation (p = 0.81, Mann-Whitney U test). Control Group In the control group without prostate cancer (n = 32), all 160 tissue samples examined were negative for RARB promoter hypermethylation. Twenty prostate cancer tissue samples were also examined, all of which were positive for RARB promoter methylation. Postoperative PSA kinetics Follow up data for biochemical recurrence was available in 152 of 176 patients. The median duration of follow-up was 60 months (mean 54, interquartile range 12, range 6–60). According to the German S3 guidelines we defined a biochemical recurrence (BCR) if a patient had at least two PSA levels > 0.2 ng/ml or one PSA level > 0.4 ng/ml after reaching a PSA nadir of zero. Thirty two (21%) patients were diagnosed with BCR. Four patients (4/152, 3%) died during the observation period and the cause of death remains unknown. In the group of patients with BCR, 27 were suitable for further examination. Of these, 13 patients had a positive resection margin (48%). In this group of 27 patients, only 3 patients had positive histologic findings in the fossa samples, but the fossa samples showed hypermethylation of the RARB promoter in the genetic analysis in 23/27 (85%). The classical R-status (margins on the specimen) was significantly superior to histological sampling from the fossa (p < 0.001) but RARB analysis from the fossa was significantly superior to the classical R-status (p < 0.001) to predict BCR. RARB analysis from the fossa was also significantly superior to histological sampling from the fossa (p < 0.001; McNemar test) in prediction of biochemical tumor recurrence. DISCUSSION If tumor cells are found at the edge of the specimen during pathological analysis, this is called a positive margin. In the UICC classification, this is called "residual tumor"[ 2 ], but the mere detection of tumor at the edge of the specimen cannot prove that there is further residual tumor tissue in the resected area. This study addresses this issue. We want to investigate the question of whether histologically and with molecular methods an actual and possibly clinically relevant residual tumor exists after a radical prostatectomy. For this reason, we took samples from 8 locations in the fossa, divided them and examined them both histologically and by analyzing RARB promoter hypermethylation. If there is a biochemical recurrence within the follow-up of 5 years, this is a clinical positive control. This shows whether the prediction with one or the other method was sensitive and clinically relevant. While the impact of a positive margin on overall survival continues to be debated, there is evidence that a positive margin has a negative impact on disease-free survival[ 13 , 21 ]. A higher biochemical risk of recurrence may lead to an earlier need for adjuvant or salvage therapies, which may affect patients' quality of life. The detection of positive resection margins can influence treatment planning after surgery. Additional treatments such as adjuvant radiotherapy or hormone therapy are often considered to reduce the risk of recurrence. Studies such as SWOG 8794 have shown that adjuvant radiotherapy can significantly reduce the biochemical risk of recurrence in patients with positive margins[ 24 ]. However, the significance of positive resection margins is not undisputed. Some studies argue that the mere presence of positive margins does not necessarily lead to a worse prognosis, but that factors such as Gleason score, tumor stage and PSA dynamics also play a crucial role[ 28 ]. Future research could focus on developing predictive models that integrate multiple variables to enable more individualized prognoses. Historically, a positive discontinuation margin is no longer as important as it used to be. Tilki at al. was able to show that salvage radiation therapy is about equally effective as adjuvant radiation from an oncological perspective if no high risk situation is apparent[ 27 ]. As early radiotherapy impairs continence function and recovery of erectile function, a positive withdrawal margin is not synonymous with the need for adjuvant therapy[ 15 ]. It remains unclear which factors determine the course of the disease in terms of a relevant biochemical recurrence for the patient. Various molecular markers have been investigated to date, but none are used in the clinical world. For this reason, the classic clinical pathological parameters that are currently used to assess the risk of a subsequent biochemical recurrence remain. A meta-analysis by Guo et al. identified the size of the resection margin and the primary Gleason score as relevant parameters[ 8 ]. In order for tumor cells to proliferate meaningfully within the cavity and form a measurable recurrence, a minimum number of cells is required. Based on prostate cancer xenograft models in mice, it is estimated that at least 1×10⁶ cells are necessary to establish a growing tumor. This supports the notion that microscopic residual disease may fail to reach biological relevance [ 26 ]. In the course of this discovery, various studies have investigated whether the margin of discontinuation or the primary Gleason score and corresponding adjuvant therapy can reduce the occurrence of a new tumor recurrence in the case of increased risk. The RADICALS study by Parker et al. was one of the largest RCTs to prove that early radiotherapy does not lead to any improvement in tumor control or tumor-specific survival[ 17 ], but does lead to a significant worsening of urinary and fecal incontinence[ 18 ]. Additional androgen deprivation therapy (ADT) also did not lead to a reduction in tumor-specific survival[ 16 ]. Unfortunately, the rehabilitation of erectile function, which, in addition to the recovery of urinary incontinence, contributes significantly to quality of life, was not investigated. Nevertheless, the fact that the addition of ADT does not contribute significantly to improving cancer-specific survival suggests that the presence of occult tumor cells, which could explain the poorer prognosis of ISUP > 3 carcinomas, could also be independent of the primary Gleason score. Although retrospective studies (Soto et al.) have described an advantage in progression-free survival (PFS) for patients with high-risk carcinoma[ 22 ]. This could mean that neither tumor stage nor Gleason score are relevant parameters for determining the effect or benefit of adjuvant or salvage therapy, but that other parameters, e.g. molecular parameters, must be found instead. These include, for example, genomic classifiers that create a global expression pattern or tumor signature or proteogenomic markers[ 23 ]. Circulating tumor cells can also provide information on the aggressive behavior of a tumor disease[ 4 ]. However, clinically reliable data on these markers is still lacking. One possible candidate, GSTP1 promoter methylation, has been described as an ideal candidate for such molecular staging. In older methylation studies by Goessl et al.[ 7 ] or Bastian et al.[ 1 ], GSTP1 was described as a possible candidate for a more specific tumor characterization. However, it has not yet been used clinically. Witt et al. were able to show that GSTP1 promoter methylation in fossa samples correlated with the degree of differentiation of the tumor[ 29 ]. Gupta et al. recently demonstrated that the methylation of the GSTP1 promoter increases extensively from normal prostate cells to carcinoma cells[ 9 ]. Another possible candidate, the RARB gene, was investigated in this study. In an earlier study, Jeronimo et al. showed that the RARB gene is predominantly methylated in prostate cancer, but that there is no correlation with the Gleason score; no further correlation with clinical parameters was performed[ 11 ]. Contradictory statements by various authors led Gao et al. to conduct a meta-analysis with the result that promoter hypermethylation of the RARB promoter appears to be independent of tumor stage and Gleason score and thus represents an early event in tumorigenesis[ 6 ]. This would not support the approach of using RARB as a sensitive predictive and genetic marker in comparison to the histologically based Gleason score. Our data showed that RARB was particularly detectable in patient samples in which a BCR occurred (85%). Thus, the detection of RARB hypermethylation in a fossa sample could not only suggest an increased risk of recurrence but also facilitate the decision to perform early or adjuvant radiotherapy in the case of a BCR. The data shown here suggest that RARB promoter methylation is another potential marker that can contribute to the decision making process of early versus salvage radiotherapy. However, the recommendation of the German S3 guideline is to delay radiotherapy in any case, as the possibility of early rehabilitation of incontinence and potency is preserved[ 19 ]. As the studies to date have not shown any survival disadvantage of delayed radiotherapy, the clinical question at present is not so much who should receive radiotherapy but rather when it should be given, possibly with concomitant hormone therapy in the case of aggressive tumor differentiation. CONCLUSION Our data indicate that intraoperative prostatic-fossa biopsies analyzed for RARB promoter hypermethylation capture molecular residual disease that conventional histology and margin status often miss, and that RARB positivity is associated with a higher risk of biochemical recurrence. These results suggest that RARB qMSP adds actionable information to early post-prostatectomy risk stratification and may refine decisions between adjuvant and early-salvage radiotherapy, helping to limit both under- and overtreatment. Declarations CONFLICT OF INTEREST STATEMENT M. Schostak is the Managing Director and Medical Director of LOGICURO GmbH, Potsdam, Germany. J. Witt is the Head of the UroKompetenz Private Urology Clinic, Düsseldorf, Germany. All other authors declare no conflicts of interest related to this work. AUTHOR CONTRIBUTION STATEMENT M. Schostak, D. Baumunk, and J. Witt contributed patient data to the study. A. Riess performed the laboratory analyses, and B. Jandrig supervised the laboratory work. F. Christoph and M. Schostak performed the statistical analysis and wrote the manuscript. All authors reviewed and approved the final version of the manuscript and agreed to be accountable for all aspects of the work. References Bastian PJ, Ellinger J, Heukamp LC et al. (2007) Prognostic value of CpG island hypermethylation at PTGS2, RAR-beta, EDNRB, and other gene loci in patients undergoing radical prostatectomy. Eur Urol 51:665-674; discussion 674 Berlin A, Brierley J, Cornford P et al. (2022) TNM Staging of Prostate Cancer: Challenges in Securing a Globally Applicable Classification. Eur Urol 82:e52-e53 Bray F, Laversanne M, Sung H et al. (2024) Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 74:229-263 Cao L, Hao P, Lin D et al. (2021) Application of Primary/Secondary Circulating Tumor Cells for the Prediction of Biochemical Recurrence in Nonmetastatic Prostate Cancer Patients following Radical Prostatectomy or Radiotherapy: A Meta-Analysis. Biomed Res Int 2021:4730970 Dou M, Zhou X, Fan Z et al. (2018) Clinical Significance of Retinoic Acid Receptor Beta Promoter Methylation in Prostate Cancer: A Meta-Analysis. Cell Physiol Biochem 45:2497-2505 Gao T, He B, Pan Y et al. (2013) The association of retinoic acid receptor beta2(RARbeta2) methylation status and prostate cancer risk: a systematic review and meta-analysis. PLoS One 8:e62950 Goessl C, Muller M, Heicappell R et al. (2001) DNA-based detection of prostate cancer in blood, urine, and ejaculates. Ann N Y Acad Sci 945:51-58 Guo H, Zhang L, Shao Y et al. (2024) The impact of positive surgical margin parameters and pathological stage on biochemical recurrence after radical prostatectomy: A systematic review and meta-analysis. PLoS One 19:e0301653 Gupta H, Inoue H, Nakai Y et al. (2023) Progressive Spreading of DNA Methylation in the GSTP1 Promoter CpG Island across Transitions from Precursors to Invasive Prostate Cancer. Cancer Prev Res (Phila) 16:449-460 Jentzmik F, Krause H, Reichelt U et al. (2012) GSTP1 CpG island hypermethylation for DNA-based detection of occult tumor cells in surgical margins after radical prostatectomy. World J Urol 30:541-546 Jeronimo C, Bastian PJ, Bjartell A et al. (2011) Epigenetics in prostate cancer: biologic and clinical relevance. Eur Urol 60:753-766 Lam D, Clark S, Stirzaker C et al. (2020) Advances in Prognostic Methylation Biomarkers for Prostate Cancer. Cancers (Basel) 12 Lysenko I, Mori K, Mostafaei H et al. (2020) Prognostic Value of Gleason Score at Positive Surgical Margin in Prostate Cancer: A Systematic Review and Meta-analysis. Clin Genitourin Cancer 18:e517-e522 Moison C, Assemat F, Daunay A et al. (2014) Synergistic chromatin repression of the tumor suppressor gene RARB in human prostate cancers. Epigenetics 9:477-482 Munoz F, Sanguineti G, Bresolin A et al. (2021) Predictors of Patient-Reported Incontinence at Adjuvant/Salvage Radiotherapy after Prostatectomy: Impact of Time between Surgery and Radiotherapy. Cancers (Basel) 13 Parker CC, Clarke NW, Cook AD et al. (2024) Adding 6 months of androgen deprivation therapy to postoperative radiotherapy for prostate cancer: a comparison of short-course versus no androgen deprivation therapy in the RADICALS-HD randomised controlled trial. Lancet 403:2405-2415 Parker CC, Petersen PM, Cook AD et al. (2024) Timing of radiotherapy (RT) after radical prostatectomy (RP): long-term outcomes in the RADICALS-RT trial (NCT00541047). Ann Oncol 35:656-666 Petersen PM, Cook AD, Sydes MR et al. (2023) Salvage Radiation Therapy After Radical Prostatectomy: Analysis of Toxicity by Dose-Fractionation in the RADICALS-RT Trial. Int J Radiat Oncol Biol Phys 117:624-629 Prostatakarzinom S-L (2024) Leitlinienprogramm Onkologie: S3-Leitlinie Prostatakarzinom, Langversion 7.0, 2024, AWMF-Registernummer: 043-022OL. In:Deutsche Krebsgesellschaft, Deutsche Krebshilfe, AWMF Rybicki BA, Rundle A, Kryvenko ON et al. (2016) Methylation in benign prostate and risk of disease progression in men subsequently diagnosed with prostate cancer. Int J Cancer 138:2884-2893 Servoll E, Vlatkovic L, Saeter T et al. (2014) The length of a positive surgical margin is of prognostic significance in patients with clinically localized prostate cancer treated with radical prostatectomy. Urol Int 93:289-295 Soto DE, Passarelli MN, Daignault S et al. (2012) Concurrent androgen deprivation therapy during salvage prostate radiotherapy improves treatment outcomes in high-risk patients. Int J Radiat Oncol Biol Phys 82:1227-1232 Spratt DE, Yousefi K, Deheshi S et al. (2017) Individual Patient-Level Meta-Analysis of the Performance of the Decipher Genomic Classifier in High-Risk Men After Prostatectomy to Predict Development of Metastatic Disease. J Clin Oncol 35:1991-1998 Swanson GP, Hussey MA, Tangen CM et al. (2007) Predominant treatment failure in postprostatectomy patients is local: analysis of patterns of treatment failure in SWOG 8794. J Clin Oncol 25:2225-2229 Tang D, Kryvenko ON, Mitrache N et al. (2013) Methylation of the RARB gene increases prostate cancer risk in black Americans. J Urol 190:317-324 Tentler JJ, Tan AC, Weekes CD et al. (2012) Patient-derived tumour xenografts as models for oncology drug development. Nat Rev Clin Oncol 9:338-350 Tilki D, Chen MH, Wu J et al. (2021) Adjuvant Versus Early Salvage Radiation Therapy for Men at High Risk for Recurrence Following Radical Prostatectomy for Prostate Cancer and the Risk of Death. J Clin Oncol 39:2284-2293 Wiegel T, Bartkowiak D, Bottke D et al. (2014) Adjuvant radiotherapy versus wait-and-see after radical prostatectomy: 10-year follow-up of the ARO 96-02/AUO AP 09/95 trial. Eur Urol 66:243-250 Witt JH, Friedrich M, Jandrig B et al. (2022) Molecular margin status after radical prostatectomy using glutathione S-transferase P1 (GSTP1) promoter hypermethylation. BJU Int 130:454-462 Yegnasubramanian S, Kowalski J, Gonzalgo ML et al. (2004) Hypermethylation of CpG islands in primary and metastatic human prostate cancer. Cancer Res 64:1975-1986 Additional Declarations Competing interest reported. M. Schostak is the Managing Director and Medical Director of LOGICURO GmbH, Potsdam, Germany. J. Witt is the Head of the UroKompetenz Private Urology Clinic, Düsseldorf, Germany. All other authors declare no conflicts of interest related to this work. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7877027","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":545617950,"identity":"6a293ecc-c39d-459e-9bda-cc2a6def401f","order_by":0,"name":"Frank Christoph","email":"","orcid":"","institution":"Urologie Citywest","correspondingAuthor":false,"prefix":"","firstName":"Frank","middleName":"","lastName":"Christoph","suffix":""},{"id":545617951,"identity":"18fac59b-c6ee-4315-9cb4-c6fb7737d4ed","order_by":1,"name":"Alina Riess","email":"","orcid":"","institution":"Otto-von-Guericke-University Magdeburg","correspondingAuthor":false,"prefix":"","firstName":"Alina","middleName":"","lastName":"Riess","suffix":""},{"id":545617952,"identity":"30f07a22-037c-4049-a509-f08ee8712830","order_by":2,"name":"Burkhard Jandrig","email":"","orcid":"","institution":"Otto-von-Guericke-University Magdeburg","correspondingAuthor":false,"prefix":"","firstName":"Burkhard","middleName":"","lastName":"Jandrig","suffix":""},{"id":545617953,"identity":"3cae2a39-d43f-4517-9e58-e91ac470f3c6","order_by":3,"name":"Daniel Baumunk","email":"","orcid":"","institution":"Praxis Baumunk \u0026 Baumunk","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Baumunk","suffix":""},{"id":545617954,"identity":"7d822d74-76db-40a7-b5c4-284dc6f5d1c3","order_by":4,"name":"Jörn Witt","email":"","orcid":"","institution":"Clinic Bel Etage","correspondingAuthor":false,"prefix":"","firstName":"Jörn","middleName":"","lastName":"Witt","suffix":""},{"id":545617955,"identity":"6f8e6e00-cf8d-421e-a496-74b8fb57bfa0","order_by":5,"name":"Martin Schostak","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYLCCBBAhAWHK8QHJAwQ0MDbAtRxgSDBmI0oLA5KWxDZCbtJtP/v8wcMdDPb8s5sPf/5Qk5bext788MDPtntyDOyHj27AosXsTLphQ+IZhsQZd46lSRw4lpPbxnPM4GBvW7ExA09a2g1sWg6kMTYAHZNgIJFjxnCArSK3TSKH4TBjW0JigwSPGVYt55+BtdgDtRh/OPCvIp2NoJYbEFsYN0jkGEgcbMtJIELLM8YZiW0SiTNupKVJnO1LMwT7peccMLRx+eV8GsPHn2029vwzkg9/qPiWLM/P3vz4w4+yBDl+9sPHsGmBAgksYmy4lY+CUTAKRsEoIAAAa+tnHng2AswAAAAASUVORK5CYII=","orcid":"","institution":"LOGICURO GmbH","correspondingAuthor":true,"prefix":"","firstName":"Martin","middleName":"","lastName":"Schostak","suffix":""}],"badges":[],"createdAt":"2025-10-16 11:23:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7877027/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7877027/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96249034,"identity":"6e0d04c0-ef69-41bd-b5de-f7f4992be9f6","added_by":"auto","created_at":"2025-11-19 07:29:58","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2954653,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptSchostakRARBfinal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/456e0bd6ce54986c18d56839.docx"},{"id":96062180,"identity":"fc140750-1251-472b-bf15-32797685dfdf","added_by":"auto","created_at":"2025-11-17 08:44:10","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9209,"visible":true,"origin":"","legend":"","description":"","filename":"ee12e4cb2a4148cd85fade174d4372ff.json","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/0d07350872a91b87124c66f2.json"},{"id":96062183,"identity":"c713132f-02ec-4758-a572-2bf279b7d870","added_by":"auto","created_at":"2025-11-17 08:44:10","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85500,"visible":true,"origin":"","legend":"","description":"","filename":"ee12e4cb2a4148cd85fade174d4372ff1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/a33dc46c5c7cb9cc2424135f.xml"},{"id":96247965,"identity":"48747ed1-36cb-4013-8fb0-e27396b9d3c9","added_by":"auto","created_at":"2025-11-19 07:27:55","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2866823,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/bf1d1f94d0195c25b9e6d3ef.png"},{"id":96062186,"identity":"2c1ca94d-738d-43e6-973c-6927bc30bb2e","added_by":"auto","created_at":"2025-11-17 08:44:10","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":436859,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/f4186a7b0fbefc0c7bed4449.png"},{"id":96062187,"identity":"47da4dba-8bd4-4cd2-b748-f021b54f12eb","added_by":"auto","created_at":"2025-11-17 08:44:10","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82954,"visible":true,"origin":"","legend":"","description":"","filename":"ee12e4cb2a4148cd85fade174d4372ff1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/bfb97002f3c92c9ba7cae9e4.xml"},{"id":96062184,"identity":"66d585d1-9442-4606-8da3-a425cff6405d","added_by":"auto","created_at":"2025-11-17 08:44:10","extension":"html","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":93497,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/93855bfbf47008c7abbc0517.html"},{"id":96062182,"identity":"485f07e0-988f-4ac9-9e33-120874269a54","added_by":"auto","created_at":"2025-11-17 08:44:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1004858,"visible":true,"origin":"","legend":"\u003cp\u003eImaging of the prostatic fossa following RPE. Biopsies were obtained from nine defined areas (A-I). A: ventral urethra B: left mediolateral prostatic fossa C: right mediolateral prostatic fossa D: left basal prostatic fossa E: Denonvilliers fascia F: right basal prostatic fossa G: left bladder neck H: right bladder neck I: ventral bladder neck\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/d994aeef1a895ac1f7acf1a7.png"},{"id":103133799,"identity":"ad521552-9362-42a7-9c3c-a5aad1dbd575","added_by":"auto","created_at":"2026-02-21 14:25:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1880087,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7877027/v1/44ebb2bf-4063-4d64-b84d-7d2df6849a5a.pdf"}],"financialInterests":"Competing interest reported. M. Schostak is the Managing Director and Medical Director of LOGICURO GmbH, Potsdam, Germany. \nJ. Witt is the Head of the UroKompetenz Private Urology Clinic, Düsseldorf, Germany. \nAll other authors declare no conflicts of interest related to this work.","formattedTitle":"Prediction of local failure by residual tumor cells after radical prostatectomy using retinoic acid receptor beta (RARB) promoter hypermethylation analysis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eProstate cancer (PCa) is the most common cancer disease in men and affects 26% of all male cancer patients. Worldwide, an estimated 1,466,680 cases are diagnosed annually while 396,792 patients have died from prostate cancer in 2022[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/p\u003e\u003cp\u003eAdjuvant therapeutic strategies such as local external radiation therapy have helped to reduce risk from early death by tumor recurrence especially after radical prostatectomy. Therefore, it is crucial to identify those patients that are at high risk for biochemical recurrence and to separate these from patients that do not need further therapy and to avoid overtreatment.\u003c/p\u003e\u003cp\u003eThus far, therapeutic strategies have been based on initial histopathological staging using prostate specific antigen (PSA) as follow-up biomarker. Unfortunately, until now molecular staging is not used and we still have to rely on histopathological staging after radical resection of the prostate.\u003c/p\u003e\u003cp\u003eThere is substantial body of evidence, that epigenetic alterations may play a role in pathology detection and prognostic evaluation. Hypermethylation of the promoter region of a gene leads to transcriptional repression and subsequent transcriptional silencing of genes that may drive the cell into further tumor progression. However, genetic silencing by hypermethylation can also affect genes that are helpful and inhibit uncontrolled cell growth, such as retinoic acid, the metabolite of vitamin A that interacts with its receptor, retinoic acid receptor beta[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The methylation rate of \u003cem\u003eRARB\u003c/em\u003e in prostate cancer cells was reported between 79% up to 90% in hormone-independent prostate cancer[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. But promoter hypermethylation is not exclusively found in prostate cancer, it has been reported as well in hepatocellular, breast and non-small cell lung cancer[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eA meta-analysis by Dou et al. has shown that \u003cem\u003eRARB\u003c/em\u003e promoter methylation is more frequently and correlated with prostate cancer carcinogenesis as compared to benign tissue. They concluded that promoter methylation of the \u003cem\u003eRARB\u003c/em\u003e promoter is an early and common event in tumorigenesis of prostate cancer suggesting an important role in the history of the disease. However, there have been controversial results that warranted further studies to clarify the role of \u003cem\u003eRARB\u003c/em\u003e methylation to use it as a potential biomarker in prostate cancer[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWith this knowledge, our goal was to identify factors and patients who will benefit from adjuvant therapies, such as radiotherapy, because of high risk of early biochemical recurrence instead of waiting until PSA relapse happens.\u003c/p\u003e\u003cp\u003eIf tumor cells are detected in the fossa, this corresponds to the definition of residual tumor according UICC. If tumor cells are found at the margin of the specimen during pathological analysis, this is called positive resection margin. In the daily practice the same Abbreviation R is used, although that doesn\u0026acute;t correspond to the above mentioned definition. The present work addresses this issue. Therefore, biopsy specimen from the prostatic fossa were obtained after radical prostatectomy following a specific sample pattern. The samples were analysed using methylation specific PCR for the \u003cem\u003eRARB\u003c/em\u003e gene. To compare \u003cem\u003eRARB\u003c/em\u003e gene promoter methylation with non prostate cancer tissue, expression analysis was also performed from patients tissue that did not suffer from prostate cancer and who served as a control.\u003c/p\u003e\u003cp\u003eIn a previous study, we analysed samples from the prostatic fossa using a methylation-specific PCR for \u003cem\u003eGSTP1\u003c/em\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The methylation-specific PCR for \u003cem\u003eRARB\u003c/em\u003e, introduced in this publication, offers markedly improved sensitivity. Thus, the analysis of \u003cem\u003eRARB\u003c/em\u003e methylation analysis of the fossa may contribute to identifying patients at greater risk of later biochemical recurrence.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePatients and sample collection\u003c/h2\u003e\u003cp\u003eThis dual centre trial included a total of 176 patients with organ confined, biopsy proven prostate cancer who underwent open or robot-assisted RPE by two experienced surgeons at the Department of Urology, University of Magdeburg, Germany or St. Antonius Hospital, Gronau, Germany.\u003c/p\u003e\u003cp\u003eAs prostate cancer negative control group, biopsies from 32 male patients who underwent radical cystectomy (RCE) for urothelial carcinoma at the Department of Urology, University of Magdeburg were used.\u003c/p\u003e\u003cp\u003eAll patients signed a written informed consent approved by the medical ethics committee of the Otto-von-Guericke University Magdeburg (# 87/11) and Westfaelische Wilhelms-University Muenster (2012-086-b-S). Analysis was carried out in accordance with the ICH-approved GCP and GLP guidelines and regulations.\u003c/p\u003e\u003cp\u003eAfter completion of RPE nine specimens (A \u0026ndash; I) were taken from defined areas in the prostatic fossa (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) as described by Witt et al [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], before the urethrovesical anastomosis was reconstructed. In total 1,584 specimens were taken and bisected with a sterile scalpel. Half of each sample was sent for further conventional histopathological analysis to the Department of Pathology at the University of Magdeburg or St. Antonius Hospital in Gronau. The other half of each specimen was flash frozen in liquid nitrogen and stored at -80\u0026deg;C pending molecular genetic analysis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFrom each patient of the control group (n\u0026thinsp;=\u0026thinsp;32) five tissue samples (C-G) were taken from the prostatic fossa (n\u0026thinsp;=\u0026thinsp;160) after completion of RCE by the same technique and worked up as for the study samples.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eMethylation analyses\u003c/h3\u003e\n\u003cp\u003eMethylation analyses were performed according to the protocol described by Jentzmik et al. 2011[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Briefly, DNA was isolated from biopsies using innuPREP DNA mini Kits (Analytik Jena, Jena, Germany) following protocol 1 of the manual. DNA was eluted in 50 \u0026micro;l elution buffer. DNA concentration and purity were analysed by using the spectral photometer Nanodrop 2000 (Thermo Fisher Scientific, Darmstadt, Germany). DNA was bisulfite-converted using EpiTect Bisulfite kit (QIAGEN, Hilden, Germany) according to the manufacturer\u0026rsquo;s instructions. The samples were eluted once in 20 \u0026micro;l elution buffer.\u003c/p\u003e\n\u003ch3\u003eQuantitative Methylation-Specific Polymerase chain reaction (Q-MSP)\u003c/h3\u003e\n\u003cp\u003eQ-MSP with specific probes was used to determine the methylation status. This was performed as a duplex PCR of the promoter regions of the genes \u003cem\u003eRARB\u003c/em\u003e and \u003cem\u003eMYOD1\u003c/em\u003e (coding for the housekeeping Myoblast determination protein 1) as an internal control to estimate the amount of input template in each sample) using StepOnePlus Real-Time PCR Systems and StepOne Software v2.1 (Applied Biosystems, Darmstadt, Germany). Primers and probes used for the amplification and detection of methylated \u003cem\u003eRARB\u003c/em\u003e were 5'-CGAGAACGCGAGCGATTC (forward primer), 5'-CAAACTTACTCGACCAATCCAACC (reverse primer) and M-RARB-TMS 5'-TCGGAACGTATTCGGAAGGTTTTTTGTAAGTATTT (Taqman probe) (Life Technologies, Darmstadt, Germany); the fluorescence dye was FAM. Primers and probe used for the amplification and detection of \u003cem\u003eMYOD1\u003c/em\u003e were 5'- CCAACTCCAAATCCCCTCTCTAT (forward primer), 5'- TGATTAATTTAGATTGGGTTTAGAGAAGGA (reverse primer) and M-MYOD1-TMS 5'-TCCCTTCCTATTCCTAAATCCAACCTAAATACCTCC (Taqman probe) (Life Technologies, Darmstadt, Germany); the fluorescence dye was VIC. The sequences concerning \u003cem\u003eRARB\u003c/em\u003e are the same as described by Bastian et al. 2007[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], the sequences concerning \u003cem\u003eMYOD1\u003c/em\u003e are the same as described by Yegnasubramanian et al.[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/p\u003e\u003cp\u003ePCR was initiated at 50\u0026deg;C for 2 min, then 95\u0026deg;C for 15 min, followed by 50 cycles of 95\u0026deg;C for 1 min and 60\u0026deg;C for 1 min.\u003c/p\u003e\u003cp\u003eBisulfite-converted CpGenome universal methylated DNA (Merck Millipore, Darmstadt, Germany) as well as bisulfite-treated DNA of the human prostate adenocarcinoma cell line LNCaP served as a positive methylation control [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBlank reactions with distilled water replacing DNA were used as a negative control (non-template control, NTC). Each assay was performed twice and in duplicate as in Jentzmik et al. 2011[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. If the \u003cem\u003eMYOD1\u003c/em\u003e PCR was negative the assay was regarded as unsuccessful.\u003c/p\u003e\n\u003ch3\u003eClinical data acquisition\u003c/h3\u003e\n\u003cp\u003eThe following clinicopathological data were collected prospectively according to GCP: age, preoperative PSA value, tumor classification according to UICC TNM classification 2018 (8th edition), tumor grading according to Gleason and biochemical relapse.\u003c/p\u003e\u003cp\u003eFor further analysis, the patient cohort was subdivided into the following groups: localized or advanced tumor stage (\u0026le;\u0026thinsp;pT2, pN0 vs. \u0026ge; pT3 and/or pN1), ISUP tumor grade (ISUP\u0026thinsp;\u0026lt;\u0026thinsp;2 vs. \u0026ge; 2; ISUP\u0026thinsp;\u0026lt;\u0026thinsp;3 vs. \u0026ge; 3; ISUP\u0026thinsp;\u0026lt;\u0026thinsp;4 vs. \u0026ge; 4), lymph node status (N0 vs. N1) and surgical margin status based on prostatectomy specimens (R0 vs. R1).\u003c/p\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eIBM SPSS Statistics Version 26 (IBM Corporation, Armonk, NY, USA) was used for statistical analysis. The statistical tests applied were Pearson\u0026rsquo;s chi-squared test, Fisher\u0026rsquo;s exact test, McNemar test, Mann\u0026ndash;Whitney \u003cem\u003eU\u003c/em\u003e test and Contingency Coefficient. All tests were two sided. P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered as statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003ePCa patients characteristics\u003c/h2\u003e\u003cp\u003eThe median age of patients (n\u0026thinsp;=\u0026thinsp;176) at the time of RPE was 65 years (mean age 60.5, interquartile range 9.25, range 45\u0026ndash;77). The TNM and grading classification showed the following subgroups distribution: Tumor stage: pT2a (n\u0026thinsp;=\u0026thinsp;10), pT2b (n\u0026thinsp;=\u0026thinsp;9), pT2c (n\u0026thinsp;=\u0026thinsp;84), pT3a (n\u0026thinsp;=\u0026thinsp;40), pT3b (n\u0026thinsp;=\u0026thinsp;26) and pT4 (n\u0026thinsp;=\u0026thinsp;6). Lymph node status: pN0 (n\u0026thinsp;=\u0026thinsp;137), pN1 (n\u0026thinsp;=\u0026thinsp;16) and pNx (n\u0026thinsp;=\u0026thinsp;23). ISUP grade: grade 1 (n\u0026thinsp;=\u0026thinsp;58), grade 2 (n\u0026thinsp;=\u0026thinsp;46), grade 3 (n\u0026thinsp;=\u0026thinsp;37), grade 4 (n\u0026thinsp;=\u0026thinsp;15), grade 5 (n\u0026thinsp;=\u0026thinsp;19). Gleason-Score: 3\u0026thinsp;+\u0026thinsp;3\u0026thinsp;=\u0026thinsp;6 (n\u0026thinsp;=\u0026thinsp;59), 3\u0026thinsp;+\u0026thinsp;4\u0026thinsp;=\u0026thinsp;7a (n\u0026thinsp;=\u0026thinsp;46), 4\u0026thinsp;+\u0026thinsp;3\u0026thinsp;=\u0026thinsp;7b (n\u0026thinsp;=\u0026thinsp;38), 3\u0026thinsp;+\u0026thinsp;5\u0026thinsp;=\u0026thinsp;8a (n\u0026thinsp;=\u0026thinsp;1), 5\u0026thinsp;+\u0026thinsp;3\u0026thinsp;=\u0026thinsp;8b (n\u0026thinsp;=\u0026thinsp;0), 4\u0026thinsp;+\u0026thinsp;4\u0026thinsp;=\u0026thinsp;8c (n\u0026thinsp;=\u0026thinsp;15), 4\u0026thinsp;+\u0026thinsp;5\u0026thinsp;=\u0026thinsp;9a (n\u0026thinsp;=\u0026thinsp;12), 5\u0026thinsp;+\u0026thinsp;4\u0026thinsp;=\u0026thinsp;9b (n\u0026thinsp;=\u0026thinsp;5), 5\u0026thinsp;+\u0026thinsp;5\u0026thinsp;=\u0026thinsp;10 (n\u0026thinsp;=\u0026thinsp;0). The median PSA at the time of diagnosis was 7.15 ng/ml (mean PSA 11.4, interquartile range 6.49, range 0.9\u0026ndash;115).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eHistological analysis of Margin Status in PCa patients\u003c/h3\u003e\n\u003cp\u003eIn the group of patients with prostate cancer (n\u0026thinsp;=\u0026thinsp;176) 130 patients were histologically classified as having a negative margin status (74%) on prostatectomy sample whereas 46 (26%) patients had a positive surgical margin classified as R1.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eCombining histological and molecular genetic analysis of prostatic fossa tissue samples in PCa patients\u003c/h2\u003e\u003cp\u003eLooking at the results of the patients with a combination of histologic and genetic analysis of the fossa samples and \u003cem\u003eRARB\u003c/em\u003e methylation, the following results are shown for the histologically fossa negative (n\u0026thinsp;=\u0026thinsp;164) and histologically fossa positive (n\u0026thinsp;=\u0026thinsp;12) patients.\u003c/p\u003e\u003cp\u003eA clear majority of 59% of the matched samples from the prostatic fossa, in which no cancer was detected histologically, showed molecular evidence of residual tumor cells, as indicated by positive \u003cem\u003eRARB\u003c/em\u003e hypermethylation. Conversely, only a clear minority of 25% of the histologically positive samples were negative on molecular analysis (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eHistological vs. molecular genetic analyses (\u003c/b\u003e\u003cb\u003eRARB\u003c/b\u003e \u003cb\u003ehypermethylation)\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e\u003cp\u003eHistological vs. molecular genetic analyses (RARB hypermethylation)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFossa biopsy with benign histology (PCa negative)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eFossa biopsy with malignant histology (PCa positive)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFossa biopsy with negative \u003cem\u003eRARB\u003c/em\u003e hypermethylation (\u003cem\u003eRARB\u003c/em\u003e negative)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e68 (41%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3 (25%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e71\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFossa biopsy with positive \u003cem\u003eRARB\u003c/em\u003e hypermethylation (\u003cem\u003eRARB\u003c/em\u003e positive)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e96 (59%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9 (75%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e105\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e164\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e176\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRARB\u003c/b\u003e \u003cb\u003epromoter hypermethylation of prostatic fossa tissue samples in PCa patients\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBased on the classical histological classification into R0 and R1 patients, 124 of the 130 R0 patients (95.4%) also showed negative conventional histology in the fossa, while 6 (4.6%) had a positive finding. Among the 46 patients with positive surgical margins (R1), 40 (87%) showed positive conventional histology in the fossa, whereas 6 (13%) had a negative result (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eSurgical margin status of the prostatectomy specimen vs. histological analysis of prostatic fossa samples\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003eSurgical margin status of the prostatectomy specimen vs.\u003c/p\u003e\u003cp\u003ehistological analysis of prostatic fossa samples\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003eMargin Status of prostatectomy specimen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003enegative (R0)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003epositive (R1)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cb\u003eProstatic fossa sample\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003ehistologically negative\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e124 (95,4%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e40 (87%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e164\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003ehistologically positive\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e6 (4,6%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e6 (13%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e130\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e176\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eBased on the classical histological classification into R0 and R1 patients, 68/164 (38%) of the R0 patients showed no promoter hypermethylation and 96/164 (54%) showed promoter hypermethylation of the \u003cem\u003eRARB\u003c/em\u003e gene. In the group of R1 patients, 3/12 (25%) showed no and 9/12 (75%) showed hypermethylation in the \u003cem\u003eRARB\u003c/em\u003e gene (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eSurgical margin status of the prostatectomy specimen vs.\u003c/b\u003e \u003cb\u003eRARB\u003c/b\u003e \u003cb\u003ehypermethylation analysis of prostatic fossa samples\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e\u003cp\u003eSurgical margin status of the prostatectomy specimen vs.\u003c/p\u003e\u003cp\u003e\u003cem\u003eRARB\u003c/em\u003e hypermethylation analysis of prostatic fossa samples\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003eMargin status of prostatectomy specimen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003enegative (R0)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003epositive (R1)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cb\u003eProstatic fossa sample\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eRARB\u003c/b\u003e \u003cb\u003enegative\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e62 (47,7%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e9 (19,6%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e164\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eRARB\u003c/b\u003e \u003cb\u003epositive\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e68 (52,3%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e37 (80,43%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e130\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e176\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eRARB\u003c/b\u003e \u003cb\u003epromoter hypermethylation and clinical data\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThere was no statistically significant correlation found for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation and tumour stage (pT2, pN0 vs. \u0026ge; pT3 and/or pN1) (p\u0026thinsp;=\u0026thinsp;0.481, Pearson\u0026rsquo;s chi-squared test) or ISUP tumour grade (ISUP\u0026thinsp;=\u0026thinsp;1 vs. \u0026ge; 2 p\u0026thinsp;=\u0026thinsp;0.948, Pearson\u0026rsquo;s chi-squared test).\u003c/p\u003e\u003cp\u003eThere was a statistical trend for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation and ISUP\u0026thinsp;\u0026lt;\u0026thinsp;3 vs. \u0026ge; 3 (p\u0026thinsp;=\u0026thinsp;0.090, Pearson\u0026rsquo;s chi-squared test) and a significant correIation for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation and ISUP\u0026thinsp;\u0026lt;\u0026thinsp;4 vs. \u0026ge; 4 (p\u0026thinsp;=\u0026thinsp;0.029, Pearson\u0026rsquo;s chi-squared test). There was also found a significant correIation for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation, surgical margin status (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, Pearson\u0026rsquo;s chi-squared test) and biochemical recurrence (p\u0026thinsp;=\u0026thinsp;0.039, Fisher\u0026rsquo;s exact test).\u003c/p\u003e\u003cp\u003eThe initial PSA was not associated with \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation (p\u0026thinsp;=\u0026thinsp;0.81, Mann-Whitney \u003cem\u003eU\u003c/em\u003e test).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eControl Group\u003c/h2\u003e\u003cp\u003eIn the control group without prostate cancer (n\u0026thinsp;=\u0026thinsp;32), all 160 tissue samples examined were negative for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation. Twenty prostate cancer tissue samples were also examined, all of which were positive for \u003cem\u003eRARB\u003c/em\u003e promoter methylation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003ePostoperative PSA kinetics\u003c/h2\u003e\u003cp\u003eFollow up data for biochemical recurrence was available in 152 of 176 patients. The median duration of follow-up was 60 months (mean 54, interquartile range 12, range 6\u0026ndash;60). According to the German S3 guidelines we defined a biochemical recurrence (BCR) if a patient had at least two PSA levels\u0026thinsp;\u0026gt;\u0026thinsp;0.2 ng/ml or one PSA level\u0026thinsp;\u0026gt;\u0026thinsp;0.4 ng/ml after reaching a PSA nadir of zero.\u003c/p\u003e\u003cp\u003eThirty two (21%) patients were diagnosed with BCR. Four patients (4/152, 3%) died during the observation period and the cause of death remains unknown.\u003c/p\u003e\u003cp\u003eIn the group of patients with BCR, 27 were suitable for further examination. Of these, 13 patients had a positive resection margin (48%). In this group of 27 patients, only 3 patients had positive histologic findings in the fossa samples, but the fossa samples showed hypermethylation of the \u003cem\u003eRARB\u003c/em\u003e promoter in the genetic analysis in 23/27 (85%).\u003c/p\u003e\u003cp\u003eThe classical R-status (margins on the specimen) was significantly superior to histological sampling from the fossa (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) but \u003cem\u003eRARB\u003c/em\u003e analysis from the fossa was significantly superior to the classical R-status (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) to predict BCR. \u003cem\u003eRARB\u003c/em\u003e analysis from the fossa was also significantly superior to histological sampling from the fossa (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; McNemar test) in prediction of biochemical tumor recurrence.\u003c/p\u003e\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIf tumor cells are found at the edge of the specimen during pathological analysis, this is called a positive margin. In the UICC classification, this is called \"residual tumor\"[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], but the mere detection of tumor at the edge of the specimen cannot prove that there is further residual tumor tissue in the resected area. This study addresses this issue. We want to investigate the question of whether histologically and with molecular methods an actual and possibly clinically relevant residual tumor exists after a radical prostatectomy.\u003c/p\u003e\u003cp\u003eFor this reason, we took samples from 8 locations in the fossa, divided them and examined them both histologically and by analyzing \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation.\u003c/p\u003e\u003cp\u003eIf there is a biochemical recurrence within the follow-up of 5 years, this is a clinical positive control. This shows whether the prediction with one or the other method was sensitive and clinically relevant.\u003c/p\u003e\u003cp\u003eWhile the impact of a positive margin on overall survival continues to be debated, there is evidence that a positive margin has a negative impact on disease-free survival[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. A higher biochemical risk of recurrence may lead to an earlier need for adjuvant or salvage therapies, which may affect patients' quality of life. The detection of positive resection margins can influence treatment planning after surgery. Additional treatments such as adjuvant radiotherapy or hormone therapy are often considered to reduce the risk of recurrence. Studies such as SWOG 8794 have shown that adjuvant radiotherapy can significantly reduce the biochemical risk of recurrence in patients with positive margins[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHowever, the significance of positive resection margins is not undisputed. Some studies argue that the mere presence of positive margins does not necessarily lead to a worse prognosis, but that factors such as Gleason score, tumor stage and PSA dynamics also play a crucial role[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Future research could focus on developing predictive models that integrate multiple variables to enable more individualized prognoses.\u003c/p\u003e\u003cp\u003eHistorically, a positive discontinuation margin is no longer as important as it used to be. Tilki at al. was able to show that salvage radiation therapy is about equally effective as adjuvant radiation from an oncological perspective if no high risk situation is apparent[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. As early radiotherapy impairs continence function and recovery of erectile function, a positive withdrawal margin is not synonymous with the need for adjuvant therapy[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIt remains unclear which factors determine the course of the disease in terms of a relevant biochemical recurrence for the patient. Various molecular markers have been investigated to date, but none are used in the clinical world. For this reason, the classic clinical pathological parameters that are currently used to assess the risk of a subsequent biochemical recurrence remain. A meta-analysis by Guo et al. identified the size of the resection margin and the primary Gleason score as relevant parameters[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn order for tumor cells to proliferate meaningfully within the cavity and form a measurable recurrence, a minimum number of cells is required. Based on prostate cancer xenograft models in mice, it is estimated that at least 1\u0026times;10⁶ cells are necessary to establish a growing tumor. This supports the notion that microscopic residual disease may fail to reach biological relevance [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn the course of this discovery, various studies have investigated whether the margin of discontinuation or the primary Gleason score and corresponding adjuvant therapy can reduce the occurrence of a new tumor recurrence in the case of increased risk. The RADICALS study by Parker et al. was one of the largest RCTs to prove that early radiotherapy does not lead to any improvement in tumor control or tumor-specific survival[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], but does lead to a significant worsening of urinary and fecal incontinence[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Additional androgen deprivation therapy (ADT) also did not lead to a reduction in tumor-specific survival[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Unfortunately, the rehabilitation of erectile function, which, in addition to the recovery of urinary incontinence, contributes significantly to quality of life, was not investigated. Nevertheless, the fact that the addition of ADT does not contribute significantly to improving cancer-specific survival suggests that the presence of occult tumor cells, which could explain the poorer prognosis of ISUP\u0026thinsp;\u0026gt;\u0026thinsp;3 carcinomas, could also be independent of the primary Gleason score. Although retrospective studies (Soto et al.) have described an advantage in progression-free survival (PFS) for patients with high-risk carcinoma[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. This could mean that neither tumor stage nor Gleason score are relevant parameters for determining the effect or benefit of adjuvant or salvage therapy, but that other parameters, e.g. molecular parameters, must be found instead.\u003c/p\u003e\u003cp\u003eThese include, for example, genomic classifiers that create a global expression pattern or tumor signature or proteogenomic markers[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Circulating tumor cells can also provide information on the aggressive behavior of a tumor disease[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHowever, clinically reliable data on these markers is still lacking. One possible candidate, \u003cem\u003eGSTP1\u003c/em\u003e promoter methylation, has been described as an ideal candidate for such molecular staging. In older methylation studies by Goessl et al.[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] or Bastian et al.[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], \u003cem\u003eGSTP1\u003c/em\u003e was described as a possible candidate for a more specific tumor characterization. However, it has not yet been used clinically. Witt et al. were able to show that \u003cem\u003eGSTP1\u003c/em\u003e promoter methylation in fossa samples correlated with the degree of differentiation of the tumor[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Gupta et al. recently demonstrated that the methylation of the \u003cem\u003eGSTP1\u003c/em\u003e promoter increases extensively from normal prostate cells to carcinoma cells[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAnother possible candidate, the \u003cem\u003eRARB\u003c/em\u003e gene, was investigated in this study. In an earlier study, Jeronimo et al. showed that the \u003cem\u003eRARB\u003c/em\u003e gene is predominantly methylated in prostate cancer, but that there is no correlation with the Gleason score; no further correlation with clinical parameters was performed[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Contradictory statements by various authors led Gao et al. to conduct a meta-analysis with the result that promoter hypermethylation of the \u003cem\u003eRARB\u003c/em\u003e promoter appears to be independent of tumor stage and Gleason score and thus represents an early event in tumorigenesis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This would not support the approach of using \u003cem\u003eRARB\u003c/em\u003e as a sensitive predictive and genetic marker in comparison to the histologically based Gleason score.\u003c/p\u003e\u003cp\u003eOur data showed that \u003cem\u003eRARB\u003c/em\u003e was particularly detectable in patient samples in which a BCR occurred (85%). Thus, the detection of \u003cem\u003eRARB\u003c/em\u003e hypermethylation in a fossa sample could not only suggest an increased risk of recurrence but also facilitate the decision to perform early or adjuvant radiotherapy in the case of a BCR.\u003c/p\u003e\u003cp\u003eThe data shown here suggest that \u003cem\u003eRARB\u003c/em\u003e promoter methylation is another potential marker that can contribute to the decision making process of early versus salvage radiotherapy. However, the recommendation of the German S3 guideline is to delay radiotherapy in any case, as the possibility of early rehabilitation of incontinence and potency is preserved[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. As the studies to date have not shown any survival disadvantage of delayed radiotherapy, the clinical question at present is not so much who should receive radiotherapy but rather when it should be given, possibly with concomitant hormone therapy in the case of aggressive tumor differentiation.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eOur data indicate that intraoperative prostatic-fossa biopsies analyzed for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation capture molecular residual disease that conventional histology and margin status often miss, and that \u003cem\u003eRARB\u003c/em\u003e positivity is associated with a higher risk of biochemical recurrence. These results suggest that \u003cem\u003eRARB\u003c/em\u003e qMSP adds actionable information to early post-prostatectomy risk stratification and may refine decisions between adjuvant and early-salvage radiotherapy, helping to limit both under- and overtreatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch3\u003e\u003cstrong\u003eCONFLICT OF INTEREST STATEMENT\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eM. Schostak is the Managing Director and Medical Director of LOGICURO GmbH, Potsdam, Germany. J. Witt is the Head of the UroKompetenz Private Urology Clinic, Düsseldorf, Germany. All other authors declare no conflicts of interest related to this work.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003eAUTHOR CONTRIBUTION STATEMENT\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eM. Schostak, D. Baumunk, and J. Witt contributed patient data to the study.\u003c/p\u003e\n\u003cp\u003eA. Riess performed the laboratory analyses, and B. Jandrig supervised the laboratory work. F. Christoph and M. Schostak performed the statistical analysis and wrote the manuscript. All authors reviewed and approved the final version of the manuscript and agreed to be accountable for all aspects of the work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBastian PJ, Ellinger J, Heukamp LC et al. (2007) Prognostic value of CpG island hypermethylation at PTGS2, RAR-beta, EDNRB, and other gene loci in patients undergoing radical prostatectomy. Eur Urol 51:665-674; discussion 674\u003c/li\u003e\n\u003cli\u003eBerlin A, Brierley J, Cornford P et al. (2022) TNM Staging of Prostate Cancer: Challenges in Securing a Globally Applicable Classification. Eur Urol 82:e52-e53\u003c/li\u003e\n\u003cli\u003eBray F, Laversanne M, Sung H et al. (2024) Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 74:229-263\u003c/li\u003e\n\u003cli\u003eCao L, Hao P, Lin D et al. (2021) Application of Primary/Secondary Circulating Tumor Cells for the Prediction of Biochemical Recurrence in Nonmetastatic Prostate Cancer Patients following Radical Prostatectomy or Radiotherapy: A Meta-Analysis. Biomed Res Int 2021:4730970\u003c/li\u003e\n\u003cli\u003eDou M, Zhou X, Fan Z et al. (2018) Clinical Significance of Retinoic Acid Receptor Beta Promoter Methylation in Prostate Cancer: A Meta-Analysis. Cell Physiol Biochem 45:2497-2505\u003c/li\u003e\n\u003cli\u003eGao T, He B, Pan Y et al. (2013) The association of retinoic acid receptor beta2(RARbeta2) methylation status and prostate cancer risk: a systematic review and meta-analysis. PLoS One 8:e62950\u003c/li\u003e\n\u003cli\u003eGoessl C, Muller M, Heicappell R et al. (2001) DNA-based detection of prostate cancer in blood, urine, and ejaculates. Ann N Y Acad Sci 945:51-58\u003c/li\u003e\n\u003cli\u003eGuo H, Zhang L, Shao Y et al. (2024) The impact of positive surgical margin parameters and pathological stage on biochemical recurrence after radical prostatectomy: A systematic review and meta-analysis. PLoS One 19:e0301653\u003c/li\u003e\n\u003cli\u003eGupta H, Inoue H, Nakai Y et al. (2023) Progressive Spreading of DNA Methylation in the GSTP1 Promoter CpG Island across Transitions from Precursors to Invasive Prostate Cancer. Cancer Prev Res (Phila) 16:449-460\u003c/li\u003e\n\u003cli\u003eJentzmik F, Krause H, Reichelt U et al. (2012) GSTP1 CpG island hypermethylation for DNA-based detection of occult tumor cells in surgical margins after radical prostatectomy. World J Urol 30:541-546\u003c/li\u003e\n\u003cli\u003eJeronimo C, Bastian PJ, Bjartell A et al. (2011) Epigenetics in prostate cancer: biologic and clinical relevance. Eur Urol 60:753-766\u003c/li\u003e\n\u003cli\u003eLam D, Clark S, Stirzaker C et al. (2020) Advances in Prognostic Methylation Biomarkers for Prostate Cancer. Cancers (Basel) 12\u003c/li\u003e\n\u003cli\u003eLysenko I, Mori K, Mostafaei H et al. (2020) Prognostic Value of Gleason Score at Positive Surgical Margin in Prostate Cancer: A Systematic Review and Meta-analysis. Clin Genitourin Cancer 18:e517-e522\u003c/li\u003e\n\u003cli\u003eMoison C, Assemat F, Daunay A et al. (2014) Synergistic chromatin repression of the tumor suppressor gene RARB in human prostate cancers. Epigenetics 9:477-482\u003c/li\u003e\n\u003cli\u003eMunoz F, Sanguineti G, Bresolin A et al. (2021) Predictors of Patient-Reported Incontinence at Adjuvant/Salvage Radiotherapy after Prostatectomy: Impact of Time between Surgery and Radiotherapy. Cancers (Basel) 13\u003c/li\u003e\n\u003cli\u003eParker CC, Clarke NW, Cook AD et al. (2024) Adding 6 months of androgen deprivation therapy to postoperative radiotherapy for prostate cancer: a comparison of short-course versus no androgen deprivation therapy in the RADICALS-HD randomised controlled trial. Lancet 403:2405-2415\u003c/li\u003e\n\u003cli\u003eParker CC, Petersen PM, Cook AD et al. (2024) Timing of radiotherapy (RT) after radical prostatectomy (RP): long-term outcomes in the RADICALS-RT trial (NCT00541047). Ann Oncol 35:656-666\u003c/li\u003e\n\u003cli\u003ePetersen PM, Cook AD, Sydes MR et al. (2023) Salvage Radiation Therapy After Radical Prostatectomy: Analysis of Toxicity by Dose-Fractionation in the RADICALS-RT Trial. Int J Radiat Oncol Biol Phys 117:624-629\u003c/li\u003e\n\u003cli\u003eProstatakarzinom S-L (2024) Leitlinienprogramm Onkologie: S3-Leitlinie Prostatakarzinom, Langversion 7.0, 2024, AWMF-Registernummer: 043-022OL. In:Deutsche Krebsgesellschaft, Deutsche Krebshilfe, AWMF\u003c/li\u003e\n\u003cli\u003eRybicki BA, Rundle A, Kryvenko ON et al. (2016) Methylation in benign prostate and risk of disease progression in men subsequently diagnosed with prostate cancer. Int J Cancer 138:2884-2893\u003c/li\u003e\n\u003cli\u003eServoll E, Vlatkovic L, Saeter T et al. (2014) The length of a positive surgical margin is of prognostic significance in patients with clinically localized prostate cancer treated with radical prostatectomy. Urol Int 93:289-295\u003c/li\u003e\n\u003cli\u003eSoto DE, Passarelli MN, Daignault S et al. (2012) Concurrent androgen deprivation therapy during salvage prostate radiotherapy improves treatment outcomes in high-risk patients. Int J Radiat Oncol Biol Phys 82:1227-1232\u003c/li\u003e\n\u003cli\u003eSpratt DE, Yousefi K, Deheshi S et al. (2017) Individual Patient-Level Meta-Analysis of the Performance of the Decipher Genomic Classifier in High-Risk Men After Prostatectomy to Predict Development of Metastatic Disease. J Clin Oncol 35:1991-1998\u003c/li\u003e\n\u003cli\u003eSwanson GP, Hussey MA, Tangen CM et al. (2007) Predominant treatment failure in postprostatectomy patients is local: analysis of patterns of treatment failure in SWOG 8794. J Clin Oncol 25:2225-2229\u003c/li\u003e\n\u003cli\u003eTang D, Kryvenko ON, Mitrache N et al. (2013) Methylation of the RARB gene increases prostate cancer risk in black Americans. J Urol 190:317-324\u003c/li\u003e\n\u003cli\u003eTentler JJ, Tan AC, Weekes CD et al. (2012) Patient-derived tumour xenografts as models for oncology drug development. Nat Rev Clin Oncol 9:338-350\u003c/li\u003e\n\u003cli\u003eTilki D, Chen MH, Wu J et al. (2021) Adjuvant Versus Early Salvage Radiation Therapy for Men at High Risk for Recurrence Following Radical Prostatectomy for Prostate Cancer and the Risk of Death. J Clin Oncol 39:2284-2293\u003c/li\u003e\n\u003cli\u003eWiegel T, Bartkowiak D, Bottke D et al. (2014) Adjuvant radiotherapy versus wait-and-see after radical prostatectomy: 10-year follow-up of the ARO 96-02/AUO AP 09/95 trial. Eur Urol 66:243-250\u003c/li\u003e\n\u003cli\u003eWitt JH, Friedrich M, Jandrig B et al. (2022) Molecular margin status after radical prostatectomy using glutathione S-transferase P1 (GSTP1) promoter hypermethylation. BJU Int 130:454-462\u003c/li\u003e\n\u003cli\u003eYegnasubramanian S, Kowalski J, Gonzalgo ML et al. (2004) Hypermethylation of CpG islands in primary and metastatic human prostate cancer. Cancer Res 64:1975-1986\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"RARB promoter, hypermethylation, prostate cancer, biochemical recurrence","lastPublishedDoi":"10.21203/rs.3.rs-7877027/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7877027/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003ePositive surgical margins after radical prostatectomy (RP) are an imperfect surrogate of residual tumor and do not reliably identify men who will experience biochemical recurrence (BCR). Promoter hypermethylation of \u003cem\u003eretinoic acid receptor beta\u003c/em\u003e gene (\u003cem\u003eRARB\u003c/em\u003e) is a frequent epigenetic alteration in prostate cancer (PCa). We evaluated whether intraoperative sampling of the prostatic fossa with quantitative methylation-specific PCR (qMSP) for \u003cem\u003eRARB\u003c/em\u003e improves prediction of BCR compared with conventional histology and margin status.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eIn a dual-centre study, 176 men with biopsy-proven PCa undergoing open or robot-assisted RP had nine standardized biopsies (sites A\u0026ndash;I) taken from the prostatic fossa before vesicourethral anastomosis; 32 cystectomy patients served as cancer-free controls. Each fossa biopsy was split for routine histology and qMSP analysis of \u003cem\u003eRARB\u003c/em\u003e (\u003cem\u003eMYOD1\u003c/em\u003e as internal control). Clinicopathologic data and PSA follow-up were prospectively recorded. BCR was defined per German S3 guideline thresholds. Statistical testing included Pearson\u0026rsquo;s χ\u0026sup2;, Fisher\u0026rsquo;s exact, McNemar, and Mann\u0026ndash;Whitney U tests (two-sided, α\u0026thinsp;=\u0026thinsp;0.05).\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eMedian age was 65 years; median diagnostic PSA 7.15 ng/ml. On specimen assessment, 130 men were R0 and 46 R1. Among 164 fossa samples with benign histology, 96 (59%) were \u003cem\u003eRARB\u003c/em\u003e-positive by qMSP; among 12 histologically malignant fossa samples, 9 (75%) were \u003cem\u003eRARB\u003c/em\u003e-positive (Table\u0026nbsp;1). \u003cem\u003eRARB\u003c/em\u003e hypermethylation associated significantly with surgical margin status (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and with BCR (p\u0026thinsp;=\u0026thinsp;0.039), but not with T-stage or initial PSA; associations by ISUP grade showed a trend for \u0026ge;\u0026thinsp;3 (p\u0026thinsp;=\u0026thinsp;0.090) and significance for \u0026ge;\u0026thinsp;4 (p\u0026thinsp;=\u0026thinsp;0.029). All 160 control-fossa samples were \u003cem\u003eRARB\u003c/em\u003e-negative, while 20 prostate cancer tissue controls were \u003cem\u003eRARB\u003c/em\u003e-positive. During a median 60-month follow-up (n\u0026thinsp;=\u0026thinsp;152), 32 men (21%) developed BCR. In the BCR subset suitable for analysis (n\u0026thinsp;=\u0026thinsp;27), fossa histology was positive in 3 (11%), specimen margin status was positive in 13 (48%), and \u003cem\u003eRARB\u003c/em\u003e was positive in 23 (85%). For predicting BCR, \u003cem\u003eRARB\u003c/em\u003e analysis outperformed margin status and fossa histology (each p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; McNemar where applicable).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eIntraoperative prostatic fossa biopsies analyzed for \u003cem\u003eRARB\u003c/em\u003e promoter hypermethylation detect molecular residual disease that is frequently missed by routine histology and provide superior prediction of BCR compared with surgical margin status. \u003cem\u003eRARB\u003c/em\u003e methylation may enable earlier, biologically informed selection for adjuvant or early salvage radiotherapy while avoiding overtreatment in molecularly negative patients. Prospective validation and integration with multivariable models are warranted.\u003c/p\u003e","manuscriptTitle":"Prediction of local failure by residual tumor cells after radical prostatectomy using retinoic acid receptor beta (RARB) promoter hypermethylation analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-17 08:44:05","doi":"10.21203/rs.3.rs-7877027/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4c0a035b-1182-4e25-a133-8318ce739028","owner":[],"postedDate":"November 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-21T14:24:22+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-17 08:44:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7877027","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7877027","identity":"rs-7877027","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}