Neuronal oversight of germline small RNAs prevents heat-induced sterility in lab-domesticated Caenorhabditis elegans

Neuronal oversight of germline small RNAs prevents heat-induced sterility in lab-domesticated Caenorhabditis elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Neuronal oversight of germline small RNAs prevents heat-induced sterility in lab-domesticated Caenorhabditis elegans View ORCID Profile Chee Kiang Ewe , Hanna Achache , Shir Weiss , Anna Mogilevskaya , Myriam Valenski , View ORCID Profile Guy Teichman , Sarit Anava , Hila Gingold , Rachel Posner , Olga Antonova , Yonatan B. Tzur , Oded Rechavi doi: https://doi.org/10.1101/2025.08.07.669182 Chee Kiang Ewe 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Chee Kiang Ewe For correspondence: ethanewe{at}gmail.com tzur{at}mail.huji.ac.il odedrechavi{at}gmail.com Hanna Achache 2 The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem ; Jerusalem, 9190401, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shir Weiss 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Anna Mogilevskaya 2 The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem ; Jerusalem, 9190401, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Myriam Valenski 2 The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem ; Jerusalem, 9190401, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Guy Teichman 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Guy Teichman Sarit Anava 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hila Gingold 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rachel Posner 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Olga Antonova 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yonatan B. Tzur 2 The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem ; Jerusalem, 9190401, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: ethanewe{at}gmail.com tzur{at}mail.huji.ac.il odedrechavi{at}gmail.com Oded Rechavi 1 School of Neurobiology, Biochemistry and Biophysics, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University ; Tel Aviv-Yafo, 6997801, Israel Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: ethanewe{at}gmail.com tzur{at}mail.huji.ac.il odedrechavi{at}gmail.com Abstract Full Text Info/History Metrics Preview PDF Abstract Thermal pollution, whether local or driven by global warming, threatens biodiversity in part through its detrimental effects on reproduction. Non-coding small RNAs (sRNAs) are crucial for maintaining germline developmental robustness under heat stress. Remarkably, we uncovered that neuronal sRNAs regulate germ cells’ thermotolerance, affecting both spermatogenic and oogenic germline in a cell non-autonomous manner. Furthermore, we demonstrate that an oxygen-sensing neural circuit antagonizes germline maintenance, likely reflecting the nematode’s innate association of reduced oxygen levels with food availability and reproductive permissive environments. Finally, we provide evidence that sRNAs buffer the negative consequences of laboratory domestication, which otherwise cause the laboratory strain to lose germline integrity and become sterile at elevated temperatures. Hence, our findings reveal that mere sensory perception, independent of direct environmental change, modulates germline integrity through sRNA pathways, highlighting a novel mechanism by which neural circuits integrate environmental information to safeguard reproductive fitness in fluctuating environments. Main Text “We are going to die, and that makes us the lucky ones. Most people are never going to die because they are never going to be born.” Underlying Richard Dawkins’ beautiful words is an important reminder: intricate molecular machinery has evolved to ensure germline immortality – but this is not to be taken for granted. Reproductive health is strongly influenced by environmental factors. Mass extinctions are happening at unprecedented scale, driven in large part by rising global temperatures that cause widespread fertility loss. Climate change is linked to declining male and female fertility from plants to mammals, posing a significant challenge for future generations ( 1 , 2 ). How do organisms endure and adapt in such difficult times? Non-coding small RNAs (sRNAs), including siRNAs, miRNAs, and piRNAs, together with Argonautes (AGOs), play conserved roles in germline development and fertility ( 3 ). In flies and mammals, loss of PIWI proteins leads to germ cell loss and transposon de-repression ( 4 – 6 ). In mice, endo-siRNAs are critical for oogenesis, while miRNAs and piRNA are essential for multiple aspects of spermatogenesis ( 7 – 11 ). Similarly, in the nematode C. elegans , sRNAs play key roles in germ cell development ( 12 – 17 ). Given the potential of sRNA/AGO pathways to drive plastic gene regulatory programs, it is of great interest to understand how they regulate fecundity in changing environments. Here, we show that neuron-to-germline communication plays an important role in regulating germline development under heat stress in laboratory-domesticated C. elegans . Specifically, we found that the oxygen-sensing neural circuit – a recurring target of environmental adaptation – modulates sRNA-mediated germline development in the presence of heat stress. Our results further reveal the molecular basis by which environmental sensory perception – despite no change in absolute oxygen levels – influences developmental robustness of germ cells through neuropeptide signaling and highlight how epigenetic mechanisms may buffer the negative effects of laboratory-derived mutations on reproductive fitness, particularly in stressful conditions. Endo-siRNAs protect sperm thermotolerance TRBP2 is a dsRNA-binding protein essential for Dicer-mediated miRNA production in vertebrates ( 18 ). In flies, its homolog R2D2 and Loqs-PD, together with Dicer, facilitate siRNA loading onto RISC ( 19 , 20 ). In C. elegans , the TRBP2 homolog RDE-4 is critical for exogenous RNAi and antiviral defense by binding long dsRNAs and interacting with DCR-1/Dicer, DRH-1/RIC-I, and the AGO RDE-1 ( 21 – 24 ). RDE-4 is also required for the biogenesis of endogenous siRNAs and ensures their proper loading onto AGOs ( 25 , 26 ). Central to this study, previous work uncovered an important role of RDE-4 in embryogenesis during heat stress, with the loss- of-function mutants exhibiting temperature-sensitive developmental defects and laying arrested embryos at 25 °C ( 27 ). Here, we similarly found that rde-4 (-) mutants are fertile at 15 °C and 20 °C; however, our results show that, at 25 °C, they lay unfertilized oocytes – large, dark, rounded cells with prominent nuclei – that are readily distinguishable from unhatched embryos ( Fig. 1A-C ). Arrested unfertilized oocytes usually undergo meiotic maturation in the absence of sperm and become endomitotic, resulting in polyploidy and nuclear hypertrophy (see below) ( 28 ). We observed this phenotype across three different alleles of rde-4 : ne299 (A123→STOP), uu53 (925 bp deletion), pig51 (637 bp deletion) ( Fig. 1A-D and fig. S1). We found that the fertility defects in rde-4 (-) under heat stress stems from sperm failure, as crossing rde-4 (-) to wild-type males rescued the phenotype ( Fig. 1E ). Download figure Open in new tab Fig. 1. Loss of RDE-4 compromises sperm thermotolerance. ( A-D ) rde-4(ne299) shows temperature-sensitive fertility defects. (A) L4 larvae were transferred from 20 °C to 15 °C or 25 °C. The fertility of day 2 adults was scored. (B) At 25 °C, rde-4(ne299) animals lay unfertilized oocytes, which are morphologically distinct from fertilized embryos. (C) Unfertilized oocytes tend to accumulate and stack within the gonads of rde-4(ne299) at 25 °C. (D) rde-4(pig51) shows similar phenotypes to rde-4(ne299) . Scale bar = 100 μm. ( E ) The fertility defects of rde-4(ne299) at 25 °C is rescued by crossing with wild-type males. ( F ) MSP expression and localization is severely disrupted in male gonad in rde-4(ne299); him-5(e1490) at 25 °C. Scale bar = 50 μm. ( G ) Sperm from rde-4(ne299); him-5(e1490) exhibits chromosomal abnormalities. Arrows mark chromosomal bridges; asterisk indicates decondensation of DNA. Scale bar = 10 μm. ( H ) rde-4(ne299); him-5(e1490) males fail to mate with fog-2(q71) female at 25 °C. Error represents mean ± SD. * p ≤ 0.05; **** p < 0.0001. Given the sperm defects observed in rde-4 (-) hermaphrodites ( Fig. 1A-E ), we wondered whether rde-4 (-) also plays a role in male sperm development. To enrich for males, we introduced a him-5 mutation, which induces high frequency of X chromosome nondisjunction without compromising sperm morphology and functions ( 29 ). In him-5(-) males, major sperm protein (MSP), which is essential for sperm functions in nematodes, is packed into fibrous bodies and localized to membranous organelles; on the other hand, its organization is severely disrupted and MSP remain diffused in rde-4(-); him-5(-) males at 25 °C ( Fig. 1F ). In addition, we observed pronounced chromosomal abnormalities in spermatocytes from rde-4(-); him-5(-) males ( Fig. 1G ). Because fog-2(-) mutants lack self-sperm and rely on mating for reproduction, fog-2(-) females crossed with him-5 males restored fertility. However, rde-4(-); him-5(-) males failed to sire progeny ( Fig. 1H ). Together, these results indicate that RDE-4, functioning in the endo-siRNA pathway, is required for the thermotolerance of sperm in both hermaphrodites and males. Neuron-to-germline communication affects sperm development C. elegans contains a highly elaborate sRNA/AGO machinery, consisting of at least 19 AGOs that act sequentially to mediate potent gene silencing responses in diverse biological contexts ( 30 – 32 ). In the endogenous siRNA pathway, the ERI complex produces 26G sRNAs using mRNAs as templates. The 22G sRNAs are then loaded onto primary AGOs: ERGO-1 in oocytes and embryos, and ALG-3/4 in sperm, which recruit RNA-dependent RNA polymerases (RdRPs) RRF-1 and EGO-1, leading to the production of abundant secondary 22G sRNAs ( 12 , 33 , 34 ). In sperm, WAGO-10 and CSR-1a bind 22G sRNA and function downstream of ALG-3/4 to regulate spermatogenesis ( 12 , 13 ). RDE-4 is required for the full production of 26G endo-siRNAs, although it is dispensable in certain cases ( 25 , 35 , 36 ). We found that siRNAs targeting spermatogenic genes are upregulated in rde-4(-) mutants grown at 25 °C compared to 20 °C ( Fig. 2A ). Notably, at 25 °C, upregulated siRNAs in rde-4(-) relative to wildtype are enriched for those targeting sperm genes, male-enriched genes, and known ALG-3/4-class sRNAs ( Fig. 2B and fig . S2A). Download figure Open in new tab Fig. 2. Neuronal RDE-4 promotes sperm thermotolerance. ( A ) siRNA targeting spermatogenic genes are upregulated in rde-4(ne299) grown at 25 °C compared 20 °C. ( B-D ) siRNAs targeting male-enriched genes, spermatogenic genes and ALG-3/4-class sRNAs are upregulated in rde-4(ne299) compared to wild type at 25 °C, which is rescued by neuronal rde-4(+) driven by sng-1 /synaptogyrin promotor. ( E ) Spermatogenic transcripts are upregulated in rde-4(ne299) and restored by neuronal rde-4(+) . ( F ) Expression of AGO and RdRP genes are dysregulated in rde-4(ne299) , which is rescued by neuronal rde-4(+) in some cases. ( G-I ) Neuronal rde-4(+) partially rescues fertility defects in rde-4(ne299) . (G) Number of unfertilized oocytes laid were scored. (H) Percent of worms carrying endomitotic nuclei were scored. (I) rde-4(ne299) day 1 adult carries endomitotic nuclei and shows disrupted MSP expression at 25 °C. These phenotypes are rescued by neuronal rde-4(+). Scale bar = 20 μm. ( J ) The effects of neuronal rde-4(+) are not affected by the loss of sid-1 . ( K ) Schematic of mosaic uniparental inheritance induced by GPR-1 overexpression. ( L ) Wild-type rde-4 in the neurons of mosaic animals partially rescues fertility defects. Error represents mean ± SD. ns p > 0.05; * p ≤ 0.05; ** p < 0.01; **** p < 0.0001. We recently demonstrated that neuronal RDE-4 may alter germline gene expression and trigger transgenerational behavioral changes ( 37 ). Intriguingly, in this study, we found that expressing rde-4 in neurons as a single-copy MosSCI transgene under the control of pan-neuronal promotor ( pigSi3[Psng-1::rde-4:SL2:yfp] ) could largely restore the expression of sperm siRNAs, many of which are associated with ALG-3/4, in rde-4(-) mutants ( Fig. 2B-D ). ALG-3/4 has previously been shown to positively regulate its targets ( 38 ), and consistent with this, we observed aberrant upregulation of spermatogenic transcripts in rde-4(-) animals ( Fig. 2E ). In addition, we detected a widespread mis-regulation of several germline AGO, including csr-1 and wago-10 , and RdRP genes ( Fig. 2F and fig . S2A). These expression patterns were at least partially rescued by neuronal rde-4(+) expression ( Fig. 2B-F , and fig. S2B). Together, our findings indicate that neuronal RDE-4 regulates germline sRNA pathways cell-non-autonomously. Strikingly, expression of neuronal rde-4(+) partially rescued the heat-induced fertility defects observed in rde-4(-) mutants ( Fig. 2G-I ). By performing smFISH and RNA-seq on isolated gonads, we previously confirmed that the neuronal rde-4(+) transgene is not mis-expressed in the germline ( 37 ). Importantly, similar to rde-4(-) mutants and in contrast to wild-type animals, rde-4(-) mutants carrying the neuronal rde-4(+) transgene are not responsive to exogenous dsRNA targeting gfp expressed in sperm (fig. S2C). Hence, these findings indicate that the observed effects are not artifacts caused by transgene mis-expression in the germline, but reflect bona fide cell-non-autonomous role of RDE-4 in regulating sperm heat tolerance. This neuron-to-sperm communication appears to be independent of SID-1, a conserved dsRNA-selective importer required for systemic RNAi ( 39 ) ( Fig. 2J ). To substantiate our conclusion, we performed mosaic analysis by inducing uniparental isodisomy. To achieve this, we crossed rde-4(ne299) males to hermaphrodites overexpressing GPR-1, a conserved microtubule force regulator. This manipulation causes premature segregation of maternal and paternal chromosomes in the pre-cleavage embryos, resulting in non-Mendelian partitioning of genetic material between the first two blastomeres: AB and P 1 . In this system, the anterior AB contains exclusively maternally derived chromosomes, while the posterior P 1 carries only paternally derived chromosomes ( 40 , 41 ). As nearly all neurons are derived from AB ( 42 ), they inherit the wild-type rde-4 from the mother, whereas the germline, arise from the P 1 lineage, carries the rde-4(ne299) mutation from the father ( Fig. 2K ). We found that these mosaic animals exhibit milder fertility defects compared to rde-4(-) mutants at 25 °C, supporting our earlier findings that neuronal sRNAs promote sperm thermotolerance ( Fig. 2L ). Importantly, this effect cannot be attributed to maternal provision, as rde-4 homozygous mutants derived from heterozygous mothers still display severe fertility defects (fig. S2D). Oxygen sensing negatively impacts germline development Previous studies showed that RDE-4 and endo-siRNAs are required for various neuronal processes, including olfactory adaption and dauer developmental decision ( 43 – 46 ). Importantly, we recently demonstrated that rde-4(-) mutants exhibits defective chemotaxis toward various volatile and soluble attractants at 25 °C, but not at 20 °C ( 37 ). This defect is partially rescued by neuronal expression of rde-4(+) (Data S1) ( 37 ). Hence, neuronal RDE-4 is important for the detection of various environmental cues, especially in the presence of heat stress. Given the roles of RDE-4 in sensory signaling, we tested whether blocking sensory perception affects sperm development. Interestingly, eliminating cmk-1 , a gene encoding the homolog of CaMKI which modulates sensory gene expression, partially rescues rde-4(-) sterility at 25 °C ( Fig. 3A ). We observed similar effects when we knockout tax-2 , which encodes a subunit of cyclic nucleotide (cGMP)-gated channel that is required for many sensory responses ( Fig. 3B, C ). These results indicate that the sensory inputs normally inhibit sRNA-mediated sperm heat tolerance. Download figure Open in new tab Fig. 3. Oxygen-sensing neurons inhibit reproduction. ( A-C ) Broad inhibition of sensory perception by knocking out cmk-1 or tax-2 rescues the fertility defects of rde-4(ne299). (C) Endomitotic oocytes in rde-4(ne299) are highlighted. Arrows indicate the -1 oocytes, located closest to the spermatheca. Scale bar = 50 μm. ( D ) Inhibiting oxygen perception, but not the other sensory modalities, improves rde-4(ne299) fertility. Knocking out gcy-35 or osm-9 rescues rde-4(ne299) phenotype. ( E ) Genetically ablating URX, AQR, and PQR neurons partially rescues rde-4(ne299) sterility. ( F ) Blocking neuropeptide processing rescues rde-4(ne299) sterility. Note that egl-2(n476) has egg-laying defects independent of fertility. ( G ) EMS-induced npr-1(ad609) loss-of-function mutation rescues rde-4(ne299) sterility. ( H-I ) Ancestral (HW) alleles of npr-1 and glb-5 partially restore rde-4(ne299) fertility. glb-5(HW); npr-1(HW) double mutants do not show heat-induced loss of fertility. Error represents mean ± SD. ns p > 0.05; * p ≤ 0.05; ** p < 0.01; p *** < 0.001; **** p < 0.0001. Next, we asked which sensory modalities might regulate sperm development. Given that sterility in rde-4(-) mutants is temperature-sensitive, we first eliminated three guanylyl cyclases (GCs) – GCY-8, CGY-18, and GCY-23 – which function specifically in AFD neurons, the primary thermosensory neurons in C. elegans ( 47 ). While we previously showed that removing gcy-8/18/23 downregulates AGO genes and disrupts heritable gene silencing in the germline ( 48 ), we found that blocking heat sensation had no effect on the fertility of rde-4(-) mutants. Similarly, impairing gustatory signaling by removing CHE-1, a C2H2-type zinc finger TF required for specification of the ASE gustatory neurons ( 49 , 50 ), or disrupting general chemosensation by knocking out the G protein α subunits GPA-3 and ODR-3 ( 51 ), also did not impact fertility ( Fig. 3D ). In addition, eliminating MEC-8, which plays a role in amphid cilia fasciculation and mechanosensory neuron development ( 52 , 53 ), had no observable effect (fig. S3A). C. elegans has strong behavioral responses to the gases oxygen and carbon dioxide, which are highly variable in its natural habitats such as soil, compost heaps, and rotting substrates. Environmental oxygen is primarily detected by the AQR, URX, and BAG neurons in the head, and the PQR neuron in the tail, with additional contribution from other neurons ( 54 – 56 ). Mitochondrial activity modulates cellular oxygen consumption, affecting behavioral and physiological response to environmental oxygen levels ( 57 , 58 ). We found that genes downregulated in rde-4(-) mutants at 25 °C compared to those at 20 °C are significantly enriched for mitochondrial processes (fig. S3B). We observed a similar pattern of mitochondrial gene downregulation when comparing rde-4(-) mutants to wild-type animals at 25 °C (fig. S3C and Data S1). We found that deletion of gcy-33 , an oxygen receptor gene expressed in BAG neurons ( 56 , 59 ), did not affect the fertility of rde-4(-) mutants ( Fig. 3D ). In contrast, loss of gcy-35 , which encodes a heme-containing oxygen sensor expressed in the URX, AQR, PQR, SDQ, ALN, and PLN neurons that promote hyperoxia avoidance, rescues sterility of rde-4(-) mutants ( Fig. 3D and fig . S3D). Genetically ablating URX, AQR, and PQR by expressing the cell-death activator gene egl-1 driven by the gcy-36 promoter causes a modest but significant rescue of rde-4(-) sterility ( Fig. 3E ). TRPV sensory channel OSM-9 acts in the polymodal nociceptive ASH neurons to regulate avoidance of high osmolarity, chemical repellents and touch, and also acts in non-nociceptive cell types to mediate olfactory responses and sensory adaptation ( 60 – 62 ). Of note, OSM-9 has been shown to function in ASH and serotonergic ADF neurons to promote hyperoxia avoidance ( 54 ). We found that knocking out osm-9 modestly rescues rde-4(-) phenotype ( Fig. 3D ). However, removing the tryptophan hydroxylase enzyme required for serotonin biosynthesis TPH-1 does not affect rde-4(-) fertility (fig. S3E), nor does genetic ablation of ASH neurons alone (fig. S3F). Together, these results indicate that multiple oxygen-sensing neurons function synergistically to regulate sRNA-mediated germline development. This neuron-to-germline communication is likely mediated by neuropeptides, as removing carboxypeptidase E orthologue EGL-21, which is required to process endogenous neuropeptides, partially restores rde-4(-) fertility ( Fig. 3F ). Hypoxia exposure, for example living at high altitude, has long been known to negatively impact male fertility in animals ( 63 ). Here, we show that mere perception of oxygen – without changing oxygen levels – can antagonize sperm development and fertility modulated by small RNA pathways. We propose that inhibiting oxygen-sensing neurons may mimic cues associated with active bacterial growth that create oxygen sinks, suggestive of conditions favorable for reproduction in C. elegans . Neuronal signaling pathways, especially the sensory system, exhibit extensive evolutionary plasticity and may be subjected to positive selection in response to changing habitats ( 64 , 65 ). In the canonical C. elegans “wild-type” strain (N2), laboratory domestication led to the fixation of a gain-of-function allele in the neuropeptide Y homolog npr-1 and a duplication/insertion in globin gene glb-5 , both of which alter the animals’ response to oxygen and carbon dioxide. These laboratory-derived alleles are absent in LSJ1, a sister strain derived from N2 at least six years before its cryopreservation in 1969 ( 66 ). In N2, the gain-of-function NPR-1(215V) downregulates the activities of oxygen-sensing AQR, PQR, and URX neurons, thereby suppressing hyperoxia avoidance. NPR-1(215V) animals do not respond to drops in oxygen levels and are solitary feeders, dispersing across bacterial lawn. In contrast, wild isolates such as CB4856 from Hawaii (abbreviated as HW), which carry NPR-1(215F), or animals with an npr-1 loss-of-function allele, slow their movement in response to reduced oxygen and exhibit social feeding, aggregating along the bacterial lawn border where oxygen levels are lower (effective oxygen concentration of ∼12.8% vs. ∼17.1% in the center of the lawn) ( 55 ). Interestingly, we found that a null mutation of npr-1 (an EMS-induced allele) rescues the fertility defects of rde-4(-) mutants, likely due to social aggregation in low oxygen environments ( Fig. 3G ). Although npr-1(HW) alone does not markedly affect rde-4(-) fertility, glb-5(HW); npr-1(HW) double mutant significantly rescues rde-4(-) phenotype ( Fig. 3H ). Consistent with previous findings that these two laboratory-derived alleles confer significant fitness advantages in standard laboratory environment, glb-5(HW); npr-1(HW) mutants show a lower brood size compared to wildtype at 20 °C ( Fig. 3I ) ( 67 , 68 ). At 25 °C, the brood size of wild-type animals drops significantly owning to sperm dysfunction ( 69 ); we found that this decline is not evident in glb-5(HW); npr-1(HW) ( Fig. 3I ), suggesting that the ancestral alleles of npr-1 and glb-5 promote reproductive resilience under heat stress – a major challenge in their natural habitat. Hence, our results indicate that laboratory domestication alters oxygen-sensing circuit and foraging behaviors, which subsequently impact sRNA-mediated germline development under heat stress. However, we note that knocking out rde-4 in LSJ1 and CB4856 causes severe loss of fertility, as observed in N2 ( Fig. S3G ), suggesting other natural genetic variants in these strains may act to affect germline development and/or sRNA pathways ( 70 – 73 ). Indeed, AGO genes and sRNA pathways are evolving rapidly, exhibiting extensive intraspecies variation that may have broad impacts on germline gene regulation ( 71 , 74 ). Additionally, other laboratory-derived alleles have been shown to affect sperm development ( 72 , 75 ), including a deletion in nurf-1 , which encodes the orthologue of the BPTF subunit of the NURF chromatin remodeling complex, that arose in the LSJ1 lineage ( 75 ). Neuronal signaling influences genome stability in the germline We note that, although mating largely rescues the fertility defect in rde-4(-) mutants, it does not fully restore brood size to wild-type levels, suggesting additional, non-sperm-origin defects ( Fig. 4A ). To investigate further, we examined RAD-51/RecA, which localizes to the double-strand break (DSB) repair loci ( 76 , 77 ). In wild-type gonads, RAD-51 appears as distinct foci mostly in the leptotene/zygotene and pachytene stages coincide with the onset of meiosis ( Fig. 4B, C ). In contrast, at 25 °C, but not at 20 °C, rde-4(-) mutants exhibited an elevated frequency of DSBs throughout the germline, including the mitotic proliferative stem cells, indicating compromised genome integrity under heat stress ( Fig. 4D and fig . S4A). Remarkably, consistent with our earlier findings, this defect was rescued by single-copy neuronal expression of rde-4(+) ( Fig. 4E-G ). Moreover, eliminating cmk-1 or tax-2 reduces the number of RAD-51 foci in rde-4(-) mutants ( Fig. 4H and fig . S4B). Finally, loss of gcy-35 rescued the DSBs in rde-4(-) ( Fig. 4I-K ), further supporting our conclusion that neuronal activity – particularly the oxygen-sensing circuit – plays an important role in regulating reproductive robustness. Perception of oxygen levels may promote germline maintenance as low oxygen levels correlate with bacteria-rich environments and reproductive permissive niche ( 55 , 78 ). Download figure Open in new tab Fig. 4. Neuronal RDE-4 and impaired oxygen-sensing neurons promote germline genome stability. ( A ) Crossing rde-4(ne299) hermaphrodites to him-5(e1490) males does not completely restore brood size at 25 °C. ( B-G ) Neuronal rde-4(+) rescues DSBs in rde-4(ne299) at 25 °C. (B) Diagram showing the five regions where RAD-51 foci were quantified. (C-E) Stacked bar charts showing the fraction of nuclei in each region, color-coded by the number of RAD-51 foci, in wildtype, rde-4(ne299) , and rde-4(ne299) + neuronal rde-4(+) at 25 °C. (F) Wild-type and rde-4(ne299) + neuronal rde-4(+) animals contain fewer number of DSBs in the mitotic germ cells compared to rde-4(ne299) . (G) Whole gonads stained with RAD-51 (red) and DAPI (blue). Scale bar = 50 μm. Right panels show magnification of mitotic nuclei. Scale bar = 10 μm. ( H-K ) Loss of oxygen perception rescues DSBs in rde-4(ne299). (H, I) Stacked bar charts showing the number of RAD-51 foci in the germ cells across different regions in tax-2(ok3403); rde-4(ne299) and gcy-35(ok769); rde-4(ne299). (J) tax-2(ok3403); rde-4(ne299) and gcy-35(ok769); rde-4(ne299) contain fewer number of DSBs in the mitotic germ cells compared to rde-4(ne299) at 25 °C. (K) Whole gonads stained with RAD-51 and DAPI in rde-4(ne299) , tax-2(ok3403); rde-4(ne299) and gcy-35(ok769); rde-4(ne299). Scale bar = 50 μm. Right panels show magnification of mitotic nuclei. Scale bar = 10 μm. Error represents mean ± SD. **** p < 0.0001. Regulatory sRNAs can exert cell non-autonomous effects via microvesicles or exosomes, influencing diverse biological processes in both health and disease ( 79 , 80 ). The intercellular transfer of RNAs and other molecular cargoes mediates soma–germline interactions from plants to mammals, regulating germline gene expression ( 81 – 83 ). In this study, we report that neuronal sRNAs can regulate reproduction through a neuroendocrine-like signaling mechanism that depends on neuropeptides, rather than on direct RNA transfer. This neuron-to-germline communication may, in some cases, initiates a lasting transgenerational epigenetic memory ( 48 ). Hence, we propose that sRNAs integrate sensory information, promote developmental plasticity and reproductive adaptation, and potentially facilitate epigenetic buffering in fluctuating environments ( 84 – 87 ). The sensory regulation of sRNA-mediated germline mortality may exert a profound influence on the evolutionary trajectories of animals. Materials and Methods Worm cultivation C. elegans strains were maintained on standard Nematode Growth Medium (NGM) plates seeded with E. coli OP50 at 20 °C, unless stated otherwise. A complete list of strains used in this study is provided in Table S1 . Fertility assay L4 animals, identified by the characteristic white crescent surrounding the developing vulva, were transferred to 25 °C. After ∼24 hours, individual day 1 adults were moved to fresh NGM plates seeded with a small (∼30 µL) drop of OP50 that had been allowed to dry for 1-2 days. About 12 hours later, the number of laid eggs and unfertilized oocytes was quantified. Samples with fewer than 20 total eggs and unfertilized oocytes were excluded from analysis. Relative fertility was calculated as: 1 – (% unfertilized oocytes / mean % unfertilized oocytes in control rde-4(-) animals from the same experiment). In all cases, the investigators were blinded to the genotypes. RNA isolation Total RNA was isolated from day 1 adults (∼72 hours at 20°C following L1 synchronization) using standard phenol-chloroform method with TRIzol TM (Invitrogen). RNA quality was accessed using Agilent 4150 BioAnalyzer instrument and High Sensitivity RNA ScreenTapes. RNA-seq To sequence the mRNA, RNA libraries were prepared using NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® coupled with NEBNext® Poly(A) mRNA Magnetic Isolation Module. The cDNA libraries were pooled and paired-end sequencing was performed on the Nextseq 2000 platform. For sRNA sequencing, we treated the RNA samples with RNA 5′ Polyphosphatase (epicentre) and the libraries were prepared using NEBNext® Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) or TruSeq Small RNA Library Prep Kit (Illumina) according to the manufacturer’s protocol. RNA ranging from ∼140 to 160 nt was size-selected by gel extraction using 4% agarose E-Gel (Life Technologies). The pooled samples were the sequenced using the Illumina HiSeq 2500 instrument. Bioinformatics All bioinformatic analyses were performed using RNAlysis ( 88 ). For sRNA-seq data, sRNA reads were aligned to PRJNA13758 ce11 genome assembly using ShortStack ( 89 ) and aligned anti-sense reads were quantified using FeatureCounts (Data S2) ( 90 ). For mRNA, we pseudo-aligned reads using Kallisto (Data S3) ( 91 ). We then performed differential expression analysis using DESeq2 ( 92 ). For gene set enrichment analysis, log 2 (fold enrichment) scores were computed and the FDR for enrichment was calculated using 10,000 random gene sets identical in size to the tested group. For Gene Ontology (GO) and KEGG pathways analyses, Fisher’s Exact tests were performed. CRISPR/Cas9 gene editing CRISPR/Cas9 was performed as previously described ( 93 ). To generate rde-4 deletion, we used two crRNAs: ACTTGGGGCACTGTCGAACT and ATCTCTGGAATCATATGATA. The following homology-directed repair (HDR) donor was used: AGGCTGCTAAGGCTGTCTATCAAAAGACGCCAACTATATGGGTATGCCTCCAAATAA TTGTAGTTAATAT. This generates 637 bp deletion in rde-4 . The results strains were backcrossed at least two times to remove potential background mutations. Antibody and DAPI staining Dissected gonads were fixed with 3.5% formaldehyde for 10 mins and washed at least twice with PBS-T (0.1% Tween-20 in PBS buffer). Tissues were then permeabilized in 0.25% PBS-Triton for 20 mins, followed by blocking in 0.5% BSA in PBS-T for 1 hour with gentle shaking. Next, primary antibodies – mouse anti-MSP (Developmental Studies Hybridoma Bank) and rabbit anti-RAD-51 (gift from Nicolas Silva) – were diluted 1:1000 in PBS-T and applied for 1 hour with gentle agitation. After two washes with PBS-T, secondary antibodies (Jackson ImmunoResearch anti-rabbit and anti-mouse; 1:200 in PBS-T) were added and incubated for 1 hour. Samples were then washed for two more times and were incubated with DAPI (0.02% in PBS-T) for 10 mins, followed by two more washes with PBS-T. Finally, samples were mounted on glass slides in VECTASHIELD® Antifade Mounting Medium (Vector Laboratories, Cat# H-1000) prior to imaging. Statistical analysis Statistical analyses were conducted using R software v4.2.3 and GraphPad Prism 10. For comparisons between two groups, non-parametric unpaired Wilcoxon rank sum tests were used. For experiments involving multiple groups, Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests were performed. Multiple comparison corrections using the Benjamini–Hochberg method were applied where appropriate. Funding EMBO Fellowship ALTF 6-2022 (CKE) Eric and Wendy Schmidt Fund for Strategic Innovation Polymath Award 0140001000 (OR) Morris Kahn Foundation (OR) European Research Council grant 335624 (OR) Israel Science Foundation 979/21 (YBT) U.S.-Israel Binational Science Foundation 2023036 (YBT) Author contributions Conceptualization: CKE, OR Methodology: CKE, HA Investigation: CKE, HA, SW, AM, GT, SA, HG, RP, OA Visualization: CKE, HA Funding acquisition: YBT, OR Supervision: YBT, OR Writing – original draft: CKE Writing – review & editing: CKE, HA, YBT, OR Competing interests Authors declare that they have no competing interests. Data and materials availability All data are available in the main text or the supplementary materials. All NGS data are available through GEO, accession number GEO: XX. Supplementary Materials Download figure Open in new tab Fig. S1. RDE-4 promotes reproduction at high temperature. ( A ) rde-4(uu53) mutants exhibit severe loss of fertility at 25 °C. ( B ) rde-4(ne299) day 2 adult shows accumulation of unfertilized oocyte stacked in the gonad at 25 °C, but not at 20 °C. The germline is marked by gfp driven by mex-5 (RNA-Pol II) promotor. *** p < 0.001. Download figure Open in new tab Fig. S2. Neuronal RDE-4 promotes sperm development. ( A ) Different classes of endo-siRNAs are differentially expressed in rde-4(ne299) . ALG-3/4-class siRNAs tend to be upregulated, whereas CSR-1–class siRNAs tend to be downregulated in rde-4(ne299) compared to wild type. ( B ) Misexpression of AGO genes in rde-4(ne299) is rescued by neuronal rde-4(+) in some cases. ( C ) Neuronal rde-4(+) does not rescue RNAi-defective phenotype of rde-4(ne299) . Arrows indicate spermatheca. ( D ) Homozygous rde-4(uu53) segregated from heterozygous mothers show severe fertility defects. ns p > 0.05; * p ≤ 0.05; *** p < 0.001; **** p < 0.0001. Download figure Open in new tab Fig. S3. Neuronal sensory affects fertility. ( A ) Knocking out mec-8 does not affect rde-4(ne299) fertility. ( B-C ) KEGG pathway analysis reveals that mitochondrial genes tend to be downregulated in rde-4(ne299) grown at 25 °C compared to either rde-4(ne299) at 20 °C or wild type at 25 °C. ( D ) Knocking out gcy-35 reduces the accumulation of endomitotic nuclei. ( E ) Eliminating tph-1 does not rescue rde-4(ne299) sterility. ( F ) Genetically ablating ASH neurons does not impact rde-4(ne299) fertility. ( G ) Deleting rde-4 in CB4856 and LSJ1 causes severe loss of fertility at 25 °C, similar to that observed in N2. ns p > 0.05; **** p < 0.0001. Download figure Open in new tab Fig. S4. Neuronal sensory affects germline integrity. ( A ) rde-4(ne299) grown at 25 °C, but not 20 °C, shows increased DSBs in the gonad. ( B ) Knocking out cmk-1 reduces DSBs in rde-4(ne299) at 25 °C. Scale bar = 50 μm. View this table: View inline View popup Table S1. Worm strains used in this study. Acknowledgments We thank Rutwik Bardapurkar and Itai Reiger for their assistance with experiments. We thank Cori Bargmann (Rockefeller University) for providing introgressed strains carrying HW alleles of npr-1 and glb-5 . Some graphics were created with Biorender.com. We are grateful to WormBase for providing valuable data and resources. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). References and Notes 1. ↵ B. S. Walsh , S. R. Parratt , A. A. Hoffmann , D. Atkinson , R. R. Snook , A. Bretman , T. A. R. Price , The Impact of Climate Change on Fertility . Trends in Ecology & Evolution 34 , 249 – 259 ( 2019 ). OpenUrl PubMed 2. ↵ J. De Jaeger-Braet , A. Schnittger , Heating up meiosis - Chromosome recombination and segregation under high temperatures . Curr Opin Plant Biol 80 , 102548 ( 2024 ). OpenUrl PubMed 3. ↵ D. Bourc’his , O. Voinnet , A Small-RNA Perspective on Gametogenesis, Fertilization, and Early Zygotic Development . Science 330 , 617 – 622 ( 2010 ). OpenUrl Abstract / FREE Full Text 4. ↵ D. N. Cox , A. Chao , J. Baker , L. Chang , D. Qiao , H. Lin , A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal . Genes Dev 12 , 3715 – 3727 ( 1998 ). OpenUrl Abstract / FREE Full Text 5. A. A. Aravin , R. Sachidanandam , A. Girard , K. Fejes-Toth , G. J. Hannon , Developmentally regulated piRNA clusters implicate MILI in transposon control . Science 316 , 744 – 747 ( 2007 ). OpenUrl Abstract / FREE Full Text 6. ↵ J. Brennecke , A. A. Aravin , A. Stark , M. Dus , M. Kellis , R. Sachidanandam , G. J. Hannon , Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila . Cell 128 , 1089 – 1103 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 7. ↵ M. A. Carmell , A. Girard , H. J. G. van de Kant , D. Bourc’his , T. H. Bestor , D. G. de Rooij , G. J. Hannon , MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline . Dev Cell 12 , 503 – 514 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 8. S. Hilz , A. J. Modzelewski , P. E. Cohen , A. Grimson , The roles of microRNAs and siRNAs in mammalian spermatogenesis . Development 143 , 3061 – 3073 ( 2016 ). OpenUrl Abstract / FREE Full Text 9. P. Stein , N. V. Rozhkov , F. Li , F. L. Cárdenas , O. Davydenk , L. E. Vandivier , B. D. Gregory , G. J. Hannon , R. M. Schultz , Essential Role for Endogenous siRNAs during Meiosis in Mouse Oocytes . PLOS Genetics 11 , e1005013 ( 2015 ). OpenUrl 10. E. Taborska , J. Pasulka , R. Malik , F. Horvat , I. Jenickova , Z. J. Matošević , P. Svoboda , Restricted and non-essential redundancy of RNAi and piRNA pathways in mouse oocytes . PLOS Genetics 15 , e1008261 ( 2019 ). OpenUrl PubMed 11. ↵ N. Vrettos , J. Oppelt , A. Zoch , P. Sgourdou , H. Yoshida , B. Song , R. Fink , D. O’Carroll , Z. Mourelatos , MIWI N-terminal arginines orchestrate generation of functional pachytene piRNAs and spermiogenesis . Nucleic Acids Res 52 , 6558 – 6570 ( 2024 ). OpenUrl PubMed 12. ↵ C. C. Conine , P. J. Batista , W. Gu , J. M. Claycomb , D. A. Chaves , M. Shirayama , C. C. Mello , Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans . Proc Natl Acad Sci U S A 107 , 3588 – 3593 ( 2010 ). OpenUrl Abstract / FREE Full Text 13. ↵ A. G. Charlesworth , U. Seroussi , N. J. Lehrbach , M. S. Renaud , A. E. Sundby , R. I. Molnar , R. X. Lao , A. R. Willis , J. R. Woock , M. J. Aber , A. J. Diao , A. W. Reinke , G. Ruvkun , J. M. Claycomb , Two isoforms of the essential C. elegans Argonaute CSR-1 differentially regulate sperm and oocyte fertility . Nucleic Acids Research 49 , 8836 – 8865 ( 2021 ). OpenUrl CrossRef PubMed 14. P. J. Batista , G. Ruby , J. M. Claycomb , R. Chiang , N. Fahlgren , K. D. Kasschau , D. A. Chaves , W. Gu , J. J. Vasale , S. Duan , J. Darryl Conte , S. Luo , G. P. Scroth , J. C. Carrington , D. P. Bartel , C. C. Mello , PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans . Molecular cell 31 , 67 ( 2008 ). 15. B. A. Buckley , K. B. Burkhart , S. G. Gu , G. Spracklin , A. Kershner , H. Fritz , J. Kimble , A. Fire , S. Kennedy , A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality . Nature 489 , 447 – 451 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 16. J. I. Gent , M. Schvarzstein , A. M. Villeneuve , S. G. Gu , V. Jantsch , A. Z. Fire , A. Baudrimont , A Caenorhabditis elegans RNA-directed RNA polymerase in sperm development and endogenous RNA interference . Genetics 183 , 1297 – 1314 ( 2009 ). OpenUrl Abstract / FREE Full Text 17. ↵ D. M. Pavelec , J. Lachowiec , T. F. Duchaine , H. E. Smith , S. Kennedy , Requirement for the ERI/DICER Complex in Endogenous RNA Interference and Sperm Development in Caenorhabditis elegans . Genetics 183 , 1283 – 1295 ( 2009 ). OpenUrl Abstract / FREE Full Text 18. ↵ T. P. Chendrimada , R. I. Gregory , E. Kumaraswamy , J. Norman , N. Cooch , K. Nishikura , R. Shiekhattar , TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing . Nature 436 , 740 – 744 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 19. ↵ B. Czech , C. D. Malone , R. Zhou , A. Stark , C. Schlingeheyde , M. Dus , N. Perrimon , M. Kellis , J. A. Wohlschlegel , R. Sachidanandam , G. J. Hannon , J. Brennecke , An endogenous small interfering RNA pathway in Drosophila . Nature 453 , 798 – 802 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 20. ↵ Q. Liu , T. A. Rand , S. Kalidas , F. Du , H.-E. Kim , D. P. Smith , X. Wang , R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway . Science 301 , 1921 – 1925 ( 2003 ). OpenUrl Abstract / FREE Full Text 21. ↵ H. Tabara , M. Sarkissian , W. G. Kelly , J. Fleenor , A. Grishok , L. Timmons , A. Fire , C. C. Mello , The rde-1 gene , RNA interference, and transposon silencing in C. elegans. Cell 99 , 123 – 132 ( 1999 ). OpenUrl CrossRef 22. H. Tabara , E. Yigit , H. Siomi , C. C. Mello , The dsRNA Binding Protein RDE-4 Interacts with RDE-1, DCR-1, and a DExH-Box Helicase to Direct RNAi in C. elegans . Cell 109 , 861 – 871 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 23. G. S. Parker , T. S. Maity , B. L. Bass , dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi . J Mol Biol 384 , 967 – 979 ( 2008 ). OpenUrl CrossRef PubMed 24. ↵ G. S. Parker , D. M. Eckert , B. L. Bass , RDE-4 preferentially binds long dsRNA and its dimerization is necessary for cleavage of dsRNA to siRNA . RNA 12 , 807 – 818 ( 2006 ). OpenUrl Abstract / FREE Full Text 25. ↵ T. L. Knittel , B. E. Montgomery , R. A. Sprister , C. N. Magelky , M. J. Smith , M. Soto-Ojeda , M. Guthrie , C. M. Phillips , T. A. Montgomery , Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegans . bioRxiv [Preprint] ( 2025 ). doi: 10.1101/2025.05.06.652520 . OpenUrl Abstract / FREE Full Text 26. ↵ N. C. Welker , D. M. Pavelec , D. A. Nix , T. F. Duchaine , S. Kennedy , B. L. Bass , Dicer’s helicase domain is required for accumulation of some, but not all, C. elegans endogenous siRNAs . RNA 16 , 893 – 903 ( 2010 ). OpenUrl Abstract / FREE Full Text 27. ↵ D. Blanchard , P. Parameswaran , J. Lopez-Molina , J. Gent , J. F. Saynuk , A. Fire , On the nature of in vivo requirements for rde-4 in RNAi and developmental pathways in C. elegans . RNA Biol 8 , 458 – 467 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 28. ↵ S. Ward , J. S. Carrel , Fertilization and sperm competition in the nematode Caenorhabditis elegans . Dev Biol 73 , 304 – 321 ( 1979 ). OpenUrl CrossRef PubMed Web of Science 29. ↵ P. M. Meneely , O. L. McGovern , F. I. Heinis , J. L. Yanowitz , Crossover Distribution and Frequency Are Regulated by him-5 in Caenorhabditis elegans . Genetics 190 , 1251 – 1266 ( 2012 ). OpenUrl Abstract / FREE Full Text 30. ↵ R. F. Ketting , L. Cochella , Concepts and functions of small RNA pathways in C. elegans . Curr Top Dev Biol 144 , 45 – 89 ( 2021 ). OpenUrl CrossRef PubMed 31. U. Seroussi , A. Lugowski , L. Wadi , R. X. Lao , A. R. Willis , W. Zhao , A. E. Sundby , A. G. Charlesworth , A. W. Reinke , J. M. Claycomb , A comprehensive survey of C. elegans argonaute proteins reveals organism-wide gene regulatory networks and functions . eLife 12 , e83853 ( 2023 ). OpenUrl CrossRef PubMed 32. ↵ E. Yigit , P. J. Batista , Y. Bei , K. M. Pang , C.-C. G. Chen , N. H. Tolia , L. Joshua-Tor , S. Mitani , M. J. Simard , C. C. Mello , Analysis of the C. elegans Argonaute Family Reveals that Distinct Argonautes Act Sequentially during RNAi . Cell 127 , 747 – 757 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 33. ↵ J. J. Vasale , W. Gu , C. Thivierge , P. J. Batista , J. M. Claycomb , E. M. Youngman , T. F. Duchaine , C. C. Mello , D. Conte , Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway . Proc Natl Acad Sci U S A 107 , 3582 – 3587 ( 2010 ). OpenUrl Abstract / FREE Full Text 34. ↵ T. Han , A. P. Manoharan , T. T. Harkins , P. Bouffard , C. Fitzpatrick , D. S. Chu , D. Thierry-Mieg , J. Thierry-Mieg , J. K. Kim , 26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans . Proceedings of the National Academy of Sciences 106 , 18674 – 18679 ( 2009 ). OpenUrl Abstract / FREE Full Text 35. ↵ C. Zhang , T. A. Montgomery , H. W. Gabel , S. E. J. Fischer , C. M. Phillips , N. Fahlgren , C. M. Sullivan , J. C. Carrington , G. Ruvkun , mut-16 and other mutator class genes modulate 22G and 26G siRNA pathways in Caenorhabditis elegans . Proceedings of the National Academy of Sciences 108 , 1201 – 1208 ( 2011 ). OpenUrl Abstract / FREE Full Text 36. ↵ T. F. Duchaine , J. A. Wohlschlegel , S. Kennedy , Y. Bei , D. Conte , K. Pang , D. R. Brownell , S. Harding , S. Mitani , G. Ruvkun , J. R. Yates , C. C. Mello , Functional Proteomics Reveals the Biochemical Niche of C. elegans DCR-1 in Multiple Small-RNA-Mediated Pathways . Cell 124 , 343 – 354 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 37. ↵ R. Posner , I. A. Toker , O. Antonova , E. Star , S. Anava , E. Azmon , M. Hendricks , S. Bracha , H. Gingold , O. Rechavi , Neuronal Small RNAs Control Behavior Transgenerationally . Cell 177 , 1814 – 1826 .e15 ( 2019 ). OpenUrl CrossRef PubMed 38. ↵ C. C. Conine , J. J. Moresco , W. Gu , M. Shirayama , D. Conte , J. R. Yates , C. C. Mello , Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans . Cell 155 , 1532 – 1544 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 39. ↵ W. M. Winston , C. Molodowitch , C. P. Hunter , Systemic RNAi in C. elegans requires the putative transmembrane protein SID-1 . Science 295 , 2456 – 2459 ( 2002 ). OpenUrl Abstract / FREE Full Text 40. ↵ K. L. Artiles , A. Z. Fire , C. Frøkjaer-Jensen , Assessment and maintenance of unigametic germline inheritance for C. elegans . Dev Cell 48 , 827 – 839 .e9 ( 2019 ). OpenUrl CrossRef PubMed 41. ↵ J. Besseling , H. Bringmann , Engineered non-Mendelian inheritance of entire parental genomes in C. elegans . Nat Biotechnol 34 , 982 – 986 ( 2016 ). OpenUrl CrossRef PubMed 42. ↵ J. E. Sulston , E. Schierenberg , J. G. White , J. N. Thomson , The embryonic cell lineage of the nematode Caenorhabditis elegans . Dev Biol 100 , 64 – 119 ( 1983 ). OpenUrl CrossRef PubMed Web of Science 43. ↵ P. S. Bharadwaj , S. E. Hall , Endogenous RNAi Pathways Are Required in Neurons for Dauer Formation in Caenorhabditis elegans . Genetics 205 , 1503 – 1516 ( 2017 ). OpenUrl Abstract / FREE Full Text 44. L. A. Tonkin , B. L. Bass , Mutations in RNAi Rescue Aberrant Chemotaxis of ADAR Mutants . Science 302 , 1725 ( 2003 ). OpenUrl FREE Full Text 45. B.-T. Juang , C. Gu , L. Starnes , F. Palladino , A. Goga , S. Kennedy , N. D. L’Etoile , Endogenous Nuclear RNAi Mediates Behavioral Adaptation to Odor . Cell 154 , 1010 – 1022 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 46. ↵ L. M. Kennedy , A. Grishok , Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans . Genetics 197 , 207 – 220 ( 2014 ). OpenUrl Abstract / FREE Full Text 47. ↵ H. Inada , H. Ito , J. Satterlee , P. Sengupta , K. Matsumoto , I. Mori , Identification of Guanylyl Cyclases That Function in Thermosensory Neurons of Caenorhabditis elegans . Genetics 172 , 2239 – 2252 ( 2006 ). OpenUrl Abstract / FREE Full Text 48. ↵ G. Teichman , M. Sela , C. K. Ewe , I. Rieger , S. Anava , Y. Mor , P. Szántó , D. H. Meyer , H. Doron , O. Shachar , V. Pechuk , H. Gingold , M. Oren-Suissa , M. McGee , M. Shapira , B. Schumacher , O. Rechavi , Perception of Temperature Even in the Absence of Actual Change is Sufficient to Drive Transgenerational Epigenetic Inheritance . bioRxiv , 2024.12.02.626416 ( 2024 ). 49. ↵ O. Uchida , H. Nakano , M. Koga , Y. Ohshima , The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons . Development 130 , 1215 – 1224 ( 2003 ). OpenUrl Abstract / FREE Full Text 50. ↵ T. Patel , O. Hobert , Coordinated control of terminal differentiation and restriction of cellular plasticity . Elife 6 , e24100 ( 2017 ). OpenUrl CrossRef PubMed 51. ↵ H. Lans , S. Rademakers , G. Jansen , A network of stimulatory and inhibitory Galpha-subunits regulates olfaction in Caenorhabditis elegans . Genetics 167 , 1677 – 1687 ( 2004 ). OpenUrl Abstract / FREE Full Text 52. ↵ L. A. Perkins , E. M. Hedgecock , J. N. Thomson , J. G. Culotti , Mutant sensory cilia in the nematode Caenorhabditis elegans . Dev Biol 117 , 456 – 487 ( 1986 ). OpenUrl CrossRef PubMed Web of Science 53. ↵ M. Chalfie , J. Sulston , Developmental genetics of the mechanosensory neurons of Caenorhabditis elegans . Developmental Biology 82 , 358 – 370 ( 1981 ). OpenUrl CrossRef PubMed Web of Science 54. ↵ A. J. Chang , N. Chronis , D. S. Karow , M. A. Marletta , C. I. Bargmann , A Distributed Chemosensory Circuit for Oxygen Preference in C. elegans . PLoS Biol 4 , e274 ( 2006 ). OpenUrl CrossRef PubMed 55. ↵ J. M. Gray , D. S. Karow , H. Lu , A. J. Chang , J. S. Chang , R. E. Ellis , M. A. Marletta , C. I. Bargmann , Oxygen sensation and social feeding mediated by a C. elegans guanylate cyclase homologue . Nature 430 , 317 – 322 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 56. ↵ M. Zimmer , J. M. Gray , N. Pokala , A. J. Chang , D. S. Karow , M. A. Marletta , M. L. Hudson , D. B. Morton , N. Chronis , C. I. Bargmann , Neurons detect increases and decreases in oxygen levels using distinct guanylate cyclases . Neuron 61 , 865 – 879 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 57. ↵ J. O. Onukwufor , M. A. Farooqi , A. Vodičková , S. A. Koren , A. Baldzizhar , B. J. Berry , G. Beutner , G. A. Porter , V. Belousov , A. Grossfield , A. P. Wojtovich , A reversible mitochondrial complex I thiol switch mediates hypoxic avoidance behavior in C. elegans . Nat Commun 13 , 2403 ( 2022 ). OpenUrl CrossRef PubMed 58. ↵ B. J. Berry , A. Baldzizhar , T. O. Nieves , A. P. Wojtovich , Neuronal AMPK coordinates mitochondrial energy sensing and hypoxia resistance in C. elegans . The FASEB Journal 34 , 16333 – 16347 ( 2020 ). OpenUrl CrossRef PubMed 59. ↵ S. Yu , L. Avery , E. Baude , D. L. Garbers , Guanylyl cyclase expression in specific sensory neurons: A new family of chemosensory receptors . Proceedings of the National Academy of Sciences 94 , 3384 – 3387 ( 1997 ). OpenUrl Abstract / FREE Full Text 60. ↵ J. M. Kaplan , H. R. Horvitz , A dual mechanosensory and chemosensory neuron in Caenorhabditis elegans . Proc Natl Acad Sci U S A 90 , 2227 – 2231 ( 1993 ). OpenUrl Abstract / FREE Full Text 61. H. A. Colbert , T. L. Smith , C. I. Bargmann , OSM-9, A Novel Protein with Structural Similarity to Channels, Is Required for Olfaction, Mechanosensation, and Olfactory Adaptation inCaenorhabditis elegans . J Neurosci 17 , 8259 – 8269 ( 1997 ). OpenUrl Abstract / FREE Full Text 62. ↵ D. M. Tobin , D. M. Madsen , A. Kahn-Kirby , E. L. Peckol , G. Moulder , R. Barstead , A. V. Maricq , C. I. Bargmann , Combinatorial Expression of TRPV Channel Proteins Defines Their Sensory Functions and Subcellular Localization in C. elegans Neurons . Neuron 35 , 307 – 318 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 63. ↵ T. Lord , Pathophysiological effects of hypoxia on testis function and spermatogenesis . Nat Rev Urol 22 , 470 – 488 ( 2025 ). OpenUrl PubMed 64. ↵ I. A. Toker , L. Ripoll-Sánchez , L. T. Geiger , A. Sussfeld , K. S. Saini , I. Beets , P. E. Vértes , W. R. Schafer , E. Ben-David , O. Hobert , Divergence in neuronal signaling pathways despite conserved neuronal identity among Caenorhabditis species . Current Biology 35 , 2927 – 2945 .e7 ( 2025 ). OpenUrl PubMed 65. ↵ F. Ma , C. Y. Lau , C. Zheng , Large genetic diversity and strong positive selection in F-box and GPCR genes among the wild isolates of Caenorhabditis elegans . Genome Biol Evol 13 , evab048 ( 2021 ). OpenUrl PubMed 66. ↵ M. G. Sterken , L. B. Snoek , J. E. Kammenga , E. C. Andersen , The laboratory domestication of Caenorhabditis elegans . Trends Genet 31 , 224 – 231 ( 2015 ). OpenUrl CrossRef PubMed 67. ↵ E. C. Andersen , J. S. Bloom , J. P. Gerke , L. Kruglyak , A Variant in the Neuropeptide Receptor npr-1 is a Major Determinant of Caenorhabditis elegans Growth and Physiology . PLOS Genetics 10 , e1004156 ( 2014 ). OpenUrl PubMed 68. ↵ Y. Zhao , L. Long , W. Xu , R. F. Campbell , E. E. Large , J. S. Greene , P. T. McGrath , Changes to social feeding behaviors are not sufficient for fitness gains of the Caenorhabditis elegans N2 reference strain . eLife 7 , e38675 ( 2018 ). OpenUrl CrossRef PubMed 69. ↵ L. N. Petrella , Natural Variants of C. elegans Demonstrate Defects in Both Sperm Function and Oogenesis at Elevated Temperatures . PLoS One 9 , e112377 ( 2014 ). OpenUrl CrossRef PubMed 70. ↵ L. Frézal , M. Saglio , G. Zhang , L. Noble , A. Richaud , M. Félix , Genome-wide association and environmental suppression of the mortal germline phenotype of wild C. elegans . EMBO reports 24 , e58116 ( 2023 ). OpenUrl CrossRef PubMed 71. ↵ H. T. Chou , F. Valencia , J. C. Alexander , A. D. Bell , D. Deb , D. A. Pollard , A. B. Paaby , Diversification of small RNA pathways underlies germline RNA interference incompetence in wild Caenorhabditis elegans strains . Genetics 226 , iyad191 ( 2024 ). OpenUrl PubMed 72. ↵ F. Duveau , M.-A. Félix , Role of Pleiotropy in the Evolution of a Cryptic Developmental Variation in Caenorhabditis elegans . PLOS Biology 10 , e1001230 ( 2012 ). OpenUrl CrossRef PubMed 73. ↵ C. Gimond , A. Vielle , N. Silva-Soares , S. Zdraljevic , P. T. McGrath , E. C. Andersen , C. Braendle , Natural Variation and Genetic Determinants of Caenorhabditis elegans Sperm Size . Genetics 213 , 615 – 632 ( 2019 ). OpenUrl Abstract / FREE Full Text 74. ↵ D. A. Pollard , M. V. Rockman , Resistance to Germline RNA Interference in a Caenorhabditis elegans Wild Isolate Exhibits Complexity and Nonadditivity . G3 (Bethesda) 3 , 941 – 947 ( 2013 ). OpenUrl 75. ↵ C. Gimond , A. Vielle , N. Silva-Soares , S. Zdraljevic , P. T. McGrath , E. C. Andersen , C. Braendle , Natural Variation and Genetic Determinants of Caenorhabditis elegans Sperm Size . Genetics 213 , 615 – 632 ( 2019 ). OpenUrl Abstract / FREE Full Text 76. ↵ T. Ogawa , X. Yu , A. Shinohara , E. H. Egelman , Similarity of the yeast RAD51 filament to the bacterial RecA filament . Science 259 , 1896 – 1899 ( 1993 ). OpenUrl Abstract / FREE Full Text 77. ↵ A. Alpi , P. Pasierbek , A. Gartner , J. Loidl , Genetic and cytological characterization of the recombination protein RAD-51 in Caenorhabditis elegans . Chromosoma 112 , 6 – 16 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 78. ↵ L. Frézal , M.-A. Félix , C. elegans outside the Petri dish . Elife 4 , e05849 ( 2015 ). OpenUrl CrossRef PubMed 79. ↵ S. Subramanian , Little RNAs Go a Long Way: Long-Distance Signaling by MicroRNAs . Molecular Plant 12 , 18 – 20 ( 2019 ). OpenUrl PubMed 80. ↵ A. M. Jose , Movement of regulatory RNA between animal cells . Genesis 53 , 395 – 416 ( 2015 ). OpenUrl CrossRef PubMed 81. ↵ Q. Chen , M. Yan , Z. Cao , X. Li , Y. Zhang , J. Shi , G. Feng , H. Peng , X. Zhang , Y. Zhang , J. Qian , E. Duan , Q. Zhai , Q. Zhou , Sperm tsRNAs contribute to intergenerational inheritance of an acquired metabolic disorder . Science 351 , 397 – 400 ( 2016 ). OpenUrl Abstract / FREE Full Text 82. U. Sharma , C. C. Conine , J. M. Shea , A. Boskovic , A. G. Derr , X. Y. Bing , C. Belleannee , A. Kucukural , R. W. Serra , F. Sun , L. Song , B. R. Carone , E. P. Ricci , X. Z. Li , L. Fauquier , M. J. Moore , R. Sullivan , C. C. Mello , M. Garber , O. J. Rando , Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals . Science 351 , 391 – 396 ( 2016 ). OpenUrl Abstract / FREE Full Text 83. ↵ C. C. Conine , O. J. Rando , Soma-to-germline RNA communication . Nat Rev Genet 23 , 73 – 88 ( 2022 ). OpenUrl CrossRef PubMed 84. ↵ R. E. O’Dea , D. W. A. Noble , S. L. Johnson , D. Hesselson , S. Nakagawa , The role of non-genetic inheritance in evolutionary rescue: epigenetic buffering, heritable bet hedging and epigenetic traps . Environ Epigenet 2 ( 2016 ). 85. P. Sarkies , Evolution beyond DNA: epigenetic drivers for evolutionary change? BMC Biol 21 , 272 ( 2023 ). OpenUrl CrossRef PubMed 86. M. Lenuzzi , H. Witte , M. Riebesell , C. Rödelsperger , R. L. Hong , R. J. Sommer , Influence of environmental temperature on mouth-form plasticity in Pristionchus pacificus acts through daf-11-dependent cGMP signaling . Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 340 , 214 – 224 ( 2023 ). OpenUrl 87. ↵ R. J. Sommer , Phenotypic Plasticity: From Theory and Genetics to Current and Future Challenges . Genetics 215 , 1 – 13 ( 2020 ). OpenUrl CrossRef PubMed 88. ↵ G. Teichman , D. Cohen , O. Ganon , N. Dunsky , S. Shani , H. Gingold , O. Rechavi , RNAlysis: analyze your RNA sequencing data without writing a single line of code . BMC Biology 21 , 74 ( 2023 ). OpenUrl PubMed 89. ↵ S. Shahid , M. J. Axtell , Identification and annotation of small RNA genes using ShortStack . Methods 67 , 20 – 27 ( 2014 ). OpenUrl CrossRef PubMed 90. ↵ Y. Liao , G. K. Smyth , W. Shi , featureCounts: an efficient general purpose program for assigning sequence reads to genomic features . Bioinformatics 30 , 923 – 930 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 91. ↵ N. L. Bray , H. Pimentel , P. Melsted , L. Pachter , Near-optimal probabilistic RNA-seq quantification . Nat Biotechnol 34 , 525 – 527 ( 2016 ). OpenUrl CrossRef PubMed 92. ↵ M. I. Love , W. Huber , S. Anders , Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biology 15 , 550 ( 2014 ). OpenUrl CrossRef PubMed 93. ↵ K. S. Ghanta , C. C. Mello , Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans . Genetics 216 , 643 – 650 ( 2020 ). OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted August 10, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Neuronal oversight of germline small RNAs prevents heat-induced sterility in lab-domesticated Caenorhabditis elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Neuronal oversight of germline small RNAs prevents heat-induced sterility in lab-domesticated Caenorhabditis elegans Chee Kiang Ewe , Hanna Achache , Shir Weiss , Anna Mogilevskaya , Myriam Valenski , Guy Teichman , Sarit Anava , Hila Gingold , Rachel Posner , Olga Antonova , Yonatan B. Tzur , Oded Rechavi bioRxiv 2025.08.07.669182; doi: https://doi.org/10.1101/2025.08.07.669182 Share This Article: Copy Citation Tools Neuronal oversight of germline small RNAs prevents heat-induced sterility in lab-domesticated Caenorhabditis elegans Chee Kiang Ewe , Hanna Achache , Shir Weiss , Anna Mogilevskaya , Myriam Valenski , Guy Teichman , Sarit Anava , Hila Gingold , Rachel Posner , Olga Antonova , Yonatan B. Tzur , Oded Rechavi bioRxiv 2025.08.07.669182; doi: https://doi.org/10.1101/2025.08.07.669182 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7636) Biochemistry (17704) Bioengineering (13898) Bioinformatics (41967) Biophysics (21460) Cancer Biology (18599) Cell Biology (25525) Clinical Trials (138) Developmental Biology (13384) Ecology (19909) Epidemiology (2067) Evolutionary Biology (24326) Genetics (15613) Genomics (22512) Immunology (17740) Microbiology (40423) Molecular Biology (17191) Neuroscience (88645) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4825) Physiology (7646) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)