Subcuticular and biofilm microbiomes in Holothuria tubulosa and its potential for denitrification | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Subcuticular and biofilm microbiomes in Holothuria tubulosa and its potential for denitrification Silke Martínez-Moreno, Elizabeth León-Palmero, Héctor Pula, Ana María Cabello, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3469562/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Jan, 2024 Read the published version in Marine Ecology Progress Series → Version 1 posted You are reading this latest preprint version Abstract Holothurians, as benthic invertebrates inhabiting the marine ecosystems, play a crucial function by actively processing organic detritus in the sediments. Previous works have provided evidence of holothurians capability to reduce nitrate and ammonium concentrations in aquaculture tanks. However, the mechanisms underlying this nitrogen decrease still needs to be elucidated and might be related to bacterial symbionts in the holothurians. Here we characterize the community of bacterial symbionts in the biofilm and subcuticle of Holothuria tubulosa and explored the presence of nitrification and denitrification genes. To characterize these bacterial symbionts, we extracted DNA and amplified the V3-V4 hypervariable region of the 16S rRNA gene. We obtained a notable contribution of Bacteroidota, Alphaproteobacteria (mostly Rhodobacterales), and Gammaproteobacteria (mostly Pseudomonadales) both within the biofilm and subcuticle of H. tubulosa. Subsequently, we tested the presence of specific genes encoding enzymes involved in nitrification (i.e., archaeal amoA and bacterial amoA) and denitrification processes (i.e., nirS and nosZ). Our results confirm the presence of denitrification genes in the holothurian biofilms. These findings indicate that the holothurians house a diverse community of bacterial symbionts, which includes species with the potential for nitrogen removal. Therefore, holothurian holobionts may play a multifaceted ecological role, both processing organic detritus and reducing nitrogen levels in coastal areas. These roles could be extended to sustainable aquaculture, making them valuable ecosystem engineers with significant implications for ecosystem and aquaculture health. echinoderm microbiome biofilm subcuticular bacteria holothurian denitrification Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Holobionts are entities formed by the association of a host and its symbiotic microbes [1]. This term has gained importance in recent years due to the evidence of the ubiquitous nature of animal-associated prokaryotes and their central role in biology, ecology, and evolution [2,3]. A first step in holobiont research requires the characterization of symbiont microorganisms in the hosts, and the current development of massive sequencing techniques has made this approach feasible [4]. Interdisciplinary approaches that combine molecular tools with biogeochemical processes can effectively explore unknown functions emerging from holobionts. In fact, recent research has shown the pivotal role of the symbiotic association between invertebrates and bacteria in driving several biogeochemical processes at the ecosystem level. For example, corals, sponges, and oysters, as holobionts, participate in the carbon and nitrogen cycles [5-11] proposed that nitrogen fixation compensates for the low heterotrophic nitrogen uptake in autotrophic corals. Siboni et al. [12] suggested a coupling of nitrification and denitrification, ultimately producing dinitrogen to remove nitrogen from the coral holobiont. Further, Arfken et al. [5] found bacteria carrying functional denitrification genes in oysters, facilitating nitrogen removal in oyster reefs. Other associations, such as those between echinoderms and bacteria, have been studied in the search for new antimicrobial compounds [13,14], but little is known about the role of the echinoderm holobionts in biogeochemical processes in marine ecosystems. Holothuria tubulosa (Gmelin, 1790) is an echinoderm of the class Holothuroidea, commonly known as sea cucumbers. Holothurians are benthic organisms usually found at the rock-sand interface of coastal zones [15]. They are sediment-eaters, playing an important role in the recycling of organic matter and bioturbation [16,17]. Recent studies have shown that holothurians can serve as extractive species in integrated multi-trophic aquaculture systems, effectively reducing ammonium, nitrates, transparent exopolymer particles, bacteria, and chromophoric dissolved organic matter in seawater [18,19]. Several echinoderm species possess a subcuticular layer of bacteria [20]. These subcuticular bacteria have been visualized using fluorescence confocal and electron microscopy in various species of echinoderms, demonstrating that it is a widespread phenomenon, present in approximately 60% of the studied echinoderms [20, 21]. Regarding their diversity, Lawrence et al. [22] were pioneers in applying molecular tools to characterize these bacteria, identifying four different groups through phylogenetic analysis of the 16S rRNA gene, all belonging to the Alpha- and Gammaproteobacteria. Later, massive sequencing techniques have been applied to the study of the subcuticular bacteria of the brittle star Amphipholis squamata , showing that 70-80% of them belong to the Roseobacter clade and that the symbiont community is much less diverse than the neighboring water communities of sea and sediment [23]. More recently, Wada et al. [24] showed that a single bacterium exists at high densities in the subcuticular space in Acanthaster planci forming a biofilm-like structure between the cuticle and the epidermis. Despite the symbiotic relationship between echinoderms and subcuticular bacteria have been recognized for over four decades [25], the potential functions of these bacteria remain largely unexplored. For instance, they could provide direct nutrients to the host, based on the observation of partially digested bacteria within phagosomes of epidermal cells in various holothurians, as well as in asteroid larvae [26,27]. They appear to translocate amino acids from seawater to the host for protein synthesis [28]. Additionally, they could play a relevant role in the early stages (larval development) of the host, helping to absorb labile dissolved organic matter [29,30]. On the other hand, holothuroids secrete mucus that coats the cuticle [15] and can contain associated bacteria that ultimately form a microbial biofilm. This kind of biofilm has been studied in corals and Siboni et al. [12] reported the presence of archaea, including marine group II, marine group III, anaerobic methanotrophs, anaerobic nitrate reducers, and ammonia-oxidizing archaea. Subsequently, it is possible that the ammonia-oxidizing archaea as coral symbionts play a role in the N recycling through nitrification and denitrification process [12]. Pogoreut et al. [8] and Rädecker et al. [7] have also demonstrated the regulation of environmental nitrogen by the coral holobionts. However, the current knowledge of the composition and the role of subcuticular and biofilm bacteria of holothurians is very limited. In this study, we delve into the composition of the biofilm and subcuticle microbiomes of H. tubulosa by the partial amplification and massive sequencing of the 16S rRNA gene. Through a complementary analysis, we aim to unravel the presence of key genes associated with nitrification (i.e., bacterial amoA and archaeal amoA ) and denitrification (i.e., nirS and nosZ ). By shedding light on the potential participation of subcuticular and biofilm bacteria in the nitrogen cycle, we offer insights into the ecological implications of these holobionts in marine coastal ecosystems. This investigation not only advances our understanding of the echinoderm symbionts, but also highlights the broader significance of holobionts in shaping nutrient cycling at the ecosystem level. Methods Sample collection We collected eight individuals of H. tubulosa from the coast of Granada, Spain (36°42'10.1"N 3°24'42.7"W) by scuba diving at depths from 5 to 15 m. Once collected, we transferred them to an aquarium until sampling. We collected the biofilm samples using sterile swabs and the subcutaneous samples using a biopsy punch in areas where the biofilm had previously been removed to avoid the transference of biofilm bacteria to subcuticle samples. From each holothurian, we collected a single biofilm sample and two replicate samples from subcutaneous punch biopsies. From the aquarium, we also collected samples of sediments and water that was subsequently filtered through 0.22 μm polycarbonate filters for comparison purposes. We preserved all samples in saline buffer (0.75M saccharose, 0.05M TRIS, 0.02M EDTA and 0.4M NaCl) until DNA extraction. DNA extractions were performed using the DNeasy Powersoil Kit (Qiagen). Sequencing and data analysis We used Illumina Next Generation Sequencing to obtain sequences of the V3-V4 hypervariable region of the 16S rRNA gene amplified with primers 341F "CCTACGGGGGNGGGGCWGCAG" and 805R "GACTACHVGGGGGTATCTAATCC" using Macrogen facilities. The 8 biofilm samples passed the quality control and from the subcuticle samples 11 out of the 16 samples passed the quality control. The 5 samples that did not pass the quality control were replicates, then we have at least one biofilm and one subcuticular sample of each individual. The water and sediment samples also passed the quality control. The sequences are available in GenBank Bioproject PRJNA1003448 (https://www.ncbi.nlm.nih.gov/genbank/). We processed the data using the DADA2 R-package [31] installed in R [32]. The DADA2 protocol clusters reads into unique sequences termed Amplicon Sequence Variants (ASVs). Primers were removed using the Cutadapt v2.10 R-package [33]. Raw sequences underwent quality control following standard filtration parameters and chimera removal. We performed taxonomic assignment of the ASVs using the assignTaxonomy function of the DADA2 R-package and using SILVA SSU v.138.1 [34] as a reference database. We rarefied the data to the minimum number of reads and randomizing 100 times using the function rrarefy of the R-package vegan [35]. Statistical analysis To compare the dissimilarities in the composition of ASVs within subcuticular, biofilm, water, and sediment communities, we employed a Non-Metric Multidimensional Scaling (NMDS) ordination model based on the Bray-Curtis index of the R-package vegan [35]. Given that the NMDS model's ordination is contingent on the initial configuration of communities in multidimensional space, we iteratively executed the model though 1000 permutations to identify the ordination with the optimal goodness of fit [35]. Lastly, we determined the location of the centroid associated with the subcuticular communities and the biofilm, and we examined the 95% Confidence Interval (CI) tied to their location in the multidimensional space. To ascertain the 95% CI around the centroids, we employed the ordihull function from the R-package vegan [35]. Finally, we compared the diversity between communities associated with the subcuticle and the biofilm using the Chao1 and Simpson's inverse indices with the functions chao1 and diversity of the R-packages fossil [36] and vegan [35], respectively. During our data exploration process, we observed that the richness measures (Chao1) did not conform to the normality assumptions required for parametric tests. Therefore, for comparisons between subcuticular and biofilm samples, we implemented a Mann-Whitney-Wilcoxon test to compare the medians of each group. The diversity measures (Simpson's inverse) fulfilled the criteria for parametric tests, prompting us to utilize a one-way ANOVA test to compare the means of each group. Both the Mann-Whitney-Wilcoxon and ANOVA tests were conducted using the wilcox.test and anova functions owithin the R software [32]. Testing the occurrence of functional genes First, we used the Functional Annotation of Prokaryotic Taxa (FAPROTAX) software [37] to envisage the functions that could be performing the holothurian symbionts. Secondly, we explored the functional genes involved in the nitrogen cycle using PCR tests. We tested the functional genes bacterial amoA and archaeal amoA that encode the catalytic subunit A of ammonium monooxygenase, which catalyse the oxidation of ammonium to nitrite in the nitrification process. Furthermore, we tested the functional genes nirS and nosZ involved in denitrification. The nirS gene encodes the nitrite reductase which catalyses the transformation of nitrite into NO and the nosZ gene encodes the nitrous oxide reductase which is responsible for the reduction of N 2 O to N 2 . The PCR reactions contained 12.5 µL of OneTaq® 2X Master Mix with Standard Buffer (NewEngland BioLabs Inc.), 1 µL at 10 µM of each primer, and 1 µL of template DNA and 9.5 µL of Milli-Q water. Thermocycling parameters were as follows: initial denaturation at 45 ºC for 3 min, followed by 35 cycles of denaturation at 94 ºC for 30 seconds, annealing temperatures are available for each gene in Table 1, elongation at 68 ºC for 30 seconds, and finally, elongation at 68 ºC 5 min. In Table 1, we also included the primers' details and positive controls. We visualized the PCR results on 2% agarose gel electrophoresis. Results Description of subcuticular and biofilm microbiomes The number of reads of the V3-V4 16S rRNA gene amplicons per sample ranged from 35,876 to 60,648, obtaining a total of 9,172 ASVs. The rarefaction curves show that a normalization to 35,876 reads was appropriate to determine the ASVs richness (Supplementary information Fig. S1). After the random normalisation, the number of ASVs in the subcuticle samples ranged between 269 and 910, and in the biofilm ranged from 266 to 1854. The number of ASVs in the water and sediment samples were 149 and 205 respectively (Supplementary information Table S1). The relative contribution of different bacterial taxa in the microbiome of the subcuticle (Fig. 1 a) and biofilm (Fig. 1 b) samples were substantially different from water and sediment samples. The most relevant taxonomic groups found in the subcuticle and biofilm samples were the Bacteroidota phylum, and the Alphaproteobacteria and Gammaproteobacteria classes. Within the Alphaproteobacteria, the ASVs of the order Rhodobacterales contribute about 10% of the total abundance. Within the Gammaproteobacteria, the order Pseudomonadales was prevalent accounting for 14% on average. To discern the specificity level of the biofilm and subcuticle microbiomes, we analyzed the ASVs present exclusively in each sample type. We found more exclusive ASVs in the subcuticle than in the biofilms (Fig. 2). In the subcuticle samples, the exclusive ASVs usually accounted for more than 25% of the total (Fig. 2 a), whereas in the biofilm samples, the exclusive ASVs accounted for less than 25% of the total (Fig. 2 b). The NMDS ordination model based on the ASV composition across sampled communities showed a high goodness of fit between the distances in the ordination against the original data (linear fit R 2 = 0.9, nonmetric fit R 2 = 0.9). The NMDS model showed a clustering that clearly discriminates between subcuticle and biofilm communities, being in both cases also different from sediment and seawater communities (Fig. 3). Therefore, these results support those derived from our taxonomic analyses, underscoring differences in the microbiomes associated with distinct sections of the holothurian body. We estimated the ASVs richness using the Chao 1 index (Fig. 4 a). Notably, the biofilm showed a higher richness than the subcuticle (Mann-Whitney-Wilcoxon test W=13, p-value = 0.009**). We also estimated the diversity using the Inverse Simpson index (Fig. 4 b) and the biofilm significantly exceeding the subcuticle in diversity (df= 17, F=4.66, p-value = 0.045*). This result indicates a higher diversity in the biofilm than in the subcuticle. Functional profile We envisaged the putative functional profiles of the holothurian symbionts based on the taxa identified in the samples using Functional Annotation of Prokaryotic Taxa (FAPROTAX) [37]. Comprehensively, the predicted functions are chemoheterotrophy, functions related to the nitrogen cycle, degradation of aromatic compounds in subcuticle samples, dark oxidation of sulfur, fermentation, photoheterotrophy, and photoautotrophy. In the case of the functions related to the nitrogen cycle, we observed the potential for denitrification of nitrate, nitrite, and nitrous oxide both in subcuticular and biofilm samples. Given that FAPROTAX suggests that holothurian microbiomes have taxa with the potential to be involved in N cycle, we performed a search of well-known taxa associated with N cycling in the subcuticular and biofilm dataset (Table 2). To corroborate the presence (or absence) of key functional genes involved in nitrogen cycle, we used PCR amplifications of the functional genes for nitrification (bacterial a moA and archaeal amoA ) and denitrification ( nirS and nosZ ), and. We were unable to detect the presence of the functional genes bacterial amoA and archaeal amoA . We did not observe a clear amplification of the nirS gene in the subcuticle samples (Fig. 5 a and b), but we observed an evident amplification in 7 out of 8 biofilm samples (Fig. 5 c), and in water and sediment samples. Like for nirS , we did not observe amplification of the nosZ gene in any of the samples from the subcuticle or their respective replicas (Fig. 5 d and e). However, we observed an evident amplification of the nosZ gene in the 8 biofilm samples (Fig. 5 f), and in the sediment sample. Discussion Currently, there is evidence that all the classes of the phylum Echinodermata host subcuticular bacteria. Although the presence of these bacteria in the Holothuroidea class supposed to be less common according to the study by Kelly & McKenzie [20], where only 39% of the surveyed holothurian species hosted subcuticular bacteria. With the present study, we confirm the presence of these subcuticular bacteria in Holothuria tubulosa , a fact that had not been reported previously. Remarkably, we found a higher ASV exclusivity and lower richness and diversity in the subcuticle samples than in the biofilm samples. In the biofilm samples, we found evidence of denitrification genes suggesting a potential function of the holothurian holobionts in the nitrogen cycle providing a service in coastal marine ecosystems. Subcuticular and biofilm microbiomes Chiarello et al. [38] studied the surface microbiomes of some echinoderms, among other taxa, and concluded that more than 90% of their prokaryotic phylogenetic richness was unique. In the case of the phylum Porifera, the microbiome richness varies widely among different host species and the complexity (assessed by the number of operative taxonomic units (OTUs)) ranges from 50 to 3,820 symbionts genetically distinct per host [39]. Recent studies show that different species of echinoderms harbor rich and diverse microbiomes and the Bacteroidota phylum and Alphaproteobacterial class predominate [40], as we have also seen in our samples. Our ASVs exclusivity and ordination analyses confirm that the bacteria associated with distinct parts of the body are different from each other, as well as different from the bacteria coming from the water and sediments (Fig. 2 and 3). Hence, we can assert that there is a site-specific (subcuticle vs. biofilm) selection of the bacterial community. The process by which echinoderms acquire subcuticular bacteria remains largely unknown. There is evidence of vertical transmission from the parent to the incubated embryo in brittle stars [23]. Although a transmission from the environment has been also previously proposed by Walker & Lesser [30]. In fact, Schuh et al. [41] indicates that larvae acquire most of their bacterial load after the onset of feeding. We observed that the subcuticle samples in Holothuria tubulosa presented a richness and diversity values higher than those reported in other echinoderms such as sea stars. Wada et al. [24] found that in Acanthaster planci there was a 61.8% predominance of a single Operational Taxonomic Unit (OTU COTS27 affiliated to the phylum Spirochaetes). Concerning the biofilm microbiome, it remains uncertain whether bacterial acquisition is related to the surrounding environment or if there is an active selection by the host. Our NMDS ordination (Fig. 3) indicates that the bacterial community of the biofilm is closer to the bacterial community of the sediments than the subcuticular bacteria. Overall, the subcuticular bacteria suggest a host-specificity signature, whereas the biofilm bacteria seem to have more influence from the environment. Potential functions at the holobiont and ecosystem levels The microbiomes associated with marine invertebrates can perform different functions or services from the perspectives of both the host and the ecosystem. The relationship between host and microbiome can be nutritional through the supply of certain nutrients or defensive concerning strains with antimicrobial capacity [42,18]. For instance, indirect evidence suggests that the endosymbiont bacteria of some echinoderms can take up dissolved amino acids [43-46]. In the case of the brittle star Amphipholis squamata , it has been observed that subcuticular bacteria can absorb dissolved amino acids for the synthesis of proteins that are later translocated to the host [28]. Some investigators have also suggested that subcuticular bacteria can metabolize dissolved organic matter [25,30]. At the ecosystem level, the symbiosis between bacteria and marine invertebrates such as corals, sponges, and oysters can participate in the nitrogen cycle [5,7,47,48]. However, it is unknown the role of echinoderm microbiomes in this cycle. Our results using FAPROTAX suggest that the echinoderm microbiomes include taxa with putative functions associated to the nitrogen cycle (Table 2). By analyzing the data obtained from the 16S rRNA gene sequencing, we observed that several genera of the Nitrosomonadaceae family appeared in the samples, whose cultivated representatives are ammonium oxidizing bacteria (AOB) [49]. Among the representatives of this family, we found Nitrosospira , Nitrosomonas , oc32, DSSD61, and unclassified ASVs belonging to the Nitrosomonadacea. Concerning AOB, we identified the presence of two genera (AqS1 and Cm1-21) and unclassified ASVs belonging to the Nitrosococcaceae [50]. We also detected nitrite-oxidizing bacteria (NOB), such as Nitrospina , Nitrolancea , and Nitrospira [51,52]. Some members of the Nitrospira genus, in addition to oxidizing nitrite, can carry out complete nitrification (comammox bacteria) [53-55]. We also detected denitrifying bacteria like, for instance, Methylophaga nitratireducenticrescens in the biofilm. Mauffrey et al. [56] also detected these bacteria in aquaria and determined that they carry out complete denitrification (Auclair et al., 2010). We also detected bacteria of the Pseudomonas and Bacillus genera. It is known that these genera can reduce nitrate in microzones with low oxygen concentrations in the upper layer of sediments (Hargreaves, 1998). Furthermore, we observed the presence of the genera Woesia . Mußmann et al. [57] studied the metagenome of some Woesia strains and observed that possibly perform denitrification producing N 2 O. Finally, we also observed Pseudohongiella nitratireducens which can reduce nitrate [58]. Despite the results obtained by FAPROTAX and the detailed study of the sequences, we were unable to confirm the occurrence of the nitrification genes archaeal amoA and bacterial amoA using PCR. This could be due to these functional genes falling below our detection threshold and their low prevalence in the total ASVs. However, we successfully confirmed the presence of denitrification genes nirS and nosZ (which encode nitrite reductase and nitrous oxide reductase, respectively) in the biofilms of H. tubulosa for the first time, using PCR. Future studies should aim to quantify the abundance of these genes (qPCR and dd-PCR) and denitrification rates. In addition, the conditions (i.e., nitrogen and oxygen concentrations) in which denitrification occurs could be key to determine the balance between denitrification products (i.e., N 2 O and N 2 ). Quantifying this N removal by the holothurian holobionts can be of great interest to the conservation of marine ecosystems. While ammonium, nitrite, and nitrate are present in nature, human activities have significantly altered the nitrogen cycle, increasing their availability [59,60] and thus, inducing coastal eutrophication [61]. Overall, the anthropogenic nitrogen represents a serious problem in coastal ecosystems, since this element usually is the limiting resource in marine systems producing phytoplankton blooms [62]. One of these human activities is related to aquaculture discharges [63]. Our data suggests the ability of H. tubulosa microbiome to reduce nitrogen concentrations, emphasizing its high intrinsic value as extractive species in integrated multitrophic aquaculture. Moreover, knowing deeply about the microbiomes of these organisms could be relevant due to their multiple functionalities beyond denitrification and nitrification. Declarations Funding This work was supported by the Junta de Andalucía, Consejería de Transformación Económica, Industria, Conocimiento y Universidades (grant no. P20.00705), and the European Regional Development Fund (ERDF). Silke Martínez-Moreno was supported by a predoctoral fellowship (grant no. PREDOC_01315) from the Junta de Andalucía Consejería de Transformación Económica, Industria, Conocimiento y Universidades. Ana M. Cabello was supported by a technical support staff contract from the Agencia Estatal de Investigación (PTA2018-016205-I). Conflicts of interest The authors declare no conflicts of interest. Ethics approval No approval of research ethics committees was required to accomplish the goals of this study because experimental work was conducted with an unregulated invertebrate species. Consent to participate This study did not involve human subjects. Consent for publication All the authors give their consent to allow this manuscript to be published by the journal of Microbial Ecology. Data availability The datasets generated in the current study are available in GenBank Bioproject PRJNA1003448 (https://www.ncbi.nlm.nih.gov/genbank/). Authors’ contributions Isabel Reche and Isabel Ferrera conceived the study and Silke Martínez-Moreno contributed to the design. The sampling was performed by Silke Martínez-Moreno and Héctor Pula. Laboratory analyses were performed by Silke Martínez-Moreno; analyses of the metagenomic data were conducted by Silke Martínez-Moreno, Ana María Cabello, and Elizabeth León-Palmero. Silke Martínez-Moreno wrote the first draft of the manuscript. Isabel Reche and Isabel Ferrera contributed substantially to manuscript drafting and funding acquisition. All authors read and approved the final manuscript. Acknowledgement The authors thank the Aula del Mar of the University of Granada for sharing their facilities where part of the experimental work was performed. We also thank Dr. Ignacio Peralta-Maraver for his help with statistics analysis. Computing analyses were performed in the Picasso Supercomputer at the University of Málaga. This work was supported by the Junta de Andalucía, Consejería de Transformación Económica, Industria, Conocimiento y Universidades (grant no. P20.00705) and the European Regional Development Fund (ERDF). Silke Martínez-Moreno was supported by a predoctoral fellowship (grant no. PREDOC_01315) from the Junta de Andalucía Consejería de Transformación Económica, Industria, Conocimiento y Universidades and Ana M. Cabello was supported by a technical support staff contract from the Agencia Estatal de Investigación (PTA2018-016205-I). References Theis, K. R., Dheilly, N. M., Klassen, J. L., Brucker, R. M., Baines, J. F., Bosch, T. C. G., Cryan, J. F., Gilbert, S. F., Goodnight, C. J., Lloyd, E. A., Sapp, J., Vandenkoornhuyse, P., Zilber-Rosenberg, I., Rosenberg, E., & Bordenstein, S. R. (2016). Getting the Hologenome Concept Right: An Eco-Evolutionary Framework for Hosts and Their Microbiomes. mSystems, 1(2), e00028-16. https://doi.org/10.1128/mSystems.00028-16 Bordenstein, S. R., & Theis, K. R. (2015). Host Biology in Light of the Microbiome: Ten Principles of Holobionts and Hologenomes. PLOS Biology, 13(8), e1002226. https://doi.org/10.1371/journal.pbio.1002226 Simon, J.-C., Marchesi, J. R., Mougel, C., & Selosse, M.-A. (2019). Host-microbiota interactions: From holobiont theory to analysis. Microbiome, 7(1), 5. https://doi.org/10.1186/s40168-019-0619-4 Schuster, S. C. (2008). Next-generation sequencing transforms today’s biology. Nature Methods, 5(1), Article 1. https://doi.org/10.1038/nmeth1156 Arfken, A., Song, B., Bowman, J. S., & Piehler, M. (2017). Denitrification potential of the eastern oyster microbiome using a 16S rRNA gene based metabolic inference approach. PLOS ONE, 12(9), e0185071. https://doi.org/10.1371/journal.pone.0185071 Glaze, T. D., Erler, D. V., & Siljanen, H. M. P. (2022). Microbially facilitated nitrogen cycling in tropical corals. The ISME Journal, 16(1), Article 1. https://doi.org/10.1038/s41396-021-01038-1 Rädecker, N., Pogoreutz, C., Voolstra, C. R., Wiedenmann, J., & Wild, C. (2015). Nitrogen cycling in corals: The key to understanding holobiont functioning? Trends in Microbiology, 23(8), 490-497. https://doi.org/10.1016/j.tim.2015.03.008 Pogoreutz, C., Rädecker, N., Cárdenas, A., Gärdes, A., Wild, C., & Voolstra, C. R. (2017). Nitrogen Fixation Aligns with nifH Abundance and Expression in Two Coral Trophic Functional Groups. Frontiers in Microbiology, 8. https://doi.org/10.3389/fmicb.2017.01187 Pita, L., Rix, L., Slaby, B. M., Franke, A., & Hentschel, U. (2018). The sponge holobiont in a changing ocean: From microbes to ecosystems. Microbiome, 6(1), 46. https://doi.org/10.1186/s40168-018-0428-1 De Goeij, J. M., & van Duyl, F. C. (2007). Coral cavities are sinks of dissolved organic carbon (DOC). Limnology and Oceanography, 52(6), 2608-2617. https://doi.org/10.4319/lo.2007.52.6.2608 de Goeij, J. M., van Oevelen, D., Vermeij, M. J. A., Osinga, R., Middelburg, J. J., de Goeij, A. F. P. M., & Admiraal, W. (2013). Surviving in a Marine Desert: The Sponge Loop Retains Resources Within Coral Reefs. Science, 342(6154), 108-110. https://doi.org/10.1126/science.1241981 Siboni, N., Ben-Dov, E., Sivan, A., & Kushmaro, A. (2008). Global distribution and diversity of coral-associated Archaea and their possible role in the coral holobiont nitrogen cycle. Environmental Microbiology, 10(11), 2979-2990. https://doi.org/10.1111/j.1462-2920.2008.01718.x Kiani, N., Heidari, B., Rassa, M., Kadkhodazadeh, M., & Heidari, B. (2014). Antibacterial activity of the body wall extracts of sea cucumber (Invertebrata; Echinodermata) on infectious oral streptococci. Journal of basic and clinical physiology and pharmacology, 25(4), 367-373. https://doi.org/10.1515/jbcpp-2013-0010 León-Palmero, E., Joglar, V., Álvarez, P. A., Martín-Platero, A., Llamas, I., & Reche, I. (2018). Diversity and antimicrobial potential in sea anemone and holothurian microbiomes. PloS one, 13(5), e0196178. https://doi.org/10.1371/journal.pone.0196178 Ocaña, M., Tocino, L. S., López González, S., & Viciana Martín, J. (2000). Guía submarina de invertebrados no artrópodos. Editorial Comares. Purcell, S. W., Mercier, A., Conand, C., Hamel, J.-F., Toral-Granda, M. V., Lovatelli, A., & Uthicke, S. (2013). Sea cucumber fisheries: Global analysis of stocks, management measures and drivers of overfishing. Fish and Fisheries, 14(1), 34-59. https://doi.org/10.1111/j.1467-2979.2011.00443.x Uthicke, S. (1999). Sediment bioturbation and impact of feeding activity of Holothuria (Halodeima) atra and Stichopus chloronotus, two sediment feeding holothurians, at Lizard Island, Great Barrier Reef. Bulletin of Marine Science, 64(1), 129-141. Sadeghi-Nassaj, S. M., Catala, T. S., Alvarez, P. A., & Reche, I. (2018)a. Sea cucumbers reduce chromophoric dissolved organic matter in aquaculture tanks. Peerj, 6, e4344. doi:10.7717/peerj.4344. https://doi.org/10.7717/peerj.4344 Sadeghi‐Nassaj, S. M., Batanero, G. L., Mazuecos, I. P., Alonso, C., & Reche, I. (2018)b. Sea cucumbers reduce nitrogen, bacteria and transparent exopolymer particles in Anemonia sulcata aquaculture tanks. Aquaculture Research, 49(11), 3669-3681. https://doi.org/10.1111/are.13836 Kelly, M., & McKenzie, J. (1995). Survey of the occurrence and morphology of sub-cuticular bacteria in shelf echinoderms from the north-east Atlantic Ocean. Marine Biology, 123(4), 741-756. https://doi.org/10.1007/BF00349117 McKenzie, J. D., & Kelly, M. S. (1994). Comparative study of sub-cuticular bacteria in brittlestars (Echinodermata: Ophiuroidea). Marine Biology, 120(1), 65-80. https://doi.org/10.1007/BF00381943 Lawrence, S. A., O’Toole, R., Taylor, M. W., & Davy, S. K. (2010). Subcuticular Bacteria Associated With Two Common New Zealand Echinoderms: Characterization Using 16S rRNA Sequence Analysis and Fluorescence in situ Hybridization. The Biological Bulletin, 218(1), 95-104. https://doi.org/10.1086/BBLv218n1p95 Morrow, K. M., Tedford, A. R., Pankey, M. S., & Lesser, M. P. (2018). A member of the Roseobacter clade, Octadecabacter sp., is the dominant symbiont in the brittle star Amphipholis squamata. FEMS Microbiology Ecology, 94(4), fiy030. https://doi.org/10.1093/femsec/fiy030 Wada, N., Yuasa, H., Kajitani, R., Gotoh, Y., Ogura, Y., Yoshimura, D., Toyoda, A., Tang, S.-L., Higashimura, Y., Sweatman, H., Forsman, Z., Bronstein, O., Eyal, G., Thongtham, N., Itoh, T., Hayashi, T., & Yasuda, N. (2020). A ubiquitous subcuticular bacterial symbiont of a coral predator, the crown-of-thorns starfish, in the Indo-Pacific. Microbiome, 8(1), 123. https://doi.org/10.1186/s40168-020-00880-3 Holland, N. D., & Nealson, K. H. (1978). The Fine Structure of the Echinoderm Cuticle and the Subcuticular Bacteria of Echinoderms. Acta Zoologica, 59(3-4), 169-185. https://doi.org/10.1111/j.1463-6395.1978.tb01032.x Roberts, D., Billett, D. S. M., McCartney, G., & Hayes, G. E. (1991). Procaryotes on the tentacles of deep-sea holothurians: A novel form of dietary supplementation. Limnology and Oceanography, 36(7), 1447-1451. https://doi.org/10.4319/lo.1991.36.7.1447 Bosch, I. (1992). Symbiosis between bacteria and oceanic clonal sea star larvae in the western North Atlantic Ocean. Marine Biology, 114(3), 495-502. https://doi.org/10.1007/BF00350041 Lesser, M. P., & Walker, C. W. (1992). Comparative study of the uptake of dissolved amino acid in sympatric brittle stars with and without endosymbiotic bacteria. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 101(1), 217-223. https://doi.org/10.1016/0305-0491(92)90182-Q Fontaine, A. R., & Chia, F.-S. (1968). Echinoderms: An Autoradiographic Study of Assimilation of Dissolved Organic Molecules. Science, 161(3846), 1153-1155. https://doi.org/10.1126/science.161.3846.1153 Walker, C. W., & Lesser, M. P. (1989). Nutrition and development of brooded embryos in the brittlestar Amphipholis squamata: Do endosymbiotic bacteria play a role? Marine Biology, 103(4), 519-530. https://doi.org/10.1007/BF00399584 Callahan, B. J., McMurdie, P. J., Rosen, M. J., Han, A. W., Johnson, A. J. A., & Holmes, S. P. (2016). DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods, 13(7), Article 7. https://doi.org/10.1038/nmeth.3869 R Core Team (2023). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/ Martin, M. (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.Journal, 17(1), Article 1. https://doi.org/10.14806/ej.17.1.200 Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., & Glöckner, F. O. (2013). The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Research, 41(D1), D590-D596. https://doi.org/10.1093/nar/gks1219 Oksanen, J. (2015). Multivariate analysis of ecological communities in R: vegan tutorial. Retrieved from http://cc.oulu.fi/~jarioksa/opetus/metodi/veg- antutor.pdf Accessed 6 March 2023 Vavrek, Matthew J. (2011). fossil: Palaeoecological and palaeogeographical analysis tools. Palaeontologia Electronica Vol. 14, Issue1; 1T:16p Louca, S., Parfrey, L. W., & Doebeli, M. (2016). Decoupling function and taxonomy in the global ocean microbiome. Science, 353(6305), 1272-1277. https://doi.org/10.1126/science.aaf4507 Chiarello, M., Auguet, J.-C., Graham, N. A. J., Claverie, T., Sucré, E., Bouvier, C., Rieuvilleneuve, F., Restrepo-Ortiz, C. X., Bettarel, Y., Villéger, S., & Bouvier, T. (2020). Exceptional but vulnerable microbial diversity in coral reef animal surface microbiomes. Proceedings of the Royal Society B: Biological Sciences, 287(1927), 20200642. https://doi.org/10.1098/rspb.2020.0642 Thomas, T., Moitinho-Silva, L., Lurgi, M., Björk, J. R., Easson, C., Astudillo-García, C., Olson, J. B., Erwin, P. M., López-Legentil, S., Luter, H., Chaves-Fonnegra, A., Costa, R., Schupp, P. J., Steindler, L., Erpenbeck, D., Gilbert, J., Knight, R., Ackermann, G., Victor Lopez, J., … Webster, N. S. (2016). Diversity, structure and convergent evolution of the global sponge microbiome. Nature Communications, 7(1), Article 1. https://doi.org/10.1038/ncomms11870 Crowley, C. A. (2022). Investigating the Microbial Diversity Between Three Species of Atlantic Echinoderms. Clark University. Schuh, N. W., Carrier, T. J., Schrankel, C. S., Reitzel, A. M., Heyland, A., & Rast, J. P. (2020). Bacterial Exposure Mediates Developmental Plasticity and Resistance to Lethal Vibrio lentus Infection in Purple Sea Urchin (Strongylocentrotus purpuratus) Larvae. Frontiers in Immunology, 10. https://www.frontiersin.org/articles/10.3389/fimmu.2019.03014 Rosenberg, E., Koren, O., Reshef, L., Efrony, R., & Zilber-Rosenberg, I. (2007). The role of microorganisms in coral health, disease and evolution. Nature Reviews Microbiology, 5(5), Article 5. https://doi.org/10.1038/nrmicro1635 Brothers, C. J., Lee, R. W., & Nestler, J. R. (2015). The uptake of dissolved organic material by the sea cucumber Parastichopus californicus (Stimpson) and its potential role in visceral regeneration. Journal of Experimental Marine Biology and Ecology, 469, 69-75. https://doi.org/10.1016/j.jembe.2015.04.016 Davis, J. P., Stephens, G. C., & Rice, M. A. (1985). Net entry of amino acids into the brittle star Ophionereis annulata. Comparative Biochemistry and Physiology Part A: Physiology, 81(4), 899-903. https://doi.org/10.1016/0300-9629(85)90927-2 Manahan, D. T., Davis, J. P., & Stephens, G. C. (1983). Bacteria-Free Sea Urchin Larvae: Selective Uptake of Neutral Amino Acids from Seawater. Science, 220(4593), 204-206. https://doi.org/10.1126/science.220.4593.204 Siebers, D. (1979). Transintegumentary Uptake of Dissolved Amino Acids in the Sea Star Asterias rubens. A Reassessment of its Nutritional Role with Special Reference to the Significance of Heterotrophic Bacteria. Marine Ecology Progress Series, 1, 169-177. https://doi.org/10.3354/meps001169 Yang, Z., & Li, Z. (2012). Spatial distribution of prokaryotic symbionts and ammoxidation, denitrifier bacteria in marine sponge Astrosclera willeyana. Scientific Reports, 2(1), Article 1. https://doi.org/10.1038/srep00528 Moeller, F. U., Webster, N. S., Herbold, C. W., Behnam, F., Domman, D., Albertsen, M., Mooshammer, M., Markert, S., Turaev, D., Becher, D., Rattei, T., Schweder, T., Richter, A., Watzka, M., Nielsen, P. H., & Wagner, M. (2019). Characterization of a thaumarchaeal symbiont that drives incomplete nitrification in the tropical sponge Ianthella basta. Environmental Microbiology, 21(10), 3831-3854. https://doi.org/10.1111/1462-2920.14732 Prosser, J. I., Head, I. M., & Stein, L. Y. (2014). The Family Nitrosomonadaceae. The Prokaryotes: Alphaproteobacteria and Betaproteobacteria, 901-918. https://doi.org/10.1007/978-3-642-30197-1_372 Semedo, M., Lopes, E., Baptista, M. S., Oller-Ruiz, A., Gilabert, J., Tomasino, M. P., & Magalhães, C. (2021). Depth Profile of Nitrifying Archaeal and Bacterial Communities in the Remote Oligotrophic Waters of the North Pacific. Frontiers in Microbiology, 12. https://www.frontiersin.org/articles/10.3389/fmicb.2021.624071 Park, S.-J., Andrei, A.-Ş., Bulzu, P.-A., Kavagutti, V. S., Ghai, R., & Mosier, A. C. (2020). Expanded Diversity and Metabolic Versatility of Marine Nitrite-Oxidizing Bacteria Revealed by Cultivation- and Genomics-Based Approaches. Applied and Environmental Microbiology, 86(22), e01667-20. https://doi.org/10.1128/AEM.01667-20 Sorokin, D. Y., Vejmelkova, D., Lücker, S., Streshinskaya, G. M., Rijpstra, W. I. C., Sinninghe Damsté, J. S., Kleerbezem, R., van Loosdrecht, M., Muyzer, G., & Daims, H. (2014). Nitrolancea hollandica gen. Nov., sp. Nov., a chemolithoautotrophic nitrite-oxidizing bacterium isolated from a bioreactor belonging to the phylum Chloroflexi. International Journal of Systematic and Evolutionary Microbiology, 64(Pt_6), 1859-1865. https://doi.org/10.1099/ijs.0.062232-0 Daims, H., Lebedeva, E. V., Pjevac, P., Han, P., Herbold, C., Albertsen, M., Jehmlich, N., Palatinszky, M., Vierheilig, J., Bulaev, A., Kirkegaard, R. H., von Bergen, M., Rattei, T., Bendinger, B., Nielsen, P. H., & Wagner, M. (2015). Complete nitrification by Nitrospira bacteria. Nature, 528(7583), Article 7583. https://doi.org/10.1038/nature16461 Palomo, A., Jane Fowler, S., Gülay, A., Rasmussen, S., Sicheritz-Ponten, T., & Smets, B. F. (2016). Metagenomic analysis of rapid gravity sand filter microbial communities suggests novel physiology of Nitrospira spp. The ISME Journal, 10(11), Article 11. https://doi.org/10.1038/ismej.2016.63 van Kessel, M. A. H. J., Speth, D. R., Albertsen, M., Nielsen, P. H., Op den Camp, H. J. M., Kartal, B., Jetten, M. S. M., & Lücker, S. (2015). Complete nitrification by a single microorganism. Nature, 528(7583), Article 7583. https://doi.org/10.1038/nature16459 Mauffrey, F., Cucaita, A., Constant, P., & Villemur, R. (2017). Denitrifying metabolism of the methylotrophic marine bacterium Methylophaga nitratireducenticrescens strain JAM1. PeerJ, 5, e4098. https://doi.org/10.7717/peerj.4098 Mußmann, M., Pjevac, P., Krüger, K., & Dyksma, S. (2017). Genomic repertoire of the Woeseiaceae/JTB255, cosmopolitan and abundant core members of microbial communities in marine sediments. The ISME Journal, 11(5), Article 5. https://doi.org/10.1038/ismej.2016.185 Xu, L., Wu, Y.-H., Jian, S.-L., Wang, C.-S., Wu, M., Cheng, L., & Xu, X.-W. (2016). Pseudohongiella nitratireducens sp. Nov., isolated from seawater, and emended description of the genus Pseudohongiella. International Journal of Systematic and Evolutionary Microbiology, 66(12), 5155-5160. https://doi.org/10.1099/ijsem.0.001489 Gruber, N., & Galloway, J. N. (2008). An Earth-system perspective of the global nitrogen cycle. Nature, 451(7176), Article 7176. https://doi.org/10.1038/nature06592 Battye, W., Aneja, V. P., & Schlesinger, W. H. (2017). Is nitrogen the next carbon? Earth’s Future, 5(9), 894-904. https://doi.org/10.1002/2017EF000592 Zhou, Y., Wang, L., Zhou, Y., & Mao, X. (2020). Eutrophication control strategies for highly anthropogenic influenced coastal waters. Science of The Total Environment, 705, 135760. https://doi.org/10.1016/j.scitotenv.2019.135760 Howarth, R. W., & Marino, R. (2006). Nitrogen as the limiting nutrient for eutrophication in coastal marine ecosystems: Evolving views over three decades. Limnology and Oceanography, 51(1part2), 364-376. https://doi.org/10.4319/lo.2006.51.1_part_2.0364 Vizzini, S., Savona, B., Caruso, M., Savona, A., & Mazzola, A. (2005). Analysis of stable carbon and nitrogen isotopes as a tool for assessing the environmental impact of aquaculture: A case study from the western Mediterranean. Aquaculture International, 13(1), 157-165. https://doi.org/10.1007/s10499-004-9023-5 Braker, G., Fesefeldt, A., & Witzel, K.-P. (1998). Development of PCR Primer Systems for Amplification of Nitrite Reductase Genes (nirK and nirS) To Detect Denitrifying Bacteria in Environmental Samples. Applied and Environmental Microbiology, 64(10), 3769-3775. https://doi.org/10.1128/AEM.64.10.3769-3775.1998 Henry, S., Bru, D., Stres, B., Hallet, S., & Philippot, L. (2006). Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils. Applied and Environmental Microbiology, 72(8), 5181-5189. https://doi.org/10.1128/AEM.00231-06 Rotthauwe, J. H., Witzel, K. P., & Liesack, W. (1997). The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Applied and Environmental Microbiology, 63(12), 4704-4712. https://doi.org/10.1128/aem.63.12.4704-4712.1997 Francis, C. A., Roberts, K. J., Beman, J. M., Santoro, A. E., & Oakley, B. B. (2005). Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proceedings of the National Academy of Sciences, 102(41), 14683-14688. https://doi.org/10.1073/pnas.0506625102 Auclair, J., Lépine, F., Parent, S., & Villemur, R. (2010). Dissimilatory reduction of nitrate in seawater by a Methylophaga strain containing two highly divergent narG sequences. The ISME Journal, 4(10), Article 10. https://doi.org/10.1038/ismej.2010.47 Hargreaves, J. A. (1998). Nitrogen biogeochemistry of aquaculture ponds. Aquaculture, 166(3), 181-212. https://doi.org/10.1016/S0044-8486(98)00298-1 Tables Table 1. Description of primers used to study functional genes involved in nitrogen cycle, the annealing temperature, the bacterial DNA used as positive controls, and their corresponding references. Process Functional genes Primers Annealing (ºC) Positive control References Denitrification nirS nirS -1F – 5’ CCTAYTGGCCGCCRCART 3’ nirS -3R – 5’ GCCGCCGCCGTCRTGVAGGAA 3’ 62 Escherichia coli transformed with a constructed plasmid containing the nirS gene [64] nosZ nosZ 1F – 5’ WCSYTGTTCMTCGACAGCCAG 3’ nosZ 1R – 5’ ATGTCGATCARCTGVKCRTTYTC 3’ 63 Paracoccus denitrificans (ATCC 17741) [65] Nitrification bacterial amoA amoA -1F – 5’ GGGGTTTCTACTACTGGTGGT 3’ amoA -2R – 5’ CCCCTCKGSAAAGCCTTCTTC 3’ 60 Nitrosomonas europaea (ATCC 25978) [66] archaeal amoA arch- amoA F – 5’ STAATGGTCTGGCTTAGACG 3’ arch- amoA R – 5’ GCGGCCATCCATCTGTATGT 3’ 53 Nitrososphaera viennensis (EN76T) [67] Table 2. Taxa with potential to participate in the N cycle found in the subcuticular and biofilm samples. Subcuticular Biofilm Function References Nitrosospira sp. + + Ammonium oxidizing bacteria [49] Nitrosomonas sp. + + Ammonium oxidizing bacteria [49] oc32 sp. + + Ammonium oxidizing bacteria [49] DSSD61 + - Ammonium oxidizing bacteria [49] AqS1 + + Ammonium oxidizing bacteria [50] CM1-21 + + Ammonium oxidizing bacteria [50] Nitrospina - + Nitrate oxidizing bacteria [51] Nitrospira + + Nitrate oxidizing bacteria [51] Nitrolancea + - Nitrate oxidizing bacteria [51,52] Methylophaga nitratireducenticrescens - + Denitrification [68] Pseudomonas sp. + + Denitrification [69] Bacillus sp. + + Denitrification [69] Woeseia + + Denitrification [57] Pseudohongiella sp. + + Denitrification [58] Pseudohongiella nitratireducens + - Denitrification [58] Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation20231020.docx Cite Share Download PDF Status: Published Journal Publication published 01 Jan, 2024 Read the published version in Marine Ecology Progress Series → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3469562","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":242357159,"identity":"c267c2d9-d044-40d9-bf8d-a079bd372e54","order_by":0,"name":"Silke Martínez-Moreno","email":"","orcid":"","institution":"Universidad de Granada","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Silke","middleName":"","lastName":"Martínez-Moreno","suffix":""},{"id":242357160,"identity":"dadb7e73-9253-430f-9710-63a8325add17","order_by":1,"name":"Elizabeth León-Palmero","email":"","orcid":"","institution":"Princeton University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Elizabeth","middleName":"","lastName":"León-Palmero","suffix":""},{"id":242357161,"identity":"3845a892-418b-4f44-b733-bbd2f30c7559","order_by":2,"name":"Héctor Pula","email":"","orcid":"","institution":"Universidad de Granada","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Héctor","middleName":"","lastName":"Pula","suffix":""},{"id":242357162,"identity":"3bbfabd4-53e5-4a60-bdd9-936a0fcc8c61","order_by":3,"name":"Ana María Cabello","email":"","orcid":"","institution":"Instituto Español de Oceanografía, IEO-CSIC","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ana","middleName":"María","lastName":"Cabello","suffix":""},{"id":242357163,"identity":"c50ad237-a0e4-46bc-9812-d951fb6bb6f5","order_by":4,"name":"Isabel Ferrera","email":"","orcid":"","institution":"Instituto Español de Oceanografía, IEO-CSIC","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Isabel","middleName":"","lastName":"Ferrera","suffix":""},{"id":242357164,"identity":"0c2d895c-c873-4ab9-8d62-41d7120182e0","order_by":5,"name":"Isabel Reche","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAp0lEQVRIiWNgGAWjYBACNiBmZmCwIV1LGok2AbUcJkE5n/Thg58LKs4nzo8+wPjwB1EO40tLlp5x5nbixnMJzMY8RGnh4TFj5m0DaulhYJMmymFsPPzfmHn/nQNpYf9JnMN4eNiYeRsOJM7nAYYekQ5jM5bmOZZsvIGHsVmaKC3yPcwPP/PU2MnO72E++JEoh8GBwQHGBpI0AK0jVcMoGAWjYBSMHAAA1yQooREJka8AAAAASUVORK5CYII=","orcid":"","institution":"Universidad de Granada","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Isabel","middleName":"","lastName":"Reche","suffix":""}],"badges":[],"createdAt":"2023-10-20 11:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3469562/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3469562/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.3354/meps14591","type":"published","date":"2024-01-01T11:16:34+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":45366207,"identity":"50da694f-b359-4a80-8494-8bc81c7b5b43","added_by":"auto","created_at":"2023-10-28 13:56:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":321603,"visible":true,"origin":"","legend":"\u003cp\u003eBar plots showing the relative abundance of the most relevant taxonomic groups in the subcuticle (a) and biofilm (b) samples. The Y axis shows the relative abundance (% of total abundance) of the taxonomic groups for each sample (X axis). W represents the water sample and SED the sediment sample in each plot. Samples # 1R, 6R, and 8R (a) are replicates of the subcuticle\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/b719a120bbd6aad71e8e6171.png"},{"id":45366210,"identity":"f1454a96-201a-4faf-a00a-e12dade97883","added_by":"auto","created_at":"2023-10-28 13:56:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":185840,"visible":true,"origin":"","legend":"\u003cp\u003eBar plots showing the relative abundance of the taxonomic groups of the exclusive ASVs in the subcuticle (a) and biofilm (b) samples. The Y axis shows the relative abundance (% of total abundance) of these ASVs for each sample (X axis). Samples # 1R, 6R and 8R (a) of the subcuticle are replicates\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/67b0c802c183309f4212edbb.png"},{"id":45366206,"identity":"30ddfd48-c50a-407c-b1f8-171e9092aa4e","added_by":"auto","created_at":"2023-10-28 13:56:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":68404,"visible":true,"origin":"","legend":"\u003cp\u003eNon-metric multidimensional scaling (NMDS) ordination model based on Bray–Curtis index comparing the dissimilarities in composition of bacterial communities of subcuticle, biofilm, water and sediment. Ellipses show the 95% credible intervals on the location of centroids for the subcuticular and biofilm communities\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/65b8b40e2e52811594417600.png"},{"id":45366208,"identity":"f3e44992-4bc6-4aeb-b9c4-312f8d2274a6","added_by":"auto","created_at":"2023-10-28 13:56:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":438073,"visible":true,"origin":"","legend":"\u003cp\u003eViolin plots to visualize the data distribution of the Chao1richness index (a) and the Inverse Simpson diversity index (b) for the subcuticle and biofilm samples. The white dot represents the median value of the data distribution. The boxes within the violin represents the interquartile range. It spans from the first quartile (25th percentile) to the third quartile (75th percentile) of the data. The black narrow lines extending from the violin indicate the minimum and maximum values of the data, excluding the outliers. Asterisks means significantly differences\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/e119c699ce70af06bb1755de.png"},{"id":45366209,"identity":"f9a33d55-d79a-430a-8ef5-6b8faee3eaed","added_by":"auto","created_at":"2023-10-28 13:56:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":9012857,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis images showing the PCR results to test the occurrence of the \u003cem\u003enirS\u003c/em\u003e (panels a, b, c) and \u003cem\u003enosZ\u003c/em\u003e (panels d, e, f) genes. Gels a, b (replicate), d, and e (replicate) correspond to the subcuticular samples and the last sample is water (W). Gels c and f correspond to biofilm samples and the last sample is the sediment sample (SED). In all the gels, the DNA ladder appears on the left, followed by a negative control (C-) and a positive control (C+)\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/a6183a0a491cd5bb3c451012.png"},{"id":54760779,"identity":"0f8fc5ed-c912-424b-96a3-25a243acb9e6","added_by":"auto","created_at":"2024-04-16 11:16:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1662807,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/d2f04159-d3a6-4ee0-ad43-07f8a05de4ea.pdf"},{"id":45366211,"identity":"0f634d73-9117-4211-a7da-50ec968e5330","added_by":"auto","created_at":"2023-10-28 13:56:19","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":90768,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation20231020.docx","url":"https://assets-eu.researchsquare.com/files/rs-3469562/v1/2da00a1561857b759fca7326.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Subcuticular and biofilm microbiomes in Holothuria tubulosa and its potential for denitrification","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHolobionts are entities formed by the association of a host and its symbiotic microbes [1]. This term has gained importance in recent years due to the evidence of the ubiquitous nature of animal-associated prokaryotes and their central role in biology, ecology, and evolution [2,3]. A first step in holobiont research requires the characterization of symbiont microorganisms in the hosts, and the current development of massive sequencing techniques has made this approach feasible [4]. Interdisciplinary approaches that combine molecular tools with biogeochemical processes can effectively\u0026nbsp;explore unknown functions emerging from holobionts. In fact, recent research has shown the pivotal role of the symbiotic association between invertebrates and bacteria in driving several\u0026nbsp;biogeochemical processes at the ecosystem level. For example, corals, sponges, and oysters, as holobionts, participate in the carbon and nitrogen cycles [5-11] proposed that nitrogen fixation compensates for the low heterotrophic nitrogen uptake in autotrophic corals. Siboni et al. [12] suggested a coupling of nitrification and denitrification, ultimately producing dinitrogen to remove nitrogen from the coral holobiont. Further, Arfken et al. [5] found bacteria carrying functional denitrification genes in oysters, facilitating nitrogen removal in oyster reefs. Other associations, such as those between echinoderms and bacteria, have been studied in the search for new antimicrobial compounds [13,14], but little is known about the role of the echinoderm holobionts in biogeochemical processes in marine ecosystems.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHolothuria tubulosa\u003c/em\u003e (Gmelin, 1790) is an echinoderm of the class Holothuroidea, commonly known as sea cucumbers. Holothurians are benthic organisms usually found at the rock-sand interface of coastal zones [15]. They are sediment-eaters, playing an important role in the recycling of organic matter and bioturbation [16,17]. Recent studies have shown that holothurians can serve as extractive species in integrated multi-trophic aquaculture systems, effectively reducing ammonium, nitrates, transparent exopolymer particles, bacteria, and chromophoric dissolved organic matter in seawater [18,19].\u0026nbsp;Several echinoderm species\u0026nbsp;possess a subcuticular layer of bacteria [20]. These subcuticular bacteria have been visualized using fluorescence confocal and electron microscopy in various species of echinoderms, demonstrating that it is a widespread phenomenon, present in approximately 60% of the studied echinoderms [20, 21]. Regarding their diversity, Lawrence et al. [22] were pioneers in applying molecular tools to characterize these bacteria, identifying four different groups through phylogenetic analysis of the 16S rRNA gene, all belonging to the Alpha- and Gammaproteobacteria. Later, massive sequencing techniques have been applied to the study of the subcuticular bacteria of the brittle star \u003cem\u003eAmphipholis squamata\u003c/em\u003e, showing that 70-80% of them belong to the \u003cem\u003eRoseobacter\u003c/em\u003e clade and that the symbiont community is much less diverse than the neighboring water communities of sea and sediment [23]. More recently, Wada et al. [24] showed that\u0026nbsp;a single bacterium exists at high densities in the subcuticular space in \u003cem\u003eAcanthaster planci\u003c/em\u003e forming a biofilm-like structure between the cuticle and the epidermis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDespite the symbiotic relationship between echinoderms and subcuticular bacteria have been recognized for over four decades [25], the potential functions of these bacteria remain largely unexplored.\u0026nbsp;For instance, they could provide direct nutrients to the host, based on the observation of partially digested bacteria within phagosomes of epidermal cells in various holothurians, as well as in asteroid larvae [26,27]. They appear to translocate amino acids from seawater to the host for protein synthesis [28]. Additionally, they could play a relevant role in the early stages (larval development) of the host, helping to absorb labile dissolved organic matter [29,30].\u0026nbsp;On the other hand, holothuroids secrete mucus that coats the cuticle [15] and can contain associated bacteria that ultimately form a microbial biofilm.\u0026nbsp;This kind of biofilm has been studied in corals and Siboni et al. [12] reported the presence of archaea, including marine group II, marine group III, anaerobic methanotrophs, anaerobic nitrate reducers, and ammonia-oxidizing archaea.\u0026nbsp;Subsequently, it is possible that the ammonia-oxidizing archaea as coral symbionts play a role in the N recycling through nitrification and denitrification process [12]. Pogoreut et al. [8] and R\u0026auml;decker et al. [7] have also demonstrated the regulation of environmental nitrogen by the coral holobionts. However, the current knowledge of the composition and the role of subcuticular and biofilm bacteria of holothurians is very limited.\u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study,\u0026nbsp;we\u0026nbsp;delve into the composition of the biofilm and subcuticle\u0026nbsp;microbiomes\u0026nbsp;of \u003cem\u003eH. tubulosa\u0026nbsp;\u003c/em\u003eby the partial amplification and massive sequencing of the 16S rRNA gene.\u003cem\u003e\u0026nbsp;\u003c/em\u003e Through a complementary analysis, we aim to unravel the presence of key genes associated with nitrification (i.e., bacterial \u003cem\u003eamoA\u0026nbsp;\u003c/em\u003eand archaeal \u003cem\u003eamoA\u003c/em\u003e) and denitrification (i.e., \u003cem\u003enirS\u0026nbsp;\u003c/em\u003eand \u003cem\u003enosZ\u003c/em\u003e). By shedding light on the potential participation of subcuticular and biofilm bacteria in the nitrogen cycle, we offer insights into the ecological implications of these holobionts in marine coastal ecosystems. This investigation not only advances our understanding of the echinoderm symbionts, but also highlights the broader significance of holobionts in shaping nutrient cycling at the ecosystem level.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eSample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe collected eight individuals of \u003cem\u003eH. tubulosa\u003c/em\u003e from the coast of Granada, Spain (36\u0026deg;42\u0026apos;10.1\u0026quot;N 3\u0026deg;24\u0026apos;42.7\u0026quot;W) by scuba diving at depths from 5 to 15 m. Once collected, we transferred them to an aquarium until sampling. We collected the biofilm samples using sterile swabs and the subcutaneous samples using a biopsy punch in areas where the biofilm had previously been removed to avoid the transference of biofilm bacteria to subcuticle samples. From each holothurian, we collected a single biofilm sample and two replicate samples from subcutaneous punch biopsies. From the aquarium, we also collected samples of sediments and water that was subsequently filtered through 0.22 \u0026mu;m polycarbonate filters for comparison purposes. We preserved all samples in saline buffer (0.75M saccharose, 0.05M TRIS, 0.02M EDTA and 0.4M NaCl) until DNA extraction. DNA extractions were performed using the DNeasy Powersoil Kit (Qiagen).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing and data analysis\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe used Illumina Next Generation Sequencing to obtain sequences of the V3-V4 hypervariable region of the 16S rRNA gene amplified with primers 341F \u0026quot;CCTACGGGGGNGGGGCWGCAG\u0026quot; and 805R \u0026quot;GACTACHVGGGGGTATCTAATCC\u0026quot; using Macrogen facilities. The 8 biofilm samples passed the quality control and from the subcuticle samples 11 out of the 16 samples passed the quality control. \u0026nbsp;The 5 samples that did not pass the quality control were replicates, then we have at least one biofilm and one subcuticular sample of each individual. The water and sediment samples also passed the quality\u0026nbsp;control. The sequences are available in GenBank Bioproject PRJNA1003448 (https://www.ncbi.nlm.nih.gov/genbank/). We processed the data using the \u003cem\u003eDADA2\u003c/em\u003e R-package [31] installed in R [32]. The DADA2 protocol clusters reads into unique sequences termed Amplicon Sequence Variants (ASVs). \u0026nbsp;Primers were removed using the \u003cem\u003eCutadapt v2.10\u003c/em\u003e R-package [33]. Raw sequences underwent quality control following standard filtration parameters and chimera removal. We performed taxonomic assignment of the ASVs using the \u003cem\u003eassignTaxonomy\u003c/em\u003e function of the \u003cem\u003eDADA2\u003c/em\u003e R-package and using SILVA SSU v.138.1 [34] as a reference database. We rarefied the data to the minimum number of reads and randomizing 100 times using the function \u003cem\u003errarefy\u003c/em\u003e of the R-package \u003cem\u003evegan\u003c/em\u003e [35].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo compare the dissimilarities in the composition of ASVs within subcuticular, biofilm, water, and sediment communities, we employed a Non-Metric Multidimensional Scaling (NMDS) ordination model based on the Bray-Curtis index of the R-package \u003cem\u003evegan\u003c/em\u003e [35]. Given that the NMDS model\u0026apos;s ordination is contingent on the initial configuration of communities in multidimensional space, we iteratively executed the model though 1000 permutations to identify the ordination with the optimal goodness of fit [35]. Lastly, we determined the location of the centroid associated with the subcuticular communities and the biofilm, and we examined the 95% Confidence Interval (CI) tied to their location in the multidimensional space. To ascertain the 95% CI around the centroids, we employed the \u003cem\u003eordihull\u0026nbsp;\u003c/em\u003efunction from the R-package \u003cem\u003evegan\u0026nbsp;\u003c/em\u003e[35].\u003c/p\u003e\n\u003cp\u003eFinally, we compared the diversity between communities associated with the subcuticle and the biofilm using the Chao1 and Simpson\u0026apos;s inverse indices with the functions \u003cem\u003echao1\u0026nbsp;\u003c/em\u003eand \u003cem\u003ediversity\u003c/em\u003e of the R-packages \u003cem\u003efossil\u0026nbsp;\u003c/em\u003e[36] and \u003cem\u003evegan\u0026nbsp;\u003c/em\u003e[35], respectively. During our data exploration process, we observed that the richness measures (Chao1) did not conform to the normality assumptions required for parametric tests. Therefore, for comparisons between subcuticular and biofilm samples, we implemented a Mann-Whitney-Wilcoxon test to compare the medians of each group. The diversity measures (Simpson\u0026apos;s inverse) fulfilled the criteria for parametric tests, prompting us to utilize a one-way ANOVA test to compare the means of each group. Both the Mann-Whitney-Wilcoxon and ANOVA tests were conducted using the \u003cem\u003ewilcox.test\u003c/em\u003e and \u003cem\u003eanova\u003c/em\u003e functions owithin the R software [32].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTesting the occurrence of functional genes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst, we used the Functional Annotation of Prokaryotic Taxa (FAPROTAX) software [37] to envisage the functions that could be performing the holothurian symbionts. Secondly, we explored the functional genes involved in the nitrogen cycle using PCR tests. We tested the functional genes bacterial \u003cem\u003eamoA\u003c/em\u003e and archaeal \u003cem\u003eamoA\u003c/em\u003e that encode the catalytic subunit A of ammonium monooxygenase, which catalyse the oxidation of ammonium to nitrite in the nitrification process. Furthermore, we tested the functional genes \u003cem\u003enirS\u003c/em\u003e and \u003cem\u003enosZ\u003c/em\u003e involved in denitrification. The \u003cem\u003enirS\u003c/em\u003e gene encodes the nitrite reductase which catalyses the transformation of nitrite into NO and the \u003cem\u003enosZ\u003c/em\u003e gene encodes the nitrous oxide reductase which is responsible for the reduction of N\u003csub\u003e2\u003c/sub\u003eO to N\u003csub\u003e2\u003c/sub\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe PCR reactions contained 12.5 \u0026micro;L of OneTaq\u0026reg; 2X Master Mix with Standard Buffer (NewEngland BioLabs Inc.), 1 \u0026micro;L at 10 \u0026micro;M of each primer, and 1 \u0026micro;L of template DNA and 9.5 \u0026micro;L of Milli-Q water. Thermocycling parameters were as follows: initial denaturation at 45 \u0026ordm;C for 3 min, followed by 35 cycles of denaturation at 94 \u0026ordm;C for 30 seconds, annealing temperatures are available for each gene in Table 1, elongation at 68 \u0026ordm;C for 30 seconds, and finally, elongation at 68 \u0026ordm;C 5 min. In Table 1, we also included the primers\u0026apos; details and positive controls. We visualized the PCR results on 2% agarose gel electrophoresis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eDescription of subcuticular and biofilm microbiomes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe number of reads of the V3-V4 16S rRNA gene amplicons per sample ranged from 35,876 to 60,648, obtaining\u0026nbsp;a total of 9,172 ASVs. The rarefaction curves show that a normalization to\u0026nbsp;35,876 reads was\u0026nbsp;appropriate to determine the ASVs richness (Supplementary information Fig. S1). After the random normalisation, the number of ASVs in the subcuticle samples ranged between 269 and 910, and in the biofilm ranged from 266 to 1854. The number of ASVs in the water and sediment samples were 149 and 205 respectively (Supplementary information Table S1).\u003c/p\u003e\n\u003cp\u003eThe relative contribution of different bacterial taxa in the microbiome of the subcuticle (Fig. 1 a) and biofilm (Fig. 1 b) samples were substantially different from water and sediment samples. The most relevant taxonomic groups found in the subcuticle and biofilm samples were the Bacteroidota phylum, and the Alphaproteobacteria and Gammaproteobacteria classes. Within the Alphaproteobacteria, the ASVs of the order Rhodobacterales contribute about 10% of the total abundance. Within the Gammaproteobacteria, the order Pseudomonadales was prevalent accounting for 14% on average. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo discern the specificity level of the biofilm and subcuticle microbiomes, we analyzed the ASVs present exclusively in each sample type. We found more exclusive ASVs in the subcuticle than in the biofilms (Fig. 2). In the subcuticle samples, the exclusive ASVs usually accounted for more than 25% of the total (Fig. 2 a), whereas in the biofilm samples, the exclusive ASVs accounted for less than 25% of the total (Fig. 2 b).\u003c/p\u003e\n\u003cp\u003eThe NMDS ordination model based on the ASV composition across sampled communities showed a high goodness of fit between the distances in the ordination against the original data (linear fit R\u003csup\u003e2\u003c/sup\u003e = 0.9, nonmetric fit R\u003csup\u003e2\u003c/sup\u003e = 0.9). The NMDS model showed a clustering that clearly discriminates between subcuticle and biofilm communities, being in both cases also different from sediment and seawater communities (Fig. 3). \u0026nbsp;Therefore, these results support those derived from our taxonomic analyses, underscoring differences in the microbiomes associated with distinct sections of the holothurian body.\u003c/p\u003e\n\u003cp\u003eWe estimated the ASVs richness using the Chao 1 index (Fig. 4 a). Notably, the biofilm showed a higher richness than the subcuticle (Mann-Whitney-Wilcoxon test W=13, p-value = 0.009**). We also estimated the diversity using the Inverse Simpson index (Fig. 4 b) and the biofilm significantly exceeding the subcuticle in diversity (df= 17, F=4.66, p-value = 0.045*). This result indicates a higher diversity in the biofilm than in the subcuticle.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunctional profile\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe envisaged the putative functional profiles of the holothurian symbionts based on the taxa identified in the samples using Functional Annotation of Prokaryotic Taxa (FAPROTAX) [37]. Comprehensively, the predicted functions are chemoheterotrophy, functions related to the nitrogen cycle, degradation of aromatic compounds in subcuticle samples, dark oxidation of sulfur, fermentation, photoheterotrophy, and photoautotrophy. In the case\u0026nbsp;of the functions related to the nitrogen cycle, we observed the potential for denitrification of nitrate, nitrite, and nitrous oxide both in subcuticular and biofilm samples. Given that FAPROTAX suggests that holothurian microbiomes have taxa with the potential to be involved in N cycle, we performed a search of well-known taxa associated with N cycling in the subcuticular and biofilm dataset (Table 2).\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo corroborate the presence (or absence) of key functional genes involved in nitrogen cycle, we used PCR amplifications of the functional genes for nitrification (bacterial a\u003cem\u003emoA\u003c/em\u003e and archaeal \u003cem\u003eamoA\u003c/em\u003e) and denitrification (\u003cem\u003enirS\u003c/em\u003e and \u003cem\u003enosZ\u003c/em\u003e), and. We were unable to detect the presence of the functional genes bacterial \u003cem\u003eamoA\u003c/em\u003e and archaeal \u003cem\u003eamoA\u003c/em\u003e. We did not observe a clear amplification of the \u003cem\u003enirS\u003c/em\u003e gene in the subcuticle samples (Fig. 5 a and b), but we observed an evident amplification in 7 out of 8 biofilm samples (Fig. 5 c), and in water and sediment samples. Like for \u003cem\u003enirS\u003c/em\u003e, we did not observe amplification of the \u003cem\u003enosZ\u003c/em\u003e gene in any of the samples from the subcuticle or their respective replicas (Fig. 5 d and e). However, we observed an evident amplification of the \u003cem\u003enosZ\u003c/em\u003e gene in the 8 biofilm samples (Fig. 5 f), and in the sediment sample.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCurrently, there is evidence that all the classes of the phylum Echinodermata host subcuticular bacteria. Although the presence of these bacteria in the Holothuroidea class supposed to be less common according to the study by Kelly \u0026amp; McKenzie [20], where only 39% of the surveyed holothurian species hosted subcuticular bacteria. With the present study, we confirm the presence of these subcuticular bacteria in \u003cem\u003eHolothuria tubulosa\u003c/em\u003e, a fact that had not been reported previously. \u0026nbsp;Remarkably, we found a higher ASV exclusivity and lower richness and diversity in the subcuticle samples than in the biofilm samples. In the biofilm samples, we found evidence of denitrification genes suggesting a potential function of the holothurian holobionts in the nitrogen cycle providing a service in coastal marine ecosystems.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSubcuticular and biofilm microbiomes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChiarello et al. [38] studied the surface microbiomes of some echinoderms, among other taxa, and concluded that more than 90% of their prokaryotic phylogenetic richness was unique. \u0026nbsp;In the case of the phylum Porifera, the microbiome richness varies widely among different host species and the complexity (assessed by the number of operative taxonomic units (OTUs)) ranges from 50 to 3,820 symbionts genetically distinct per host [39]. Recent studies show that different species of echinoderms harbor rich and diverse microbiomes and the Bacteroidota phylum and Alphaproteobacterial class predominate [40], as we have also seen in our samples. Our ASVs exclusivity and ordination analyses confirm that the bacteria associated with distinct parts of the body are different from each other, as well as different from the bacteria coming from the water and sediments (Fig. 2 and 3). \u0026nbsp;Hence, we can assert that there is a site-specific (subcuticle vs. biofilm) selection of the bacterial community. The process by which echinoderms acquire subcuticular bacteria remains largely unknown. There is evidence of vertical transmission from the parent to the incubated embryo in brittle stars [23]. Although a transmission from the environment has been also previously proposed by Walker \u0026amp; Lesser [30]. In fact, Schuh et al. [41] indicates that larvae acquire most of their bacterial load after the onset of feeding.\u0026nbsp;We observed that the subcuticle samples in \u003cem\u003eHolothuria tubulosa\u003c/em\u003e presented a richness and diversity values higher than those reported in other echinoderms such as sea stars. Wada et al. [24] found that in \u003cem\u003eAcanthaster planci\u003c/em\u003e there was a 61.8% predominance of a single Operational Taxonomic Unit (OTU COTS27 affiliated to the phylum Spirochaetes). Concerning the biofilm microbiome, it remains uncertain whether bacterial acquisition is related to the surrounding environment or if there is an active selection by the host. Our NMDS ordination (Fig. 3) indicates that the bacterial community of the biofilm is closer to the bacterial community of the sediments than the subcuticular bacteria. \u0026nbsp;Overall, the subcuticular bacteria suggest a host-specificity signature, whereas the biofilm bacteria seem to have more influence from the environment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePotential functions at the holobiont and ecosystem levels\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe microbiomes associated with marine invertebrates can perform different functions or services from the perspectives of both the host and the ecosystem. The relationship between host and microbiome\u0026nbsp;can be nutritional through the supply of certain nutrients or defensive concerning strains with antimicrobial capacity [42,18]. For instance, indirect evidence suggests that the endosymbiont bacteria of some echinoderms can take up dissolved amino acids [43-46]. In the case of the brittle star \u003cem\u003eAmphipholis squamata\u003c/em\u003e, it has been observed that subcuticular bacteria can absorb dissolved amino acids for the synthesis of proteins that are later translocated to the host [28]. Some investigators have also suggested that subcuticular bacteria can metabolize dissolved organic matter [25,30].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAt the ecosystem level, the symbiosis between bacteria and marine invertebrates such as corals, sponges, and oysters can participate in the nitrogen cycle [5,7,47,48]. However, it is unknown the role of echinoderm microbiomes in this cycle. Our results using FAPROTAX suggest that the echinoderm microbiomes include taxa with putative functions associated to the nitrogen cycle (Table 2). By analyzing the data obtained from the 16S rRNA gene sequencing, we observed that several genera of the Nitrosomonadaceae family appeared in the samples, whose cultivated representatives are ammonium oxidizing bacteria (AOB) [49]. Among the representatives of this family, we found \u003cem\u003eNitrosospira\u003c/em\u003e, \u003cem\u003eNitrosomonas\u003c/em\u003e, oc32, DSSD61, and unclassified ASVs belonging to the Nitrosomonadacea. Concerning AOB, we identified the presence of two genera (AqS1 and Cm1-21) and unclassified ASVs belonging to the Nitrosococcaceae [50].\u0026nbsp;We also detected nitrite-oxidizing bacteria (NOB), such as \u003cem\u003eNitrospina\u003c/em\u003e, \u003cem\u003eNitrolancea\u003c/em\u003e, and \u003cem\u003eNitrospira\u003c/em\u003e [51,52]. Some members of the \u003cem\u003eNitrospira\u003c/em\u003e genus, in addition to oxidizing nitrite, can carry out complete nitrification (comammox bacteria) [53-55]. We also detected denitrifying bacteria like, for instance, \u003cem\u003eMethylophaga nitratireducenticrescens\u003c/em\u003e in the biofilm. Mauffrey et al. [56] also detected these bacteria in aquaria and determined that they carry out complete denitrification (Auclair \u003cem\u003eet al.,\u003c/em\u003e 2010). We also detected bacteria of the \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eBacillus\u003c/em\u003e genera. It is known that these genera can reduce nitrate in microzones with low oxygen concentrations in the upper layer of sediments (Hargreaves, 1998). Furthermore, we observed the presence of the genera \u003cem\u003eWoesia\u003c/em\u003e. Mu\u0026szlig;mann et al. [57] studied the metagenome of some \u003cem\u003eWoesia\u003c/em\u003e strains and observed that possibly perform denitrification producing N\u003csub\u003e2\u003c/sub\u003eO. Finally, we also observed \u003cem\u003ePseudohongiella nitratireducens\u0026nbsp;\u003c/em\u003ewhich can reduce nitrate [58].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDespite the results obtained by FAPROTAX and the detailed study of the sequences, we were unable to confirm the occurrence of the nitrification genes archaeal \u003cem\u003eamoA\u0026nbsp;\u003c/em\u003eand bacterial \u003cem\u003eamoA\u0026nbsp;\u003c/em\u003eusing PCR. This could be due to these functional genes falling below our detection threshold and their low prevalence in the total ASVs. However, we successfully confirmed the presence of denitrification genes \u003cem\u003enirS\u0026nbsp;\u003c/em\u003eand \u003cem\u003enosZ\u0026nbsp;\u003c/em\u003e(which encode nitrite reductase and nitrous oxide reductase, respectively) in the biofilms of \u003cem\u003eH. tubulosa\u003c/em\u003e for the first time, using PCR. Future studies should aim to quantify the abundance of these genes (qPCR and dd-PCR) and denitrification rates. In addition, the conditions (i.e., nitrogen and oxygen concentrations) in which denitrification occurs could be key to determine the balance between denitrification products (i.e., N\u003csub\u003e2\u003c/sub\u003eO and N\u003csub\u003e2\u003c/sub\u003e). Quantifying this N removal by the holothurian holobionts can be of great interest to the conservation of marine ecosystems. While\u0026nbsp;ammonium, nitrite, and nitrate are present in nature, human activities have significantly altered the nitrogen cycle, increasing their availability [59,60] and thus, inducing coastal eutrophication [61]. Overall, the anthropogenic nitrogen represents a serious problem in coastal ecosystems, since this element usually is the limiting resource in marine systems producing phytoplankton blooms [62]. One of these human activities is related to aquaculture discharges [63]. Our data suggests the ability of \u003cem\u003eH. tubulosa\u003c/em\u003e microbiome to reduce nitrogen concentrations, emphasizing its high intrinsic value as extractive species in integrated multitrophic aquaculture. Moreover, knowing deeply about the microbiomes of these organisms could be relevant due to their multiple functionalities beyond denitrification and nitrification.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Junta de Andaluc\u0026iacute;a, Consejer\u0026iacute;a de Transformaci\u0026oacute;n Econ\u0026oacute;mica, Industria, Conocimiento y Universidades (grant no. P20.00705), and the European Regional Development Fund (ERDF). Silke Mart\u0026iacute;nez-Moreno was supported by a predoctoral fellowship (grant no.\u0026nbsp;PREDOC_01315) from the Junta de Andaluc\u0026iacute;a Consejer\u0026iacute;a de Transformaci\u0026oacute;n Econ\u0026oacute;mica, Industria, Conocimiento y Universidades.\u0026nbsp;Ana M. Cabello was supported by a technical support staff contract from the Agencia Estatal de Investigaci\u0026oacute;n (PTA2018-016205-I).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo approval of research ethics committees was required to accomplish the goals of this study because experimental work was conducted with an unregulated invertebrate species.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study did not involve human subjects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors give their consent to allow this manuscript to be published by the journal of Microbial Ecology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated in the current study are available in GenBank Bioproject PRJNA1003448 (https://www.ncbi.nlm.nih.gov/genbank/). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIsabel Reche and Isabel Ferrera conceived the study and Silke Mart\u0026iacute;nez-Moreno contributed to the design. The sampling was performed by Silke Mart\u0026iacute;nez-Moreno and H\u0026eacute;ctor Pula. Laboratory analyses were performed by Silke Mart\u0026iacute;nez-Moreno; analyses of the metagenomic data were conducted by Silke Mart\u0026iacute;nez-Moreno, Ana Mar\u0026iacute;a Cabello, and Elizabeth Le\u0026oacute;n-Palmero. Silke Mart\u0026iacute;nez-Moreno wrote the first draft of the manuscript. Isabel Reche and Isabel Ferrera contributed substantially to manuscript drafting and funding acquisition. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the Aula del Mar of the University of Granada for sharing their facilities where part of the experimental work was performed. We also thank Dr. Ignacio Peralta-Maraver for his help with statistics analysis. Computing analyses were performed in the Picasso Supercomputer at the University of M\u0026aacute;laga. This work was supported by the Junta de Andaluc\u0026iacute;a, Consejer\u0026iacute;a de Transformaci\u0026oacute;n Econ\u0026oacute;mica, Industria, Conocimiento y Universidades (grant no. P20.00705) and the European Regional Development Fund (ERDF). Silke Mart\u0026iacute;nez-Moreno was supported by a predoctoral fellowship (grant no. PREDOC_01315) from the Junta de Andaluc\u0026iacute;a Consejer\u0026iacute;a de Transformaci\u0026oacute;n Econ\u0026oacute;mica, Industria, Conocimiento y Universidades and Ana M. Cabello was supported by a technical support staff contract from the Agencia Estatal de Investigaci\u0026oacute;n (PTA2018-016205-I).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eTheis, K. R., Dheilly, N. M., Klassen, J. L., Brucker, R. M., Baines, J. F., Bosch, T. C. G., Cryan, J. F., Gilbert, S. F., Goodnight, C. J., Lloyd, E. A., Sapp, J., Vandenkoornhuyse, P., Zilber-Rosenberg, I., Rosenberg, E., \u0026amp; Bordenstein, S. R. (2016). Getting the Hologenome Concept Right: An Eco-Evolutionary Framework for Hosts and Their Microbiomes. mSystems, 1(2), e00028-16. https://doi.org/10.1128/mSystems.00028-16\u003c/li\u003e\n \u003cli\u003eBordenstein, S. R., \u0026amp; Theis, K. R. (2015). Host Biology in Light of the Microbiome: Ten Principles of Holobionts and Hologenomes. PLOS Biology, 13(8), e1002226. https://doi.org/10.1371/journal.pbio.1002226\u003c/li\u003e\n \u003cli\u003eSimon, J.-C., Marchesi, J. R., Mougel, C., \u0026amp; Selosse, M.-A. (2019). Host-microbiota interactions: From holobiont theory to analysis. Microbiome, 7(1), 5. https://doi.org/10.1186/s40168-019-0619-4\u003c/li\u003e\n \u003cli\u003eSchuster, S. C. (2008). Next-generation sequencing transforms today\u0026rsquo;s biology. Nature Methods, 5(1), Article 1. https://doi.org/10.1038/nmeth1156\u003c/li\u003e\n \u003cli\u003eArfken, A., Song, B., Bowman, J. S., \u0026amp; Piehler, M. (2017). Denitrification potential of the eastern oyster microbiome using a 16S rRNA gene based metabolic inference approach. PLOS ONE, 12(9), e0185071. https://doi.org/10.1371/journal.pone.0185071\u003c/li\u003e\n \u003cli\u003eGlaze, T. D., Erler, D. V., \u0026amp; Siljanen, H. M. P. (2022). Microbially facilitated nitrogen cycling in tropical corals. The ISME Journal, 16(1), Article 1. https://doi.org/10.1038/s41396-021-01038-1\u003c/li\u003e\n \u003cli\u003eR\u0026auml;decker, N., Pogoreutz, C., Voolstra, C. R., Wiedenmann, J., \u0026amp; Wild, C. (2015). Nitrogen cycling in corals: The key to understanding holobiont functioning? Trends in Microbiology, 23(8), 490-497. https://doi.org/10.1016/j.tim.2015.03.008\u003c/li\u003e\n \u003cli\u003ePogoreutz, C., R\u0026auml;decker, N., C\u0026aacute;rdenas, A., G\u0026auml;rdes, A., Wild, C., \u0026amp; Voolstra, C. R. (2017). Nitrogen Fixation Aligns with nifH Abundance and Expression in Two Coral Trophic Functional Groups. Frontiers in Microbiology, 8. https://doi.org/10.3389/fmicb.2017.01187\u003c/li\u003e\n \u003cli\u003ePita, L., Rix, L., Slaby, B. M., Franke, A., \u0026amp; Hentschel, U. (2018). The sponge holobiont in a changing ocean: From microbes to ecosystems. Microbiome, 6(1), 46. https://doi.org/10.1186/s40168-018-0428-1\u003c/li\u003e\n \u003cli\u003eDe Goeij, J. M., \u0026amp; van Duyl, F. C. (2007).\u0026nbsp;Coral cavities are sinks of dissolved organic carbon (DOC). Limnology and Oceanography, 52(6), 2608-2617. https://doi.org/10.4319/lo.2007.52.6.2608\u003c/li\u003e\n \u003cli\u003ede Goeij, J. M., van Oevelen, D., Vermeij, M. J. A., Osinga, R., Middelburg, J. J., de Goeij, A. F. P. M., \u0026amp; Admiraal, W. (2013).\u0026nbsp;Surviving in a Marine Desert: The Sponge Loop Retains Resources Within Coral Reefs. Science, 342(6154), 108-110. https://doi.org/10.1126/science.1241981\u003c/li\u003e\n \u003cli\u003eSiboni, N., Ben-Dov, E., Sivan, A., \u0026amp; Kushmaro, A. (2008).\u0026nbsp;Global distribution and diversity of coral-associated Archaea and their possible role in the coral holobiont nitrogen cycle. Environmental Microbiology, 10(11), 2979-2990. https://doi.org/10.1111/j.1462-2920.2008.01718.x\u003c/li\u003e\n \u003cli\u003eKiani, N., Heidari, B., Rassa, M., Kadkhodazadeh, M., \u0026amp; Heidari, B. (2014). Antibacterial activity of the body wall extracts of sea cucumber (Invertebrata; Echinodermata) on infectious oral streptococci. \u003cem\u003eJournal of basic and clinical physiology and pharmacology,\u003c/em\u003e 25(4), 367-373. https://doi.org/10.1515/jbcpp-2013-0010\u003c/li\u003e\n \u003cli\u003eLe\u0026oacute;n-Palmero, E., Joglar, V., \u0026Aacute;lvarez, P. A., Mart\u0026iacute;n-Platero, A., Llamas, I., \u0026amp; Reche, I. (2018).\u0026nbsp;Diversity and antimicrobial potential in sea anemone and holothurian microbiomes. \u003cem\u003ePloS one,\u003c/em\u003e 13(5), e0196178. https://doi.org/10.1371/journal.pone.0196178\u003c/li\u003e\n \u003cli\u003eOca\u0026ntilde;a, M., Tocino, L. S., L\u0026oacute;pez Gonz\u0026aacute;lez, S., \u0026amp; Viciana Mart\u0026iacute;n, J. (2000). \u003cem\u003eGu\u0026iacute;a submarina de invertebrados no artr\u0026oacute;podos.\u003c/em\u003e Editorial Comares.\u003c/li\u003e\n \u003cli\u003ePurcell, S. W., Mercier, A., Conand, C., Hamel, J.-F., Toral-Granda, M. V., Lovatelli, A., \u0026amp; Uthicke, S. (2013). Sea cucumber fisheries: Global analysis of stocks, management measures and drivers of overfishing. Fish and Fisheries, 14(1), 34-59. https://doi.org/10.1111/j.1467-2979.2011.00443.x\u003c/li\u003e\n \u003cli\u003eUthicke, S. (1999). Sediment bioturbation and impact of feeding activity of Holothuria (Halodeima) atra and Stichopus chloronotus, two sediment feeding holothurians, at Lizard Island, Great Barrier Reef. Bulletin of Marine Science, 64(1), 129-141.\u003c/li\u003e\n \u003cli\u003eSadeghi-Nassaj, S. M., Catala, T. S., Alvarez, P. A., \u0026amp; Reche, I. (2018)a. Sea cucumbers reduce chromophoric dissolved organic matter in aquaculture tanks. \u003cem\u003ePeerj,\u003c/em\u003e 6, e4344. doi:10.7717/peerj.4344. https://doi.org/10.7717/peerj.4344\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eSadeghi‐Nassaj, S. M., Batanero, G. L., Mazuecos, I. P., Alonso, C., \u0026amp; Reche, I. (2018)b. Sea cucumbers reduce nitrogen, bacteria and transparent exopolymer particles in Anemonia sulcata aquaculture tanks. \u003cem\u003eAquaculture Research,\u003c/em\u003e 49(11), 3669-3681. https://doi.org/10.1111/are.13836\u003c/li\u003e\n \u003cli\u003eKelly, M., \u0026amp; McKenzie, J. (1995). Survey of the occurrence and morphology of sub-cuticular bacteria in shelf echinoderms from the north-east Atlantic Ocean. \u003cem\u003eMarine Biology,\u003c/em\u003e 123(4), 741-756. https://doi.org/10.1007/BF00349117\u003c/li\u003e\n \u003cli\u003eMcKenzie, J. D., \u0026amp; Kelly, M. S. (1994). Comparative study of sub-cuticular bacteria in brittlestars (Echinodermata: Ophiuroidea). Marine Biology, 120(1), 65-80. https://doi.org/10.1007/BF00381943\u003c/li\u003e\n \u003cli\u003eLawrence, S. A., O\u0026rsquo;Toole, R., Taylor, M. W., \u0026amp; Davy, S. K. (2010). Subcuticular Bacteria Associated With Two Common New Zealand Echinoderms: Characterization Using 16S rRNA Sequence Analysis and Fluorescence in situ Hybridization. The Biological Bulletin, 218(1), 95-104. https://doi.org/10.1086/BBLv218n1p95\u003c/li\u003e\n \u003cli\u003eMorrow, K. M., Tedford, A. R., Pankey, M. S., \u0026amp; Lesser, M. P. (2018). A member of the Roseobacter clade, Octadecabacter sp., is the dominant symbiont in the brittle star Amphipholis squamata. FEMS Microbiology Ecology, 94(4), fiy030. https://doi.org/10.1093/femsec/fiy030\u003c/li\u003e\n \u003cli\u003eWada, N., Yuasa, H., Kajitani, R., Gotoh, Y., Ogura, Y., Yoshimura, D., Toyoda, A., Tang, S.-L., Higashimura, Y., Sweatman, H., Forsman, Z., Bronstein, O., Eyal, G., Thongtham, N., Itoh, T., Hayashi, T., \u0026amp; Yasuda, N. (2020). A ubiquitous subcuticular bacterial symbiont of a coral predator, the crown-of-thorns starfish, in the Indo-Pacific. Microbiome, 8(1), 123. https://doi.org/10.1186/s40168-020-00880-3\u003c/li\u003e\n \u003cli\u003eHolland, N. D., \u0026amp; Nealson, K. H. (1978). The Fine Structure of the Echinoderm Cuticle and the Subcuticular Bacteria of Echinoderms. Acta Zoologica, 59(3-4), 169-185. https://doi.org/10.1111/j.1463-6395.1978.tb01032.x\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Roberts, D., Billett, D. S. M., McCartney, G., \u0026amp; Hayes, G. E. (1991). Procaryotes on the tentacles of deep-sea holothurians: A novel form of dietary supplementation. Limnology and Oceanography, 36(7), 1447-1451. https://doi.org/10.4319/lo.1991.36.7.1447\u003c/li\u003e\n \u003cli\u003eBosch, I. (1992). Symbiosis between bacteria and oceanic clonal sea star larvae in the western North Atlantic Ocean. Marine Biology, 114(3), 495-502. https://doi.org/10.1007/BF00350041\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Lesser, M. P., \u0026amp; Walker, C. W. (1992). Comparative study of the uptake of dissolved amino acid in sympatric brittle stars with and without endosymbiotic bacteria. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 101(1), 217-223. https://doi.org/10.1016/0305-0491(92)90182-Q\u003c/li\u003e\n \u003cli\u003eFontaine, A. R., \u0026amp; Chia, F.-S. (1968). Echinoderms: An Autoradiographic Study of Assimilation of Dissolved Organic Molecules. Science, 161(3846), 1153-1155. https://doi.org/10.1126/science.161.3846.1153\u003c/li\u003e\n \u003cli\u003eWalker, C. W., \u0026amp; Lesser, M. P. (1989). Nutrition and development of brooded embryos in the brittlestar Amphipholis squamata: Do endosymbiotic bacteria play a role? Marine Biology, 103(4), 519-530. https://doi.org/10.1007/BF00399584\u003c/li\u003e\n \u003cli\u003eCallahan, B. J., McMurdie, P. J., Rosen, M. J., Han, A. W., Johnson, A. J. A., \u0026amp; Holmes, S. P. (2016). DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods, 13(7), Article 7. https://doi.org/10.1038/nmeth.3869\u003c/li\u003e\n \u003cli\u003eR Core Team (2023). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/\u003c/li\u003e\n \u003cli\u003eMartin, M. (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.Journal, 17(1), Article 1. https://doi.org/10.14806/ej.17.1.200\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., \u0026amp; Gl\u0026ouml;ckner, F. O. (2013). The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Research, 41(D1), D590-D596. https://doi.org/10.1093/nar/gks1219\u003c/li\u003e\n \u003cli\u003eOksanen, J. (2015). Multivariate analysis of ecological communities in R: vegan tutorial. Retrieved from http://cc.oulu.fi/~jarioksa/opetus/metodi/veg- antutor.pdf Accessed 6 March 2023\u003c/li\u003e\n \u003cli\u003eVavrek, Matthew J. (2011). fossil: Palaeoecological and palaeogeographical analysis tools. Palaeontologia Electronica Vol. 14, Issue1; 1T:16p\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Louca, S., Parfrey, L. W., \u0026amp; Doebeli, M. (2016). Decoupling function and taxonomy in the global ocean microbiome. Science, 353(6305), 1272-1277. https://doi.org/10.1126/science.aaf4507\u003c/li\u003e\n \u003cli\u003eChiarello, M., Auguet, J.-C., Graham, N. A. J., Claverie, T., Sucr\u0026eacute;, E., Bouvier, C., Rieuvilleneuve, F., Restrepo-Ortiz, C. X., Bettarel, Y., Vill\u0026eacute;ger, S., \u0026amp; Bouvier, T. (2020).\u0026nbsp;Exceptional but vulnerable microbial diversity in coral reef animal surface microbiomes. Proceedings of the Royal Society B: Biological Sciences, 287(1927), 20200642. https://doi.org/10.1098/rspb.2020.0642\u003c/li\u003e\n \u003cli\u003eThomas, T., Moitinho-Silva, L., Lurgi, M., Bj\u0026ouml;rk, J. R., Easson, C., Astudillo-Garc\u0026iacute;a, C., Olson, J. B., Erwin, P. M., L\u0026oacute;pez-Legentil, S., Luter, H., Chaves-Fonnegra, A., Costa, R., Schupp, P. J., Steindler, L., Erpenbeck, D., Gilbert, J., Knight, R., Ackermann, G., Victor Lopez, J., \u0026hellip; Webster, N. S. (2016). Diversity, structure and convergent evolution of the global sponge microbiome. Nature Communications, 7(1), Article 1. https://doi.org/10.1038/ncomms11870\u003c/li\u003e\n \u003cli\u003eCrowley, C. A. (2022). Investigating the Microbial Diversity Between Three Species of Atlantic Echinoderms. Clark University.\u003c/li\u003e\n \u003cli\u003eSchuh, N. W., Carrier, T. J., Schrankel, C. S., Reitzel, A. M., Heyland, A., \u0026amp; Rast, J. P. (2020). Bacterial Exposure Mediates Developmental Plasticity and Resistance to Lethal Vibrio lentus Infection in Purple Sea Urchin (Strongylocentrotus purpuratus) Larvae. Frontiers in Immunology, 10. https://www.frontiersin.org/articles/10.3389/fimmu.2019.03014\u003c/li\u003e\n \u003cli\u003eRosenberg, E., Koren, O., Reshef, L., Efrony, R., \u0026amp; Zilber-Rosenberg, I. (2007). The role of microorganisms in coral health, disease and evolution. Nature Reviews Microbiology, 5(5), Article 5. https://doi.org/10.1038/nrmicro1635\u003c/li\u003e\n \u003cli\u003eBrothers, C. J., Lee, R. W., \u0026amp; Nestler, J. R. (2015). The uptake of dissolved organic material by the sea cucumber Parastichopus californicus (Stimpson) and its potential role in visceral regeneration. Journal of Experimental Marine Biology and Ecology, 469, 69-75. https://doi.org/10.1016/j.jembe.2015.04.016\u003c/li\u003e\n \u003cli\u003eDavis, J. P., Stephens, G. C., \u0026amp; Rice, M. A. (1985). Net entry of amino acids into the brittle star Ophionereis annulata. Comparative Biochemistry and Physiology Part A: Physiology, 81(4), 899-903. https://doi.org/10.1016/0300-9629(85)90927-2\u003c/li\u003e\n \u003cli\u003eManahan, D. T., Davis, J. P., \u0026amp; Stephens, G. C. (1983). Bacteria-Free Sea Urchin Larvae: Selective Uptake of Neutral Amino Acids from Seawater. Science, 220(4593), 204-206. https://doi.org/10.1126/science.220.4593.204\u003c/li\u003e\n \u003cli\u003eSiebers, D. (1979). Transintegumentary Uptake of Dissolved Amino Acids in the Sea Star Asterias rubens. A Reassessment of its Nutritional Role with Special Reference to the Significance of Heterotrophic Bacteria. Marine Ecology Progress Series, 1, 169-177. https://doi.org/10.3354/meps001169\u003c/li\u003e\n \u003cli\u003eYang, Z., \u0026amp; Li, Z. (2012). Spatial distribution of prokaryotic symbionts and ammoxidation, denitrifier bacteria in marine sponge Astrosclera willeyana. Scientific Reports, 2(1), Article 1. https://doi.org/10.1038/srep00528\u003c/li\u003e\n \u003cli\u003eMoeller, F. U., Webster, N. S., Herbold, C. W., Behnam, F., Domman, D., Albertsen, M., Mooshammer, M., Markert, S., Turaev, D., Becher, D., Rattei, T., Schweder, T., Richter, A., Watzka, M., Nielsen, P. H., \u0026amp; Wagner, M. (2019). Characterization of a thaumarchaeal symbiont that drives incomplete nitrification in the tropical sponge Ianthella basta. Environmental Microbiology, 21(10), 3831-3854. https://doi.org/10.1111/1462-2920.14732\u003c/li\u003e\n \u003cli\u003eProsser, J. I., Head, I. M., \u0026amp; Stein, L. Y. (2014). The Family Nitrosomonadaceae. The Prokaryotes: Alphaproteobacteria and Betaproteobacteria, 901-918. https://doi.org/10.1007/978-3-642-30197-1_372\u003c/li\u003e\n \u003cli\u003eSemedo, M., Lopes, E., Baptista, M. S., Oller-Ruiz, A., Gilabert, J., Tomasino, M. P., \u0026amp; Magalh\u0026atilde;es, C. (2021). Depth Profile of Nitrifying Archaeal and Bacterial Communities in the Remote Oligotrophic Waters of the North Pacific. Frontiers in Microbiology, 12. https://www.frontiersin.org/articles/10.3389/fmicb.2021.624071\u003c/li\u003e\n \u003cli\u003ePark, S.-J., Andrei, A.-Ş., Bulzu, P.-A., Kavagutti, V. S., Ghai, R., \u0026amp; Mosier, A. C. (2020). Expanded Diversity and Metabolic Versatility of Marine Nitrite-Oxidizing Bacteria Revealed by Cultivation- and Genomics-Based Approaches. Applied and Environmental Microbiology, 86(22), e01667-20. https://doi.org/10.1128/AEM.01667-20\u003c/li\u003e\n \u003cli\u003eSorokin, D. Y., Vejmelkova, D., L\u0026uuml;cker, S., Streshinskaya, G. M., Rijpstra, W. I. C., Sinninghe Damst\u0026eacute;, J. S., Kleerbezem, R., van Loosdrecht, M., Muyzer, G., \u0026amp; Daims, H. (2014). Nitrolancea hollandica gen. Nov., sp. Nov., a chemolithoautotrophic nitrite-oxidizing bacterium isolated from a bioreactor belonging to the phylum Chloroflexi. International Journal of Systematic and Evolutionary Microbiology, 64(Pt_6), 1859-1865. https://doi.org/10.1099/ijs.0.062232-0\u003c/li\u003e\n \u003cli\u003eDaims, H., Lebedeva, E. V., Pjevac, P., Han, P., Herbold, C., Albertsen, M., Jehmlich, N., Palatinszky, M., Vierheilig, J., Bulaev, A., Kirkegaard, R. H., von Bergen, M., Rattei, T., Bendinger, B., Nielsen, P. H., \u0026amp; Wagner, M. (2015). Complete nitrification by Nitrospira bacteria. Nature, 528(7583), Article 7583. https://doi.org/10.1038/nature16461\u003c/li\u003e\n \u003cli\u003ePalomo, A., Jane Fowler, S., G\u0026uuml;lay, A., Rasmussen, S., Sicheritz-Ponten, T., \u0026amp; Smets, B. F. (2016). Metagenomic analysis of rapid gravity sand filter microbial communities suggests novel physiology of Nitrospira spp. The ISME Journal, 10(11), Article 11. https://doi.org/10.1038/ismej.2016.63\u003c/li\u003e\n \u003cli\u003evan Kessel, M. A. H. J., Speth, D. R., Albertsen, M., Nielsen, P. H., Op den Camp, H. J. M., Kartal, B., Jetten, M. S. M., \u0026amp; L\u0026uuml;cker, S. (2015). Complete nitrification by a single microorganism. Nature, 528(7583), Article 7583. https://doi.org/10.1038/nature16459\u003c/li\u003e\n \u003cli\u003eMauffrey, F., Cucaita, A., Constant, P., \u0026amp; Villemur, R. (2017). Denitrifying metabolism of the methylotrophic marine bacterium Methylophaga nitratireducenticrescens strain JAM1. PeerJ, 5, e4098. https://doi.org/10.7717/peerj.4098\u003c/li\u003e\n \u003cli\u003eMu\u0026szlig;mann, M., Pjevac, P., Kr\u0026uuml;ger, K., \u0026amp; Dyksma, S. (2017). Genomic repertoire of the Woeseiaceae/JTB255, cosmopolitan and abundant core members of microbial communities in marine sediments. The ISME Journal, 11(5), Article 5. https://doi.org/10.1038/ismej.2016.185\u003c/li\u003e\n \u003cli\u003eXu, L., Wu, Y.-H., Jian, S.-L., Wang, C.-S., Wu, M., Cheng, L., \u0026amp; Xu, X.-W. (2016). Pseudohongiella nitratireducens sp. Nov., isolated from seawater, and emended description of the genus Pseudohongiella. International Journal of Systematic and Evolutionary Microbiology, 66(12), 5155-5160. https://doi.org/10.1099/ijsem.0.001489\u003c/li\u003e\n \u003cli\u003eGruber, N., \u0026amp; Galloway, J. N. (2008). An Earth-system perspective of the global nitrogen cycle. Nature, 451(7176), Article 7176. https://doi.org/10.1038/nature06592\u003c/li\u003e\n \u003cli\u003eBattye, W., Aneja, V. P., \u0026amp; Schlesinger, W. H. (2017). Is nitrogen the next carbon? Earth\u0026rsquo;s Future, 5(9), 894-904. https://doi.org/10.1002/2017EF000592\u003c/li\u003e\n \u003cli\u003eZhou, Y., Wang, L., Zhou, Y., \u0026amp; Mao, X. (2020). Eutrophication control strategies for highly anthropogenic influenced coastal waters. Science of The Total Environment, 705, 135760. https://doi.org/10.1016/j.scitotenv.2019.135760\u003c/li\u003e\n \u003cli\u003eHowarth, R. W., \u0026amp; Marino, R. (2006). Nitrogen as the limiting nutrient for eutrophication in coastal marine ecosystems: Evolving views over three decades. Limnology and Oceanography, 51(1part2), 364-376. https://doi.org/10.4319/lo.2006.51.1_part_2.0364\u003c/li\u003e\n \u003cli\u003eVizzini, S., Savona, B., Caruso, M., Savona, A., \u0026amp; Mazzola, A. (2005).\u0026nbsp;Analysis of stable carbon and nitrogen isotopes as a tool for assessing the environmental impact of aquaculture: A case study from the western Mediterranean. Aquaculture International, 13(1), 157-165. https://doi.org/10.1007/s10499-004-9023-5\u003c/li\u003e\n \u003cli\u003eBraker, G., Fesefeldt, A., \u0026amp; Witzel, K.-P. (1998). Development of PCR Primer Systems for Amplification of Nitrite Reductase Genes (nirK and nirS) To Detect Denitrifying Bacteria in Environmental Samples. Applied and Environmental Microbiology, 64(10), 3769-3775. https://doi.org/10.1128/AEM.64.10.3769-3775.1998\u003c/li\u003e\n \u003cli\u003eHenry, S., Bru, D., Stres, B., Hallet, S., \u0026amp; Philippot, L. (2006). Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils. Applied and Environmental Microbiology, 72(8), 5181-5189. https://doi.org/10.1128/AEM.00231-06\u003c/li\u003e\n \u003cli\u003eRotthauwe, J. H., Witzel, K. P., \u0026amp; Liesack, W. (1997). The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Applied and Environmental Microbiology, 63(12), 4704-4712. https://doi.org/10.1128/aem.63.12.4704-4712.1997\u003c/li\u003e\n \u003cli\u003eFrancis, C. A., Roberts, K. J., Beman, J. M., Santoro, A. E., \u0026amp; Oakley, B. B. (2005). Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proceedings of the National Academy of Sciences, 102(41), 14683-14688. https://doi.org/10.1073/pnas.0506625102\u003c/li\u003e\n \u003cli\u003eAuclair, J., L\u0026eacute;pine, F., Parent, S., \u0026amp; Villemur, R. (2010). Dissimilatory reduction of nitrate in seawater by a Methylophaga strain containing two highly divergent narG sequences. The ISME Journal, 4(10), Article 10. https://doi.org/10.1038/ismej.2010.47\u003c/li\u003e\n \u003cli\u003eHargreaves, J. A. (1998). Nitrogen biogeochemistry of aquaculture ponds. Aquaculture, 166(3), 181-212. https://doi.org/10.1016/S0044-8486(98)00298-1\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Description of primers used to study functional genes involved in nitrogen cycle, the annealing temperature, the bacterial DNA used as positive controls, and their corresponding references.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"907\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.621145374449338%\"\u003e\n \u003cp\u003e\u003cstrong\u003eProcess\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.775330396475772%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFunctional genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.048458149779734%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.370044052863436%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnnealing\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;(\u0026ordm;C)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.823788546255507%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive control\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.361233480176212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.621145374449338%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eDenitrification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.775330396475772%\"\u003e\n \u003cp\u003e\u003cem\u003enirS\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.048458149779734%\"\u003e\n \u003cp\u003e\u003cem\u003enirS\u003c/em\u003e-1F \u0026ndash; 5\u0026rsquo; \u0026nbsp;CCTAYTGGCCGCCRCART 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003enirS\u003c/em\u003e-3R \u0026ndash; 5\u0026rsquo; \u0026nbsp;GCCGCCGCCGTCRTGVAGGAA 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.370044052863436%\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.823788546255507%\"\u003e\n \u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e transformed with a constructed plasmid containing the \u003cem\u003enirS\u0026nbsp;\u003c/em\u003egene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.361233480176212%\"\u003e\n \u003cp\u003e[64]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.508021390374331%\"\u003e\n \u003cp\u003e\u003cem\u003enosZ\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.903743315508024%\"\u003e\n \u003cp\u003e\u003cem\u003enosZ\u003c/em\u003e1F \u0026ndash; 5\u0026rsquo;\u0026nbsp;WCSYTGTTCMTCGACAGCCAG 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003enosZ\u003c/em\u003e1R \u0026ndash; 5\u0026rsquo; \u0026nbsp;ATGTCGATCARCTGVKCRTTYTC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.16042780748663%\"\u003e\n \u003cp\u003e63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.06417112299465%\"\u003e\n \u003cp\u003e\u003cem\u003eParacoccus denitrificans\u003c/em\u003e (ATCC 17741)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.363636363636363%\"\u003e\n \u003cp\u003e[65]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.621145374449338%\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eNitrification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.775330396475772%\"\u003e\n \u003cp\u003ebacterial \u003cem\u003eamoA\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.048458149779734%\"\u003e\n \u003cp\u003e\u003cem\u003eamoA\u003c/em\u003e-1F \u0026ndash; 5\u0026rsquo; \u0026nbsp;GGGGTTTCTACTACTGGTGGT 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eamoA\u003c/em\u003e-2R \u0026ndash; 5\u0026rsquo; \u0026nbsp;CCCCTCKGSAAAGCCTTCTTC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.370044052863436%\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.823788546255507%\"\u003e\n \u003cp\u003e\u003cem\u003eNitrosomonas europaea\u003c/em\u003e (ATCC 25978)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.361233480176212%\"\u003e\n \u003cp\u003e[66]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.508021390374331%\"\u003e\n \u003cp\u003earchaeal \u003cem\u003eamoA\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.903743315508024%\"\u003e\n \u003cp\u003earch-\u003cem\u003eamoA\u003c/em\u003eF \u0026ndash; 5\u0026rsquo; \u0026nbsp;STAATGGTCTGGCTTAGACG 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003earch-\u003cem\u003eamoA\u003c/em\u003eR \u0026ndash; 5\u0026rsquo; \u0026nbsp;GCGGCCATCCATCTGTATGT 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.16042780748663%\"\u003e\n \u003cp\u003e53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.06417112299465%\"\u003e\n \u003cp\u003e\u003cem\u003eNitrososphaera viennensis\u003c/em\u003e (EN76T)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.363636363636363%\"\u003e\n \u003cp\u003e[67]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 2. Taxa with potential to participate in the N cycle found in the subcuticular and biofilm samples.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSubcuticular\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eBiofilm\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFunction\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReferences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eNitrosospira\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAmmonium oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[49]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eNitrosomonas\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAmmonium oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[49]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eoc32 sp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAmmonium oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[49]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDSSD61\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAmmonium oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[49]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAqS1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAmmonium oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[50]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eCM1-21\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAmmonium oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[50]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNitrospina\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNitrate oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[51]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNitrospira\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNitrate oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[51]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNitrolancea\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNitrate oxidizing bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[51,52]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eMethylophaga nitratireducenticrescens\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDenitrification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[68]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ePseudomonas\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDenitrification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[69]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eBacillus\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDenitrification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[69]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eWoeseia\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDenitrification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[57]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ePseudohongiella\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDenitrification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[58]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003ePseudohongiella nitratireducens\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDenitrification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e[58]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"echinoderm microbiome, biofilm, subcuticular bacteria, holothurian, denitrification ","lastPublishedDoi":"10.21203/rs.3.rs-3469562/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3469562/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Holothurians, as benthic invertebrates inhabiting the marine ecosystems, play a crucial function by actively processing organic detritus in the sediments. Previous works have provided evidence of holothurians capability to reduce nitrate and ammonium concentrations in aquaculture tanks. However, the mechanisms underlying this nitrogen decrease still needs to be elucidated and might be related to bacterial symbionts in the holothurians. Here we characterize the community of bacterial symbionts in the biofilm and subcuticle of Holothuria tubulosa and explored the presence of nitrification and denitrification genes. To characterize these bacterial symbionts, we extracted DNA and amplified the V3-V4 hypervariable region of the 16S rRNA gene. We obtained a notable contribution of Bacteroidota, Alphaproteobacteria (mostly Rhodobacterales), and Gammaproteobacteria (mostly Pseudomonadales) both within the biofilm and subcuticle of H. tubulosa. Subsequently, we tested the presence of specific genes encoding enzymes involved in nitrification (i.e., archaeal amoA and bacterial amoA) and denitrification processes (i.e., nirS and nosZ). Our results confirm the presence of denitrification genes in the holothurian biofilms. These findings indicate that the holothurians house a diverse community of bacterial symbionts, which includes species with the potential for nitrogen removal. Therefore, holothurian holobionts may play a multifaceted ecological role, both processing organic detritus and reducing nitrogen levels in coastal areas. These roles could be extended to sustainable aquaculture, making them valuable ecosystem engineers with significant implications for ecosystem and aquaculture health.","manuscriptTitle":"Subcuticular and biofilm microbiomes in Holothuria tubulosa and its potential for denitrification","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-28 13:56:14","doi":"10.21203/rs.3.rs-3469562/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a1af9952-1bdb-4c48-90db-b2f8852a298e","owner":[],"postedDate":"October 28th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-04-16T11:16:34+00:00","versionOfRecord":{"articleIdentity":"rs-3469562","link":"https://doi.org/10.3354/meps14591","journal":{"identity":"marine-ecology-progress-series","isVorOnly":true,"title":"Marine Ecology Progress Series"},"publishedOn":"2024-01-01 11:16:34","publishedOnDateReadable":"January 1st, 2024"},"versionCreatedAt":"2023-10-28 13:56:14","video":"","vorDoi":"10.3354/meps14591","vorDoiUrl":"https://doi.org/10.3354/meps14591","workflowStages":[]},"version":"v1","identity":"rs-3469562","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3469562","identity":"rs-3469562","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.