Goat bile acid and Clostridium butyricum exert a synergistic effect in enhancing the therapeutic efficacy against diarrhea induced by Escherichia coli infection

preprint OA: closed
Full text JSON View at publisher
Full text 139,641 characters · extracted from preprint-html · click to expand
Goat bile acid and Clostridium butyricum exert a synergistic effect in enhancing the therapeutic efficacy against diarrhea induced by Escherichia coli infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Goat bile acid and Clostridium butyricum exert a synergistic effect in enhancing the therapeutic efficacy against diarrhea induced by Escherichia coli infection Zhiyu Zhu, Qingyun Bu, Chen Li, Haoyu Sun, Yue Li, Yunfei Deng, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9061762/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract The goat industry has emerged as one of the major livestock sectors in China, with an annual production exceeding 300 million head. Bacterial diseases in goat pose significant threats to the sustainability and productivity of goat farming. Clinically, antibiotic treatments in ruminants are associated with considerable side effects, raising concerns about food safety. Therefore, the development of antibacterial functional feed additives has become an urgent priority for the industry. Bile acids are endogenous molecules synthesized in the liver through cholesterol metabolism and serve critical physiological roles, including hepatobiliary protection, reduction of oxidative stress, and enhancement of intestinal barrier function. They exert antimicrobial effects against pathogenic Escherichia coli ( E. coli ) primarily through direct mechanisms—such as disruption of the phospholipid bilayer of the bacterial cell membrane, leading to intracellular content leakage and subsequent bacterial cell death. Indirectly, bile acids promote the secretion of water and electrolytes in the intestine and modulate the gut microbiota composition, thereby creating an intestinal environment unfavorable for pathogenic bacterial survival. Clostridium butyricum ( C. butyricum ) contributes to intestinal health by maintaining gut microecological stability and reinforcing the intestinal barrier.Upon entering the intestinal tract, C. butyricum produces the antimicrobial agent butyric acid, which lowers the intestinal pH and thereby inhibits the growth of pathogenic E. coli . One of its core functions is to promote the proliferation and repair of intestinal epithelial cells and enhance the expression of tight junction proteins, facilitating the restoration of the intestinal barrier damaged by E. coli infection, and ultimately alleviating diarrhea and systemic inflammation at their source. Goat bile acid and C. butyricum exhibit strong potential for the treatment of E. coli -induced diarrhea. While goat bile acid excels in direct pathogen suppression, C. butyricum specializes in repairing and restoring intestinal homeostasis. Their combination offers a comprehensive therapeutic strategy that spans acute pathogen control to long-term mucosal recovery, presenting a highly promising biological alternative for reducing or replacing antibiotic use—particularly in cases involving antibiotic-associated dysbiosis and antimicrobial resistance.In this study, a mouse model of E. coli infection was first established to investigate the protective effects of dietary supplementation with goat bile acid and C. butyricum in infected mice, aiming to determine the optimal infection dose for the E. coli -induced diarrhea model and to identify effective therapeutic doses of goat bile acid and C. butyricum . The results demonstrated that concurrent supplementation with 200 mg/kg goat bile acid and 0.1 g/mouse of C. butyricum freeze-dried powder significantly alleviated infection-related damage and conferred protective benefits. Based on these findings, a diarrheal lamb model was further developed to evaluate the protective efficacy of the same interventions against E. coli infection in a clinically relevant large animal model. Dietary co-administration of 50 mg/kg goat bile acid and 5 g/lamb of C. butyricum freeze-dried powder was shown to enhance antioxidant capacity, reduce intestinal inflammatory responses, improve jejunal architecture, strengthen intestinal barrier function, and increase gut microbiota diversity in infected lambs. Notably, the combination regimen outperformed goat bile acid monotherapy. This study demonstrates that dietary supplementation with both goat bile acid and C. butyricum effectively protects lambs against E. coli infection and holds promise for practical application in ruminant health management. Goat bile acid Clostridium butyricum Escherichia coli Lamb Intestine Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction China is the world's largest country in terms of goat breeding, mutton production, and mutton consumption. The goat population has remained consistently above 300 million, with annual slaughter numbers also reaching approximately 300 million, ensuring a stable supply for the domestic mutton market (Amoah et al., 2024).The primary goat farming systems in China include traditional grazing, pen feeding, semi-grazing and semi-pen feeding, and modern intensive farming. Currently, pen feeding and the semi-grazing/semi-pen feeding system represent the dominant production models, while intensive farming is emerging as the principal direction for future development (Hume et al., 2011 ). Pathogenic E. coli in goat is a common opportunistic pathogen, and in intensive farming systems, it ranks among the most severe bacterial infectious agents. It primarily induces diarrhea and high mortality in neonatal lambs, which are critical to flock productivity and farm profitability. The death of lambs, as key biological assets, can result in substantial economic losses for goat operations (Gozi et al., 2021 ).Farmers commonly rely on antibiotics for the prevention and treatment of colibacillosis in goat. However, due to prolonged and inappropriate antibiotic use in farming practices, bacterial resistance has become increasingly prevalent, resulting in high rates of clinical treatment failure. Furthermore, antibiotics often fail to completely eradicate pathogenic bacteria, making the disease prone to recurrence following treatment (Zhao et al., 2022 ). Moreover, ruminants are less amenable to repeated antibiotic treatments compared to monogastric animals due to their complex gastrointestinal physiology and susceptibility to microbial imbalance (Tardiolo et al., 2025 ). Therefore, the development of novel biological products capable of reducing or replacing antibiotic use has become an urgent priority in the livestock industry. Bile acids, as key components of bile, are endogenous molecules synthesized in the liver through cholesterol metabolism. Owing to their safety, environmental compatibility, and high efficacy, bile acids have been widely adopted in the livestock and aquaculture industries as a state-recognized novel feed additive (Li et al., 2019). Our studies have demonstrated that bile acids exert protective effects on the hepatobiliary system, reduce oxidative stress, and enhance intestinal barrier function. Dietary supplementation with bile acids has been shown to significantly increase the abundance of beneficial bacteria such as Lactobacillus reuteri in the ileum and Clostridium leptum in the colon, elevate butyric acid levels, and promote the expression of its receptors, thereby contributing to the maintenance of intestinal microecological stability (Yang et al., 2017 ). Some studies have demonstrated that bile acids can directly kill bacteria and inhibit the activity of Clostridium difficile toxin B, indicating their capacity to counteract bacterial toxins. By independently suppressing bacterial virulence—without direct killing—they significantly reduce pathogenicity while minimizing selective pressure for the development of antimicrobial resistance (Icho et al., 2023 ). goat-derived bile acids provide a multi-pronged strategy: they not only exert direct bactericidal effects but also "disarm" pathogens by neutralizing toxins and suppressing virulence factor expression, which is particularly advantageous in managing drug-resistant E. coli infections. Clostridium butyricum ( C. butyricum ) is a Gram-positive, anaerobic bacterium isolated from the intestines of healthy humans and animals, known for its beneficial probiotic properties. It exhibits high tolerance to heat, acid, and multiple antibiotics, and has the capacity to produce butyric acid. C. butyricum can modulate host intestinal microecological balance, restore intestinal barrier function, and enhance systemic immune responses (Stoeva et al., 2021 ). C. butyricum inhibits the growth of pathogenic E. coli by producing the antibacterial metabolite butyric acid and bacteriocin, a protein with antibiotic-like activity. It also promotes the repair of intestinal epithelial cells and enhances the expression of tight junction proteins, thereby restoring the intestinal barrier integrity compromised by E. coli infection. This effectively prevents bacterial and toxin translocation into the bloodstream, contributing to the fundamental alleviation of diarrhea and systemic inflammation (Fu et al., 2020). The core functions of C. butyricum include repairing the intestinal barrier, modulating immune responses, and exerting competitive exclusion. These biological processes are time-dependent and typically require several h to several days to achieve significant effects. Therefore, it is not suitable as a monotherapy for acute conditions and should be used in combination with other therapeutic agents (Xie et al., 2025 ). In clinical practice, C. butyricum is primarily used as a feed additive for preventive purposes. Long-term supplementation with a low dose of C. butyricum enables the establishment of a healthy intestinal microecological environment in advance. It can also serve as an adjuvant therapy, acting synergistically with other therapeutic agents (Wu et al., 2025). The combined use of goat bile acids and C. butyricum theoretically enables a synergistic effect, forming a highly effective therapeutic strategy. goat bile acids can rapidly reduce the load of pathogenic E. coli by leveraging their antibacterial and antitoxin properties. Subsequently, C. butyricum not only suppresses residual pathogenic bacteria but also repairs the intestinal mucosa damaged by E. coli infection. Some probiotics are inhibited or inactivated by bile acids, whereas C. butyricum can form spores and exhibits exceptional tolerance to bile acids, enabling it to transit through the upper gastrointestinal tract successfully and survive and colonize in the intestinal environment containing these compounds (Zhou et al., 2021 ). This enables the combination with goat bile acids. Goat bile acids and C. butyricum show considerable potential for treating E. coli -induced diarrhea. goat bile acids are effective in directly targeting pathogens, whereas C. butyricum excels at repairing and restoring intestinal health. Together, they theoretically constitute a therapeutic strategy that spans acute pathogen control to long-term mucosal recovery, offering a promising biological alternative to reduce or replace antibiotics—particularly in addressing dysbiosis and antimicrobial resistance caused by conventional antibiotic therapy. However, the specific efficacy requires further scientific validation. Based on previous research, this project selects C. butyricum and ovine bile acids as the target agents. By artificially establishing mouse and lamb infection models, it evaluates the therapeutic efficacy of their combined application in E. coli -induced diarrheal infections, with systematic investigation conducted from the perspectives of anti-inflammatory effects, antioxidant activity, intestinal barrier repair, and intestinal microecological regulation. The aim is to explore the synergistic potential of combining microecological preparations with animal-derived antibacterial substances, provide a theoretical foundation for the development of green antibacterial additives for ruminants, and ultimately reduce clinical dependence on antibiotics. Materials and Methods Ethics Statement All animal experiments were conducted in strict accordance with relevant ethical guidelines and regulations. The experimental protocol was reviewed and approved by the Animal Care and Use Committee of Shandong Agricultural University (Approval No. 20010510). Extraction of bile acids (BAs) Fresh goat gallbladders were purchased from a local farmers' market in Tai'an. Bile acid (BAs) extraction was performed according to the method described by (Huang et al., 2025). Briefly, 500 mL of fresh goat bile was measured, filtered, and mixed with 95% ethanol, followed by heating to boiling. After cooling, the ethanol was recovered, and dilute hydrochloric acid was added to adjust the pH to ≥ 3.0. A viscous precipitate subsequently formed, which was re-dissolved in ethanol, decolorized with activated carbon, and filtered; the ethanol in the filtrate was then recovered. The residue was dried to yield a white or light yellow solid. This solid was redissolved in ethanol and decolorized again, with the purification cycle repeated three times. Finally, the purified material was ground to obtain pure goat bile acid powder. Animals and Experimental Design The C. butyricum strain used in this study was provided by Shandong Fanyin Biotechnology Co., Ltd., with a concentration of 1×10⁹ CFU/g. All animal experiments were conducted in strict accordance with applicable ethical guidelines and regulations. Mice experiment: Ninety six-week-old Kunming (KM) mice were selected and, after a three-day acclimatization period, randomly assigned to five groups, with three replicates per group and six mice per replicate. The groups were as follows: the control group (Control), E. coli infection group (E. coli), goat BAs group (BAs), C. butyricum group (C. B), and C. butyricum + goat BAs group (C. B + BAs). The Control and E. coli groups received the basal diet only; the BAs group received the basal diet supplemented with 200 mg/kg goat bile acids; the C. B group received the basal diet supplemented with 0.1 g/kg C. butyricum freeze-dried powder; and the BAs + C. B group received the basal diet supplemented with both 200 mg/kg goat bile acids and 0.1 g/kg C. butyricum freeze-dried powder. All treatments were administered once daily for seven consecutive days. Body weights were measured at 1, 4, 7, and 10 days post-treatment (dpt) by randomly selecting three mice from each group. At 7 dpt, 1.0 mL of an E. coli bacterial suspension (1.0×10⁸ CFU/mL) was intraperitoneally injected into the E. coli, BAs, C. B, and C. B + BAs groups. The E. coli strain was isolated from fecal samples of clinically infected lambs in the laboratory and has been preserved for experimental use. The challenge dose was determined based on preliminary trials. Clinical signs, incidence, and mortality were recorded following infection, and tissue and biological samples were collecte at 10 dpt. Goat experiment: Twelve 6-week-old Bordeaux goats were selected and acclimatized for 3 days before being randomly assigned to four groups, with three animals per group. The groups were as follows: Control, E. coli infection group, goat BAs group (BAs), and Clostridium butyricum + goat BAs group (C. B + BAs). The Control and E. coli groups received the basal diet only; the BAs group received the basal diet supplemented with 50 mg/kg goat bile acids; and the C. B + BAs group received the basal diet supplemented with 50 mg/kg goat bile acids and 5 g/kg C. butyricum freeze-dried powder. All treatments were administered once daily for 14 consecutive days. The dosages were determined based on standard feeding practices observed on commercial goat farms. At 14 dpt, 1.0 mL of an E. coli bacterial suspension (5×10⁹ CFU/mL) was administered orally to the E. coli , BAs, and C. B + BAs groups. The E. coli strain was previously isolated from fecal samples of clinically infected lambs in the laboratory and has been preserved for experimental use. The challenge dose was established through preliminary trials. Tissue and biological samples were collected at 21 dpt. Sample collection Ten days after the mice were challenged, their body weights were measured. They were then anesthetized with ether and decapitated. The blood was collected and left to stand at 37°C for 2 h. After centrifugation at 3000 r/min for 15 min, the upper serum layer was taken and stored at -80°C for future use. The intestinal samples were taken after dissection and stored at -80°C or fixed in 4% paraformaldehyde. The lambs were sent to the slaughterhouse 21 days after challenge, where they were stunned and bled from the jugular vein. Blood, liver and intestinal samples were collected and stored at -80°C. Cecal content samples were collected and frozen in liquid nitrogen for 16S rRNA sequencing. Detection of blood biochemical indicators The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) were measured according to the manufacturer's instructions using assay kits from Nanjing Jiancheng Bioengineering Institute (Batch No.: 20250508). Detection of antioxidant capacity in serum, liver and jejunum The activities of superoxide dismutase (SOD) and reduced glutathione (GSH), as well as the level of malondialdehyde (MDA), in serum, liver tissue, and jejunum tissue were measured using commercial assay kits from Nanjing Jiancheng Bioengineering Institute (Batch No.: 20250429). To quantitatively assess the antioxidant capacity of liver and jejunum tissues, 10% tissue homogenates were prepared in physiological saline, centrifuged at 2500×g for 10 min, and the supernatants were collected for measurement of oxidative stress markers. Real-time fluorescence quantitative PCR (qRT-PCR) was employed to quantify the mRNA expression levels in tissues. The mRNA expression levels of the target genes in jejunum tissue were quantified by qRT-PCR. Total RNA was extracted from liver and jejunum tissues using TRIzon reagent (CWBIO, China) according to the manufacturer's instructions for the Ultrapure RNA Kit (CWBIO, China). The concentration and purity of the extracted RNA were assessed using a micro UV spectrophotometer and adjusted to a uniform concentration. RNA samples were reverse transcribed into cDNA using the HiScript QRT SuperMix for qPCR (+ gDNA wiper) (Vazyme, China). The primer sequences for the target genes are listed in Table 1 and were synthesized by Beijing Qikexin Biotechnology Co., Ltd. qPCR amplification was performed using the SYBR Green method with β-actin as the internal reference gene. The relative mRNA expression levels of the target genes were calculated using the comparative CT method (2⁻∆∆Cᴛ). Table 1 Primer sequences Primer name Forward(5′→3′) Reverse(5′→3′) β-actin GAGAAGAGCTACGAGCTGCC CGCAGGATTCCATGCCCAG TNF-α AGGGAAGAGCAGTCCCCAG CGCTGATGTTGGCTACAACG IL-1β TGCTGGATAGCCCATGTGTG TGCAGAACACCACTTCTCGG IL-6 AATCTGGGTTCAATCAGGCGA GCTCTGCAACTCCATGACAG IL-4 TTGGCAAGCAAGACCTGTTC TTTCCAAGAGGTCTCTCAGCG IL-10 TCAAGGAGCACGTGAACTCG CAGAAAACGATGACAGCGCC ZO-1 CTCCTCGTCGGGTGATCCT ACAGAAACACAGTTTGCGCC Occludin CCATACCACTCCTCCTCCGTA GTAGTGATTAGGTTTGCTGCGG Claudin-1 GAGTAGGGTGCTGTGGTTTGA TATCACCTGCACACGCCCAT Pathological histological analysis After jejunal tissues from each group were collected and fixed in 4% paraformaldehyde for 24 h, they were sequentially dehydrated through a graded ethanol series (70%, 80%, 95%, and 100%) with 40 min at each concentration, followed by clearing in xylene. The tissues were then embedded and sectioned into 5 µm-thick slices using a microtome, baked at 60°C for 1 hour, dewaxed in xylene, rehydrated through a descending alcohol series, and stained with hematoxylin and eosin (H&E). The sections were mounted with neutral balsam and examined under a light microscope to capture clear and complete images. Histological architecture, pathological changes, and goblet cell numbers in the jejunal tissues were evaluated. Statistical analysis In this study, Graphpad Prism 8.0 statistical analysis software was used for graphing and calculating the means and standard deviations (SD) of each group. The data of each group were expressed as Mean ± SD. Among them, “*” indicated P < 0.05, with significant differences; “**” indicated P < 0.01, with extremely significant differences; and “ns” indicated no significant difference, with 0.05 < P ≤ 0.10, showing a significant trend. Results and analysis The impact of ovine bile acids on body weight dynamics and mortality in mice infected with E. coli To investigate the effects of E. coli infection on body weight dynamics and mortality in mice, we monitored weight changes and survival outcomes in each experimental group and presented the data using kinetic curves (Fig. 1 ). Within 7 dpi, mice in the E. coli, C. B, C. B + BAs, and BAs groups exhibited clinical signs including depression, reduced appetite, and decreased activity, with the first deaths occurring within 12 h after infection. Significant weight loss was observed in all infected groups, with the most pronounced reduction in the E. coli group and the least in the C. B + BAs group. The survival rates were 100% in the Control group, 40% in the E. coli group, 55% in the C. B group, 70% in the C. B + BAs group, and 60% in the BAs group. These findings suggest that the combined administration of ovine bile acids and C. butyricum mitigates E. coli -induced weight loss and enhances survival in infected mice. The effects of ovine bile acids and C. butyricum on jejunal histopathology in mice infected with E. coli To investigate the effects of ovine bile acids and C. butyricum on jejunal morphology in mice following E. coli infection, H&E staining was performed on jejunal tissue sections ( Fig. 2 ). Histopathological examination revealed that E. coli infection induced significant structural damage to the jejunum. However, this damage was ameliorated following treatment with ovine bile acids and C. butyricum . In the E. coli group, H&E staining showed extensive disruption of the mucosal epithelium, exposure of the lamina propria, and widespread necrosis and dissolution of intestinal gland tissues within the lamina propria, which were replaced by proliferative connective tissue. In contrast, the C. B, C. B + BAs, and BAs groups exhibited only mild connective tissue proliferation and focal areas of glandular necrosis, indicating partial preservation of jejunal architecture. The effects of ovine bile acids and C. butyricum on the expression of tight junction proteins in the mouse jejunum following E. coli infection To investigate the effects of ovine bile acids and C. butyricum on tight junction protein expression in the jejunum of mice infected with E. coli , we analyzed the mRNA levels of ZO-1, Occludin, and Claudin-1 in jejunal tissues (Fig. 3 ). Compared with the Control group, the E. coli group exhibited significantly reduced mRNA expression of ZO-1, Occludin, and Claudin-1 in the jejunum ( P < 0.01). Relative to the E. coli group, the C. B group showed significant upregulation of ZO-1 and Occludin mRNA ( P < 0.05), while the C. B + BAs group demonstrated marked increases in the mRNA expression of all three proteins ( P < 0.01). The BAs group significantly elevated ZO-1 mRNA levels ( P < 0.05) and Occludin mRNA levels ( P < 0.01). These results indicate that E. coli infection downregulates the expression of tight junction proteins ZO-1, Claudin-1, and Occludin in the mouse jejunum, and treatment with ovine bile acids and C. butyricum can partially restore their expression. The effects of ovine bile acids and C. butyricum on jejunal inflammatory responses in mice infected with E. coli E. coli infection typically induces an inflammatory response characterized by elevated levels of pro-inflammatory cytokines and reduced levels of anti-inflammatory cytokines in tissues and organs. To evaluate the effects of ovine bile acids and C. butyricum on E. coli -induced inflammation, we measured the mRNA expression levels of pro-inflammatory cytokines IL-1β and TNF-α, as well as anti-inflammatory cytokines IL-4 and IL-10, in jejunal tissues of mice from each group using qRT-PCR (Fig. 4 ). As shown in the figure, compared with the Control group, the E. coli group exhibited significantly higher expression of IL-1β and TNF-α ( P < 0.01) and significantly lower expression of IL-4 and IL-10 ( P < 0.01). Relative to the E. coli group, both the C. B and C. B + BAs groups significantly attenuated the upregulation of IL-1β and TNF-α ( P < 0.01). The C. B group significantly mitigated the downregulation of IL-4 and IL-10 ( P < 0.05), and the C. B + BAs group showed a more pronounced effect with significant restoration of these anti-inflammatory factors ( P < 0.01). The BAs group significantly reduced the expression of IL-1β ( P < 0.01) and TNF-α ( P < 0.01), and also partially reversed the suppression of IL-4 and IL-10 ( P < 0.05). These findings indicate that E. coli infection triggers a robust inflammatory response in the mouse jejunum, and dietary supplementation with ovine bile acids and C. butyricum can effectively alleviate this inflammatory reaction. The effects of ovine bile acids and C. butyricum on the antioxidant capacity in mice infected with E. coli Studies have shown that E. coli infection can lead to an increase in ROS content in the animal body, causing oxidative stress and damaging the animal's immune system. Therefore, we detected the changes in the oxidative indicators MDA and SOD in the liver tissue, jejunum tissue, and serum of each group of mice to evaluate the effects of goat bile acid and C. butyricum on antioxidant capacity (Fig. 5 ). As shown in the figure, the MDA levels in the liver tissue, jejunum tissue, and serum of the E. coli group were significantly and extremely significantly increased compared to the Control group after E. coli infection. Adding goat bile acid and C. butyricum to the diet could significantly alleviate the increase in MDA levels in the jejunum ( P < 0.05) and extremely significantly alleviate the increase in MDA levels in the serum and liver tissue ( P < 0.01) caused by E. coli . Compared to the E. coli group, the C. B group could extremely significantly alleviate the increase in MDA levels in the liver ( P < 0.01) and significantly alleviate the increase in MDA levels in the serum ( P < 0.05), with no significant difference in MDA levels in the jejunum. The BAs group could significantly alleviate the increase in MDA levels in the liver ( P < 0.05), with no significant difference in MDA levels in the jejunum tissue and serum. Compared to the Control group, the SOD content in the liver tissue, jejunum tissue, and serum of the E. coli group decreased extremely significantly. Compared to the E. coli group, the C. B group could extremely significantly alleviate the decrease in SOD levels in the jejunum tissue ( P < 0.01) and significantly alleviate the decrease in SOD levels in the liver tissue and serum ( P < 0.05); the C. B + BAs group could extremely significantly alleviate the decrease in SOD levels in the liver tissue, jejunum tissue, and serum. This indicates that E. coli infection can cause oxidative stress in mice, and goat bile acid and C. butyricum have strong antioxidant capacity. The effects of ovine bile acids and C. butyricum on jejunal histology in goats infected with E. coli To investigate the effects of ovine bile acids and C. butyricum on jejunal morphology in goats following E. coli infection, H&E staining was performed on jejunal tissue sections (Fig. 6 ). Histopathological examination revealed that E. coli infection induced structural damage in the goat jejunum. However, this damage was ameliorated by treatment with ovine bile acids and C. butyricum . In the E. coli group, the jejunal architecture was severely disrupted, with extensive necrosis, accumulation of necrotic cellular debris and amorphous eosinophilic material, and widespread loss of intestinal gland epithelial cells due to necrosis and sloughing. In contrast, the C. B + BAs group exhibited numerous leaf-like villi of reduced length and minimal epithelial cell shedding. The BAs group displayed abundant finger-like villi that were elongated, although accompanied by moderate epithelial cell shedding and loss. The submucosa consisted of loose connective tissue with mild granulocyte infiltration. These findings suggest a partial protective effect of the interventions on jejunal integrity. The effects of ovine bile acids and C. butyricum on the expression of tight junction proteins in the jejunal tissue of goats infected with E. coli To investigate the effects of ovine bile acids and C. butyricum on jejunal barrier function in goats infected with E. coli , we analyzed the mRNA expression levels of tight junction proteins ZO-1, Occludin, and Claudin-1 in jejunal tissues (Fig. 7 ). Compared with the Control group, the E. coli group exhibited significantly reduced mRNA expression of ZO-1 and Occludin ( P < 0.01) and a highly significant decrease in Claudin-1 expression ( P < 0.001). Relative to the E. coli group, the C. B + BAs group showed significant upregulation of ZO-1 and Claudin-1 ( P < 0.01) and a moderate increase in Occludin expression ( P < 0.05). The BAs group significantly increased the mRNA levels of ZO-1 and Claudin-1 ( P < 0.05), but no significant change was observed in Occludin expression compared to the E. coli group. These results indicate that E. coli infection downregulates the expression of key tight junction proteins—ZO-1, Occludin, and Claudin-1 in the goat jejunum, and supplementation with ovine bile acids and C. butyricum can partially restore their expression. Notably, the combination treatment exerted a more pronounced protective effect than either agent alone. The effects of ovine bile acids and C. butyricum on jejunal inflammatory responses in goats infected with E. coli E. coli infection typically induces an inflammatory response characterized by elevated levels of pro-inflammatory cytokines and reduced levels of anti-inflammatory cytokines in tissues and organs. To evaluate the effects of caprine bile acids and C. butyricum on E. coli -induced inflammation, we measured the mRNA expression levels of pro-inflammatory cytokines IL-1β, TNF-α, and IL-6, as well as anti-inflammatory cytokines IL-4 and IL-10, in jejunal tissues of mice from each group using qRT-PCR (Fig. 8 ). Compared with the Control group, the E. coli group exhibited significantly increased mRNA expression of IL-1β, TNF-α, and IL-6 ( P < 0.01), while mRNA levels of IL-4 and IL-10 were significantly decreased ( P < 0.01). Relative to the E. coli group, the C. B + BAs group significantly downregulated TNF-α and IL-6 expression ( P < 0.01), moderately reduced IL-1β expression ( P < 0.05), and significantly upregulated IL-4 expression, with no significant change in IL-10. The BAs group significantly suppressed IL-1β and TNF-α expression ( P < 0.05) and markedly reduced IL-6 levels ( P < 0.01), but showed no significant effect on IL-4 or IL-10 expression. These findings indicate that E. coli infection triggers a robust inflammatory response in the jejunum, and dietary supplementation with caprine bile acids and C. butyricum can mitigate this inflammatory reaction, with the combination treatment showing greater efficacy. The effects of ovine bile acids and C. butyricum on antioxidant capacity in goats infected with E. coli E. coli infection increases reactive oxygen species (ROS) levels in animals, leading to oxidative stress and impaired immune function. To evaluate the effects of caprine bile acids and C. butyricum on antioxidant capacity, we measured glutathione (GSH) and superoxide dismutase (SOD) levels in liver tissue, jejunal tissue, and serum from each group of goats using assays corresponding to Fig. 9 . Compared with the Control group, the E. coli group exhibited a highly significant decrease in GSH levels in the jejunum and serum ( P < 0.01) and a significant reduction in hepatic GSH ( P < 0.05). SOD levels in the liver, jejunum, and serum were also profoundly reduced ( P < 0.01). Relative to the E. coli group, the C. B + BAs group significantly increased GSH levels in the liver and jejunum ( P < 0.01), as well as in the serum ( P < 0.05), and showed a highly significant restoration of SOD activity across all three compartments ( P < 0.01). The BAs group significantly elevated hepatic GSH ( P < 0.01) and serum GSH ( P < 0.05), but no significant change was observed in jejunal GSH. Additionally, the BAs group significantly enhanced SOD levels in the liver and serum ( P < 0.01), with no significant improvement in jejunal SOD. These findings indicate that E. coli infection induces systemic oxidative stress in goats, and supplementation with caprine bile acids and C. butyricum enhances antioxidant defenses, with the combination treatment demonstrating superior efficacy. The effects of ovine bile acids and C. butyricum on serum biochemical indicators in goats infected with E. coli E. coli infection is likely to impair liver function. To assess the impact of E. coli infection on hepatic status and the effects of dietary supplementation with ovine bile acids and C. butyricum , we measured serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) in goats from each group (Fig. 10 ). Compared with the Control group, the E. coli group exhibited significantly elevated serum AST and ALT levels ( P < 0.001) and a marked increase in LDH levels ( P < 0.01). Relative to the E. coli group, both the C. B + BAs and BAs groups significantly reduced serum AST, ALT, and LDH levels ( P < 0.01). These results indicate that E. coli infection induces hepatocellular injury, as reflected by increased serum transaminase and LDH activities, and that dietary supplementation with ovine bile acids and C. butyricum effectively mitigates this enzyme elevation, suggesting a protective effect on liver function. The effects of ovine bile acids and C. butyricum on the intestinal microbiota of goats infected with E. coli To investigate the impact of E. coli infection on the intestinal microbiota in goats, 16S rRNA gene sequencing was performed, and effective sequences were clustered into operational taxonomic units (OTUs) using the Vsearch algorithm at a 97% sequence similarity threshold (Fig. 11 ). The total number of OTUs was 6,491 in the Control group, 6,117 in the E. coli group, 6,809 in the C. B + BAs group, and 5,427 in the BAs group. A total of 351 OTUs were shared among all four groups, with unique OTUs numbering 5,066, 4,545, 5,606, and 4,306, respectively. The C. B + BAs group exhibited the highest species richness, as reflected by both the total and unique OTU counts, indicating that the combination of caprine bile acids and C. butyricum significantly enhanced microbial diversity. To assess sequencing depth, rarefaction curves were analyzed; as sequencing depth increased, the curves approached saturation, suggesting that the sequencing effort adequately captured the majority of microbial diversity in the samples. Rank-abundance curves, which reflect both species richness and evenness, showed low richness and uneven distribution in the E. coli group, whereas the C. B + BAs group displayed the highest richness and improved evenness. Alpha diversity analysis revealed that the C. B + BAs group had a significantly lower Simpson index compared to the E. coli group ( P < 0.05), indicating higher diversity, while no significant differences were observed in the Chao1 or ACE indices. At the phylum level, the dominant bacterial taxa included Bacillota (formerly Firmicutes), Bacteroidota, Pseudomonadota, and Verrucomicrobiota. Notably, the relative abundance of Bacillota was increased in the C. B + BAs group compared to the E. coli group, suggesting a beneficial modulation of gut microbiota composition. Furthermore, principal coordinate analysis (PCoA) based on beta diversity revealed distinct clustering patterns, with the E. coli group clearly separated from the C. B + BAs and BAs groups, indicating significant structural differences in microbial communities. These findings demonstrate that dietary supplementation with caprine bile acids and C. butyricum , particularly in combination, can effectively enrich and reshape the intestinal microbiota in E. coli -infected goats. Discussion The harm and economic losses caused by pathogenic E. coli in goat have become increasingly severe, making it one of the most serious infectious diseases threatening the goat industry today. In China, antibiotics are commonly used in clinical practice to prevent and treat E. coli infections in goat; however, excessive and inappropriate use has led to widespread bacterial resistance. Against the current backdrop of antibiotic bans and restrictions in animal production, developing effective alternative antibacterial agents has become particularly urgent (Ren et al., 2023 ). Bile acids are important components of bile and are endogenous molecules synthesized from cholesterol in the liver. Due to their safety, environmental compatibility, and high efficacy, they have been approved by the national authorities as a novel feed additive and are widely used in livestock and aquaculture industries (Collins et al., 2023 ). Previous studies have demonstrated that ovine bile acids possess beneficial properties including hepatobiliary protection, reduction of oxidative stress, and improvement of intestinal barrier function (Xu et al., 2023 ). C. butyricum , a Gram-positive, anaerobic bacterium isolated from the intestines of healthy humans and animals, exhibits strong probiotic characteristics (Chen et al., 2019). C. butyricum is resistant to heat, acid, and multiple antibiotics, and produces butyric acid (Liang et al., 2021 ). It can modulate host intestinal microecological balance, restore intestinal barrier integrity, and enhance immune function, thereby offering broad application potential in animal health and production. The combined use of goat bile acid and C. butyricum theoretically can produce asynergistic effect, forming a very ideal treatment strategy. goat bile acid can quickly control the number of pathogenic E. coli by taking advantage of its antibacterial and antitoxin capabilities. Subsequently, C. butyricum , on the one hand, inhibits the remaining pathogenic bacteria and, on the other hand, repairs the intestinal mucosa damaged by E. coli . Some probiotics are inhibited or killed by bile acid, but C. butyricum can form spores and has extremely strong tolerance to bile acid, allowing it to smoothly pass through the upper digestive tract and survive and colonize in the intestinal environment containing bile acid (Zhou et al., 2021 ). This makes the combination of it and goat bile acid possible. Goat bile acid and C. butyricum have great potential in treating diarrhea caused by E. coli . Here, we evaluated the protective effects of ovine bile acids and C. butyricum in mice and goats infected with E. coli . We demonstrated that dietary supplementation with ovine bile acids and C. butyricum mitigates the adverse effects of E. coli infection by enhancing antioxidant capacity and intestinal immune function, reducing inflammatory responses, and improving intestinal barrier integrity and microbiota composition in both animal models. The jejunum is a key segment of the gastrointestinal tract and serves as the primary site for nutrient digestion and absorption in the body (Koga et al., 2012). In this study, E. coli infection was found to induce structural damage in the jejunum of both mice and goats, whereas supplementation with ovine bile acids and C. butyricum alleviated such intestinal injury. Tight junction proteins play a critical role in maintaining intestinal barrier function and integrity and constitute a vital defense mechanism against inflammation and dysbiosis. Reduced expression of these proteins has been shown to increase intestinal permeability, compromising gut health (Kuo et al., 2022 ). Our results demonstrate that ovine bile acids and C. butyricum upregulated the mRNA expression of Occludin, Claudin-1, and ZO-1 in the jejunum of E. coli -infected mice, a finding consistent with observations in infected goats. This protective effect may be mediated through oxidative stress pathways, as oxidative stress can disrupt tight junctions; ovine bile acids may counteract this disruption by enhancing systemic antioxidant capacity, thereby preserving junctional protein integrity. The intestinal mucosal immune system functions largely through lymphocytes, including intraepithelial lymphocytes, which secrete cytokines such as IL-4 and IL-10, playing essential roles in maintaining mucosal integrity and regulating immune responses. Alterations in cytokine levels and gene expression serve as indirect indicators of host health status (Chen et al., 2021 ). In E. coli -infected mice, jejunal expression of pro-inflammatory cytokines IL-6, IL-1, and TNF-α was significantly elevated, while anti-inflammatory cytokines IL-4 and IL-10 were markedly downregulated. Dietary supplementation with ovine bile acids and C. butyricum effectively reversed these imbalances, and similar trends were observed in infected goats. Notably, the combination of ovine bile acids and C. butyricum exerted a more pronounced protective effect than bile acid treatment alone. E. coli infection induces systemic inflammation and triggers the accumulation of reactive oxygen species (ROS) in organs and tissues. Excessive ROS accumulation can impair cellular activity, leading to apoptosis and necrosis, ultimately compromising normal tissue and organ function (Zeng et al., 2023 ). In this study, E. coli infection in mice significantly increased malondialdehyde (MDA) levels in the liver, jejunum, and serum, while decreasing superoxide dismutase (SOD) activity. Dietary supplementation with ovine bile acids and C. butyricum alleviated these oxidative stress markers, indicating a protective effect against E. coli -induced oxidative damage. Consistent with findings in mice, E. coli infection in goats also altered the levels or activities of MDA, SOD, and glutathione (GSH) in liver, jejunum, and serum, indicative of oxidative injury. The present results demonstrate that ovine bile acids and C. butyricum mitigate oxidative damage in both animal models; however, the underlying mechanisms remain to be fully elucidated and warrant further investigation. Serum biochemical indicators can reflect the health status of animals to some extent (Tang et al., 2022 ). Consistent with previous findings, this study showed that the activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH) in the serum of goats infected with E. coli were significantly elevated, indicating that E. coli infection induced hepatic dysfunction. Dietary supplementation with ovine bile acids and C. butyricum alleviated this impairment to varying degrees. The digestive system microecosystem of ruminants is a complex environment composed of diverse microbial communities, with bacteria playing a dominant role (Asakura et al., 2022). These microbial populations provide the host with a wide range of enzymes and play a crucial role in promoting nutrient digestion and absorption, supporting animal growth and development, and enhancing immune function. E. coli infection disrupts intestinal homeostasis in the host, and restoring this balance represents an effective strategy for managing E. coli infection. In this study, E. coli infection in goats was associated with reduced diversity and richness of intestinal microbiota. However, dietary supplementation with bile acids and C. butyricum increased the abundance of Firmicutes in the intestine compared to the E. coli group. Most members of the phylum Firmicutes are beneficial bacteria that play a key regulatory role in maintaining intestinal health, suggesting that bile acids and C. butyricum can modulate the intestinal microbiota and may contribute significantly to the restoration of microbial homeostasis. In conclusion, our results demonstrate that E. coli infection causes damage to intestinal morphology and structure, impairs intestinal barrier function, induces intestinal inflammation, reduces systemic antioxidant capacity, and disrupts the homeostasis of the gut microbiota in both mice and goats. Dietary supplementation with ovine bile acids and C. butyricum effectively improves serum enzyme activity and antioxidant capacity, alleviates intestinal inflammatory responses, enhances intestinal barrier integrity, and promotes microbial richness and diversity in E. coli -infected animals. The combined use of ovine bile acids and C. butyricum exerts a synergistic protective effect in infected mice and goats. These findings provide theoretical and experimental support for the joint development of these agents as novel green antibacterial additives in animal production. Declarations Author Contribution Methodology: Z.Y.Z, Q.Y.B.Project administration: K.W, Z.H.S.Resources: Z.H.S, K.W.Software: Z.Y.Z, Q.Y.B.C.LSupervision: Z.H.S, K,W.Validation:Z.Y.Z,Q.Y.B,Z.H.S, K.W.Visualization: Z.Y.Z, Q.Y.B,Z.H.S, K.W.Writing – original draft: Z.Y.Z, Q.Y.B.Writing – review & editing: Z.Y.Z, Q.Y.B, K.W,H.Y.S,Y.F.D,Y.L,F.E.Y,N,J Acknowledgments This work has been provided with technical support by the earmarked fund for Shandong Agriculture Research System (SDARS-10-05), and Shandong science and technology project of traditional chinese medicine (M-2023041). References Amoah EA, Gelaye S (1997) Biotechnological advances in goat reproduction. J Anim Sci 75:578–585 Hume DA, Whitelaw CBA, Archibald AL (2011) The future of animal production: improving productivity and sustainability[J]. J Agricultural Sci 149:9–16 Gozi KS, Deus Ajude LPT, Barroso MDV, Silva CRD, Peiró JR, Mendes LCN, Nogueira MCL, Casella T (2021) Potentially Pathogenic Multidrug-Resistant in Lamb Meat. Microb Drug Resist 27:1071–1078 Zhao X, Zhao H, Zhou Z, Miao Y, Li R, Yang B, Cao C, Xiao S, Wang X, Liu H, Wang J, Yang Z (2022) Characterization of Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates That Cause Diarrhea in Sheep in Northwest China. Microbiol Spectr 10:159 Tardiolo G, La Fauci D, Riggio V, Daghio M, Di Salvo E, Zumbo A, Sutera AM (2025) Gut Microbiota of Ruminants and Monogastric Livestock: An Overview. Anim Basel 15:758 Li J, Dawson PA (2019) Animal models to study bile acid metabolism. Biochim Biophys Acta Mol Basis Dis 1865:895–911 Yang Y, Nirmagustina DE, Kumrungsee T, Okazaki Y, Tomotake H, Kato N (2017) Feeding of the water extract from Ganoderma lingzhi to rats modulates secondary bile acids, intestinal microflora, mucins, and propionate important to colon cancer. Biosci Biotechnol Biochem 81:1796–1804 Icho S, Ward JS, Tam J, Kociolek LK, Theriot CM, Melnyk RA (2023) Intestinal bile acids provide a surmountable barrier against C. difficile TcdB-induced disease pathogenesis. Proc Natl Acad Sci U S A 120:120 Stoeva MK, Garcia-So J, Justice N, Myers J, Tyagi S, Nemchek M, McMurdie PJ, Kolterman O, Eid J (2021) Butyrate-producing human gut symbiont, Clostridium butyricum , and its role in health and disease. Gut Microbes 13:1–28 Xie M, Yuan K, Zhang Y, Zhang Y, Zhang R, Gao J, Wei W, Jiang L, Li T, Ding Y, Wang L, Lin Y, Wong CC, Yu J (2025) Tumor-resident probiotic Clostridium butyricum improves aPD-1 efficacy in colorectal cancer models by inhibiting IL-6-mediated immunosuppression. Cancer Cell 43:1885–1901 Wu Minyan H, Min C, Weidong (2025) Effects of a combination of Clostridium butyricum and Lactobacillus acidophilus on production performance, immune function, antioxidant capacity and meat quality of broilers [J]. Chin J Anim Sci 61:300–307 Zhou H, Quanxi X, Xiaohui L (2021) Performance Study of Several Clostridium butyricum Strains [J]. China Brew 40:120–123 Ren Z, Chen W, Getachew T, Mwacharo JM, Haile A, Sun W (2023) Expression analysis of TLR signaling pathway genes under lipopolysaccharide-induced and E. coli F17-infected sheep intestinal epithelial cells. Anim Biotechnol 34:1815–1821 Collins SL, Stine JG, Bisanz JE, Okafor CD, Patterson AD (2023) Bile acids and the gut microbiota: metabolic interactions and impacts on disease. Nat Rev Microbiol 21:236–247 Xu H, Luo H, Zhang J, Li K, Lee MH (2023) Therapeutic potential of Clostridium butyricum anticancer effects in colorectal cancer. Gut Microbes 15:114 Chen D, Jin D, Huang S, Wu J, Xu M, Liu T, Dong W, Liu X, Wang S, Zhong W, Liu Y, Jiang R, Piao M, Wang B, Cao H (2020) Clostridium butyricum , a butyrate-producing probiotic, inhibits intestinal tumor development through modulating Wnt signaling and gut microbiota. Cancer Lett 469:456–467 Liang J, Kou S, Chen C, Raza SHA, Wang S, Ma X, Zhang WJ, Nie C (2021) Effects of Clostridium butyricum on growth performance, metabonomics and intestinal microbial differences of weaned piglets. BMC Microbiol 21:85 Liu H, Xu X, Liang J, Wang J, Li Y (2022) The relationship between Clostridium butyricum and colorectal cancer. J Cancer Res Ther 18:1855–1859 Kuo WT, Odenwald MA, Turner JR, Zuo L (2022) Tight junction proteins occludin and ZO-1 as regulators of epithelial proliferation and survival. Ann N Y Acad Sci 1514:21–33 Chen Y, Cui W, Li X, Yang H (2021) Interaction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease. Front Immunol 12:761981 Zeng Y, Yang Q, Ouyang Y, Lou Y, Cui H, Deng H, Zhu Y, Geng Y, Ouyang P, Chen L, Zuo Z, Fang J, Guo H (2023) Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol 67:102886 Tang H, Zhang H, Liu D, Wang Z, Yu D, Fan W, Guo Z, Huang W, Hou S, Zhou Z (2022) Genome-wide association study reveals the genetic determinism of serum biochemical indicators in ducks. BMC Genomics 23:856 Yamamoto S, Sasaki Y, Okada Y, Katabami S, Fujimori A, Munakata K, Shiraki Y, Nishibu H, Hisamoto C, Kawase J, Ojima Y, Kiyoshima A, Shiroma K (2022) Bacterial Distribution and Community Structure in Beef Cattle Liver and Bile at Slaughter. J Food Prot 85:424–434 Nesta B, Pizza M (2018) Vaccines Against Escherichia coli . Curr Top Microbiol Immunol 416:213–242 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 29 Apr, 2026 Reviews received at journal 10 Apr, 2026 Reviews received at journal 26 Mar, 2026 Reviewers agreed at journal 23 Mar, 2026 Reviewers agreed at journal 19 Mar, 2026 Reviewers invited by journal 19 Mar, 2026 Editor assigned by journal 09 Mar, 2026 Submission checks completed at journal 09 Mar, 2026 First submitted to journal 07 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9061762","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":610915038,"identity":"f2d27357-9718-47e9-bd2a-7436c4e908f6","order_by":0,"name":"Zhiyu Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIie3RIQvCQBTA8TcOzvJkdSLMTyCcDARB9KtsCCaDcc2BcBbtE/wQgmB+8sA0+4JFBJNhNpNo1LSzCd4/vx/vHQdgs/1grnALvscPX1amZEZqs6TFkFHg4j40I+o1zY6maJmOlOFleRjyODs6axrd8iv0/GZSIpw0JE7ji1B02HRWMAjaVEKEFyWEmZBqt9jWESjalhHpDYCqWqBivJgRxD1wVbNX0yjNiFeZwy7NhspFGXRWyuAtfUZRFHF3ohvnU36Ne34p+VyJpl/zRr4VNpvN9hc9AcDESbE3Ze2BAAAAAElFTkSuQmCC","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Zhiyu","middleName":"","lastName":"Zhu","suffix":""},{"id":610915039,"identity":"60141b7a-bdd9-4ed9-8ef4-a014ac47401d","order_by":1,"name":"Qingyun Bu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Qingyun","middleName":"","lastName":"Bu","suffix":""},{"id":610915040,"identity":"f68d0bdb-fa4f-4d08-a9ef-07c21e5398e8","order_by":2,"name":"Chen Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Li","suffix":""},{"id":610915041,"identity":"a1d72ca7-b74e-4c1f-bcc8-8008456d4405","order_by":3,"name":"Haoyu Sun","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Haoyu","middleName":"","lastName":"Sun","suffix":""},{"id":610915042,"identity":"a0975e9b-c09f-46fc-90ce-9cb09edea43d","order_by":4,"name":"Yue Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Li","suffix":""},{"id":610915043,"identity":"0632b366-bd44-4212-a15a-f4ccd59f271e","order_by":5,"name":"Yunfei Deng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yunfei","middleName":"","lastName":"Deng","suffix":""},{"id":610915044,"identity":"972cc5fe-7281-4d38-adb2-1d3774878b9b","order_by":6,"name":"Feier Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Feier","middleName":"","lastName":"Liu","suffix":""},{"id":610915045,"identity":"adac237c-d79c-47b9-b186-d9ab5decc104","order_by":7,"name":"Ning Jia","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Jia","suffix":""},{"id":610915046,"identity":"d75ccd2d-84b1-4004-bb55-10df03733185","order_by":8,"name":"kai Wei","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"kai","middleName":"","lastName":"Wei","suffix":""},{"id":610915052,"identity":"eb45ea6f-1d77-43fa-85fd-0710c398673e","order_by":9,"name":"Zhenhong Sun","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhenhong","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2026-03-08 03:38:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9061762/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9061762/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105751889,"identity":"b49f094f-8f86-4df7-810d-f5b4c2342874","added_by":"auto","created_at":"2026-03-30 15:50:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":76895,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of ovine bile acid and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eClostridium butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the weight change rate and mortality of infected mice.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/53c0a61a9948e931deb96963.png"},{"id":105564499,"identity":"d676596e-6cb1-48a2-bfc1-3fa6143a228a","added_by":"auto","created_at":"2026-03-27 12:49:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":861659,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon jejunal structural changes in mice infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e Histopathological observations show connective tissue hyperplasia (black arrow), necrosis of intestinal gland cells (blue arrow), lymphocyte infiltration (yellow arrow), and reduced staining intensity of muscle fibers in the muscular layer (red arrow)\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/ab6ff6d27e77e9ffe92bffc9.png"},{"id":105320834,"identity":"524bc4e1-b144-4233-8a5c-4c68f24888ec","added_by":"auto","created_at":"2026-03-24 17:18:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":105018,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon the mRNA expression levels of tight junction proteins in the jejunum of mice infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e “*” denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/959acc1281ae8ea3b517ab8b.png"},{"id":105320825,"identity":"6f7a9172-1313-41d0-a30c-af47e1276310","added_by":"auto","created_at":"2026-03-24 17:18:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":97050,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the expression levels of inflammatory cytokines in the jejunum of mice infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003eThe mRNA expression levels of IL-1β(A), TNF-α (B), IL-4 (C), and IL-10 (D) in jejunal tissue were determined by qRT-PCR. “*”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01. IL-1β: interleukin-1β; TNF-α: tumor necrosis factor-α; IL-4: interleukin-4; IL-10: interleukin-10.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/763472e3df5a2b30f1735dac.png"},{"id":105320826,"identity":"70430041-3607-4a03-a673-ac1bd2e49e4e","added_by":"auto","created_at":"2026-03-24 17:18:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":72116,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on oxidative stress markers in mice infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e The levels or activities of malondialdehyde (MDA) in liver tissue (A), jejunum (B), and serum (C), as well as superoxide dismutase (SOD) in liver tissue (D), jejunum (E), and serum (F), were measured by appropriate assays. “*”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01. MDA: malondialdehyde; SOD: superoxide dismutase.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/528a22f69a4c2d521299218b.png"},{"id":105564953,"identity":"ab52f008-aef8-4bb3-b9a4-1ae0c5b295c2","added_by":"auto","created_at":"2026-03-27 12:51:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":962980,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon jejunal structural changes in goats infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e Histopathological observations reveal intestinal villus epithelial shedding (black arrow), disorganized jejunal architecture, and extensive necrosis (red arrow\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/bc6a263b0dba471c54c83066.png"},{"id":105565627,"identity":"6af5cc4e-ae95-4902-865e-062bbd850a1e","added_by":"auto","created_at":"2026-03-27 12:53:52","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":58490,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon the mRNA expression levels of tight junction proteins in the jejunum of goats infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e “*” denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/37ec34c6734140c1c167ab1c.png"},{"id":105320830,"identity":"3457f161-c9df-404a-ac2e-769aabff176f","added_by":"auto","created_at":"2026-03-24 17:18:18","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":96365,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the expression levels of inflammatory cytokines in the jejunum of goats infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003eThe mRNA expression levels of IL-1β (A), TNF-α (B), IL-6 (C), IL-4 (D), and IL-10 (E) in jejunal tissue were determined by qRT-PCR. “*” denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**” denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01. IL-1β: interleukin-1β; TNF-α: tumor necrosis factor-α; IL-6: interleukin-6; IL-4: interleukin-4; IL-10: interleukin-10.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/43b543f711a9d9ed5abb2220.png"},{"id":105320833,"identity":"1f2de4ef-5023-4e22-aad9-39f2d42b1968","added_by":"auto","created_at":"2026-03-24 17:18:18","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":115136,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on oxidative stress markers in goats infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003eThe levels or activities of reduced glutathione (GSH) in liver tissue (A), jejunum (B), and serum (C), as well as superoxide dismutase (SOD) in liver tissue (D), jejunum (E), and serum (F), were measured using appropriate assays. “*”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01. GSH: reduced glutathione; SOD: superoxide dismutase.\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/25e53a15e8494da510e8af93.png"},{"id":105565137,"identity":"bcb11d86-d626-4d94-8c0b-11a9674877b4","added_by":"auto","created_at":"2026-03-27 12:52:03","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":79334,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon serum levels of AST (A), ALT (B), and LDH (C) in goats infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e “*” denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**” denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01. AST: aspartate aminotransferase; ALT: alanine aminotransferase; LDH: lactate dehydrogenase. Values are expressed in U/L, representing enzyme activity per liter of serum.\u003c/p\u003e","description":"","filename":"image10.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/7ca942baf0b5c7630a07b741.png"},{"id":105565625,"identity":"87b1ba38-694b-4cef-8ebb-a17fbcbce53a","added_by":"auto","created_at":"2026-03-27 12:53:51","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":199879,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ovine bile acids and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e on the intestinal microbiota of goats infected with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eE. coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) Venn diagram showing shared operational taxonomic units (OTUs) among groups. (B) Sample dilution curves reflecting sequencing depth. (C) Rank abundance curves illustrating species richness and evenness. (D) Alpha diversity indices (Chao1, Ace, Shannon, Simpson) across groups. “*”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; “**”denotes \u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01. (E) Principal component analysis (PCA) of bacterial β-diversity in the intestinal microbiota. (F) Relative abundance of bacterial taxa at the phylum level among experimental groups. Con: control group; EC: \u003cem\u003eE. coli\u003c/em\u003e-infected group; CaB: C. B+ BAs group; BAs: bile acids group.\u003c/p\u003e","description":"","filename":"image11.png","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/2dd8f670e786d1f29c7b7da7.png"},{"id":105752512,"identity":"477b01f6-3e46-44a3-9669-8484b690ce75","added_by":"auto","created_at":"2026-03-30 16:02:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4225501,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9061762/v1/b2015785-6ef3-4b00-ac5a-6b40bc372540.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Goat bile acid and Clostridium butyricum exert a synergistic effect in enhancing the therapeutic efficacy against diarrhea induced by Escherichia coli infection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChina is the world's largest country in terms of goat breeding, mutton production, and mutton consumption. The goat population has remained consistently above 300\u0026nbsp;million, with annual slaughter numbers also reaching approximately 300\u0026nbsp;million, ensuring a stable supply for the domestic mutton market (Amoah et al., 2024).The primary goat farming systems in China include traditional grazing, pen feeding, semi-grazing and semi-pen feeding, and modern intensive farming. Currently, pen feeding and the semi-grazing/semi-pen feeding system represent the dominant production models, while intensive farming is emerging as the principal direction for future development (Hume et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Pathogenic \u003cem\u003eE. coli\u003c/em\u003e in goat is a common opportunistic pathogen, and in intensive farming systems, it ranks among the most severe bacterial infectious agents. It primarily induces diarrhea and high mortality in neonatal lambs, which are critical to flock productivity and farm profitability. The death of lambs, as key biological assets, can result in substantial economic losses for goat operations (Gozi et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).Farmers commonly rely on antibiotics for the prevention and treatment of colibacillosis in goat. However, due to prolonged and inappropriate antibiotic use in farming practices, bacterial resistance has become increasingly prevalent, resulting in high rates of clinical treatment failure. Furthermore, antibiotics often fail to completely eradicate pathogenic bacteria, making the disease prone to recurrence following treatment (Zhao et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, ruminants are less amenable to repeated antibiotic treatments compared to monogastric animals due to their complex gastrointestinal physiology and susceptibility to microbial imbalance (Tardiolo et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Therefore, the development of novel biological products capable of reducing or replacing antibiotic use has become an urgent priority in the livestock industry.\u003c/p\u003e \u003cp\u003eBile acids, as key components of bile, are endogenous molecules synthesized in the liver through cholesterol metabolism. Owing to their safety, environmental compatibility, and high efficacy, bile acids have been widely adopted in the livestock and aquaculture industries as a state-recognized novel feed additive (Li et al., 2019). Our studies have demonstrated that bile acids exert protective effects on the hepatobiliary system, reduce oxidative stress, and enhance intestinal barrier function. Dietary supplementation with bile acids has been shown to significantly increase the abundance of beneficial bacteria such as Lactobacillus reuteri in the ileum and Clostridium leptum in the colon, elevate butyric acid levels, and promote the expression of its receptors, thereby contributing to the maintenance of intestinal microecological stability (Yang et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Some studies have demonstrated that bile acids can directly kill bacteria and inhibit the activity of Clostridium difficile toxin B, indicating their capacity to counteract bacterial toxins. By independently suppressing bacterial virulence\u0026mdash;without direct killing\u0026mdash;they significantly reduce pathogenicity while minimizing selective pressure for the development of antimicrobial resistance (Icho et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). goat-derived bile acids provide a multi-pronged strategy: they not only exert direct bactericidal effects but also \"disarm\" pathogens by neutralizing toxins and suppressing virulence factor expression, which is particularly advantageous in managing drug-resistant \u003cem\u003eE. coli\u003c/em\u003e infections.\u003c/p\u003e \u003cp\u003e \u003cem\u003eClostridium butyricum\u003c/em\u003e (\u003cem\u003eC. butyricum\u003c/em\u003e) is a Gram-positive, anaerobic bacterium isolated from the intestines of healthy humans and animals, known for its beneficial probiotic properties. It exhibits high tolerance to heat, acid, and multiple antibiotics, and has the capacity to produce butyric acid. \u003cem\u003eC. butyricum\u003c/em\u003e can modulate host intestinal microecological balance, restore intestinal barrier function, and enhance systemic immune responses (Stoeva et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \u003cem\u003eC. butyricum\u003c/em\u003e inhibits the growth of pathogenic \u003cem\u003eE. coli\u003c/em\u003e by producing the antibacterial metabolite butyric acid and bacteriocin, a protein with antibiotic-like activity. It also promotes the repair of intestinal epithelial cells and enhances the expression of tight junction proteins, thereby restoring the intestinal barrier integrity compromised by \u003cem\u003eE. coli\u003c/em\u003e infection. This effectively prevents bacterial and toxin translocation into the bloodstream, contributing to the fundamental alleviation of diarrhea and systemic inflammation (Fu et al., 2020). The core functions of \u003cem\u003eC. butyricum\u003c/em\u003e include repairing the intestinal barrier, modulating immune responses, and exerting competitive exclusion. These biological processes are time-dependent and typically require several h to several days to achieve significant effects. Therefore, it is not suitable as a monotherapy for acute conditions and should be used in combination with other therapeutic agents (Xie et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In clinical practice, \u003cem\u003eC. butyricum\u003c/em\u003e is primarily used as a feed additive for preventive purposes. Long-term supplementation with a low dose of \u003cem\u003eC. butyricum\u003c/em\u003e enables the establishment of a healthy intestinal microecological environment in advance. It can also serve as an adjuvant therapy, acting synergistically with other therapeutic agents (Wu et al., 2025). The combined use of goat bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e theoretically enables a synergistic effect, forming a highly effective therapeutic strategy. goat bile acids can rapidly reduce the load of pathogenic \u003cem\u003eE. coli\u003c/em\u003e by leveraging their antibacterial and antitoxin properties. Subsequently, \u003cem\u003eC. butyricum\u003c/em\u003e not only suppresses residual pathogenic bacteria but also repairs the intestinal mucosa damaged by \u003cem\u003eE. coli\u003c/em\u003e infection. Some probiotics are inhibited or inactivated by bile acids, whereas \u003cem\u003eC. butyricum\u003c/em\u003e can form spores and exhibits exceptional tolerance to bile acids, enabling it to transit through the upper gastrointestinal tract successfully and survive and colonize in the intestinal environment containing these compounds (Zhou et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This enables the combination with goat bile acids. Goat bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e show considerable potential for treating \u003cem\u003eE. coli\u003c/em\u003e-induced diarrhea. goat bile acids are effective in directly targeting pathogens, whereas \u003cem\u003eC. butyricum\u003c/em\u003e excels at repairing and restoring intestinal health. Together, they theoretically constitute a therapeutic strategy that spans acute pathogen control to long-term mucosal recovery, offering a promising biological alternative to reduce or replace antibiotics\u0026mdash;particularly in addressing dysbiosis and antimicrobial resistance caused by conventional antibiotic therapy. However, the specific efficacy requires further scientific validation.\u003c/p\u003e \u003cp\u003eBased on previous research, this project selects \u003cem\u003eC. butyricum\u003c/em\u003e and ovine bile acids as the target agents. By artificially establishing mouse and lamb infection models, it evaluates the therapeutic efficacy of their combined application in \u003cem\u003eE. coli\u003c/em\u003e-induced diarrheal infections, with systematic investigation conducted from the perspectives of anti-inflammatory effects, antioxidant activity, intestinal barrier repair, and intestinal microecological regulation. The aim is to explore the synergistic potential of combining microecological preparations with animal-derived antibacterial substances, provide a theoretical foundation for the development of green antibacterial additives for ruminants, and ultimately reduce clinical dependence on antibiotics.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics Statement\u003c/h2\u003e \u003cp\u003e All animal experiments were conducted in strict accordance with relevant ethical guidelines and regulations. The experimental protocol was reviewed and approved by the Animal Care and Use Committee of Shandong Agricultural University (Approval No. 20010510).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExtraction of bile acids (BAs)\u003c/h3\u003e\n\u003cp\u003eFresh goat gallbladders were purchased from a local farmers' market in Tai'an. Bile acid (BAs) extraction was performed according to the method described by (Huang et al., 2025). Briefly, 500 mL of fresh goat bile was measured, filtered, and mixed with 95% ethanol, followed by heating to boiling. After cooling, the ethanol was recovered, and dilute hydrochloric acid was added to adjust the pH to ≥ 3.0. A viscous precipitate subsequently formed, which was re-dissolved in ethanol, decolorized with activated carbon, and filtered; the ethanol in the filtrate was then recovered. The residue was dried to yield a white or light yellow solid. This solid was redissolved in ethanol and decolorized again, with the purification cycle repeated three times. Finally, the purified material was ground to obtain pure goat bile acid powder.\u003c/p\u003e\n\u003ch3\u003eAnimals and Experimental Design\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eC. butyricum\u003c/em\u003e strain used in this study was provided by Shandong Fanyin Biotechnology Co., Ltd., with a concentration of 1×10⁹ CFU/g. All animal experiments were conducted in strict accordance with applicable ethical guidelines and regulations.\u003c/p\u003e \u003cp\u003eMice experiment: Ninety six-week-old Kunming (KM) mice were selected and, after a three-day acclimatization period, randomly assigned to five groups, with three replicates per group and six mice per replicate. The groups were as follows: the control group (Control), \u003cem\u003eE. coli\u003c/em\u003e infection group (E. coli), goat BAs group (BAs), \u003cem\u003eC. butyricum\u003c/em\u003e group (C. B), and \u003cem\u003eC. butyricum\u003c/em\u003e + goat BAs group (C. B + BAs). The Control and E. coli groups received the basal diet only; the BAs group received the basal diet supplemented with 200 mg/kg goat bile acids; the C. B group received the basal diet supplemented with 0.1 g/kg \u003cem\u003eC. butyricum\u003c/em\u003e freeze-dried powder; and the BAs + C. B group received the basal diet supplemented with both 200 mg/kg goat bile acids and 0.1 g/kg \u003cem\u003eC. butyricum\u003c/em\u003e freeze-dried powder. All treatments were administered once daily for seven consecutive days. Body weights were measured at 1, 4, 7, and 10 days post-treatment (dpt) by randomly selecting three mice from each group. At 7 dpt, 1.0 mL of an \u003cem\u003eE. coli\u003c/em\u003e bacterial suspension (1.0×10⁸ CFU/mL) was intraperitoneally injected into the E. coli, BAs, C. B, and C. B + BAs groups. The \u003cem\u003eE. coli\u003c/em\u003e strain was isolated from fecal samples of clinically infected lambs in the laboratory and has been preserved for experimental use. The challenge dose was determined based on preliminary trials. Clinical signs, incidence, and mortality were recorded following infection, and tissue and biological samples were collecte at 10 dpt.\u003c/p\u003e \u003cp\u003eGoat experiment: Twelve 6-week-old Bordeaux goats were selected and acclimatized for 3 days before being randomly assigned to four groups, with three animals per group. The groups were as follows: Control, E. coli infection group, goat BAs group (BAs), and \u003cem\u003eClostridium butyricum\u003c/em\u003e + goat BAs group (C. B + BAs). The Control and E. coli groups received the basal diet only; the BAs group received the basal diet supplemented with 50 mg/kg goat bile acids; and the C. B + BAs group received the basal diet supplemented with 50 mg/kg goat bile acids and 5 g/kg \u003cem\u003eC. butyricum\u003c/em\u003e freeze-dried powder. All treatments were administered once daily for 14 consecutive days. The dosages were determined based on standard feeding practices observed on commercial goat farms. At 14 dpt, 1.0 mL of an \u003cem\u003eE. coli\u003c/em\u003e bacterial suspension (5×10⁹ CFU/mL) was administered orally to the \u003cem\u003eE. coli\u003c/em\u003e, BAs, and C. B + BAs groups. The \u003cem\u003eE. coli\u003c/em\u003e strain was previously isolated from fecal samples of clinically infected lambs in the laboratory and has been preserved for experimental use. The challenge dose was established through preliminary trials. Tissue and biological samples were collected at 21 dpt.\u003c/p\u003e\n\u003ch3\u003eSample collection\u003c/h3\u003e\n\u003cp\u003eTen days after the mice were challenged, their body weights were measured. They were then anesthetized with ether and decapitated. The blood was collected and left to stand at 37°C for 2 h. After centrifugation at 3000 r/min for 15 min, the upper serum layer was taken and stored at -80°C for future use. The intestinal samples were taken after dissection and stored at -80°C or fixed in 4% paraformaldehyde. The lambs were sent to the slaughterhouse 21 days after challenge, where they were stunned and bled from the jugular vein. Blood, liver and intestinal samples were collected and stored at -80°C. Cecal content samples were collected and frozen in liquid nitrogen for 16S rRNA sequencing.\u003c/p\u003e\n\u003ch3\u003eDetection of blood biochemical indicators\u003c/h3\u003e\n\u003cp\u003e The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) were measured according to the manufacturer's instructions using assay kits from Nanjing Jiancheng Bioengineering Institute (Batch No.: 20250508).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetection of antioxidant capacity in serum, liver and jejunum\u003c/h2\u003e \u003cp\u003eThe activities of superoxide dismutase (SOD) and reduced glutathione (GSH), as well as the level of malondialdehyde (MDA), in serum, liver tissue, and jejunum tissue were measured using commercial assay kits from Nanjing Jiancheng Bioengineering Institute (Batch No.: 20250429). To quantitatively assess the antioxidant capacity of liver and jejunum tissues, 10% tissue homogenates were prepared in physiological saline, centrifuged at 2500×g for 10 min, and the supernatants were collected for measurement of oxidative stress markers.\u003c/p\u003e \u003cp\u003e \u003cb\u003eReal-time fluorescence quantitative PCR (qRT-PCR) was employed to quantify the mRNA expression levels in tissues.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe mRNA expression levels of the target genes in jejunum tissue were quantified by qRT-PCR. Total RNA was extracted from liver and jejunum tissues using TRIzon reagent (CWBIO, China) according to the manufacturer's instructions for the Ultrapure RNA Kit (CWBIO, China). The concentration and purity of the extracted RNA were assessed using a micro UV spectrophotometer and adjusted to a uniform concentration. RNA samples were reverse transcribed into cDNA using the HiScript QRT SuperMix for qPCR (+ gDNA wiper) (Vazyme, China). The primer sequences for the target genes are listed in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e and were synthesized by Beijing Qikexin Biotechnology Co., Ltd. qPCR amplification was performed using the SYBR Green method with β-actin as the internal reference gene. The relative mRNA expression levels of the target genes were calculated using the comparative CT method (2⁻∆∆Cᴛ).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\"\u003e\u003c/div\u003e\u003ctable id=\"Tab1\" border=\"1\"\u003e \u003ccaption\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003c/colgroup\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\"\u003e \u003cp\u003eForward(5′→3′)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\"\u003e \u003cp\u003eReverse(5′→3′)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eGAGAAGAGCTACGAGCTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eCGCAGGATTCCATGCCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eAGGGAAGAGCAGTCCCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eCGCTGATGTTGGCTACAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eTGCTGGATAGCCCATGTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTGCAGAACACCACTTCTCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eAATCTGGGTTCAATCAGGCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eGCTCTGCAACTCCATGACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eIL-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eTTGGCAAGCAAGACCTGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTTTCCAAGAGGTCTCTCAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eTCAAGGAGCACGTGAACTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eCAGAAAACGATGACAGCGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eCTCCTCGTCGGGTGATCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eACAGAAACACAGTTTGCGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eOccludin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eCCATACCACTCCTCCTCCGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eGTAGTGATTAGGTTTGCTGCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eClaudin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\"\u003e \u003cp\u003eGAGTAGGGTGCTGTGGTTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\"\u003e \u003cp\u003eTATCACCTGCACACGCCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePathological histological analysis\u003c/h3\u003e\n\u003cp\u003eAfter jejunal tissues from each group were collected and fixed in 4% paraformaldehyde for 24 h, they were sequentially dehydrated through a graded ethanol series (70%, 80%, 95%, and 100%) with 40 min at each concentration, followed by clearing in xylene. The tissues were then embedded and sectioned into 5 µm-thick slices using a microtome, baked at 60°C for 1 hour, dewaxed in xylene, rehydrated through a descending alcohol series, and stained with hematoxylin and eosin (H\u0026amp;E). The sections were mounted with neutral balsam and examined under a light microscope to capture clear and complete images. Histological architecture, pathological changes, and goblet cell numbers in the jejunal tissues were evaluated.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eIn this study, Graphpad Prism 8.0 statistical analysis software was used for graphing and calculating the means and standard deviations (SD) of each group. The data of each group were expressed as Mean ± SD. Among them, “*” indicated \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, with significant differences; “**” indicated \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, with extremely significant differences; and “ns” indicated no significant difference, with 0.05 \u0026lt; \u003cem\u003eP\u003c/em\u003e ≤ 0.10, showing a significant trend.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003c/div\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results and analysis","content":"\u003cp\u003e \u003cb\u003eThe impact of ovine bile acids on body weight dynamics and mortality in mice infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of \u003cem\u003eE. coli\u003c/em\u003e infection on body weight dynamics and mortality in mice, we monitored weight changes and survival outcomes in each experimental group and presented the data using kinetic curves (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Within 7 dpi, mice in the E. coli, C. B, C. B + BAs, and BAs groups exhibited clinical signs including depression, reduced appetite, and decreased activity, with the first deaths occurring within 12 h after infection. Significant weight loss was observed in all infected groups, with the most pronounced reduction in the E. coli group and the least in the C. B + BAs group. The survival rates were 100% in the Control group, 40% in the E. coli group, 55% in the C. B group, 70% in the C. B + BAs group, and 60% in the BAs group. These findings suggest that the combined administration of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e mitigates \u003cem\u003eE. coli\u003c/em\u003e-induced weight loss and enhances survival in infected mice.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon jejunal histopathology in mice infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on jejunal morphology in mice following \u003cem\u003eE. coli\u003c/em\u003e infection, H\u0026amp;E staining was performed on jejunal tissue sections ( Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Histopathological examination revealed that \u003cem\u003eE. coli\u003c/em\u003e infection induced significant structural damage to the jejunum. However, this damage was ameliorated following treatment with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e. In the E. coli group, H\u0026amp;E staining showed extensive disruption of the mucosal epithelium, exposure of the lamina propria, and widespread necrosis and dissolution of intestinal gland tissues within the lamina propria, which were replaced by proliferative connective tissue. In contrast, the C. B, C. B + BAs, and BAs groups exhibited only mild connective tissue proliferation and focal areas of glandular necrosis, indicating partial preservation of jejunal architecture.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon the expression of tight junction proteins in the mouse jejunum following\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e \u003cb\u003einfection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on tight junction protein expression in the jejunum of mice infected with \u003cem\u003eE. coli\u003c/em\u003e, we analyzed the mRNA levels of ZO-1, Occludin, and Claudin-1 in jejunal tissues (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Compared with the Control group, the E. coli group exhibited significantly reduced mRNA expression of ZO-1, Occludin, and Claudin-1 in the jejunum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). Relative to the E. coli group, the C. B group showed significant upregulation of ZO-1 and Occludin mRNA (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), while the C. B + BAs group demonstrated marked increases in the mRNA expression of all three proteins (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). The BAs group significantly elevated ZO-1 mRNA levels (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05) and Occludin mRNA levels (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). These results indicate that \u003cem\u003eE. coli\u003c/em\u003e infection downregulates the expression of tight junction proteins ZO-1, Claudin-1, and Occludin in the mouse jejunum, and treatment with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e can partially restore their expression.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon jejunal inflammatory responses in mice infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e infection typically induces an inflammatory response characterized by elevated levels of pro-inflammatory cytokines and reduced levels of anti-inflammatory cytokines in tissues and organs. To evaluate the effects of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on \u003cem\u003eE. coli\u003c/em\u003e-induced inflammation, we measured the mRNA expression levels of pro-inflammatory cytokines IL-1β and TNF-α, as well as anti-inflammatory cytokines IL-4 and IL-10, in jejunal tissues of mice from each group using qRT-PCR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). As shown in the figure, compared with the Control group, the E. coli group exhibited significantly higher expression of IL-1β and TNF-α (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) and significantly lower expression of IL-4 and IL-10 (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). Relative to the E. coli group, both the C. B and C. B + BAs groups significantly attenuated the upregulation of IL-1β and TNF-α (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). The C. B group significantly mitigated the downregulation of IL-4 and IL-10 (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), and the C. B + BAs group showed a more pronounced effect with significant restoration of these anti-inflammatory factors (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). The BAs group significantly reduced the expression of IL-1β (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and TNF-α (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), and also partially reversed the suppression of IL-4 and IL-10 (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05). These findings indicate that \u003cem\u003eE. coli\u003c/em\u003e infection triggers a robust inflammatory response in the mouse jejunum, and dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e can effectively alleviate this inflammatory reaction.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon the antioxidant capacity in mice infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eStudies have shown that \u003cem\u003eE. coli\u003c/em\u003e infection can lead to an increase in ROS content in the animal body, causing oxidative stress and damaging the animal's immune system. Therefore, we detected the changes in the oxidative indicators MDA and SOD in the liver tissue, jejunum tissue, and serum of each group of mice to evaluate the effects of goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e on antioxidant capacity (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). As shown in the figure, the MDA levels in the liver tissue, jejunum tissue, and serum of the E. coli group were significantly and extremely significantly increased compared to the Control group after \u003cem\u003eE. coli\u003c/em\u003e infection. Adding goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e to the diet could significantly alleviate the increase in MDA levels in the jejunum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05) and extremely significantly alleviate the increase in MDA levels in the serum and liver tissue (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) caused by \u003cem\u003eE. coli\u003c/em\u003e. Compared to the E. coli group, the C. B group could extremely significantly alleviate the increase in MDA levels in the liver (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and significantly alleviate the increase in MDA levels in the serum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), with no significant difference in MDA levels in the jejunum. The BAs group could significantly alleviate the increase in MDA levels in the liver (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), with no significant difference in MDA levels in the jejunum tissue and serum. Compared to the Control group, the SOD content in the liver tissue, jejunum tissue, and serum of the E. coli group decreased extremely significantly. Compared to the E. coli group, the C. B group could extremely significantly alleviate the decrease in SOD levels in the jejunum tissue (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and significantly alleviate the decrease in SOD levels in the liver tissue and serum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05); the C. B + BAs group could extremely significantly alleviate the decrease in SOD levels in the liver tissue, jejunum tissue, and serum. This indicates that \u003cem\u003eE. coli\u003c/em\u003e infection can cause oxidative stress in mice, and goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e have strong antioxidant capacity.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon jejunal histology in goats infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on jejunal morphology in goats following \u003cem\u003eE. coli\u003c/em\u003e infection, H\u0026amp;E staining was performed on jejunal tissue sections (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). Histopathological examination revealed that \u003cem\u003eE. coli\u003c/em\u003e infection induced structural damage in the goat jejunum. However, this damage was ameliorated by treatment with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e. In the E. coli group, the jejunal architecture was severely disrupted, with extensive necrosis, accumulation of necrotic cellular debris and amorphous eosinophilic material, and widespread loss of intestinal gland epithelial cells due to necrosis and sloughing. In contrast, the C. B + BAs group exhibited numerous leaf-like villi of reduced length and minimal epithelial cell shedding. The BAs group displayed abundant finger-like villi that were elongated, although accompanied by moderate epithelial cell shedding and loss. The submucosa consisted of loose connective tissue with mild granulocyte infiltration. These findings suggest a partial protective effect of the interventions on jejunal integrity.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon the expression of tight junction proteins in the jejunal tissue of goats infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on jejunal barrier function in goats infected with \u003cem\u003eE. coli\u003c/em\u003e, we analyzed the mRNA expression levels of tight junction proteins ZO-1, Occludin, and Claudin-1 in jejunal tissues (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e). Compared with the Control group, the E. coli group exhibited significantly reduced mRNA expression of ZO-1 and Occludin (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and a highly significant decrease in Claudin-1 expression (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.001). Relative to the E. coli group, the C. B + BAs group showed significant upregulation of ZO-1 and Claudin-1 (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and a moderate increase in Occludin expression (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05). The BAs group significantly increased the mRNA levels of ZO-1 and Claudin-1 (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), but no significant change was observed in Occludin expression compared to the E. coli group. These results indicate that \u003cem\u003eE. coli\u003c/em\u003e infection downregulates the expression of key tight junction proteins—ZO-1, Occludin, and Claudin-1 in the goat jejunum, and supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e can partially restore their expression. Notably, the combination treatment exerted a more pronounced protective effect than either agent alone.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon jejunal inflammatory responses in goats infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e infection typically induces an inflammatory response characterized by elevated levels of pro-inflammatory cytokines and reduced levels of anti-inflammatory cytokines in tissues and organs. To evaluate the effects of caprine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on \u003cem\u003eE. coli\u003c/em\u003e-induced inflammation, we measured the mRNA expression levels of pro-inflammatory cytokines IL-1β, TNF-α, and IL-6, as well as anti-inflammatory cytokines IL-4 and IL-10, in jejunal tissues of mice from each group using qRT-PCR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e). Compared with the Control group, the E. coli group exhibited significantly increased mRNA expression of IL-1β, TNF-α, and IL-6 (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), while mRNA levels of IL-4 and IL-10 were significantly decreased (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). Relative to the E. coli group, the C. B + BAs group significantly downregulated TNF-α and IL-6 expression (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), moderately reduced IL-1β expression (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), and significantly upregulated IL-4 expression, with no significant change in IL-10. The BAs group significantly suppressed IL-1β and TNF-α expression (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05) and markedly reduced IL-6 levels (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), but showed no significant effect on IL-4 or IL-10 expression. These findings indicate that \u003cem\u003eE. coli\u003c/em\u003e infection triggers a robust inflammatory response in the jejunum, and dietary supplementation with caprine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e can mitigate this inflammatory reaction, with the combination treatment showing greater efficacy.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon antioxidant capacity in goats infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e infection increases reactive oxygen species (ROS) levels in animals, leading to oxidative stress and impaired immune function. To evaluate the effects of caprine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e on antioxidant capacity, we measured glutathione (GSH) and superoxide dismutase (SOD) levels in liver tissue, jejunal tissue, and serum from each group of goats using assays corresponding to Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e. Compared with the Control group, the E. coli group exhibited a highly significant decrease in GSH levels in the jejunum and serum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and a significant reduction in hepatic GSH (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05). SOD levels in the liver, jejunum, and serum were also profoundly reduced (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). Relative to the E. coli group, the C. B + BAs group significantly increased GSH levels in the liver and jejunum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), as well as in the serum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), and showed a highly significant restoration of SOD activity across all three compartments (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). The BAs group significantly elevated hepatic GSH (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01) and serum GSH (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), but no significant change was observed in jejunal GSH. Additionally, the BAs group significantly enhanced SOD levels in the liver and serum (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), with no significant improvement in jejunal SOD. These findings indicate that \u003cem\u003eE. coli\u003c/em\u003e infection induces systemic oxidative stress in goats, and supplementation with caprine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e enhances antioxidant defenses, with the combination treatment demonstrating superior efficacy.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon serum biochemical indicators in goats infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e infection is likely to impair liver function. To assess the impact of \u003cem\u003eE. coli\u003c/em\u003e infection on hepatic status and the effects of dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e, we measured serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) in goats from each group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e). Compared with the Control group, the E. coli group exhibited significantly elevated serum AST and ALT levels (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.001) and a marked increase in LDH levels (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). Relative to the E. coli group, both the C. B + BAs and BAs groups significantly reduced serum AST, ALT, and LDH levels (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01). These results indicate that \u003cem\u003eE. coli\u003c/em\u003e infection induces hepatocellular injury, as reflected by increased serum transaminase and LDH activities, and that dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e effectively mitigates this enzyme elevation, suggesting a protective effect on liver function.\u003c/p\u003e\u003cp\u003e \u003c/p\u003e\u003cp\u003e \u003cb\u003eThe effects of ovine bile acids and\u003c/b\u003e \u003cb\u003eC. butyricum\u003c/b\u003e \u003cb\u003eon the intestinal microbiota of goats infected with\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the impact of \u003cem\u003eE. coli\u003c/em\u003e infection on the intestinal microbiota in goats, 16S rRNA gene sequencing was performed, and effective sequences were clustered into operational taxonomic units (OTUs) using the Vsearch algorithm at a 97% sequence similarity threshold (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e). The total number of OTUs was 6,491 in the Control group, 6,117 in the E. coli group, 6,809 in the C. B + BAs group, and 5,427 in the BAs group. A total of 351 OTUs were shared among all four groups, with unique OTUs numbering 5,066, 4,545, 5,606, and 4,306, respectively. The C. B + BAs group exhibited the highest species richness, as reflected by both the total and unique OTU counts, indicating that the combination of caprine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e significantly enhanced microbial diversity. To assess sequencing depth, rarefaction curves were analyzed; as sequencing depth increased, the curves approached saturation, suggesting that the sequencing effort adequately captured the majority of microbial diversity in the samples. Rank-abundance curves, which reflect both species richness and evenness, showed low richness and uneven distribution in the E. coli group, whereas the C. B + BAs group displayed the highest richness and improved evenness. Alpha diversity analysis revealed that the C. B + BAs group had a significantly lower Simpson index compared to the E. coli group (\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05), indicating higher diversity, while no significant differences were observed in the Chao1 or ACE indices. At the phylum level, the dominant bacterial taxa included Bacillota (formerly Firmicutes), Bacteroidota, Pseudomonadota, and Verrucomicrobiota. Notably, the relative abundance of Bacillota was increased in the C. B + BAs group compared to the E. coli group, suggesting a beneficial modulation of gut microbiota composition. Furthermore, principal coordinate analysis (PCoA) based on beta diversity revealed distinct clustering patterns, with the E. coli group clearly separated from the C. B + BAs and BAs groups, indicating significant structural differences in microbial communities. These findings demonstrate that dietary supplementation with caprine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e, particularly in combination, can effectively enrich and reshape the intestinal microbiota in \u003cem\u003eE. coli\u003c/em\u003e-infected goats.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe harm and economic losses caused by pathogenic \u003cem\u003eE. coli\u003c/em\u003e in goat have become increasingly severe, making it one of the most serious infectious diseases threatening the goat industry today. In China, antibiotics are commonly used in clinical practice to prevent and treat \u003cem\u003eE. coli\u003c/em\u003e infections in goat; however, excessive and inappropriate use has led to widespread bacterial resistance. Against the current backdrop of antibiotic bans and restrictions in animal production, developing effective alternative antibacterial agents has become particularly urgent (Ren et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Bile acids are important components of bile and are endogenous molecules synthesized from cholesterol in the liver. Due to their safety, environmental compatibility, and high efficacy, they have been approved by the national authorities as a novel feed additive and are widely used in livestock and aquaculture industries (Collins et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Previous studies have demonstrated that ovine bile acids possess beneficial properties including hepatobiliary protection, reduction of oxidative stress, and improvement of intestinal barrier function (Xu et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). \u003cem\u003eC. butyricum\u003c/em\u003e, a Gram-positive, anaerobic bacterium isolated from the intestines of healthy humans and animals, exhibits strong probiotic characteristics (Chen et al., 2019). \u003cem\u003eC. butyricum\u003c/em\u003e is resistant to heat, acid, and multiple antibiotics, and produces butyric acid (Liang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It can modulate host intestinal microecological balance, restore intestinal barrier integrity, and enhance immune function, thereby offering broad application potential in animal health and production.\u003c/p\u003e \u003cp\u003eThe combined use of goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e theoretically can produce asynergistic effect, forming a very ideal treatment strategy. goat bile acid can quickly control the number of pathogenic \u003cem\u003eE. coli\u003c/em\u003e by taking advantage of its antibacterial and antitoxin capabilities. Subsequently, \u003cem\u003eC. butyricum\u003c/em\u003e, on the one hand, inhibits the remaining pathogenic bacteria and, on the other hand, repairs the intestinal mucosa damaged by \u003cem\u003eE. coli\u003c/em\u003e. Some probiotics are inhibited or killed by bile acid, but \u003cem\u003eC. butyricum\u003c/em\u003e can form spores and has extremely strong tolerance to bile acid, allowing it to smoothly pass through the upper digestive tract and survive and colonize in the intestinal environment containing bile acid (Zhou et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This makes the combination of it and goat bile acid possible. Goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e have great potential in treating diarrhea caused by \u003cem\u003eE. coli\u003c/em\u003e. Here, we evaluated the protective effects of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e in mice and goats infected with \u003cem\u003eE. coli\u003c/em\u003e. We demonstrated that dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e mitigates the adverse effects of \u003cem\u003eE. coli\u003c/em\u003e infection by enhancing antioxidant capacity and intestinal immune function, reducing inflammatory responses, and improving intestinal barrier integrity and microbiota composition in both animal models.\u003c/p\u003e \u003cp\u003eThe jejunum is a key segment of the gastrointestinal tract and serves as the primary site for nutrient digestion and absorption in the body (Koga et al., 2012). In this study, \u003cem\u003eE. coli\u003c/em\u003e infection was found to induce structural damage in the jejunum of both mice and goats, whereas supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e alleviated such intestinal injury. Tight junction proteins play a critical role in maintaining intestinal barrier function and integrity and constitute a vital defense mechanism against inflammation and dysbiosis. Reduced expression of these proteins has been shown to increase intestinal permeability, compromising gut health (Kuo et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our results demonstrate that ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e upregulated the mRNA expression of Occludin, Claudin-1, and ZO-1 in the jejunum of \u003cem\u003eE. coli\u003c/em\u003e-infected mice, a finding consistent with observations in infected goats. This protective effect may be mediated through oxidative stress pathways, as oxidative stress can disrupt tight junctions; ovine bile acids may counteract this disruption by enhancing systemic antioxidant capacity, thereby preserving junctional protein integrity. The intestinal mucosal immune system functions largely through lymphocytes, including intraepithelial lymphocytes, which secrete cytokines such as IL-4 and IL-10, playing essential roles in maintaining mucosal integrity and regulating immune responses. Alterations in cytokine levels and gene expression serve as indirect indicators of host health status (Chen et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In \u003cem\u003eE. coli\u003c/em\u003e-infected mice, jejunal expression of pro-inflammatory cytokines IL-6, IL-1, and TNF-α was significantly elevated, while anti-inflammatory cytokines IL-4 and IL-10 were markedly downregulated. Dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e effectively reversed these imbalances, and similar trends were observed in infected goats. Notably, the combination of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e exerted a more pronounced protective effect than bile acid treatment alone.\u003c/p\u003e \u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e infection induces systemic inflammation and triggers the accumulation of reactive oxygen species (ROS) in organs and tissues. Excessive ROS accumulation can impair cellular activity, leading to apoptosis and necrosis, ultimately compromising normal tissue and organ function (Zeng et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In this study, \u003cem\u003eE. coli\u003c/em\u003e infection in mice significantly increased malondialdehyde (MDA) levels in the liver, jejunum, and serum, while decreasing superoxide dismutase (SOD) activity. Dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e alleviated these oxidative stress markers, indicating a protective effect against \u003cem\u003eE. coli\u003c/em\u003e-induced oxidative damage. Consistent with findings in mice, \u003cem\u003eE. coli\u003c/em\u003e infection in goats also altered the levels or activities of MDA, SOD, and glutathione (GSH) in liver, jejunum, and serum, indicative of oxidative injury. The present results demonstrate that ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e mitigate oxidative damage in both animal models; however, the underlying mechanisms remain to be fully elucidated and warrant further investigation.\u003c/p\u003e \u003cp\u003eSerum biochemical indicators can reflect the health status of animals to some extent (Tang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Consistent with previous findings, this study showed that the activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH) in the serum of goats infected with \u003cem\u003eE. coli\u003c/em\u003e were significantly elevated, indicating that \u003cem\u003eE. coli\u003c/em\u003e infection induced hepatic dysfunction. Dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e alleviated this impairment to varying degrees.\u003c/p\u003e \u003cp\u003eThe digestive system microecosystem of ruminants is a complex environment composed of diverse microbial communities, with bacteria playing a dominant role (Asakura et al., 2022). These microbial populations provide the host with a wide range of enzymes and play a crucial role in promoting nutrient digestion and absorption, supporting animal growth and development, and enhancing immune function. \u003cem\u003eE. coli\u003c/em\u003e infection disrupts intestinal homeostasis in the host, and restoring this balance represents an effective strategy for managing \u003cem\u003eE. coli\u003c/em\u003e infection. In this study, \u003cem\u003eE. coli\u003c/em\u003e infection in goats was associated with reduced diversity and richness of intestinal microbiota. However, dietary supplementation with bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e increased the abundance of Firmicutes in the intestine compared to the E. coli group. Most members of the phylum Firmicutes are beneficial bacteria that play a key regulatory role in maintaining intestinal health, suggesting that bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e can modulate the intestinal microbiota and may contribute significantly to the restoration of microbial homeostasis.\u003c/p\u003e \u003cp\u003eIn conclusion, our results demonstrate that \u003cem\u003eE. coli\u003c/em\u003e infection causes damage to intestinal morphology and structure, impairs intestinal barrier function, induces intestinal inflammation, reduces systemic antioxidant capacity, and disrupts the homeostasis of the gut microbiota in both mice and goats. Dietary supplementation with ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e effectively improves serum enzyme activity and antioxidant capacity, alleviates intestinal inflammatory responses, enhances intestinal barrier integrity, and promotes microbial richness and diversity in \u003cem\u003eE. coli\u003c/em\u003e-infected animals. The combined use of ovine bile acids and \u003cem\u003eC. butyricum\u003c/em\u003e exerts a synergistic protective effect in infected mice and goats. These findings provide theoretical and experimental support for the joint development of these agents as novel green antibacterial additives in animal production.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eMethodology: Z.Y.Z, Q.Y.B.Project administration: K.W, Z.H.S.Resources: Z.H.S, K.W.Software: Z.Y.Z, Q.Y.B.C.LSupervision: Z.H.S, K,W.Validation:Z.Y.Z,Q.Y.B,Z.H.S, K.W.Visualization: Z.Y.Z, Q.Y.B,Z.H.S, K.W.Writing \u0026ndash; original draft: Z.Y.Z, Q.Y.B.Writing \u0026ndash; review \u0026amp; editing: Z.Y.Z, Q.Y.B, K.W,H.Y.S,Y.F.D,Y.L,F.E.Y,N,J\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThis work has been provided with technical support by the earmarked fund for Shandong Agriculture Research System (SDARS-10-05), and Shandong science and technology project of traditional chinese medicine (M-2023041).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAmoah EA, Gelaye S (1997) Biotechnological advances in goat reproduction. J Anim Sci 75:578\u0026ndash;585\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHume DA, Whitelaw CBA, Archibald AL (2011) The future of animal production: improving productivity and sustainability[J]. J Agricultural Sci 149:9\u0026ndash;16\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGozi KS, Deus Ajude LPT, Barroso MDV, Silva CRD, Peir\u0026oacute; JR, Mendes LCN, Nogueira MCL, Casella T (2021) Potentially Pathogenic Multidrug-Resistant in Lamb Meat. Microb Drug Resist 27:1071\u0026ndash;1078\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Zhao H, Zhou Z, Miao Y, Li R, Yang B, Cao C, Xiao S, Wang X, Liu H, Wang J, Yang Z (2022) Characterization of Extended-Spectrum β-Lactamase-Producing \u003cem\u003eEscherichia coli\u003c/em\u003e Isolates That Cause Diarrhea in Sheep in Northwest China. Microbiol Spectr 10:159\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTardiolo G, La Fauci D, Riggio V, Daghio M, Di Salvo E, Zumbo A, Sutera AM (2025) Gut Microbiota of Ruminants and Monogastric Livestock: An Overview. Anim Basel 15:758\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Dawson PA (2019) Animal models to study bile acid metabolism. Biochim Biophys Acta Mol Basis Dis 1865:895\u0026ndash;911\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Nirmagustina DE, Kumrungsee T, Okazaki Y, Tomotake H, Kato N (2017) Feeding of the water extract from Ganoderma lingzhi to rats modulates secondary bile acids, intestinal microflora, mucins, and propionate important to colon cancer. Biosci Biotechnol Biochem 81:1796\u0026ndash;1804\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIcho S, Ward JS, Tam J, Kociolek LK, Theriot CM, Melnyk RA (2023) Intestinal bile acids provide a surmountable barrier against C. difficile TcdB-induced disease pathogenesis. Proc Natl Acad Sci U S A 120:120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStoeva MK, Garcia-So J, Justice N, Myers J, Tyagi S, Nemchek M, McMurdie PJ, Kolterman O, Eid J (2021) Butyrate-producing human gut symbiont, \u003cem\u003eClostridium butyricum\u003c/em\u003e, and its role in health and disease. Gut Microbes 13:1\u0026ndash;28\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie M, Yuan K, Zhang Y, Zhang Y, Zhang R, Gao J, Wei W, Jiang L, Li T, Ding Y, Wang L, Lin Y, Wong CC, Yu J (2025) Tumor-resident probiotic \u003cem\u003eClostridium butyricum\u003c/em\u003e improves aPD-1 efficacy in colorectal cancer models by inhibiting IL-6-mediated immunosuppression. Cancer Cell 43:1885\u0026ndash;1901\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Minyan H, Min C, Weidong (2025) Effects of a combination of \u003cem\u003eClostridium butyricum\u003c/em\u003e and Lactobacillus acidophilus on production performance, immune function, antioxidant capacity and meat quality of broilers [J]. Chin J Anim Sci 61:300\u0026ndash;307\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou H, Quanxi X, Xiaohui L (2021) Performance Study of Several \u003cem\u003eClostridium butyricum\u003c/em\u003e Strains [J]. China Brew 40:120\u0026ndash;123\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen Z, Chen W, Getachew T, Mwacharo JM, Haile A, Sun W (2023) Expression analysis of TLR signaling pathway genes under lipopolysaccharide-induced and \u003cem\u003eE. coli\u003c/em\u003e F17-infected sheep intestinal epithelial cells. Anim Biotechnol 34:1815\u0026ndash;1821\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollins SL, Stine JG, Bisanz JE, Okafor CD, Patterson AD (2023) Bile acids and the gut microbiota: metabolic interactions and impacts on disease. Nat Rev Microbiol 21:236\u0026ndash;247\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H, Luo H, Zhang J, Li K, Lee MH (2023) Therapeutic potential of \u003cem\u003eClostridium butyricum\u003c/em\u003e anticancer effects in colorectal cancer. Gut Microbes 15:114\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen D, Jin D, Huang S, Wu J, Xu M, Liu T, Dong W, Liu X, Wang S, Zhong W, Liu Y, Jiang R, Piao M, Wang B, Cao H (2020) \u003cem\u003eClostridium butyricum\u003c/em\u003e, a butyrate-producing probiotic, inhibits intestinal tumor development through modulating Wnt signaling and gut microbiota. Cancer Lett 469:456\u0026ndash;467\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang J, Kou S, Chen C, Raza SHA, Wang S, Ma X, Zhang WJ, Nie C (2021) Effects of \u003cem\u003eClostridium butyricum\u003c/em\u003e on growth performance, metabonomics and intestinal microbial differences of weaned piglets. BMC Microbiol 21:85\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Xu X, Liang J, Wang J, Li Y (2022) The relationship between \u003cem\u003eClostridium\u003c/em\u003e butyricum and colorectal cancer. J Cancer Res Ther 18:1855\u0026ndash;1859\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuo WT, Odenwald MA, Turner JR, Zuo L (2022) Tight junction proteins occludin and ZO-1 as regulators of epithelial proliferation and survival. Ann N Y Acad Sci 1514:21\u0026ndash;33\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Cui W, Li X, Yang H (2021) Interaction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease. Front Immunol 12:761981\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Y, Yang Q, Ouyang Y, Lou Y, Cui H, Deng H, Zhu Y, Geng Y, Ouyang P, Chen L, Zuo Z, Fang J, Guo H (2023) Nickel induces blood-testis barrier damage through ROS-mediated p38 MAPK pathways in mice. Redox Biol 67:102886\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang H, Zhang H, Liu D, Wang Z, Yu D, Fan W, Guo Z, Huang W, Hou S, Zhou Z (2022) Genome-wide association study reveals the genetic determinism of serum biochemical indicators in ducks. BMC Genomics 23:856\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamamoto S, Sasaki Y, Okada Y, Katabami S, Fujimori A, Munakata K, Shiraki Y, Nishibu H, Hisamoto C, Kawase J, Ojima Y, Kiyoshima A, Shiroma K (2022) Bacterial Distribution and Community Structure in Beef Cattle Liver and Bile at Slaughter. J Food Prot 85:424\u0026ndash;434\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNesta B, Pizza M (2018) Vaccines Against \u003cem\u003eEscherichia coli\u003c/em\u003e. Curr Top Microbiol Immunol 416:213\u0026ndash;242\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Goat bile acid, Clostridium butyricum, Escherichia coli, Lamb, Intestine","lastPublishedDoi":"10.21203/rs.3.rs-9061762/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9061762/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe goat industry has emerged as one of the major livestock sectors in China, with an annual production exceeding 300\u0026nbsp;million head. Bacterial diseases in goat pose significant threats to the sustainability and productivity of goat farming. Clinically, antibiotic treatments in ruminants are associated with considerable side effects, raising concerns about food safety. Therefore, the development of antibacterial functional feed additives has become an urgent priority for the industry. Bile acids are endogenous molecules synthesized in the liver through cholesterol metabolism and serve critical physiological roles, including hepatobiliary protection, reduction of oxidative stress, and enhancement of intestinal barrier function. They exert antimicrobial effects against pathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e (\u003cem\u003eE. coli\u003c/em\u003e) primarily through direct mechanisms\u0026mdash;such as disruption of the phospholipid bilayer of the bacterial cell membrane, leading to intracellular content leakage and subsequent bacterial cell death. Indirectly, bile acids promote the secretion of water and electrolytes in the intestine and modulate the gut microbiota composition, thereby creating an intestinal environment unfavorable for pathogenic bacterial survival. \u003cem\u003eClostridium butyricum\u003c/em\u003e (\u003cem\u003eC. butyricum\u003c/em\u003e) contributes to intestinal health by maintaining gut microecological stability and reinforcing the intestinal barrier.Upon entering the intestinal tract, \u003cem\u003eC. butyricum\u003c/em\u003e produces the antimicrobial agent butyric acid, which lowers the intestinal pH and thereby inhibits the growth of pathogenic \u003cem\u003eE. coli\u003c/em\u003e. One of its core functions is to promote the proliferation and repair of intestinal epithelial cells and enhance the expression of tight junction proteins, facilitating the restoration of the intestinal barrier damaged by \u003cem\u003eE. coli\u003c/em\u003e infection, and ultimately alleviating diarrhea and systemic inflammation at their source. Goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e exhibit strong potential for the treatment of \u003cem\u003eE. coli\u003c/em\u003e-induced diarrhea. While goat bile acid excels in direct pathogen suppression, \u003cem\u003eC. butyricum\u003c/em\u003e specializes in repairing and restoring intestinal homeostasis. Their combination offers a comprehensive therapeutic strategy that spans acute pathogen control to long-term mucosal recovery, presenting a highly promising biological alternative for reducing or replacing antibiotic use\u0026mdash;particularly in cases involving antibiotic-associated dysbiosis and antimicrobial resistance.In this study, a mouse model of \u003cem\u003eE. coli\u003c/em\u003e infection was first established to investigate the protective effects of dietary supplementation with goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e in infected mice, aiming to determine the optimal infection dose for the \u003cem\u003eE. coli\u003c/em\u003e-induced diarrhea model and to identify effective therapeutic doses of goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e. The results demonstrated that concurrent supplementation with 200 mg/kg goat bile acid and 0.1 g/mouse of \u003cem\u003eC. butyricum\u003c/em\u003e freeze-dried powder significantly alleviated infection-related damage and conferred protective benefits. Based on these findings, a diarrheal lamb model was further developed to evaluate the protective efficacy of the same interventions against \u003cem\u003eE. coli\u003c/em\u003e infection in a clinically relevant large animal model. Dietary co-administration of 50 mg/kg goat bile acid and 5 g/lamb of \u003cem\u003eC. butyricum\u003c/em\u003e freeze-dried powder was shown to enhance antioxidant capacity, reduce intestinal inflammatory responses, improve jejunal architecture, strengthen intestinal barrier function, and increase gut microbiota diversity in infected lambs. Notably, the combination regimen outperformed goat bile acid monotherapy. This study demonstrates that dietary supplementation with both goat bile acid and \u003cem\u003eC. butyricum\u003c/em\u003e effectively protects lambs against \u003cem\u003eE. coli\u003c/em\u003e infection and holds promise for practical application in ruminant health management.\u003c/p\u003e","manuscriptTitle":"Goat bile acid and Clostridium butyricum exert a synergistic effect in enhancing the therapeutic efficacy against diarrhea induced by Escherichia coli infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-24 17:18:13","doi":"10.21203/rs.3.rs-9061762/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-30T00:33:10+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-10T19:25:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-26T09:08:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"37960969268196328982038764981456550763","date":"2026-03-23T18:58:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"286350081201236141317182825588096585098","date":"2026-03-20T01:27:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-20T01:17:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-09T09:58:25+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-09T09:57:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Probiotics and Antimicrobial Proteins","date":"2026-03-08T03:28:01+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d64acef2-e59e-4934-9b38-f40bb42f66e5","owner":[],"postedDate":"March 24th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-04-30T00:33:10+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-17T00:38:11+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-24 17:18:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9061762","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9061762","identity":"rs-9061762","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00