0.005% Preservative-Free Latanoprost Triggers Meibomian Gland Dysfunction in Mice via Inflammation and Oxidative Stress Modulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article 0.005% Preservative-Free Latanoprost Triggers Meibomian Gland Dysfunction in Mice via Inflammation and Oxidative Stress Modulation Caihong Huang, Yiran Yang, Shinan Wu, Zhaolin Liu, Lin Chen, Dan Yan, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6897699/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Jan, 2026 Read the published version in BMC Pharmacology and Toxicology → Version 1 posted 11 You are reading this latest preprint version Abstract Purpose This study aimed to investigate the effects of preservative-free latanoprost on meibomian gland function in mice and its possible mechanism. Methods Disproportionality analysis was conducted using the FAERS database to evaluate adverse reaction reports and epidemiological characteristics associated with preservative-free latanoprost. In mouse models, 0.005% preservative-free latanoprost or vehicle control was topically applied for periods ranging from 7 to 28 days. Morphological changes of the meibomian gland in mice were detected by immunohistochemistry. Immunofluorescence staining, western blotting, and/or quantitative real-time fluorescence quantitative PCR (qRT-PCR) were used to examine the expression levels of prostaglandin F2α receptor (FP), inflammatory cells and mediators, oxidative stress and signaling pathways related factors in mouse meibomian gland tissues. Results Reports of adverse reactions caused by preservative-free latanoprost increased annually in the FAERS database. Locally applied preservative-free latanoprost in mice led to an escalation of mucous secretion at the eyelid margin, accompanied by meibomian gland duct obstruction, lipid accumulation in glandular acini, an elevation in the expression levels of FP and Slco2a, and a reduction in the expression levels of PGDH within the meibomian glands. Other inflammatory markers such as CCL2, IL-1β, TNF-α, IL-6, and CXCL5 showed elevated expression levels. Notably, there was an increase in oxidative stress proteins, including NOX4, 3-NT, and 4-HNE, along with a decrease in the expression of antioxidant stress proteins, including SOD2 and Keap-1. Additionally, the Erk and NF-κB signaling pathways were significantly activated. Conclusion 0.005% preservative-free latanoprost induces meibomian gland dysfunction in mice by promoting inflammatory responses and oxidative stress. Latanoprost meibomian gland dysfunction inflammation ocular surface damage FAERS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Précis Reports of preservative-free latanoprost inducing changes in the eyelid margin during glaucoma treatment are increasing. Animal studies have shown that preservative-free latanoprost can cause meibomian gland dysfunction in mice through inflammation- and oxidative stress-related mechanisms. Introduction Meibomian gland dysfunction (MGD) is a disease characterized by chronic diffuse damage to the meibomian glands, ductal obstruction, or abnormal quantity or quality of meibum secretion [ 1 ]. In recent years, numerous clinical trials have reported a high incidence of MGD in glaucoma patients[ 2 – 5 ]. The researchers reiterated that glaucoma patients had significantly worse meibum quality, lower meibomian gland secretion, and thinner lipid layer thickness compared to healthy control[ 5 , 6 ], with a notable negative impact on the quality of life, compliance with treatment, and progression of glaucoma treatment in patients[ 7 ]. Moreover, studies have linked that the high incidence of MGD in glaucoma patients is closely related to the long-term use of anti-glaucoma eye drops, especially prostaglandin (PG) analogs[ 3 , 6 ]. Mocan et al. observed a higher prevalence of MGD in glaucoma patients undergoing PG analog monotherapy (92.0%) compared to those receiving non-PG analog therapy (58.3%)[ 8 ]. In another study, Cho and colleagues compared patients under PG analogs monotherapy with those under combined PG analogs and other intraocular pressure (IOP)--lowering agents, and the results showed no significant difference in meibomian gland dropout between the two groups, suggesting that PG analogs might be the predominant IOP-lowering agent causing MGD[ 9 ]. As the first PG analog used in the treatment of glaucoma[ 10 ], latanoprost also has been reported to induce significantly higher scores for lid margin abnormality, meiboscore, and meibum compared with untreated control eyes in clinical studies[ 11 , 12 ]. With the continuous emergence of new drugs in recent years, reports of drug-induced diseases have become increasingly common. The FDA's Adverse Event Reporting System (FAERS) is a database of drug-related adverse reactions reported by groups including physicians, pharmacists, and drug manufacturers, which has been used to summarize drug-induced pancreatitis, drug-related interstitial lung disease, etc. in previous studies[ 13 , 14 ]. Latanoprost represents a significant addition to the first-line treatment options for reducing IOP in patients with open-angle glaucoma or ocular hypertension and continues to be widely prescribed worldwide[ 15 , 16 ]. Therefore, the potential adverse reactions of latanoprost will be evaluated using the FAERS database in this study. Meanwhile, it is important to examine its potential role in eye disorders. In our previous study, we demonstrated that 0.005% preservative-free latanoprost can induce dry eye-like ocular surface damage by promoting inflammation in mice[ 17 ]. However, to date, the research on latanoprost-induced MGD is predominantly confined to clinical trials, with the underlying mechanisms yet to be thoroughly studied. Latanoprost is an ester prodrug of prostaglandin F2α (PGF2α), it can also bind to the PGF2α receptor, interacting with the inflammatory factor PGF2α to perform biological function[ 18 ]. This mechanism may lead to various inflammation-related adverse reactions on the ocular surface[ 17 ]. Given that MGD is an inflammation-driven eyelid disorder, the local application of preservative-free latanoprost eye drops could potentially influence the pathogenesis of MGD. Understanding the role and mechanism of PG analogs in MGD would help preserve the structural and functional integrity of meibomian glands during eye drop usage, which could significantly enhance the glaucoma treatment effect. In this study, we aim to evaluate the epidemiological characteristics of adverse ocular reactions to preservative-free latanoprost, explore the effects of 0.005% preservative-free latanoprost eye drops on the mouse meibomian gland, and delve deeper into the potential mechanism. Methods Study design and data source We conducted a retrospective pharmacovigilance analysis of latanoprost based on the FAERS databases ( https://fis.fda.gov/extensions/FPD-QDE-FAERS/FPD-QDE-FAERS.html ) , which are publicly accessible repositories of adverse drug event reports. The FAERS database comprises voluntary reports from various sources including healthcare professionals, patients, pharmacists, and pharmaceutical companies. This database adheres to national safety reporting guidelines and encodes all adverse events using preferred terms (PTs) from the Medical Dictionary of Regulatory Activities. Due to the public accessibility and anonymized nature of patient records in both databases, our study did not involve informed consent or ethical approval. To ensure the inclusion of the most up-to-date and comprehensive reports, we extracted all FAERS reports from the first quarter of 2004 through the fourth quarter of 2023. Specifically, our analysis focused on adverse reaction reports associated with xelpros , monoprost , and iyuzeh ( preservative-free formulations). Animals In this study, male C57BL/6J mice aged 6–8 weeks[ 19 ], obtained from the Shanghai SLAC Laboratory Animal Center (Shanghai, China), were utilized. All experimental procedures were approved by the Experimental Animal Ethics Committee of Xiamen University and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. During all experimental procedures, mice were anesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/kg). Within 3–5 minutes after injection, mice reached a deep anesthesia state, characterized by slow respiration and absence of pedal or righting reflexes. The depth of anesthesia was confirmed before any manipulation to ensure that animals were completely unconscious and free from pain. At the end of experiments, mice were humanely euthanized by cervical dislocation under deep anesthesia. This method was selected because pentobarbital sodium induces rapid and stable anesthesia, ensuring a painless and humane euthanasia process in accordance with the AVMA Guidelines for the Euthanasia of Animals (2020). Topical administration of 0.005% latanoprost In alignment with our previous study, 0.005% preservative-free latanoprost was prepared in PBS, supplemented with 0.01% dimethyl sulfoxide (DMSO) [ 20 ]. The mice were randomly allocated into three groups (n = 5 each): (1) the untreated control group (UT group), which received no eye drop administration; (2) the vehicle-treated group (Vehicle group), receiving only vehicle eye drops; and (3) the group treated with 0.005% latanoprost eye drops (Latanoprost group). Topical application of eye drops was conducted four times daily over periods of 7, 14, and 28 days. Animal examination The ocular surface phenotype of the mice was evaluated in a blinded manner by the same researcher on days 7, 14, and 28 using a slit-lamp microscope (Takagi Seiko Co., Ltd., Nagano, Japan). This evaluation included measuring corneal epithelial integrity through corneal epithelial fluorescein staining, assessing conjunctival sac secretion, and observing changes in the eyelid margins. Additionally, the meibomian gland (MG) structure was imaged using a stereoscopic microscope (Leica M165-FC, Germany), following the methodology described in a previous study [ 21 ]. LipidTOX Staining Frozen eyelid sections underwent fixation in 4% paraformaldehyde for 10 minutes, succeeded by a 5-minute rinsing step in PBS. Subsequently, the sections were immersed in a buffer solution containing LipidTOX neutral lipid stain (H34475; Thermofisher, Waltham, MA, USA), which was diluted at a ratio of 1:100, and were left to incubate at room temperature for a minimum of 30 minutes. Following this incubation period, counterstaining was carried out using DAPI. Evaluation and imaging of the sections were performed utilizing a microscope (DM2500; Leica Microsystems, Wetzlar, Germany). Immunofluorescent staining For immunofluorescence staining, cryosections were first fixed with cold acetone (-20°C for 10 minutes), then permeabilized with 0.2% Triton X-100 for 20 min. After that, sections were blocked with 2% BSA for 1h at room temperature, and incubated with CD-11b (1:250, ab8878; Abcam), and Ly6G (1:600) at 4°C overnight. Secondary antibodies corresponding to the species of the primary antibodies were applied the next day, and the nucleus was stained with 4’,6-diamidino-2-phenylindole (DAPI; Catalog no. H-1200; Vector, Burlingame, CA, USA). Avoid light during the above operation. Images were captured with an upright microscope (DM2500; Leica Microsystems), and the fluorescent intensity was measured using the NIS Elements Software. Immunohistochemistry Following deparaffinization and rehydration, paraffin-embedded sections were treated with 3% hydrogen peroxide for 10 minutes to quench endogenous peroxidase activity. Subsequently, heat-induced antigen retrieval was conducted using 0.01 M sodium citrate buffer (pH 6.0) for 8 minutes, followed by membrane permeabilization with 0.2% Triton X-100 for 20 minutes. Sections were then blocked with 2% BSA for 1 hour at room temperature and incubated overnight at 4°C with primary antibodies FP, NOX-4, 3-NT, and 4-HNE, each diluted at 1:100. The next day, secondary antibodies corresponding to the species of the primary antibodies were applied, and the detection was performed using DAB staining. Slides were subsequently counterstained with hematoxylin, dehydrated, and mounted. Imaging was accomplished using a Nikon microscope. Total RNA extraction, reverse transcription and qRT-PCR The meibomian glands were meticulously dissected from each group under a dissecting microscope, following the removal of the skin, subcutaneous tissue, muscle, and palpebral conjunctiva. Total RNA was then extracted using Trizol reagent (Thermo Fisher Scientific, United States), adhering to the manufacturer’s protocol. RNA concentration was determined using a Nanodrop 2000, and 10 µg of RNA was used for cDNA synthesis with a reverse transcription kit (Catalog no. RR047A; TaKaRa, Shiga, Japan). Real-time PCR analysis was performed using Hieff™ qPCR SYBR® Green Master Mix (No Rox) (catalog no. 11201ES08; Yeasen, China) on a LightCycler® 96 Real-Time PCR System (catalog no.05815916001, Roche, Switzerland), following a previously described amplification protocol[ 22 ]. mRNA expression levels were quantified using the comparative threshold cycle (Ct) method, with β-actin serving as the internal control. The sequences of the specific primers used are provided in Table 1 . Table 1 Primers involved in this study. Gene Sense Primer Anti-sense Primer FP CTGGACTCATCGCAAACACAA AGGAAGCCTTTGACTTCTGTCTA SLCO2a TGAAGCGTTTTGTTTTCCCTCT CGGGTGTGGAACATCCCATAA PGDH GTGAACGGCAAAGTGGCTCT TCCAATCCACCAATGCTACCT CCL2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT IL-1β GGGCCTCAAAGGAAAGAATC TACCAGTTGGGGAACTCTGC TNF-α TCTACTGAACTTCGGGGTGATCG ACGTGGGCTACAGGCTTGTCA IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC IL-8 AAGAAACCACCGGAAGGAAC ACTCCTTGGCAAAACTGCAC β-actin CCTAAGGCCAACCGTGAAAAG AGGCATACAGGGACAGCACAG Western blot Proteins extracted from meibomian glands were dissolved in cold RIPA buffer containing protease and phosphatase inhibitors. Protein concentration was determined using a BCA Protein Assay Kit (23225; Thermo Fisher Scientific) and adjusted to an equal level. To denature the proteins, the supernatant was boiled at 100°C for 10 minutes. Equal amounts of protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred electronically to polyvinylidene fluoride (PVDF) membranes (catalog no. IPVH00010; Millipore, Billerica, MA, USA). Membranes were blocked with 5% BSA (2 hours at room temperature) and then incubated overnight at 4°C with primary antibodies targeting NOX-4, 3-NT, 4-HNE, Keap1, SOD2, p-NFκB, NFκB, p-Erk and Erk (all at 1:1000 dilution). Following incubation with HRP-conjugated goat anti-rabbit IgG or goat anti-mouse IgG, protein expression levels were visualized using an enhanced chemiluminescence reagent (NcmECL Ultra®, NCM Biotech, China), recorded with a transilluminator (ChemiDoc XRS System; BioRad, USA), and quantified using Quanty Software (Shanghai, China). β-actin was used as a reference antibody for data normalization. Statistical analysis Adverse event reporting signal detection was performed using the disproportionality method, employing reported odds ratio (ROR)[ 23 ], proportional reported ratio (PRR)[ 24 ], bayesian confidence propagation neural network (BCPNN)[ 25 ], and multi-item gamma poisson shrinker (MGPS)[ 26 ]. The calculation method and screening criteria for positive signals of disproportionality analysis can be found in our previous research[ 27 – 32 ]. We further evaluated the distribution of adverse drug reaction reports for preservative-free Latanoprost. Statistical analysis was conducted using SPSS (version 26.0; IBM, US), Graphpad Prism (version 10.1.2), Microsoft Excel 2019, and R (version 4.2.2), with significance set at P < 0.05. R data analysis employed major packages such as ggplot2 (version 3.4.4), ggrepel (version 0.9.4), dplyr (version 1.1.4), and DescTools (version 0.99.52). Results Adverse reactions and epidemiological characteristics of preservative-free latanoprost Since 2019, reports of adverse reactions to preservative-free latanoprost have been on the rise, reaching a peak in 2023 (Fig. 1 A). Disproportionality analysis revealed significant signals for adverse reactions related to MG, including eyelid irritation (ROR = 83.228), eyelid swelling (ROR = 79.2), eyelid pruritus (ROR = 66.216), blepharitis (ROR = 52.505), and eyelid erythema (ROR = 36.763) (Fig. 1 B). Topical application of preservative-free latanoprost induced changes in eyelid phenotype Compared to the vehicle control mice, the preservative-free latanoprost eye-treated mice showed increased mucinous secretions on the eyelid margins since day 14, and more obvious plugging of the MG orifice since day 28 (Fig. 2 A). While a closer inspection revealed that MG dropout grade was not significantly different between the two groups (Fig. 2 B). Those results indicated that MGD induced by preservative-free latanoprost was still in its early stages. Topical application of preservative-free latanoprost-induced functional MG changes The immunofluorescence staining results using LipidTox showed increased lipid deposition in the preservative-free latanoprost-treated group compared to the Vehicle group, and a significant difference between the two groups was observed on Day 28 (Fig. 3 ). Building upon the adverse drug reactions induced by 0.005% preservative-free latanoprost, including blepharitis, as well as our previous research findings [ 17 , 19 , 33 ], we further explored the inflammatory and oxidative stress levels associated with latanoprost-induced meibomian gland inflammation. Topical application of preservative-free latanoprost increased prostaglandin accumulation in MG According to previous reports, FP, as the prostaglandin F receptor, binds prostaglandin F2α and mediates its physiological effects[ 34 ]. Through immunohistochemical and qRT-PCR analyses, we observed a significant increase in FP gene levels in the meibomian glands of the latanoprost group compared to both the vehicle group and the UT group (Fig. 4 A). Slco2a is a prostaglandin transporter, while PGDH is the prostaglandin dehydrogenase according to a previous study[ 35 ]. Hence, we also noted an increase in Slco2a expression levels and a decrease in PGDH expression levels in the latanoprost group compared to the vehicle group (Fig. 4 B). These changes in gene expression levels suggest the cumulative effect of latanoprost on prostaglandins in mouse meibomian glands. Topical application of preservative-free latanoprost stimulated inflammation in MG Myeloid-derived cells such as monocytes and neutrophils can be identified by the expression of CD11b and Ly6G on the cell surface. In this study, CD11b and Ly6G immunofluorescent staining showed more inflammatory cells infiltrating in MG from the preservative-free latanoprost group compared with both the vehicle group and UT group (Fig. 5 A). We also found significant mRNA upregulation of several inflammatory cytokines and chemokines including CCL2, IL-1β, TNF-α, IL-6, and CXCL5 (Fig. 5 B). These results suggested that topical application of latanoprost induced chronic inflammation of the MG microenvironment. The intracellular signaling pathways involved in latanoprost regulation of cytokine and chemokine output in MG In addition, we analyzed the activation of signaling pathways among the three groups. The results showed significant activation of the Erk and NF-κB signaling pathways in the Latanoprost group compared to the other two groups (Fig. 6 ). The marked activation of these two pathways suggests the potential presence of significant chronic inflammatory activation in the meibomian glands following Latanoprost administration in mice. Topical application of preservative-free latanoprost promoted oxidative stress in MG Numerous studies have shown that inflammation and oxidative stress are closely linked and promote each other in the pathogenesis of many chronic diseases. We detected the levels of NADPH oxidase subunits and oxidative stress markers by immunohistochemical staining and western blot and found that topical application of latanoprost promoted the expression of NOX4, 4HNE, and 3-NT in MG (Fig. 7 A-B). Meanwhile, we investigated the changes in the antioxidant defense system. Western blotting demonstrated that latanoprost treatment showed an elevated protein level of keap1 and decreased protein levels of SOD2 (Fig. 7 C). These results, taken together, suggested that topical application of latanoprost causes oxidative stress in MG. Discussion Much of the prior research has suggested that adverse reactions to latanoprost eye drops, mainly ocular surface reactions, originate from the preservative contained in the drop[ 36 ]. However, based on an analysis of epidemiological data and reports of adverse eyelid reactions, we have observed that, as the use of preservative-free latanoprost eye drops expands, reports of adverse reactions such as eyelid irritation, swelling, itching, inflammation, and redness, all symptoms related to MGD, are continuously increasing year by year. Past clinical research has shown a clear increase in the incidence of MGD in patients who have used latanoprost eye drops for a long period[ 37 ]. Further exploration through animal experimentation was carried out to study the effects of preservative-free latanoprost on the functionality of the meibomian gland in mice, as well as possible causal mechanisms. The findings of this investigation demonstrated that the topical application of preservative-free 0.005% latanoprost instigates the obstruction of the meibomian gland opening and lipid deposits within the gland in mice. Additionally, it induced oxidative stress and inflammation of the meibomian gland tissue in mice. All these alterations are considered key presentations of clinical MGD. This data points to the possibility that MGD induced by latanoprost eye drops may not solely be due to the preservative, but potentially associated with latanoprost itself. Latanoprost is an ester prodrug of PGF2α. PGF2α is a type of prostaglandin and a substantial pro-inflammatory factor. It exhibits pro-inflammatory effects when combined with FP. Our previous research confirmed that latanoprost can bind with ocular surface FP triggering ocular surface inflammation in mice and causing dry eye-like alterations[ 17 ]. In this study, after the local application of latanoprost in mice, not only did we observe an increase in the FP expression in the meibomian gland tissue but interestingly, we also discovered significant upregulation Slco2a in the latanoprost subject group, meanwhile PGDH was considerably downregulated. Slco2a plays a role in the transmembrane transport of prostaglandins, facilitating their accumulation. Conversely, PGDH, which is responsible for the metabolism and degradation of prostaglandins, sees a reduction that diminishes prostaglandin breakdown. These changes collectively contribute to an increased prostaglandin presence[ 38 – 40 ]. Thus, it becomes evident that local use of latanoprost eye drops not only allows latanoprost itself to bind with FP receptors but also enables the meibomian gland to produce more PGF2α, creating a positive feedback loop. These findings suggest that even preservative-free latanoprost can still lead to the build-up of prostaglandins within the meibomian gland when locally applied to the mouse eye, thereby instigating relevant inflammatory responses. Ocular surface inflammation plays a significant role in MGD, with the disease's pathophysiological processes heavily involving inflammatory responses[ 41 , 42 ]. Multiple inflammatory signaling pathways were activated in MGD, such as NF-κB, MAPK, and PI3K[ 43 – 45 ], leading to the release of various pro-inflammatory cytokines and chemokines like CCL2, IL-1β, TNF-α, CXCL5, and IL-6. NF-κB is a key transcriptional activator for many pro-inflammatory cytokines, including IL-1β and TNF-α[ 46 ]. Additionally, it has been shown that Latanoprost can trigger the P38-NF-κB signaling pathway in human fibroblasts, leading to a heightened release of inflammatory cytokines and chemokines[ 47 ]. In our study, treatment with preservative-free Latanoprost led to a significant activation of Erk, a key protein in the MAPK signaling pathway, and NF-κB in mouse meibomian glands. The significant upregulation of inflammation-related markers CD11b, Ly6G, CCL2, IL-1β, TNF-α, CXCL5, and IL-6 further validates the critical role of inflammation in the dysfunction of meibomian glands following Latanoprost treatment. Our findings suggest that the binding of Latanoprost to its FP receptors may induce inflammation in the meibomian gland, involving the activation of NF-κB and Erk signaling pathways and the production of inflammatory cytokines. Hence, we further substantiate that preservative-free latanoprost induces meibomian gland dysfunction in mice through the provocation of inflammatory responses within the meibomian gland. These results align with previous reports regarding the pathological mechanisms of MGD[ 48 ]. Oxidative stress is the imbalance between the oxidation and antioxidation systems of cells and tissues, resulting from excessive production of reactive oxygen species (ROS) [ 49 ]. Our previous research results demonstrated a significant increase in oxidative stress levels in MGD mice induced by a high-fat and high-sugar diet[ 19 ]. Additionally, NOX4, 3-NT, and 4HNE proteins play important roles in the oxidative stress process [ 50 ]. NOX4 is primarily involved in nuclear oxidative stress processes [ 51 ], and tyrosine may be oxidized to form 3-NT under conditions of oxidative stress, making 3-NT concentration a marker of cellular or tissue oxidative stress activity [ 52 ]. Our study revealed a significant increase in the levels of NOX4, 3-NT, and 4HNE proteins involved in oxidative stress processes in the meibomian gland of mice treated with preservative-free latanoprost. Conversely, the levels of key proteins involved in the anti-oxidative stress process, including SOD2 [ 53 ], were significantly decreased. Therefore, we speculate that one of the potential mechanisms underlying MGD induced by preservative-free latanoprost in mice is an increase in oxidative stress levels and a decrease in anti-oxidative stress levels. Antioxidant enzymes such as peroxidases are expressed in the human meibomian gland and conjunctival tissues, and previous studies have already confirmed that oxidative stress plays a crucial role in the changes associated with corneal epithelial damage[ 54 ]. The production of ROS is related to the activity of nicotinamide adenine dinucleotide phosphate (NADPH oxidase), particularly in phagocytic immune cells and endothelial cells, with inflammation also playing a role in this process[ 55 ]. When ROS is produced chronically or over a long duration, accumulating beyond the body's capacity to clear ROS, related oxidative metabolites become major mediators of inflammatory pathological responses, promoting the initiation and cascade of inflammatory responses[ 56 ]. The pro-inflammatory activity of these substances is partially related to cells of the immune system, such as polymorphonuclear neutrophils[ 57 ]. Therefore, the ROS metabolites that gradually accumulate during oxidative stress are drivers of inflammatory responses, further exacerbating local inflammation in the mouse meibomian gland. During the inflammatory process, activated phagocytes such as neutrophils and macrophages produce a large amount of ROS, thereby further aggravating oxidative stress damage[ 58 ]. Hence, the inflammatory process can induce oxidative stress, and oxidative stress can also induce inflammation through the activation of various pathways; oxidative stress and inflammation are closely related pathophysiological processes. Our research demonstrates that both factors play a pivotal role in inducing MGD in mice when preservative-free latanoprost is applied topically to the eye, and they may interact to form a vicious cycle. In summary, according to our research findings, we have uncovered for the first time that preservative-free latanoprost also has the potential to induce MGD in mice. This matches epidemiological data reported in the adverse drug reaction database regarding the adverse reactions of preservative-free latanoprost. We have also verified that inflammatory damage and oxidative stress are significant mechanisms involved in this process. Our study validates the mechanisms from databases to animal experiments for pharmacovigilance and medication safety. Therefore, glaucoma clinicians need to consider the possible adverse effects of long-term use of latanoprost when prescribing glaucoma patients, especially those with pre-existing meibomian gland dysfunction or limbal inflammation. Declarations Funding Declaration Supported by grants from the Natural Science Foundation of Fujian (No. 2023J01012, CH), and National Natural Science Foundation of China (No.82271054, ZL). Data availability statement The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: FAERS Publish Dashboard (https://www.fda.gov/drugs/questions-and-answers-fdas-adverse-event-reporting-system-faers/fda-adverse-event-reporting-system-faers-public-dashboard). Authors’ contributions Caihong Huang, Yiran Yang, and Shinan Wu conceived the research idea. Caihong Huang conducted data cleaning and a literature review. Caihong Huang, Yiran Yang, Shinan Wu, Zhaolin Liu, Lin Chen, Dan Yan and Mingyan Wei contributed to drafting and critically revising the work for intellectual content. Caihong Huang and Shinan Wu conducted the analysis and created the figures and tables. Ke Yan, Ruochen Wang, Jiaoyue Hu, Wei Li, and Zuguo Liu provided a critical review of the manuscript. All authors have read and approved the manuscript. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments Not Applicable. Clinical trial number Not applicable. References Nelson, J.D.; Shimazaki, J.; Benitez-del-Castillo, J.M.; Craig, J.P.; McCulley, J.P.; Den, S.; Foulks, G.N. The international workshop on meibomian gland dysfunction: report of the definition and classification subcommittee. Invest Ophthalmol Vis Sci 2011 , 52 , 1930-1937, doi:10.1167/iovs.10-6997b. Kim, J.H.; Shin, Y.U.; Seong, M.; Cho, H.Y.; Kang, M.H. Eyelid Changes Related to Meibomian Gland Dysfunction in Early Middle-Aged Patients Using Topical Glaucoma Medications. Cornea 2018 , 37 , 421-425, doi:10.1097/ico.0000000000001489. Mocan, M.C.; Uzunosmanoglu, E.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. The Association of Chronic Topical Prostaglandin Analog Use With Meibomian Gland Dysfunction. J Glaucoma 2016 , 25 , 770-774, doi:10.1097/ijg.0000000000000495. Soriano, D.; Ferrandez, B.; Mateo, A.; Polo, V.; Garcia-Martin, E. Meibomian Gland Changes in Open-angle Glaucoma Users Treated with Topical Medication. Optom Vis Sci 2021 , 98 , 1177-1182, doi:10.1097/opx.0000000000001782. Uzunosmanoglu, E.; Mocan, M.C.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. Meibomian Gland Dysfunction in Patients Receiving Long-Term Glaucoma Medications. Cornea 2016 , 35 , 1112-1116, doi:10.1097/ico.0000000000000838. Cho, W.H.; Lai, I.C.; Fang, P.C.; Chien, C.C.; Tseng, S.L.; Lai, Y.H.; Huang, Y.T.; Kuo, M.T. Meibomian Gland Performance in Glaucomatous Patients With Long-term Instillation of IOP-lowering Medications. J Glaucoma 2018 , 27 , 176-183, doi:10.1097/ijg.0000000000000841. Lee, T.H.; Sung, M.S.; Heo, H.; Park, S.W. Association between meibomian gland dysfunction and compliance of topical prostaglandin analogs in patients with normal tension glaucoma. PLoS One 2018 , 13 , e0191398, doi:10.1371/journal.pone.0191398. Mocan, M.C.; Uzunosmanoglu, E.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. The association of chronic topical prostaglandin analog use with meibomian gland dysfunction. Journal of glaucoma 2016 , 25 , 770-774. Cho, W.-H.; Lai, C.; Fang, P.-C.; Chien, C.-C.; Tseng, S.-L.; Lai, Y.-H.; Huang, Y.-T.; Kuo, M.-T. Meibomian gland performance in glaucomatous patients with long-term instillation of IOP-lowering medications. Journal of glaucoma 2018 , 27 , 176-183. Alm, A. Latanoprost in the treatment of glaucoma. Clinical ophthalmology 2014 , 1967-1985. Arita, R.; Itoh, K.; Maeda, S.; Maeda, K.; Furuta, A.; Tomidokoro, A.; Aihara, M.; Amano, S. Effects of long-term topical anti-glaucoma medications on meibomian glands. Graefe's Archive for Clinical and Experimental Ophthalmology 2012 , 250 , 1181-1185. Arita, R.; Itoh, K.; Maeda, S.; Maeda, K.; Furuta, A.; Tomidokoro, A.; Aihara, M.; Amano, S. Comparison of the long-term effects of various topical antiglaucoma medications on meibomian glands. Cornea 2012 , 31 , 1229-1234. Jiang, T.; Su, H.; Xu, J.; Li, C.; Zhang, N.; Li, Y.; Wu, Y.; Ni, R.; Ming, Y.; Li, Z. Drug-induced interstitial lung disease: a real-world pharmacovigilance study of the FDA Adverse Event Reporting System from 2004 to 2021. Therapeutic Advances in Drug Safety 2024 , 15 , 20420986231224227. Li, D.; Wang, H.; Qin, C.; Du, D.; Wang, Y.; Du, Q.; Liu, S. Drug‐Induced Acute Pancreatitis: A Real‐World Pharmacovigilance Study Using the FDA Adverse Event Reporting System Database. Clinical Pharmacology & Therapeutics 2024 , 115 , 535-544. Digiuni, M.; Fogagnolo, P.; Rossetti, L. A review of the use of latanoprost for glaucoma since its launch. Expert opinion on pharmacotherapy 2012 , 13 , 723-745. Perry, C.M.; McGavin, J.K.; Culy, C.R.; Ibbotson, T. Latanoprost: an update of its use in glaucoma and ocular hypertension. Drugs & aging 2003 , 20 , 597-630. Yang, Y.; Huang, C.; Lin, X.; Wu, Y.; Ouyang, W.; Tang, L.; Ye, S.; Wang, Y.; Li, W.; Zhang, X. 0.005% preservative-free latanoprost induces dry eye-like ocular surface damage via promotion of inflammation in mice. Investigative ophthalmology & visual science 2018 , 59 , 3375-3384. Sharif, N.; Kelly, C.; Crider, J. Agonist activity of bimatoprost, travoprost, latanoprost, unoprostone isopropyl ester and other prostaglandin analogs at the cloned human ciliary body FP prostaglandin receptor. Journal of ocular pharmacology and therapeutics 2002 , 18 , 313-324. Bu, J.; Wu, Y.; Cai, X.; Jiang, N.; Jeyalatha, M.V.; Yu, J.; He, X.; He, H.; Guo, Y.; Zhang, M. Hyperlipidemia induces meibomian gland dysfunction. The ocular surface 2019 , 17 , 777-786. Yang, Y.; Huang, C.; Lin, X.; Wu, Y.; Ouyang, W.; Tang, L.; Ye, S.; Wang, Y.; Li, W.; Zhang, X.; et al. 0.005% Preservative-Free Latanoprost Induces Dry Eye-Like Ocular Surface Damage via Promotion of Inflammation in Mice. Invest Ophthalmol Vis Sci 2018 , 59 , 3375-3384, doi:10.1167/iovs.18-24013. Bu, J.; Wu, Y.; Li, K.; Zhang, M.; Zhang, R.; Sun, L.; Guo, Y.; He, H.; Li, S.; Liu, Z.; et al. Transitory alkali exposure on meibomian gland orifices induces meibomian gland dysfunction. Ocul Surf 2023 , 29 , 406-415, doi:10.1016/j.jtos.2023.06.007. Schlesinger, J.; Tönjes, M.; Schueler, M.; Zhang, Q.; Dunkel, I.; Sperling, S.R. Evaluation of the LightCycler 1536 Instrument for high-throughput quantitative real-time PCR. Methods 2010 , 50 , S19-22, doi:10.1016/j.ymeth.2010.01.007. Zhou, S.; Jia, B.; Kong, J.; Zhang, X.; Lei, L.; Tao, Z.; Ma, L.; Xiang, Q.; Zhou, Y.; Cui, Y. Drug-induced fall risk in older patients: A pharmacovigilance study of FDA adverse event reporting system database. Frontiers in pharmacology 2022 , 13 , 4936. Khouri, C.; Revol, B.; Lepelley, M.; Mouffak, A.; Bernardeau, C.; Salvo, F.; Pariente, A.; Roustit, M.; Cracowski, J.-L. A meta-epidemiological study found lack of transparency and poor reporting of disproportionality analyses for signal detection in pharmacovigilance databases. Journal of Clinical Epidemiology 2021 , 139 , 191-198. Bate, A. Bayesian confidence propagation neural network. Drug safety 2007 , 30 , 623-625. Berlin, C.; Blanch, C.; Lewis, D.J.; Maladorno, D.D.; Michel, C.; Petrin, M.; Sarp, S.; Close, P. Are all quantitative postmarketing signal detection methods equal? Performance characteristics of logistic regression and Multi‐item Gamma Poisson Shrinker. Pharmacoepidemiology and drug safety 2012 , 21 , 622-630. Wu, S.N.; Chen, X.D.; Zhang, Q.H.; Wang, Y.Q.; Yan, D.; Xu, C.S.; Wang, S.P.; Zhu, L.; Qin, D.Y.; Guo, S.J.; et al. Drug-Related Keratitis: A Real-World FDA Adverse Event Reporting System Database Study. Transl Vis Sci Technol 2024 , 13 , 17, doi:10.1167/tvst.13.9.17. Wu, S.N.; Chen, X.D.; Yan, D.; Wang, Y.Q.; Wang, S.P.; Guan, W.Y.; Huang, C.; Hu, J.; Liu, Z. Drug-associated glaucoma: A real-world study based on the Food and Drug Administration adverse event reporting system database. Clin Exp Ophthalmol 2024 , doi:10.1111/ceo.14454. Wu, S.N.; Huang, C.; Wang, Y.Q.; Li, X.; Zhang, S.Q.; Chen, X.D.; Qin, D.Y.; Zhu, L.; Wen, J.Y.; Luo, N.C.; et al. Adverse events of topical ocular prostaglandin medications for glaucoma treatment: a pharmacovigilance study based on the FAERS database. Ther Adv Drug Saf 2024 , 15 , 20420986241285929, doi:10.1177/20420986241285929. Wu, S.N.; Huang, C.; Wang, Y.Q.; Chen, X.D.; Li, X.; Zhang, S.Q.; Qin, D.Y.; Zhu, L.; Xu, C.S.; Zhang, Q.H.; et al. Real-World Large Sample Assessment of Drug-related Dry Eye Risk: Based on the FDA Adverse Event Reporting System Database. Asia Pac J Ophthalmol (Phila) 2024 , 13 , 100104, doi:10.1016/j.apjo.2024.100104. Li, X.; Wu, S.N.; Zhang, S.Q.; Zhang, Z.J.; Wang, M.Y.; Chen, C.T.; Luo, Z.Y.; Dong, N. Real-world analysis of medications inducing meibomian gland dysfunction: based on the FDA adverse event reporting system database. Expert Opin Drug Saf 2025 , doi:10.1080/14740338.2024.2446430. Liu, R.; Chen, Y.; Wu, S.N.; Ma, W.; Qiu, Z.; Wang, J.; Xu, X.; Chen, C.; Wang, W. Adverse drug events associated with capecitabine: a real-world pharmacovigilance study based on the FAERS database. Ther Adv Drug Saf 2024 , 15 , 20420986241303428, doi:10.1177/20420986241303428. Uzunosmanoglu, E.; Mocan, M.C.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. Meibomian gland dysfunction in patients receiving long-term glaucoma medications. Cornea 2016 , 35 , 1112-1116. Sugimoto, Y.; Yamasaki, A.; Segi, E.; Tsuboi, K.; Aze, Y.; Nishimura, T.; Oida, H.; Yoshida, N.; Tanaka, T.; Katsuyama, M. Failure of parturition in mice lacking the prostaglandin F receptor. Science 1997 , 277 , 681-683. Nakata, R.; Nakamura, Y.; Hosomi, S.; Okuda, H.; Nishida, Y.; Sugita, N.; Itani, S.; Nadatani, Y.; Otani, K.; Tanaka, F. Slco 2 a1 deficiency exacerbates experimental colitis via inflammasome activation in macrophages: a possible mechanism of chronic enteropathy associated with SLCO2A1 gene. Scientific reports 2020 , 10 , 4883. Rath, A.; Eichhorn, M.; Träger, K.; Paulsen, F.; Hampel, U. In vitro effects of benzalkonium chloride and prostaglandins on human meibomian gland epithelial cells. Annals of Anatomy-Anatomischer Anzeiger 2019 , 222 , 129-138. Ha, J.Y.; Sung, M.S.; Park, S.W. Effects of preservative on the meibomian gland in glaucoma patients treated with prostaglandin analogues. Chonnam Medical Journal 2019 , 55 , 156. Sabirov, R.Z.; Merzlyak, P.G.; Okada, T.; Islam, M.R.; Uramoto, H.; Mori, T.; Makino, Y.; Matsuura, H.; Xie, Y.; Okada, Y. The organic anion transporter SLCO 2A1 constitutes the core component of the Maxi‐Cl channel. The EMBO journal 2017 , 36 , 3309-3324. Zaragoza, D.B.; Wilson, R.R.; Mitchell, B.F.; Olson, D.M. The interleukin 1beta-induced expression of human prostaglandin F2alpha receptor messenger RNA in human myometrial-derived ULTR cells requires the transcription factor, NFkappaB. Biology of reproduction 2006 , 75 , 697-704. Sun, C.-C.; Zhou, Z.-Q.; Yang, D.; Chen, Z.-L.; Zhou, Y.-Y.; Wen, W.; Feng, C.; Zheng, L.; Peng, X.-Y.; Tang, C.-F. Recent advances in studies of 15-PGDH as a key enzyme for the degradation of prostaglandins. International Immunopharmacology 2021 , 101 , 108176. Suzuki, T.; Teramukai, S.; Kinoshita, S. Meibomian glands and ocular surface inflammation. The ocular surface 2015 , 13 , 133-149. Sabeti, S.; Kheirkhah, A.; Yin, J.; Dana, R. Management of meibomian gland dysfunction: a review. Survey of ophthalmology 2020 , 65 , 205-217. Guo, Y.; Zhang, H.; Zhao, Z.; Luo, X.; Zhang, M.; Bu, J.; Liang, M.; Wu, H.; Yu, J.; He, H. Hyperglycemia induces meibomian gland dysfunction. Investigative Ophthalmology & Visual Science 2022 , 63 , 30-30. Liu, R.; Li, J.; Xu, Y.; Chen, Z.; Ye, H.; Tang, J.; Wei, L.; Liang, L. Melatonin attenuates lps-induced proinflammatory cytokine response and lipogenesis in human meibomian gland epithelial cells via MAPK/NF-κB pathway. Investigative Ophthalmology & Visual Science 2022 , 63 , 6-6. MM, H.Z.; MM, Q.W.; MM, L.Y.; MM, Y.G. Medication rules and mechanism of topical traditional Chinese medicine for meibomian gland dysfunction-related dry eye disease. Alternative Therapies in Health and Medicine 2023 , 29 , 126-132. Luo, L.; Li, D.-Q.; Doshi, A.; Farley, W.; Corrales, R.M.; Pflugfelder, S.C. Experimental dry eye stimulates production of inflammatory cytokines and MMP-9 and activates MAPK signaling pathways on the ocular surface. Investigative ophthalmology & visual science 2004 , 45 , 4293-4301. Liu, Y.; Liu, Y.; Xu, D.; Li, J. Latanoprost-induced cytokine and chemokine release from human Tenon’s capsule fibroblasts: role of MAPK and NF-κB signaling pathways. Journal of glaucoma 2015 , 24 , 635-641. Qazi, Y.; Kheirkhah, A.; Blackie, C.; Trinidad, M.; Williams, C.; Cruzat, A.; Korb, D.R.; Hamrah, P. Clinically relevant immune-cellular metrics of inflammation in meibomian gland dysfunction. Investigative Ophthalmology & Visual Science 2018 , 59 , 6111-6123. Maritim, A.; Sanders, a.; Watkins Iii, J. Diabetes, oxidative stress, and antioxidants: a review. Journal of biochemical and molecular toxicology 2003 , 17 , 24-38. Walters, J.L.; De Iuliis, G.N.; Nixon, B.; Bromfield, E.G. Oxidative stress in the male germline: A review of novel strategies to reduce 4-hydroxynonenal production. Antioxidants 2018 , 7 , 132. Matsushima, S.; Kuroda, J.; Ago, T.; Zhai, P.; Park, J.Y.; Xie, L.-H.; Tian, B.; Sadoshima, J. Increased oxidative stress in the nucleus caused by Nox4 mediates oxidation of HDAC4 and cardiac hypertrophy. Circulation research 2013 , 112 , 651-663. Govindasamy, M.; Manavalan, S.; Chen, S.-M.; Umamaheswari, R.; Chen, T.-W. Determination of oxidative stress biomarker 3-nitro-L-tyrosine using CdWO4 nanodots decorated reduced graphene oxide. Sensors and Actuators B: Chemical 2018 , 272 , 274-281. Qiu, X.; Brown, K.; Hirschey, M.D.; Verdin, E.; Chen, D. Calorie restriction reduces oxidative stress by SIRT3-mediated SOD2 activation. Cell metabolism 2010 , 12 , 662-667. Dogru, M.; Kojima, T.; Simsek, C.; Tsubota, K. Potential role of oxidative stress in ocular surface inflammation and dry eye disease. Investigative ophthalmology & visual science 2018 , 59 , DES163-DES168. Pendyala, S.; Natarajan, V. Redox regulation of Nox proteins. Respiratory physiology & neurobiology 2010 , 174 , 265-271. Dammak, A.; Huete-Toral, F.; Carpena-Torres, C.; Martin-Gil, A.; Pastrana, C.; Carracedo, G. From oxidative stress to inflammation in the posterior ocular diseases: diagnosis and treatment. Pharmaceutics 2021 , 13 , 1376. Ghanei, M.; Harandi, A.A. Molecular and cellular mechanism of lung injuries due to exposure to sulfur mustard: a review. Inhalation toxicology 2011 , 23 , 363-371. Ahmad, A.; Ahsan, H. Biomarkers of inflammation and oxidative stress in ophthalmic disorders. Journal of Immunoassay and Immunochemistry 2020 , 41 , 257-271. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx BmcPharmacologyToxicologyOriginalImagesforBlots.zip Cite Share Download PDF Status: Published Journal Publication published 24 Jan, 2026 Read the published version in BMC Pharmacology and Toxicology → Version 1 posted Editorial decision: Revision requested 11 Dec, 2025 Reviews received at journal 09 Dec, 2025 Reviewers agreed at journal 28 Nov, 2025 Reviewers agreed at journal 27 Nov, 2025 Reviews received at journal 24 Nov, 2025 Reviewers agreed at journal 10 Nov, 2025 Reviewers invited by journal 03 Nov, 2025 Editor assigned by journal 28 Oct, 2025 Editor invited by journal 23 Oct, 2025 Submission checks completed at journal 23 Oct, 2025 First submitted to journal 23 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6897699","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":542871986,"identity":"f79b77fb-8689-4b33-9f5e-6d9b89227a27","order_by":0,"name":"Caihong Huang","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Caihong","middleName":"","lastName":"Huang","suffix":""},{"id":542871988,"identity":"5523ab7f-a081-436b-998b-2b41328ea3cc","order_by":1,"name":"Yiran Yang","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Yiran","middleName":"","lastName":"Yang","suffix":""},{"id":542871989,"identity":"4d681a0c-e310-4164-a2c6-ed263fcb391a","order_by":2,"name":"Shinan Wu","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Shinan","middleName":"","lastName":"Wu","suffix":""},{"id":542871990,"identity":"878d5903-1112-41e7-8122-709c05d5b014","order_by":3,"name":"Zhaolin Liu","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Zhaolin","middleName":"","lastName":"Liu","suffix":""},{"id":542871991,"identity":"98cb1d09-5d8d-45a5-b4b0-cef193c61b7d","order_by":4,"name":"Lin Chen","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Chen","suffix":""},{"id":542871992,"identity":"bc6bdad3-811d-45a7-b1e4-411120aebc78","order_by":5,"name":"Dan Yan","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Yan","suffix":""},{"id":542871993,"identity":"e74650e3-534e-43da-9277-cc6af8113428","order_by":6,"name":"Mingyan Wei","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Mingyan","middleName":"","lastName":"Wei","suffix":""},{"id":542871994,"identity":"db8d5ebf-9c3a-43e4-867b-5a8951f7188f","order_by":7,"name":"Ke Yan","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Yan","suffix":""},{"id":542871995,"identity":"dc2146d8-ed90-4f9c-a75c-84a4888a1134","order_by":8,"name":"Ruochen Wang","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Ruochen","middleName":"","lastName":"Wang","suffix":""},{"id":542871996,"identity":"597551b5-a7dc-47e8-ba6a-5c0c78335197","order_by":9,"name":"Jiaoyue Hu","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Jiaoyue","middleName":"","lastName":"Hu","suffix":""},{"id":542871997,"identity":"f5575e68-f066-45dc-b25d-c79d66cbc888","order_by":10,"name":"Wei Li","email":"","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Li","suffix":""},{"id":542871998,"identity":"3383d289-b88d-41e4-afdd-0ed130bf56dd","order_by":11,"name":"Zuguo Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYNCCAgkGfgiLmVgtBhIMkg0kagGiA8RqkZ+Rfk3ig4FF4uYb2WkSDBXWiQ3sZw/g1cI4I6dMcoaBROK2M2e3STCcSU9s4MlLwKuFWSInTZoHpOV47zYJxrbDiQ0SPAZ4tbDBtGxu5gVq+UeEFh6J9GNgLRvYQbY0EKFFgucNsyXQL8YzzpzdbJFwLN24jScHvxb59vSHNz5U1Mn2z8jdeONDjbVsP/sZ/FqATkNSkADyHQH1QMD+gLCaUTAKRsEoGNkAAOWfPpmC8OBtAAAAAElFTkSuQmCC","orcid":"","institution":"Xiamen University affiliated Xiamen Eye Center, Fujian Engineering and Research Center of Eye Regenerative Medicine, Eye Institute of Xiamen University, Xiamen University","correspondingAuthor":true,"prefix":"","firstName":"Zuguo","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-06-15 10:08:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6897699/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6897699/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40360-025-01078-9","type":"published","date":"2026-01-24T15:59:14+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":96240197,"identity":"a517a209-ef36-44ad-9062-e6793b092c64","added_by":"auto","created_at":"2025-11-19 07:08:33","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97900,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptBPTclean.docx","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/20ec69b3a672e1b2204e694e.docx"},{"id":95828432,"identity":"c8da5444-fbaa-41a6-8217-5f482dfb2d41","added_by":"auto","created_at":"2025-11-13 11:48:28","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11759,"visible":true,"origin":"","legend":"","description":"","filename":"TABLES.docx","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/1e9ccf41a96c5dd5b8b7c99c.docx"},{"id":96239145,"identity":"02502b1c-88d1-498e-9140-9078d7e10d56","added_by":"auto","created_at":"2025-11-19 07:03:10","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12545,"visible":true,"origin":"","legend":"","description":"","filename":"7005857996bb42cbbb057fad036ff8f7.json","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/69c4a42b0c248825c1badc22.json"},{"id":95828420,"identity":"da910588-607a-45f6-8c45-1701f3a6640f","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"zip","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1924093,"visible":true,"origin":"","legend":"","description":"","filename":"BmcPharmacologyToxicologyOriginalImagesforBlots.zip","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/f8029e52bcba61d63128ba9d.zip"},{"id":96240327,"identity":"2b9a9638-5ec9-4bee-a54f-2444e14d700d","added_by":"auto","created_at":"2025-11-19 07:08:49","extension":"docx","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10889,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/2dc3cdbffde739e982ae0862.docx"},{"id":95828422,"identity":"a416b61c-30df-4ec7-bb16-d7b276a5d0cd","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155033,"visible":true,"origin":"","legend":"","description":"","filename":"7005857996bb42cbbb057fad036ff8f71enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/b68c3d5d6659383c8b199394.xml"},{"id":95828426,"identity":"7a23d970-fbdf-4b9a-bb7c-9f4c74a18bc4","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"pdf","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":236052,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/2879f0f2e05768c36dfd9b38.pdf"},{"id":96239501,"identity":"cde28694-dc6d-429a-af08-67b01e628df6","added_by":"auto","created_at":"2025-11-19 07:06:51","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2227017,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/f86763fe006fa54819ae1380.pdf"},{"id":95828430,"identity":"98822140-860f-431a-b16c-65a233b72e74","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"pdf","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10977323,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/297074d2f0cf27c72f95e184.pdf"},{"id":95828421,"identity":"03257fa5-3d1d-47e1-b245-61bf3dc33c5c","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"pdf","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":589848,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/56109b0fa16329a0fb8841cc.pdf"},{"id":95828429,"identity":"a709a230-0c14-4d9a-ae78-d076eb2ee125","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"pdf","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9261227,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/edd8a0303103a73a5ef82ad5.pdf"},{"id":96239400,"identity":"8eeea5fd-9cd5-4b37-9a5f-0d65157ed95d","added_by":"auto","created_at":"2025-11-19 07:06:32","extension":"pdf","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":643711,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/a2e4437882788a13851a5c48.pdf"},{"id":95828423,"identity":"8e2d710a-dcaa-46f6-8a49-b09b688d9fc6","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"pdf","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1114432,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/09ee27a81b27f81a0d45a9f6.pdf"},{"id":96239476,"identity":"4e886e6a-69e6-4c80-b536-f21a8b02bc01","added_by":"auto","created_at":"2025-11-19 07:06:45","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":154026,"visible":true,"origin":"","legend":"","description":"","filename":"7005857996bb42cbbb057fad036ff8f71structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/948ddf7bade05a08780f9b89.xml"},{"id":95828427,"identity":"c490478b-56b8-41bc-868c-3990a75a8fc6","added_by":"auto","created_at":"2025-11-13 11:48:26","extension":"html","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":166837,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/139fd29cabbe052b0463b8b9.html"},{"id":95828408,"identity":"886f5591-7fee-49b5-9bbb-104b6aa8cd39","added_by":"auto","created_at":"2025-11-13 11:48:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":414257,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdverse reaction reports and epidemiological distribution of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epreservative-free\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003elatanoprost in the FAERS database.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes: \u003c/strong\u003eFigure 1A presents the epidemiological distribution of \u003cem\u003epreservative-free\u003c/em\u003e latanoprost; Figure 1B shows the positive signal values for eyelid-related adverse reactions caused by \u003cem\u003epreservative-free\u003c/em\u003e latanoprost.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation: \u003c/strong\u003eROR, reporting odds ratio; PRR, proportional reporting ratio; BCPNN, Bayesian confidence propagation neural network; MGPS, multi-item gamma poisson shrinker.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/238c285addc84f7f2a84caf7.png"},{"id":96239789,"identity":"88b064f4-538f-446b-8302-cef0c41404cc","added_by":"auto","created_at":"2025-11-19 07:07:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4805328,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of topical application of latanoprost on eyelid phenotype in mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes: \u003c/strong\u003eFigure 2A depicts increased mucinous secretions on the eyelid margins in mice treated with latanoprost eye drops; Figure 2B illustrates the differences in meibomian gland dropout grade among groups after latanoprost treatment, with no significant differences observed between groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation: \u003c/strong\u003eUT, Untreated control mice.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/2def79b1373a2a84965bd86f.png"},{"id":95828409,"identity":"16c51df5-d527-426a-bf95-94118a72e26f","added_by":"auto","created_at":"2025-11-13 11:48:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6229506,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunofluorescence Staining Results of Mouse Meibomian Glands among Groups.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003eFigure 3 LipidTox immunofluorescence staining results indicate increased lipid deposition in the acinar units of the latanoprost-treated group on day 28. \u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001. Scale bar: 50μm.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation:\u003c/strong\u003eUT, Untreated control mice.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/67ca81ff5912e006e3ef09df.png"},{"id":96239503,"identity":"c53c03e5-d15d-484b-881a-19ddfa626b61","added_by":"auto","created_at":"2025-11-19 07:06:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1402703,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAccumulation of prostaglandins in the meibomian glands of mice caused by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epreservative-free\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e latanoprost.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003eFigure 4A shows the immunohistochemical results for FP among the different groups; Figure 4B displays the changes in the expression levels of prostaglandin-related genes among the groups. After treatment with \u003cem\u003epreservative-free\u003c/em\u003e latanoprost, the expression levels of FP and Slco2a were significantly increased, while the expression level of PGDH was significantly decreased.\u003cem\u003e *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001. Scale bar: 50μm.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation:\u003c/strong\u003eUT, Untreated control mice.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/fb1556655b9cbdd0fac9496b.png"},{"id":96239237,"identity":"94c63b5f-c783-42a8-a0d2-e3410a75973b","added_by":"auto","created_at":"2025-11-19 07:05:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4517988,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTopical application of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epreservative-free\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003elatanoprost stimulated inflammation in the meibomian glands.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003eFigure 5A shows the immunofluorescent results of the CD11b and Ly6G myeloid cell markers. Figure 5B illustrates the differences in expression of inflammatory cytokines and chemokines among groups, including upregulated levels of CCL2, IL-1β, TNF-α, IL-6, and CXCL5 in the latanoprost-treated group.\u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001. Scale bar: 50μm.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation: \u003c/strong\u003eUT, Untreated control group.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/e62688db89432b71500a941f.png"},{"id":96239459,"identity":"33d43de4-aea3-4e53-98f1-a619fe048d52","added_by":"auto","created_at":"2025-11-19 07:06:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":275550,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in the expression levels of pathway proteins in the meibomian glands of mice treated with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epreservative-free\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e latanoprost.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes: \u003c/strong\u003eLocal application of \u003cem\u003epreservative-free\u003c/em\u003elatanoprost in mice significantly increased the expression levels of Erk and NF-κB proteins.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/50ba333ea4c55abbdd67aa3a.png"},{"id":96239038,"identity":"e177f153-4d94-41f6-bc7c-0ae13dfb2c5e","added_by":"auto","created_at":"2025-11-19 07:01:47","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3682525,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in markers of oxidative stress induced by latanoprost in mouse meibomian glands.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNotes: \u003c/strong\u003eFigures 7A and B depict significant increases in markers of oxidative stress induced by latanoprost in mouse meibomian glands, such as NOX4, 3-NT, and 4-HNE. Conversely, antioxidant stress-related indicators significantly decreased, including SOD2. Additionally, higher levels of Keap-1 protein indicate weaker antioxidant capacity, which significantly increased in the Latanoprost group.\u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001. Scale bar: 50μm.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation:\u003c/strong\u003eUT, Untreated control group.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/cc60134e42a9e993c69caa81.png"},{"id":101151830,"identity":"ef783360-b176-4331-af03-b89bdc2a2d4e","added_by":"auto","created_at":"2026-01-26 16:06:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":28296259,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/f884ba84-bb20-4840-adcf-c3bb5dd47a93.pdf"},{"id":96238998,"identity":"b8113c12-84f9-42a0-a94f-22566951cd1e","added_by":"auto","created_at":"2025-11-19 07:00:14","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10889,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/3d5da5267b86b71cddf099ae.docx"},{"id":95828416,"identity":"68f64c1b-3599-435f-80be-662b3cb405da","added_by":"auto","created_at":"2025-11-13 11:48:25","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1924093,"visible":true,"origin":"","legend":"","description":"","filename":"BmcPharmacologyToxicologyOriginalImagesforBlots.zip","url":"https://assets-eu.researchsquare.com/files/rs-6897699/v1/3fb16628e6da2a6a24d86aca.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"0.005% Preservative-Free Latanoprost Triggers Meibomian Gland Dysfunction in Mice via Inflammation and Oxidative Stress Modulation","fulltext":[{"header":"Précis","content":"\u003cul start=\"50\"\u003e\n \u003cli\u003eReports of preservative-free latanoprost inducing changes in the eyelid margin during glaucoma treatment are increasing. Animal studies have shown that preservative-free latanoprost can cause meibomian gland dysfunction in mice through inflammation- and oxidative stress-related mechanisms.\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"Introduction","content":"\u003cp\u003eMeibomian gland dysfunction (MGD) is a disease characterized by chronic diffuse damage to the meibomian glands, ductal obstruction, or abnormal quantity or quality of meibum secretion [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In recent years, numerous clinical trials have reported a high incidence of MGD in glaucoma patients[\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The researchers reiterated that glaucoma patients had significantly worse meibum quality, lower meibomian gland secretion, and thinner lipid layer thickness compared to healthy control[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], with a notable negative impact on the quality of life, compliance with treatment, and progression of glaucoma treatment in patients[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Moreover, studies have linked that the high incidence of MGD in glaucoma patients is closely related to the long-term use of anti-glaucoma eye drops, especially prostaglandin (PG) analogs[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Mocan et al. observed a higher prevalence of MGD in glaucoma patients undergoing PG analog monotherapy (92.0%) compared to those receiving non-PG analog therapy (58.3%)[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In another study, Cho and colleagues compared patients under PG analogs monotherapy with those under combined PG analogs and other intraocular pressure (IOP)--lowering agents, and the results showed no significant difference in meibomian gland dropout between the two groups, suggesting that PG analogs might be the predominant IOP-lowering agent causing MGD[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. As the first PG analog used in the treatment of glaucoma[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], latanoprost also has been reported to induce significantly higher scores for lid margin abnormality, meiboscore, and meibum compared with untreated control eyes in clinical studies[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWith the continuous emergence of new drugs in recent years, reports of drug-induced diseases have become increasingly common. The FDA's Adverse Event Reporting System (FAERS) is a database of drug-related adverse reactions reported by groups including physicians, pharmacists, and drug manufacturers, which has been used to summarize drug-induced pancreatitis, drug-related interstitial lung disease, etc. in previous studies[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Latanoprost represents a significant addition to the first-line treatment options for reducing IOP in patients with open-angle glaucoma or ocular hypertension and continues to be widely prescribed worldwide[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Therefore, the potential adverse reactions of latanoprost will be evaluated using the FAERS database in this study. Meanwhile, it is important to examine its potential role in eye disorders. In our previous study, we demonstrated that 0.005% \u003cem\u003epreservative-free\u003c/em\u003e latanoprost can induce dry eye-like ocular surface damage by promoting inflammation in mice[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, to date, the research on latanoprost-induced MGD is predominantly confined to clinical trials, with the underlying mechanisms yet to be thoroughly studied.\u003c/p\u003e\u003cp\u003eLatanoprost is an ester prodrug of prostaglandin F2α (PGF2α), it can also bind to the PGF2α receptor, interacting with the inflammatory factor PGF2α to perform biological function[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. This mechanism may lead to various inflammation-related adverse reactions on the ocular surface[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Given that MGD is an inflammation-driven eyelid disorder, the local application of \u003cem\u003epreservative-free\u003c/em\u003e latanoprost eye drops could potentially influence the pathogenesis of MGD. Understanding the role and mechanism of PG analogs in MGD would help preserve the structural and functional integrity of meibomian glands during eye drop usage, which could significantly enhance the glaucoma treatment effect. In this study, we aim to evaluate the epidemiological characteristics of adverse ocular reactions to \u003cem\u003epreservative-free\u003c/em\u003e latanoprost, explore the effects of 0.005% \u003cem\u003epreservative-free\u003c/em\u003e latanoprost eye drops on the mouse meibomian gland, and delve deeper into the potential mechanism.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStudy design and data source\u003c/h2\u003e\u003cp\u003eWe conducted a retrospective pharmacovigilance analysis of latanoprost based on the FAERS databases (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://fis.fda.gov/extensions/FPD-QDE-FAERS/FPD-QDE-FAERS.html\u003c/span\u003e\u003cspan address=\"https://fis.fda.gov/extensions/FPD-QDE-FAERS/FPD-QDE-FAERS.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e, which are publicly accessible repositories of adverse drug event reports. The FAERS database comprises voluntary reports from various sources including healthcare professionals, patients, pharmacists, and pharmaceutical companies. This database adheres to national safety reporting guidelines and encodes all adverse events using preferred terms (PTs) from the Medical Dictionary of Regulatory Activities. Due to the public accessibility and anonymized nature of patient records in both databases, our study did not involve informed consent or ethical approval. To ensure the inclusion of the most up-to-date and comprehensive reports, we extracted all FAERS reports from the first quarter of 2004 through the fourth quarter of 2023. Specifically, our analysis focused on adverse reaction reports associated with \u003cem\u003exelpros\u003c/em\u003e, \u003cem\u003emonoprost\u003c/em\u003e, and \u003cem\u003eiyuzeh\u003c/em\u003e (\u003cem\u003epreservative-free\u003c/em\u003e formulations).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAnimals\u003c/h3\u003e\n\u003cp\u003eIn this study, male C57BL/6J mice aged 6\u0026ndash;8 weeks[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], obtained from the Shanghai SLAC Laboratory Animal Center (Shanghai, China), were utilized. All experimental procedures were approved by the Experimental Animal Ethics Committee of Xiamen University and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. During all experimental procedures, mice were anesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/kg). Within 3\u0026ndash;5 minutes after injection, mice reached a deep anesthesia state, characterized by slow respiration and absence of pedal or righting reflexes. The depth of anesthesia was confirmed before any manipulation to ensure that animals were completely unconscious and free from pain. At the end of experiments, mice were humanely euthanized by cervical dislocation under deep anesthesia. This method was selected because pentobarbital sodium induces rapid and stable anesthesia, ensuring a painless and humane euthanasia process in accordance with the AVMA Guidelines for the Euthanasia of Animals (2020).\u003c/p\u003e\n\u003ch3\u003eTopical administration of 0.005% latanoprost\u003c/h3\u003e\n\u003cp\u003eIn alignment with our previous study, 0.005% \u003cem\u003epreservative-free\u003c/em\u003e latanoprost was prepared in PBS, supplemented with 0.01% dimethyl sulfoxide (DMSO) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The mice were randomly allocated into three groups (n\u0026thinsp;=\u0026thinsp;5 each): (1) the untreated control group (UT group), which received no eye drop administration; (2) the vehicle-treated group (Vehicle group), receiving only vehicle eye drops; and (3) the group treated with 0.005% latanoprost eye drops (Latanoprost group). Topical application of eye drops was conducted four times daily over periods of 7, 14, and 28 days.\u003c/p\u003e\n\u003ch3\u003eAnimal examination\u003c/h3\u003e\n\u003cp\u003eThe ocular surface phenotype of the mice was evaluated in a blinded manner by the same researcher on days 7, 14, and 28 using a slit-lamp microscope (Takagi Seiko Co., Ltd., Nagano, Japan). This evaluation included measuring corneal epithelial integrity through corneal epithelial fluorescein staining, assessing conjunctival sac secretion, and observing changes in the eyelid margins. Additionally, the meibomian gland (MG) structure was imaged using a stereoscopic microscope (Leica M165-FC, Germany), following the methodology described in a previous study [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eLipidTOX Staining\u003c/h3\u003e\n\u003cp\u003eFrozen eyelid sections underwent fixation in 4% paraformaldehyde for 10 minutes, succeeded by a 5-minute rinsing step in PBS. Subsequently, the sections were immersed in a buffer solution containing LipidTOX neutral lipid stain (H34475; Thermofisher, Waltham, MA, USA), which was diluted at a ratio of 1:100, and were left to incubate at room temperature for a minimum of 30 minutes. Following this incubation period, counterstaining was carried out using DAPI. Evaluation and imaging of the sections were performed utilizing a microscope (DM2500; Leica Microsystems, Wetzlar, Germany).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescent staining\u003c/h2\u003e\u003cp\u003eFor immunofluorescence staining, cryosections were first fixed with cold acetone (-20\u0026deg;C for 10 minutes), then permeabilized with 0.2% Triton X-100 for 20 min. After that, sections were blocked with 2% BSA for 1h at room temperature, and incubated with CD-11b (1:250, ab8878; Abcam), and Ly6G (1:600) at 4\u0026deg;C overnight. Secondary antibodies corresponding to the species of the primary antibodies were applied the next day, and the nucleus was stained with 4\u0026rsquo;,6-diamidino-2-phenylindole (DAPI; Catalog no. H-1200; Vector, Burlingame, CA, USA). Avoid light during the above operation. Images were captured with an upright microscope (DM2500; Leica Microsystems), and the fluorescent intensity was measured using the NIS Elements Software.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eImmunohistochemistry\u003c/h3\u003e\n\u003cp\u003eFollowing deparaffinization and rehydration, paraffin-embedded sections were treated with 3% hydrogen peroxide for 10 minutes to quench endogenous peroxidase activity. Subsequently, heat-induced antigen retrieval was conducted using 0.01 M sodium citrate buffer (pH 6.0) for 8 minutes, followed by membrane permeabilization with 0.2% Triton X-100 for 20 minutes. Sections were then blocked with 2% BSA for 1 hour at room temperature and incubated overnight at 4\u0026deg;C with primary antibodies FP, NOX-4, 3-NT, and 4-HNE, each diluted at 1:100. The next day, secondary antibodies corresponding to the species of the primary antibodies were applied, and the detection was performed using DAB staining. Slides were subsequently counterstained with hematoxylin, dehydrated, and mounted. Imaging was accomplished using a Nikon microscope.\u003c/p\u003e\n\u003ch3\u003eTotal RNA extraction, reverse transcription and qRT-PCR\u003c/h3\u003e\n\u003cp\u003eThe meibomian glands were meticulously dissected from each group under a dissecting microscope, following the removal of the skin, subcutaneous tissue, muscle, and palpebral conjunctiva. Total RNA was then extracted using Trizol reagent (Thermo Fisher Scientific, United States), adhering to the manufacturer\u0026rsquo;s protocol. RNA concentration was determined using a Nanodrop 2000, and 10 \u0026micro;g of RNA was used for cDNA synthesis with a reverse transcription kit (Catalog no. RR047A; TaKaRa, Shiga, Japan). Real-time PCR analysis was performed using Hieff\u0026trade; qPCR SYBR\u0026reg; Green Master Mix (No Rox) (catalog no. 11201ES08; Yeasen, China) on a LightCycler\u0026reg; 96 Real-Time PCR System (catalog no.05815916001, Roche, Switzerland), following a previously described amplification protocol[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. mRNA expression levels were quantified using the comparative threshold cycle (Ct) method, with β-actin serving as the internal control. The sequences of the specific primers used are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers involved in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSense Primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAnti-sense Primer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGGACTCATCGCAAACACAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGAAGCCTTTGACTTCTGTCTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSLCO2a\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGAAGCGTTTTGTTTTCCCTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGGTGTGGAACATCCCATAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePGDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGAACGGCAAAGTGGCTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCAATCCACCAATGCTACCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCCL2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTAAAAACCTGGATCGGAACCAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCATTAGCTTCAGATTTACGGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGCCTCAAAGGAAAGAATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTACCAGTTGGGGAACTCTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNF-α\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTACTGAACTTCGGGGTGATCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACGTGGGCTACAGGCTTGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTAGTCCTTCCTACCCCAATTTCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTGGTCCTTAGCCACTCCTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL-8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGAAACCACCGGAAGGAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACTCCTTGGCAAAACTGCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTAAGGCCAACCGTGAAAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGCATACAGGGACAGCACAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eWestern blot\u003c/h2\u003e\u003cp\u003eProteins extracted from meibomian glands were dissolved in cold RIPA buffer containing protease and phosphatase inhibitors. Protein concentration was determined using a BCA Protein Assay Kit (23225; Thermo Fisher Scientific) and adjusted to an equal level. To denature the proteins, the supernatant was boiled at 100\u0026deg;C for 10 minutes. Equal amounts of protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred electronically to polyvinylidene fluoride (PVDF) membranes (catalog no. IPVH00010; Millipore, Billerica, MA, USA). Membranes were blocked with 5% BSA (2 hours at room temperature) and then incubated overnight at 4\u0026deg;C with primary antibodies targeting NOX-4, 3-NT, 4-HNE, Keap1, SOD2, p-NFκB, NFκB, p-Erk and Erk (all at 1:1000 dilution). Following incubation with HRP-conjugated goat anti-rabbit IgG or goat anti-mouse IgG, protein expression levels were visualized using an enhanced chemiluminescence reagent (NcmECL Ultra\u0026reg;, NCM Biotech, China), recorded with a transilluminator (ChemiDoc XRS System; BioRad, USA), and quantified using Quanty Software (Shanghai, China). β-actin was used as a reference antibody for data normalization.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eAdverse event reporting signal detection was performed using the disproportionality method, employing reported odds ratio (ROR)[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], proportional reported ratio (PRR)[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], bayesian confidence propagation neural network (BCPNN)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and multi-item gamma poisson shrinker (MGPS)[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The calculation method and screening criteria for positive signals of disproportionality analysis can be found in our previous research[\u003cspan additionalcitationids=\"CR28 CR29 CR30 CR31\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. We further evaluated the distribution of adverse drug reaction reports for \u003cem\u003epreservative-free\u003c/em\u003e Latanoprost. Statistical analysis was conducted using SPSS (version 26.0; IBM, US), Graphpad Prism (version 10.1.2), Microsoft Excel 2019, and R (version 4.2.2), with significance set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. R data analysis employed major packages such as ggplot2 (version 3.4.4), ggrepel (version 0.9.4), dplyr (version 1.1.4), and DescTools (version 0.99.52).\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eAdverse reactions and epidemiological characteristics of preservative-free latanoprost\u003c/h2\u003e\u003cp\u003eSince 2019, reports of adverse reactions to \u003cem\u003epreservative-free\u003c/em\u003e latanoprost have been on the rise, reaching a peak in 2023 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Disproportionality analysis revealed significant signals for adverse reactions related to MG, including eyelid irritation (ROR\u0026thinsp;=\u0026thinsp;83.228), eyelid swelling (ROR\u0026thinsp;=\u0026thinsp;79.2), eyelid pruritus (ROR\u0026thinsp;=\u0026thinsp;66.216), blepharitis (ROR\u0026thinsp;=\u0026thinsp;52.505), and eyelid erythema (ROR\u0026thinsp;=\u0026thinsp;36.763) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eTopical application of preservative-free latanoprost induced changes in eyelid phenotype\u003c/h2\u003e\u003cp\u003eCompared to the vehicle control mice, the \u003cem\u003epreservative-free\u003c/em\u003e latanoprost eye-treated mice showed increased mucinous secretions on the eyelid margins since day 14, and more obvious plugging of the MG orifice since day 28 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). While a closer inspection revealed that MG dropout grade was not significantly different between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Those results indicated that MGD induced by \u003cem\u003epreservative-free\u003c/em\u003e latanoprost was still in its early stages.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eTopical application of preservative-free latanoprost-induced functional MG changes\u003c/h2\u003e\u003cp\u003eThe immunofluorescence staining results using LipidTox showed increased lipid deposition in the \u003cem\u003epreservative-free\u003c/em\u003e latanoprost-treated group compared to the Vehicle group, and a significant difference between the two groups was observed on Day 28 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Building upon the adverse drug reactions induced by 0.005% \u003cem\u003epreservative-free\u003c/em\u003e latanoprost, including blepharitis, as well as our previous research findings [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], we further explored the inflammatory and oxidative stress levels associated with latanoprost-induced meibomian gland inflammation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eTopical application of preservative-free latanoprost increased prostaglandin accumulation in MG\u003c/h2\u003e\u003cp\u003eAccording to previous reports, FP, as the prostaglandin F receptor, binds prostaglandin F2α and mediates its physiological effects[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Through immunohistochemical and qRT-PCR analyses, we observed a significant increase in FP gene levels in the meibomian glands of the latanoprost group compared to both the vehicle group and the UT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Slco2a is a prostaglandin transporter, while PGDH is the prostaglandin dehydrogenase according to a previous study[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Hence, we also noted an increase in Slco2a expression levels and a decrease in PGDH expression levels in the latanoprost group compared to the vehicle group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). These changes in gene expression levels suggest the cumulative effect of latanoprost on prostaglandins in mouse meibomian glands.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eTopical application of preservative-free latanoprost stimulated inflammation in MG\u003c/h2\u003e\u003cp\u003eMyeloid-derived cells such as monocytes and neutrophils can be identified by the expression of CD11b and Ly6G on the cell surface. In this study, CD11b and Ly6G immunofluorescent staining showed more inflammatory cells infiltrating in MG from the \u003cem\u003epreservative-free\u003c/em\u003e latanoprost group compared with both the vehicle group and UT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). We also found significant mRNA upregulation of several inflammatory cytokines and chemokines including CCL2, IL-1β, TNF-α, IL-6, and CXCL5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These results suggested that topical application of latanoprost induced chronic inflammation of the MG microenvironment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eThe intracellular signaling pathways involved in latanoprost regulation of cytokine and chemokine output in MG\u003c/h2\u003e\u003cp\u003eIn addition, we analyzed the activation of signaling pathways among the three groups. The results showed significant activation of the Erk and NF-κB signaling pathways in the Latanoprost group compared to the other two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The marked activation of these two pathways suggests the potential presence of significant chronic inflammatory activation in the meibomian glands following Latanoprost administration in mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eTopical application of preservative-free latanoprost promoted oxidative stress in MG\u003c/h2\u003e\u003cp\u003eNumerous studies have shown that inflammation and oxidative stress are closely linked and promote each other in the pathogenesis of many chronic diseases. We detected the levels of NADPH oxidase subunits and oxidative stress markers by immunohistochemical staining and western blot and found that topical application of latanoprost promoted the expression of NOX4, 4HNE, and 3-NT in MG (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-B). Meanwhile, we investigated the changes in the antioxidant defense system. Western blotting demonstrated that latanoprost treatment showed an elevated protein level of keap1 and decreased protein levels of SOD2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). These results, taken together, suggested that topical application of latanoprost causes oxidative stress in MG.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMuch of the prior research has suggested that adverse reactions to latanoprost eye drops, mainly ocular surface reactions, originate from the preservative contained in the drop[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. However, based on an analysis of epidemiological data and reports of adverse eyelid reactions, we have observed that, as the use of \u003cem\u003epreservative-free\u003c/em\u003e latanoprost eye drops expands, reports of adverse reactions such as eyelid irritation, swelling, itching, inflammation, and redness, all symptoms related to MGD, are continuously increasing year by year. Past clinical research has shown a clear increase in the incidence of MGD in patients who have used latanoprost eye drops for a long period[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Further exploration through animal experimentation was carried out to study the effects of \u003cem\u003epreservative-free\u003c/em\u003e latanoprost on the functionality of the meibomian gland in mice, as well as possible causal mechanisms. The findings of this investigation demonstrated that the topical application of \u003cem\u003epreservative-free\u003c/em\u003e 0.005% latanoprost instigates the obstruction of the meibomian gland opening and lipid deposits within the gland in mice. Additionally, it induced oxidative stress and inflammation of the meibomian gland tissue in mice. All these alterations are considered key presentations of clinical MGD. This data points to the possibility that MGD induced by latanoprost eye drops may not solely be due to the preservative, but potentially associated with latanoprost itself. Latanoprost is an ester prodrug of PGF2α. PGF2α is a type of prostaglandin and a substantial pro-inflammatory factor. It exhibits pro-inflammatory effects when combined with FP. Our previous research confirmed that latanoprost can bind with ocular surface FP triggering ocular surface inflammation in mice and causing dry eye-like alterations[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn this study, after the local application of latanoprost in mice, not only did we observe an increase in the FP expression in the meibomian gland tissue but interestingly, we also discovered significant upregulation Slco2a in the latanoprost subject group, meanwhile PGDH was considerably downregulated. Slco2a plays a role in the transmembrane transport of prostaglandins, facilitating their accumulation. Conversely, PGDH, which is responsible for the metabolism and degradation of prostaglandins, sees a reduction that diminishes prostaglandin breakdown. These changes collectively contribute to an increased prostaglandin presence[\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Thus, it becomes evident that local use of latanoprost eye drops not only allows latanoprost itself to bind with FP receptors but also enables the meibomian gland to produce more PGF2α, creating a positive feedback loop. These findings suggest that even \u003cem\u003epreservative-free\u003c/em\u003e latanoprost can still lead to the build-up of prostaglandins within the meibomian gland when locally applied to the mouse eye, thereby instigating relevant inflammatory responses.\u003c/p\u003e\u003cp\u003eOcular surface inflammation plays a significant role in MGD, with the disease's pathophysiological processes heavily involving inflammatory responses[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Multiple inflammatory signaling pathways were activated in MGD, such as NF-κB, MAPK, and PI3K[\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], leading to the release of various pro-inflammatory cytokines and chemokines like CCL2, IL-1β, TNF-α, CXCL5, and IL-6. NF-κB is a key transcriptional activator for many pro-inflammatory cytokines, including IL-1β and TNF-α[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Additionally, it has been shown that Latanoprost can trigger the P38-NF-κB signaling pathway in human fibroblasts, leading to a heightened release of inflammatory cytokines and chemokines[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In our study, treatment with \u003cem\u003epreservative-free\u003c/em\u003e Latanoprost led to a significant activation of Erk, a key protein in the MAPK signaling pathway, and NF-κB in mouse meibomian glands. The significant upregulation of inflammation-related markers CD11b, Ly6G, CCL2, IL-1β, TNF-α, CXCL5, and IL-6 further validates the critical role of inflammation in the dysfunction of meibomian glands following Latanoprost treatment. Our findings suggest that the binding of Latanoprost to its FP receptors may induce inflammation in the meibomian gland, involving the activation of NF-κB and Erk signaling pathways and the production of inflammatory cytokines. Hence, we further substantiate that \u003cem\u003epreservative-free\u003c/em\u003e latanoprost induces meibomian gland dysfunction in mice through the provocation of inflammatory responses within the meibomian gland. These results align with previous reports regarding the pathological mechanisms of MGD[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOxidative stress is the imbalance between the oxidation and antioxidation systems of cells and tissues, resulting from excessive production of reactive oxygen species (ROS) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Our previous research results demonstrated a significant increase in oxidative stress levels in MGD mice induced by a high-fat and high-sugar diet[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, NOX4, 3-NT, and 4HNE proteins play important roles in the oxidative stress process [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. NOX4 is primarily involved in nuclear oxidative stress processes [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], and tyrosine may be oxidized to form 3-NT under conditions of oxidative stress, making 3-NT concentration a marker of cellular or tissue oxidative stress activity [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Our study revealed a significant increase in the levels of NOX4, 3-NT, and 4HNE proteins involved in oxidative stress processes in the meibomian gland of mice treated with \u003cem\u003epreservative-free\u003c/em\u003e latanoprost. Conversely, the levels of key proteins involved in the anti-oxidative stress process, including SOD2 [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], were significantly decreased. Therefore, we speculate that one of the potential mechanisms underlying MGD induced by \u003cem\u003epreservative-free\u003c/em\u003e latanoprost in mice is an increase in oxidative stress levels and a decrease in anti-oxidative stress levels.\u003c/p\u003e\u003cp\u003eAntioxidant enzymes such as peroxidases are expressed in the human meibomian gland and conjunctival tissues, and previous studies have already confirmed that oxidative stress plays a crucial role in the changes associated with corneal epithelial damage[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. The production of ROS is related to the activity of nicotinamide adenine dinucleotide phosphate (NADPH oxidase), particularly in phagocytic immune cells and endothelial cells, with inflammation also playing a role in this process[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. When ROS is produced chronically or over a long duration, accumulating beyond the body's capacity to clear ROS, related oxidative metabolites become major mediators of inflammatory pathological responses, promoting the initiation and cascade of inflammatory responses[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. The pro-inflammatory activity of these substances is partially related to cells of the immune system, such as polymorphonuclear neutrophils[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Therefore, the ROS metabolites that gradually accumulate during oxidative stress are drivers of inflammatory responses, further exacerbating local inflammation in the mouse meibomian gland. During the inflammatory process, activated phagocytes such as neutrophils and macrophages produce a large amount of ROS, thereby further aggravating oxidative stress damage[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Hence, the inflammatory process can induce oxidative stress, and oxidative stress can also induce inflammation through the activation of various pathways; oxidative stress and inflammation are closely related pathophysiological processes. Our research demonstrates that both factors play a pivotal role in inducing MGD in mice when \u003cem\u003epreservative-free\u003c/em\u003e latanoprost is applied topically to the eye, and they may interact to form a vicious cycle.\u003c/p\u003e\u003cp\u003eIn summary, according to our research findings, we have uncovered for the first time that \u003cem\u003epreservative-free\u003c/em\u003e latanoprost also has the potential to induce MGD in mice. This matches epidemiological data reported in the adverse drug reaction database regarding the adverse reactions of \u003cem\u003epreservative-free\u003c/em\u003e latanoprost. We have also verified that inflammatory damage and oxidative stress are significant mechanisms involved in this process. Our study validates the mechanisms from databases to animal experiments for pharmacovigilance and medication safety. Therefore, glaucoma clinicians need to consider the possible adverse effects of long-term use of latanoprost when prescribing glaucoma patients, especially those with pre-existing meibomian gland dysfunction or limbal inflammation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Declaration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupported by grants from the Natural Science Foundation of Fujian (No. 2023J01012, CH), and National Natural Science Foundation of China (No.82271054, ZL).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: FAERS Publish Dashboard (https://www.fda.gov/drugs/questions-and-answers-fdas-adverse-event-reporting-system-faers/fda-adverse-event-reporting-system-faers-public-dashboard).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCaihong Huang, Yiran Yang, and Shinan Wu conceived the research idea. Caihong Huang conducted data cleaning and a literature review. Caihong Huang, Yiran Yang, Shinan Wu, Zhaolin Liu, Lin Chen, Dan Yan and Mingyan Wei contributed to drafting and critically revising the work for intellectual content. Caihong Huang and Shinan Wu conducted the analysis and created the figures and tables. Ke Yan, Ruochen Wang, Jiaoyue Hu, Wei Li, and Zuguo Liu provided a critical review of the manuscript. All authors have read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNelson, J.D.; Shimazaki, J.; Benitez-del-Castillo, J.M.; Craig, J.P.; McCulley, J.P.; Den, S.; Foulks, G.N. The international workshop on meibomian gland dysfunction: report of the definition and classification subcommittee. \u003cem\u003eInvest Ophthalmol Vis Sci \u003c/em\u003e\u003cstrong\u003e2011\u003c/strong\u003e, \u003cem\u003e52\u003c/em\u003e, 1930-1937, doi:10.1167/iovs.10-6997b.\u003c/li\u003e\n\u003cli\u003eKim, J.H.; Shin, Y.U.; Seong, M.; Cho, H.Y.; Kang, M.H. Eyelid Changes Related to Meibomian Gland Dysfunction in Early Middle-Aged Patients Using Topical Glaucoma Medications. \u003cem\u003eCornea \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e37\u003c/em\u003e, 421-425, doi:10.1097/ico.0000000000001489.\u003c/li\u003e\n\u003cli\u003eMocan, M.C.; Uzunosmanoglu, E.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. The Association of Chronic Topical Prostaglandin Analog Use With Meibomian Gland Dysfunction. \u003cem\u003eJ Glaucoma \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e25\u003c/em\u003e, 770-774, doi:10.1097/ijg.0000000000000495.\u003c/li\u003e\n\u003cli\u003eSoriano, D.; Ferrandez, B.; Mateo, A.; Polo, V.; Garcia-Martin, E. Meibomian Gland Changes in Open-angle Glaucoma Users Treated with Topical Medication. \u003cem\u003eOptom Vis Sci \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e98\u003c/em\u003e, 1177-1182, doi:10.1097/opx.0000000000001782.\u003c/li\u003e\n\u003cli\u003eUzunosmanoglu, E.; Mocan, M.C.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. Meibomian Gland Dysfunction in Patients Receiving Long-Term Glaucoma Medications. \u003cem\u003eCornea \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e35\u003c/em\u003e, 1112-1116, doi:10.1097/ico.0000000000000838.\u003c/li\u003e\n\u003cli\u003eCho, W.H.; Lai, I.C.; Fang, P.C.; Chien, C.C.; Tseng, S.L.; Lai, Y.H.; Huang, Y.T.; Kuo, M.T. Meibomian Gland Performance in Glaucomatous Patients With Long-term Instillation of IOP-lowering Medications. \u003cem\u003eJ Glaucoma \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e27\u003c/em\u003e, 176-183, doi:10.1097/ijg.0000000000000841.\u003c/li\u003e\n\u003cli\u003eLee, T.H.; Sung, M.S.; Heo, H.; Park, S.W. Association between meibomian gland dysfunction and compliance of topical prostaglandin analogs in patients with normal tension glaucoma. \u003cem\u003ePLoS One \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, e0191398, doi:10.1371/journal.pone.0191398.\u003c/li\u003e\n\u003cli\u003eMocan, M.C.; Uzunosmanoglu, E.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. The association of chronic topical prostaglandin analog use with meibomian gland dysfunction. \u003cem\u003eJournal of glaucoma \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e25\u003c/em\u003e, 770-774.\u003c/li\u003e\n\u003cli\u003eCho, W.-H.; Lai, C.; Fang, P.-C.; Chien, C.-C.; Tseng, S.-L.; Lai, Y.-H.; Huang, Y.-T.; Kuo, M.-T. Meibomian gland performance in glaucomatous patients with long-term instillation of IOP-lowering medications. \u003cem\u003eJournal of glaucoma \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e27\u003c/em\u003e, 176-183.\u003c/li\u003e\n\u003cli\u003eAlm, A. Latanoprost in the treatment of glaucoma. \u003cem\u003eClinical ophthalmology \u003c/em\u003e\u003cstrong\u003e2014\u003c/strong\u003e, 1967-1985.\u003c/li\u003e\n\u003cli\u003eArita, R.; Itoh, K.; Maeda, S.; Maeda, K.; Furuta, A.; Tomidokoro, A.; Aihara, M.; Amano, S. Effects of long-term topical anti-glaucoma medications on meibomian glands. \u003cem\u003eGraefe\u0026apos;s Archive for Clinical and Experimental Ophthalmology \u003c/em\u003e\u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e250\u003c/em\u003e, 1181-1185.\u003c/li\u003e\n\u003cli\u003eArita, R.; Itoh, K.; Maeda, S.; Maeda, K.; Furuta, A.; Tomidokoro, A.; Aihara, M.; Amano, S. Comparison of the long-term effects of various topical antiglaucoma medications on meibomian glands. \u003cem\u003eCornea \u003c/em\u003e\u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e31\u003c/em\u003e, 1229-1234.\u003c/li\u003e\n\u003cli\u003eJiang, T.; Su, H.; Xu, J.; Li, C.; Zhang, N.; Li, Y.; Wu, Y.; Ni, R.; Ming, Y.; Li, Z. Drug-induced interstitial lung disease: a real-world pharmacovigilance study of the FDA Adverse Event Reporting System from 2004 to 2021. \u003cem\u003eTherapeutic Advances in Drug Safety \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e15\u003c/em\u003e, 20420986231224227.\u003c/li\u003e\n\u003cli\u003eLi, D.; Wang, H.; Qin, C.; Du, D.; Wang, Y.; Du, Q.; Liu, S. Drug‐Induced Acute Pancreatitis: A Real‐World Pharmacovigilance Study Using the FDA Adverse Event Reporting System Database. \u003cem\u003eClinical Pharmacology \u0026amp; Therapeutics \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e115\u003c/em\u003e, 535-544.\u003c/li\u003e\n\u003cli\u003eDigiuni, M.; Fogagnolo, P.; Rossetti, L. A review of the use of latanoprost for glaucoma since its launch. \u003cem\u003eExpert opinion on pharmacotherapy \u003c/em\u003e\u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 723-745.\u003c/li\u003e\n\u003cli\u003ePerry, C.M.; McGavin, J.K.; Culy, C.R.; Ibbotson, T. Latanoprost: an update of its use in glaucoma and ocular hypertension. \u003cem\u003eDrugs \u0026amp; aging \u003c/em\u003e\u003cstrong\u003e2003\u003c/strong\u003e, \u003cem\u003e20\u003c/em\u003e, 597-630.\u003c/li\u003e\n\u003cli\u003eYang, Y.; Huang, C.; Lin, X.; Wu, Y.; Ouyang, W.; Tang, L.; Ye, S.; Wang, Y.; Li, W.; Zhang, X. 0.005% preservative-free latanoprost induces dry eye-like ocular surface damage via promotion of inflammation in mice. \u003cem\u003eInvestigative ophthalmology \u0026amp; visual science \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e59\u003c/em\u003e, 3375-3384.\u003c/li\u003e\n\u003cli\u003eSharif, N.; Kelly, C.; Crider, J. Agonist activity of bimatoprost, travoprost, latanoprost, unoprostone isopropyl ester and other prostaglandin analogs at the cloned human ciliary body FP prostaglandin receptor. \u003cem\u003eJournal of ocular pharmacology and therapeutics \u003c/em\u003e\u003cstrong\u003e2002\u003c/strong\u003e, \u003cem\u003e18\u003c/em\u003e, 313-324.\u003c/li\u003e\n\u003cli\u003eBu, J.; Wu, Y.; Cai, X.; Jiang, N.; Jeyalatha, M.V.; Yu, J.; He, X.; He, H.; Guo, Y.; Zhang, M. Hyperlipidemia induces meibomian gland dysfunction. \u003cem\u003eThe ocular surface \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e17\u003c/em\u003e, 777-786.\u003c/li\u003e\n\u003cli\u003eYang, Y.; Huang, C.; Lin, X.; Wu, Y.; Ouyang, W.; Tang, L.; Ye, S.; Wang, Y.; Li, W.; Zhang, X.; et al. 0.005% Preservative-Free Latanoprost Induces Dry Eye-Like Ocular Surface Damage via Promotion of Inflammation in Mice. \u003cem\u003eInvest Ophthalmol Vis Sci \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e59\u003c/em\u003e, 3375-3384, doi:10.1167/iovs.18-24013.\u003c/li\u003e\n\u003cli\u003eBu, J.; Wu, Y.; Li, K.; Zhang, M.; Zhang, R.; Sun, L.; Guo, Y.; He, H.; Li, S.; Liu, Z.; et al. Transitory alkali exposure on meibomian gland orifices induces meibomian gland dysfunction. \u003cem\u003eOcul Surf \u003c/em\u003e\u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e29\u003c/em\u003e, 406-415, doi:10.1016/j.jtos.2023.06.007.\u003c/li\u003e\n\u003cli\u003eSchlesinger, J.; T\u0026ouml;njes, M.; Schueler, M.; Zhang, Q.; Dunkel, I.; Sperling, S.R. Evaluation of the LightCycler 1536 Instrument for high-throughput quantitative real-time PCR. \u003cem\u003eMethods \u003c/em\u003e\u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e50\u003c/em\u003e, S19-22, doi:10.1016/j.ymeth.2010.01.007.\u003c/li\u003e\n\u003cli\u003eZhou, S.; Jia, B.; Kong, J.; Zhang, X.; Lei, L.; Tao, Z.; Ma, L.; Xiang, Q.; Zhou, Y.; Cui, Y. Drug-induced fall risk in older patients: A pharmacovigilance study of FDA adverse event reporting system database. \u003cem\u003eFrontiers in pharmacology \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 4936.\u003c/li\u003e\n\u003cli\u003eKhouri, C.; Revol, B.; Lepelley, M.; Mouffak, A.; Bernardeau, C.; Salvo, F.; Pariente, A.; Roustit, M.; Cracowski, J.-L. A meta-epidemiological study found lack of transparency and poor reporting of disproportionality analyses for signal detection in pharmacovigilance databases. \u003cem\u003eJournal of Clinical Epidemiology \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e139\u003c/em\u003e, 191-198.\u003c/li\u003e\n\u003cli\u003eBate, A. Bayesian confidence propagation neural network. \u003cem\u003eDrug safety \u003c/em\u003e\u003cstrong\u003e2007\u003c/strong\u003e, \u003cem\u003e30\u003c/em\u003e, 623-625.\u003c/li\u003e\n\u003cli\u003eBerlin, C.; Blanch, C.; Lewis, D.J.; Maladorno, D.D.; Michel, C.; Petrin, M.; Sarp, S.; Close, P. Are all quantitative postmarketing signal detection methods equal? Performance characteristics of logistic regression and Multi‐item Gamma Poisson Shrinker. \u003cem\u003ePharmacoepidemiology and drug safety \u003c/em\u003e\u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e21\u003c/em\u003e, 622-630.\u003c/li\u003e\n\u003cli\u003eWu, S.N.; Chen, X.D.; Zhang, Q.H.; Wang, Y.Q.; Yan, D.; Xu, C.S.; Wang, S.P.; Zhu, L.; Qin, D.Y.; Guo, S.J.; et al. Drug-Related Keratitis: A Real-World FDA Adverse Event Reporting System Database Study. \u003cem\u003eTransl Vis Sci Technol \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 17, doi:10.1167/tvst.13.9.17.\u003c/li\u003e\n\u003cli\u003eWu, S.N.; Chen, X.D.; Yan, D.; Wang, Y.Q.; Wang, S.P.; Guan, W.Y.; Huang, C.; Hu, J.; Liu, Z. Drug-associated glaucoma: A real-world study based on the Food and Drug Administration adverse event reporting system database. \u003cem\u003eClin Exp Ophthalmol \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, doi:10.1111/ceo.14454.\u003c/li\u003e\n\u003cli\u003eWu, S.N.; Huang, C.; Wang, Y.Q.; Li, X.; Zhang, S.Q.; Chen, X.D.; Qin, D.Y.; Zhu, L.; Wen, J.Y.; Luo, N.C.; et al. Adverse events of topical ocular prostaglandin medications for glaucoma treatment: a pharmacovigilance study based on the FAERS database. \u003cem\u003eTher Adv Drug Saf \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e15\u003c/em\u003e, 20420986241285929, doi:10.1177/20420986241285929.\u003c/li\u003e\n\u003cli\u003eWu, S.N.; Huang, C.; Wang, Y.Q.; Chen, X.D.; Li, X.; Zhang, S.Q.; Qin, D.Y.; Zhu, L.; Xu, C.S.; Zhang, Q.H.; et al. Real-World Large Sample Assessment of Drug-related Dry Eye Risk: Based on the FDA Adverse Event Reporting System Database. \u003cem\u003eAsia Pac J Ophthalmol (Phila) \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 100104, doi:10.1016/j.apjo.2024.100104.\u003c/li\u003e\n\u003cli\u003eLi, X.; Wu, S.N.; Zhang, S.Q.; Zhang, Z.J.; Wang, M.Y.; Chen, C.T.; Luo, Z.Y.; Dong, N. Real-world analysis of medications inducing meibomian gland dysfunction: based on the FDA adverse event reporting system database. \u003cem\u003eExpert Opin Drug Saf \u003c/em\u003e\u003cstrong\u003e2025\u003c/strong\u003e, doi:10.1080/14740338.2024.2446430.\u003c/li\u003e\n\u003cli\u003eLiu, R.; Chen, Y.; Wu, S.N.; Ma, W.; Qiu, Z.; Wang, J.; Xu, X.; Chen, C.; Wang, W. Adverse drug events associated with capecitabine: a real-world pharmacovigilance study based on the FAERS database. \u003cem\u003eTher Adv Drug Saf \u003c/em\u003e\u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e15\u003c/em\u003e, 20420986241303428, doi:10.1177/20420986241303428.\u003c/li\u003e\n\u003cli\u003eUzunosmanoglu, E.; Mocan, M.C.; Kocabeyoglu, S.; Karakaya, J.; Irkec, M. Meibomian gland dysfunction in patients receiving long-term glaucoma medications. \u003cem\u003eCornea \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e35\u003c/em\u003e, 1112-1116.\u003c/li\u003e\n\u003cli\u003eSugimoto, Y.; Yamasaki, A.; Segi, E.; Tsuboi, K.; Aze, Y.; Nishimura, T.; Oida, H.; Yoshida, N.; Tanaka, T.; Katsuyama, M. Failure of parturition in mice lacking the prostaglandin F receptor. \u003cem\u003eScience \u003c/em\u003e\u003cstrong\u003e1997\u003c/strong\u003e, \u003cem\u003e277\u003c/em\u003e, 681-683.\u003c/li\u003e\n\u003cli\u003eNakata, R.; Nakamura, Y.; Hosomi, S.; Okuda, H.; Nishida, Y.; Sugita, N.; Itani, S.; Nadatani, Y.; Otani, K.; Tanaka, F. Slco 2 a1 deficiency exacerbates experimental colitis via inflammasome activation in macrophages: a possible mechanism of chronic enteropathy associated with SLCO2A1 gene. \u003cem\u003eScientific reports \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 4883.\u003c/li\u003e\n\u003cli\u003eRath, A.; Eichhorn, M.; Tr\u0026auml;ger, K.; Paulsen, F.; Hampel, U. In vitro effects of benzalkonium chloride and prostaglandins on human meibomian gland epithelial cells. \u003cem\u003eAnnals of Anatomy-Anatomischer Anzeiger \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e222\u003c/em\u003e, 129-138.\u003c/li\u003e\n\u003cli\u003eHa, J.Y.; Sung, M.S.; Park, S.W. Effects of preservative on the meibomian gland in glaucoma patients treated with prostaglandin analogues. \u003cem\u003eChonnam Medical Journal \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e55\u003c/em\u003e, 156.\u003c/li\u003e\n\u003cli\u003eSabirov, R.Z.; Merzlyak, P.G.; Okada, T.; Islam, M.R.; Uramoto, H.; Mori, T.; Makino, Y.; Matsuura, H.; Xie, Y.; Okada, Y. The organic anion transporter SLCO 2A1 constitutes the core component of the Maxi‐Cl channel. \u003cem\u003eThe EMBO journal \u003c/em\u003e\u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e36\u003c/em\u003e, 3309-3324.\u003c/li\u003e\n\u003cli\u003eZaragoza, D.B.; Wilson, R.R.; Mitchell, B.F.; Olson, D.M. The interleukin 1beta-induced expression of human prostaglandin F2alpha receptor messenger RNA in human myometrial-derived ULTR cells requires the transcription factor, NFkappaB. \u003cem\u003eBiology of reproduction \u003c/em\u003e\u003cstrong\u003e2006\u003c/strong\u003e, \u003cem\u003e75\u003c/em\u003e, 697-704.\u003c/li\u003e\n\u003cli\u003eSun, C.-C.; Zhou, Z.-Q.; Yang, D.; Chen, Z.-L.; Zhou, Y.-Y.; Wen, W.; Feng, C.; Zheng, L.; Peng, X.-Y.; Tang, C.-F. Recent advances in studies of 15-PGDH as a key enzyme for the degradation of prostaglandins. \u003cem\u003eInternational Immunopharmacology \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e101\u003c/em\u003e, 108176.\u003c/li\u003e\n\u003cli\u003eSuzuki, T.; Teramukai, S.; Kinoshita, S. Meibomian glands and ocular surface inflammation. \u003cem\u003eThe ocular surface \u003c/em\u003e\u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 133-149.\u003c/li\u003e\n\u003cli\u003eSabeti, S.; Kheirkhah, A.; Yin, J.; Dana, R. Management of meibomian gland dysfunction: a review. \u003cem\u003eSurvey of ophthalmology \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e65\u003c/em\u003e, 205-217.\u003c/li\u003e\n\u003cli\u003eGuo, Y.; Zhang, H.; Zhao, Z.; Luo, X.; Zhang, M.; Bu, J.; Liang, M.; Wu, H.; Yu, J.; He, H. Hyperglycemia induces meibomian gland dysfunction. \u003cem\u003eInvestigative Ophthalmology \u0026amp; Visual Science \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e63\u003c/em\u003e, 30-30.\u003c/li\u003e\n\u003cli\u003eLiu, R.; Li, J.; Xu, Y.; Chen, Z.; Ye, H.; Tang, J.; Wei, L.; Liang, L. Melatonin attenuates lps-induced proinflammatory cytokine response and lipogenesis in human meibomian gland epithelial cells via MAPK/NF-\u0026kappa;B pathway. \u003cem\u003eInvestigative Ophthalmology \u0026amp; Visual Science \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e63\u003c/em\u003e, 6-6.\u003c/li\u003e\n\u003cli\u003eMM, H.Z.; MM, Q.W.; MM, L.Y.; MM, Y.G. Medication rules and mechanism of topical traditional Chinese medicine for meibomian gland dysfunction-related dry eye disease. \u003cem\u003eAlternative Therapies in Health and Medicine \u003c/em\u003e\u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e29\u003c/em\u003e, 126-132.\u003c/li\u003e\n\u003cli\u003eLuo, L.; Li, D.-Q.; Doshi, A.; Farley, W.; Corrales, R.M.; Pflugfelder, S.C. Experimental dry eye stimulates production of inflammatory cytokines and MMP-9 and activates MAPK signaling pathways on the ocular surface. \u003cem\u003eInvestigative ophthalmology \u0026amp; visual science \u003c/em\u003e\u003cstrong\u003e2004\u003c/strong\u003e, \u003cem\u003e45\u003c/em\u003e, 4293-4301.\u003c/li\u003e\n\u003cli\u003eLiu, Y.; Liu, Y.; Xu, D.; Li, J. Latanoprost-induced cytokine and chemokine release from human Tenon\u0026rsquo;s capsule fibroblasts: role of MAPK and NF-\u0026kappa;B signaling pathways. \u003cem\u003eJournal of glaucoma \u003c/em\u003e\u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, 635-641.\u003c/li\u003e\n\u003cli\u003eQazi, Y.; Kheirkhah, A.; Blackie, C.; Trinidad, M.; Williams, C.; Cruzat, A.; Korb, D.R.; Hamrah, P. Clinically relevant immune-cellular metrics of inflammation in meibomian gland dysfunction. \u003cem\u003eInvestigative Ophthalmology \u0026amp; Visual Science \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e59\u003c/em\u003e, 6111-6123.\u003c/li\u003e\n\u003cli\u003eMaritim, A.; Sanders, a.; Watkins Iii, J. Diabetes, oxidative stress, and antioxidants: a review. \u003cem\u003eJournal of biochemical and molecular toxicology \u003c/em\u003e\u003cstrong\u003e2003\u003c/strong\u003e, \u003cem\u003e17\u003c/em\u003e, 24-38.\u003c/li\u003e\n\u003cli\u003eWalters, J.L.; De Iuliis, G.N.; Nixon, B.; Bromfield, E.G. Oxidative stress in the male germline: A review of novel strategies to reduce 4-hydroxynonenal production. \u003cem\u003eAntioxidants \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e7\u003c/em\u003e, 132.\u003c/li\u003e\n\u003cli\u003eMatsushima, S.; Kuroda, J.; Ago, T.; Zhai, P.; Park, J.Y.; Xie, L.-H.; Tian, B.; Sadoshima, J. Increased oxidative stress in the nucleus caused by Nox4 mediates oxidation of HDAC4 and cardiac hypertrophy. \u003cem\u003eCirculation research \u003c/em\u003e\u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e112\u003c/em\u003e, 651-663.\u003c/li\u003e\n\u003cli\u003eGovindasamy, M.; Manavalan, S.; Chen, S.-M.; Umamaheswari, R.; Chen, T.-W. Determination of oxidative stress biomarker 3-nitro-L-tyrosine using CdWO4 nanodots decorated reduced graphene oxide. \u003cem\u003eSensors and Actuators B: Chemical \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e272\u003c/em\u003e, 274-281.\u003c/li\u003e\n\u003cli\u003eQiu, X.; Brown, K.; Hirschey, M.D.; Verdin, E.; Chen, D. Calorie restriction reduces oxidative stress by SIRT3-mediated SOD2 activation. \u003cem\u003eCell metabolism \u003c/em\u003e\u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 662-667.\u003c/li\u003e\n\u003cli\u003eDogru, M.; Kojima, T.; Simsek, C.; Tsubota, K. Potential role of oxidative stress in ocular surface inflammation and dry eye disease. \u003cem\u003eInvestigative ophthalmology \u0026amp; visual science \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e59\u003c/em\u003e, DES163-DES168.\u003c/li\u003e\n\u003cli\u003ePendyala, S.; Natarajan, V. Redox regulation of Nox proteins. \u003cem\u003eRespiratory physiology \u0026amp; neurobiology \u003c/em\u003e\u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e174\u003c/em\u003e, 265-271.\u003c/li\u003e\n\u003cli\u003eDammak, A.; Huete-Toral, F.; Carpena-Torres, C.; Martin-Gil, A.; Pastrana, C.; Carracedo, G. From oxidative stress to inflammation in the posterior ocular diseases: diagnosis and treatment. \u003cem\u003ePharmaceutics \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 1376.\u003c/li\u003e\n\u003cli\u003eGhanei, M.; Harandi, A.A. Molecular and cellular mechanism of lung injuries due to exposure to sulfur mustard: a review. \u003cem\u003eInhalation toxicology \u003c/em\u003e\u003cstrong\u003e2011\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e, 363-371.\u003c/li\u003e\n\u003cli\u003eAhmad, A.; Ahsan, H. Biomarkers of inflammation and oxidative stress in ophthalmic disorders. \u003cem\u003eJournal of Immunoassay and Immunochemistry \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e41\u003c/em\u003e, 257-271.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-pharmacology-and-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"phat","sideBox":"Learn more about [BMC Pharmacology and Toxicology](http://bmcpharmacoltoxicol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/phat/Default.aspx","title":"BMC Pharmacology and Toxicology","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Latanoprost, meibomian gland dysfunction, inflammation, ocular surface damage, FAERS","lastPublishedDoi":"10.21203/rs.3.rs-6897699/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6897699/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e\u003cp\u003eThis study aimed to investigate the effects of \u003cem\u003epreservative-free\u003c/em\u003e latanoprost on meibomian gland function in mice and its possible mechanism.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eDisproportionality analysis was conducted using the FAERS database to evaluate adverse reaction reports and epidemiological characteristics associated with \u003cem\u003epreservative-free\u003c/em\u003e latanoprost. In mouse models, 0.005% \u003cem\u003epreservative-free\u003c/em\u003e latanoprost or vehicle control was topically applied for periods ranging from 7 to 28 days. Morphological changes of the meibomian gland in mice were detected by immunohistochemistry. Immunofluorescence staining, western blotting, and/or quantitative real-time fluorescence quantitative PCR (qRT-PCR) were used to examine the expression levels of prostaglandin F2α receptor (FP), inflammatory cells and mediators, oxidative stress and signaling pathways related factors in mouse meibomian gland tissues.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eReports of adverse reactions caused by \u003cem\u003epreservative-free\u003c/em\u003e latanoprost increased annually in the FAERS database. Locally applied \u003cem\u003epreservative-free\u003c/em\u003e latanoprost in mice led to an escalation of mucous secretion at the eyelid margin, accompanied by meibomian gland duct obstruction, lipid accumulation in glandular acini, an elevation in the expression levels of FP and Slco2a, and a reduction in the expression levels of PGDH within the meibomian glands. Other inflammatory markers such as CCL2, IL-1β, TNF-α, IL-6, and CXCL5 showed elevated expression levels. Notably, there was an increase in oxidative stress proteins, including NOX4, 3-NT, and 4-HNE, along with a decrease in the expression of antioxidant stress proteins, including SOD2 and Keap-1. Additionally, the Erk and NF-κB signaling pathways were significantly activated.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003e0.005% \u003cem\u003epreservative-free\u003c/em\u003e latanoprost induces meibomian gland dysfunction in mice by promoting inflammatory responses and oxidative stress.\u003c/p\u003e","manuscriptTitle":"0.005% Preservative-Free Latanoprost Triggers Meibomian Gland Dysfunction in Mice via Inflammation and Oxidative Stress Modulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-13 11:48:21","doi":"10.21203/rs.3.rs-6897699/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-11T14:56:01+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-09T10:40:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"133166703364545797008739395778411352701","date":"2025-11-28T17:13:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"81143597670121065270044857370454947937","date":"2025-11-27T10:02:37+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-24T06:09:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93308807497152510030190350582623390875","date":"2025-11-10T13:12:24+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-04T04:40:25+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-28T10:41:31+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-10-23T10:31:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-23T06:57:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Pharmacology and Toxicology","date":"2025-10-23T06:53:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-pharmacology-and-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"phat","sideBox":"Learn more about [BMC Pharmacology and Toxicology](http://bmcpharmacoltoxicol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/phat/Default.aspx","title":"BMC Pharmacology and Toxicology","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"395db655-b2e0-4478-81cd-921d35c620a0","owner":[],"postedDate":"November 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:02:36+00:00","versionOfRecord":{"articleIdentity":"rs-6897699","link":"https://doi.org/10.1186/s40360-025-01078-9","journal":{"identity":"bmc-pharmacology-and-toxicology","isVorOnly":false,"title":"BMC Pharmacology and Toxicology"},"publishedOn":"2026-01-24 15:59:14","publishedOnDateReadable":"January 24th, 2026"},"versionCreatedAt":"2025-11-13 11:48:21","video":"","vorDoi":"10.1186/s40360-025-01078-9","vorDoiUrl":"https://doi.org/10.1186/s40360-025-01078-9","workflowStages":[]},"version":"v1","identity":"rs-6897699","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6897699","identity":"rs-6897699","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.