Large transient assemblies of Apaf1 constitute the apoptosome in cells

Large transient assemblies of Apaf1 constitute the apoptosome in cells | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Large transient assemblies of Apaf1 constitute the apoptosome in cells Alicia C. Borgeaud , Iva Ganeva , Calvin Klein , Amandine Stooss , Daniela Ross-Kaschitza , Liyang Wu , Joel S. Riley , Stephen W.G. Tait , Thomas Lemmin , Thomas Kaufmann , Wanda Kukulski doi: https://doi.org/10.1101/2024.07.01.600688 Alicia C. Borgeaud 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland 2 MRC Laboratory of Molecular Biology , Cambridge CB2 0QH, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Iva Ganeva 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland 2 MRC Laboratory of Molecular Biology , Cambridge CB2 0QH, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Calvin Klein 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Amandine Stooss 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Daniela Ross-Kaschitza 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Liyang Wu 3 Institute of Pharmacology, University of Bern , 3010 Bern, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Joel S. Riley 4 Cancer Research UK Scotland Institute , Glasgow G61 1BD, UK 5 School of Cancer Sciences, College of Medical, Veterinary and Life Sciences, University of Glasgow , Glasgow G61 1QH, UK 6 Institute of Developmental Immunology, Biocenter, Medical University of Innsbruck , 6020 Innsbruck, Austria Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stephen W.G. Tait 4 Cancer Research UK Scotland Institute , Glasgow G61 1BD, UK 5 School of Cancer Sciences, College of Medical, Veterinary and Life Sciences, University of Glasgow , Glasgow G61 1QH, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Thomas Lemmin 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Thomas Kaufmann 3 Institute of Pharmacology, University of Bern , 3010 Bern, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Wanda Kukulski 1 Institute of Biochemistry and Molecular Medicine, University of Bern , 3012 Bern, Switzerland 2 MRC Laboratory of Molecular Biology , Cambridge CB2 0QH, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: wanda.kukulski{at}unibe.ch Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Upon cell death signals, the apoptotic protease-activating factor Apaf1 and cytochrome c interact to form the apoptosome complex. The apoptosome is crucial for mitochondrial apoptosis, as it activates caspases that dismantle the cell. However, the assembly mechanism and appearance of the apoptosome in vivo remain unclear. We show that upon onset of apoptosis, Apaf1 molecules accumulate into multiple foci per cell. Disassembly of the foci is linked to survival of the cell. Structurally, Apaf1 foci resemble organelle-sized, cloud-like assemblies. Foci form upon specific molecular interactions with cytochrome c and depending on procaspase-9. We propose that Apaf1 foci correspond to the apoptosome in cells. Transientness and ultrastructure of Apaf1 foci suggest that the dynamic spatiotemporal organisation of apoptosome components regulates progression of apoptosis. Introduction Apoptosis, a major type of programmed cell death, is essential in multicellular organisms for clearance of cancerous cells and removal of excess cells during tissue development ( 1 ). The programme relies on a cascade of molecular interactions which elicit signals that lead to cleavage of cellular components by cysteine proteases known as caspases ( 2 ). This orchestrated dismantling of the cell results in non-inflammatory removal of the cellular remains. In intrinsic or mitochondrial apoptosis, the Bcl-2 proteins Bax and Bak accumulate on the outer mitochondrial membrane and cause its permeabilisation, resulting in the release of mitochondrial proteins into the cytosol ( 3 – 7 ). Thereby, the respiratory chain component cytochrome c (cyt c) can interact with the cytosolic protein apoptotic protease-activating factor 1 (Apaf1) ( 8 , 9 ). In healthy cells, Apaf1 resides in the cytosol as an inactive monomer ( 10 – 12 ). Its interaction with cyt c results in conformational changes leading to oligomerisation of Apaf1 via the nucleotide-binding oligomerisation domain (NOD) ( 13 , 14 ). This assembly is required for recruiting procaspase-9 which is thereby activated and processed into the initiator caspase-9 ( 10 , 13 , 15 , 16 ). The structure of the heterooligomeric complex formed by Apaf1, cyt c and caspase-9 is well characterised in vitro and known as the heptameric apoptosome holoenzyme ( 17 – 19 ). In this wheel-like assembly, procaspase-9 binds to the central hub through interactions between its own and Apaf1 caspase recruitment domains (CARD), resulting in a local accumulation of procaspase-9 molecules, their conformational activation and self-cleavage ( 14 , 20 – 24 ). Although the formation of the apoptosome has been elucidated in much detail using biochemistry and structural biology, the subcellular events of this pathway remain largely unknown. It is also unclear if apoptosome function is controllable after complex formation. Here, we visualised Apaf1 during apoptosis inside cells. Our results suggest that a transient, pleiomorphic assembly of Apaf1 molecules corresponds to the apoptosome, and its dissociation is linked to evasion from cell death. Results Apaf1 assembles into multiple cellular foci upon induction of apoptosis To investigate apoptosome formation by live cell imaging, we generated a HeLa cell line stably expressing Apaf1-GFP (Suppl. Fig. S1). We induced apoptosis in these cells using the Bcl-2 inhibitor ABT-737 ( 25 ), and imaged them by live fluorescence microscopy. Initially, we found that the Apaf1-GFP signal was homogenously dispersed in the cytoplasm ( Fig. 1A , Movie S1, Suppl. Fig. S2A), similarly to what has been observed before ( 26 , 27 ). Over time, the Apaf1-GFP signal accumulated into dozens of foci distributed in the cytoplasm ( Fig. 1A , Movie S1, Suppl. Fig. S2A and B). This was accompanied by fragmentation of mitochondria, typical for intrinsic apoptosis ( 28 ). Within 18 hours from induction, Apaf1-GFP foci had appeared in 63% of the cells ( Fig. 1B ). The majority of these cells shrank, often followed by detachment from the imaging plate, within 37 minutes of foci appearance ( Fig. 1C , Suppl. Fig. S2C), in accordance with progression of apoptosis (Suppl. Fig. S2D and E). Cells that did not form foci had similar levels of GFP fluorescence compared to the cells with foci prior to cell death (Suppl. Fig. S2F), indicating that foci formation was not caused by excessive Apaf1-GFP levels. Taken together, Apaf1-GFP molecules assemble into areas of high concentration during the progression of apoptosis. Download figure Open in new tab Figure 1: Apaf1 accumulates into cytoplasmic foci during apoptosis. A) Live fluorescence imaging of HeLa cells stably expressing Apaf1-GFP, showing Apaf1 foci (green) upon ABT-737 treatment. Mitochondria were stained with MitoTracker DeepRed (magenta). Image acquisition time since ABT-737 treatment is indicated on large images. White squares indicate areas shown as close-ups (from left to right: MitoTracker DeepRed; Apaf1-GFP; merge). B-E) Analysis of live fluorescence imaging. Lines correspond to means and standard deviations (SD). N=4 experiments. At least 54 cells were imaged per experiment. B) Percentage of cells forming or not forming Apaf1-GFP foci, among all imaged cells. Mean=63%, SD=15%. C) Percentage of cells shrinking (indicating cell death) or surviving, among cells forming foci. Mean=92%, SD=6%. D) Percentage of cells forming foci once or multiple times, among cells that shrank. Mean=97%, SD=2%. E) Percentage of cells in which foci disassembled, among all cells forming foci. Mean=24%, SD=3%. Scale bars in A: 10 μm in large images, 3 μm in close-ups. In a small fraction of cells, the Apaf1-GFP foci dissociated and re-formed before the cells died ( Fig. 1D , Movie S2). In total we observed disassembly of foci in 24% of the cells that had foci ( Fig. 1E ), which includes those cells that survived throughout the course of imaging ( Fig. 1C ). Thus, when foci appearance was not immediately followed by cell death, the foci were transient. To further investigate this phenomenon, we imaged Apaf1-GFP expressing cells treated with both ABT-737 and QVD, a broad-spectrum caspase inhibitor which prevents the completion of apoptosis and thereby facilitates the study of transient steps ( 29 )( Fig. 2A , Movie S3). Under these conditions, 38% of cells displayed Apaf1 foci ( Fig. 2B ) within 18 hours of apoptosis induction. In most of these cells, the foci disassembled after two and a half hours ( Fig. 2C , Suppl. Fig. S2G). Moreover, 10% of the cells in which foci had disassembled showed further foci appearances over time ( Fig. 2D ). Within the imaged cell population, the percentage of cells with foci peaked 10 hours after induction and decreased subsequently ( Fig. 2E ), reflecting the foci’s limited lifetime. These results show that Apaf1-GFP foci are transient structures, and their evanescence correlates with cell survival. Download figure Open in new tab Figure 2: Apaf1 foci disassemble when cells survive. A) Live fluorescence imaging of HeLa cells stably expressing Apaf1-GFP, showing assembly and disassembly of Apaf1 foci (green) upon ABT-737 and QVD treatment. Mitochondria were stained with MitoTracker DeepRed (magenta). Image acquisition time since ABT-737 and QVD treatment is indicated on large images. White squares indicate areas shown as close-ups (from left to right: MitoTracker DeepRed, Apaf1-GFP, merge). B-E) Analysis of live fluorescence imaging. Lines correspond to means and SD. At least 94 cells were imaged per experiment. B) Percentage of cells forming or not forming Apaf1 foci, among all imaged cells. Mean=38%, SD=18%, N=6 experiments. C) Percentage of cells in which foci disassembled or did not disassemble, among cells forming foci. Mean=85%, SD=7%, N=6 experiments. D) Percentage of cells forming foci repeatedly, among cells showing Apaf1 foci disassembly. Mean=10%, SD=9%, N=6 experiments. E) Percentages of cells displaying Apaf1 foci at the time points after ABT-737 and QVD treatment indicated on x-axis. The different symbols represent individual experiments. At 10 h: Mean=16%, SD=8%, N=4 experiments. F) Immunofluorescence of untreated and ABT-737/QVD treated HeLa cells, using antibodies labelling the mitochondrial protein Tom20 (magenta) and endogenous Apaf1 (green). G) Percentages of HeLa cells displaying endogenous Apaf1 foci by immunofluorescence, fixed at the time points after ABT-737 and QVD treatment indicated on x-axis. The different symbols represent individual experiments. At 10 h: Mean=62%, SD=18%, N=4 experiments. At least 164 cells were imaged per time point and experiment. White squares indicate areas shown as close-ups (from left to right: MitoTracker DeepRed, Apaf1-GFP, merge). Scale bars in A and F: 10 μm in large images, 3 μm in close-ups. Next, we tested if endogenous, untagged Apaf1 also accumulates into foci. By immunofluorescence of HeLa cells treated with ABT-737 and QVD, we observed that endogenous Apaf1 formed multiple bright foci, similarly to Apaf1-GFP ( Fig. 2F ). Cells displaying endogenous Apaf1 foci also had fragmented mitochondria ( 28 ). Further, we performed time-course immunofluorescence of these HeLa cells after apoptosis induction ( Fig. 2G ). The fraction of cells displaying foci of endogenous Apaf1 was highest 10 hours after ABT-737 treatment, and then decreased over time, in agreement with Apaf1-GFP in live cells ( Fig. 2E ). These experiments confirm that both formation and disassembly of Apaf1 foci are endogenous features of apoptosis in HeLa cells. To explore whether Apaf1 foci formation also occurred in other cell types, we expressed Apaf1-GFP in U2OS and HCT116 cells (Suppl. Fig. S3). In both cell types, we observed the formation of Apaf1-GFP foci after induction of apoptosis with ABT-737 similarly to HeLa cells, indicating that Apaf1 foci formation is likely a universal phenomenon of apoptotic cells. Apaf1 foci consist of cloud-like assemblies of irregular shape Since in vitro, Apaf1 oligomerises into the wheel-like heptameric apoptosome complex ( 10 , 17 , 19 ), we hypothesized that Apaf1 foci might correspond to apoptosome clusters. Therefore, we visualised the 3D architecture of Apaf1-GFP foci in HeLa cells using a correlative light and electron microscopy (CLEM) approach for resin-embedded cells, which allows to precisely correlate fluorescent signals to cellular ultrastructure ( 30 ) ( Fig. 3A and Suppl. Fig. S4A). MitoTracker staining helped confirming the correlation based on the positions of mitochondria. We acquired 13 electron tomograms at locations that contained a total of 29 Apaf1-GFP foci in two cells ( Fig. 3B-E ). In all cases, the areas corresponding to Apaf1-GFP foci contained cloud-like irregular meshwork structures ( Fig. 3C and E ). This meshwork consisted of areas with varying density, which were loosely associated with each other within one Apaf1-GFP focus and interspersed with cytosolic components such as ribosomes. While areas of high density varied in size and shape, the meshwork appeared continuous within each tomographic volume. The meshwork was found in varying proximity to mitochondria, ER or Golgi membranes, indicating no preferential localisation near a specific organelle ( Fig. 3B and D , Movie S4 and S5). Download figure Open in new tab Figure 3: Correlative light and electron microscopy (CLEM) reveals cloud-like meshwork structure of Apaf1 foci. See Suppl. Fig. S4 for workflow details. A-E) CLEM of resin-embedded HeLa cells transiently transfected with Apaf1-GFP, treated with ABT-737 and QVD. A) Fluorescence image of a section through a resin-embedded cell; Apaf1-GFP (green) and MitoTracker DeepRed (magenta). White squares indicate areas imaged by electron tomography and shown in B and D. B) Virtual slice from electron tomogram acquired at area indicated in A. White square indicates area that contains an Apaf1-GFP localisation, shown in C. Magenta arrow indicates mitochondrion, white arrow indicates ER. C) Zoomed-in area from the electron tomogram shown in B. Here shown virtual slice corresponds to a different z-position than the virtual slice shown in B. Yellow arrows indicate parts of the cloud-like meshwork structure, white arrows indicate putative ribosomes. D) Virtual slice from electron tomogram acquired at area indicated in A. White square indicates area that contains an Apaf1-GFP localisation, shown in E. White arrows indicate Golgi. E) Zoomed-in area from the electron tomogram shown in D. Here shown virtual slice corresponds to a different z-position than the virtual slice shown in D. Yellow arrows indicate parts of the cloud-like meshwork structure, white arrows indicate putative ribosomes. F-I) Pre-FIB milling cryo-CLEM of vitreous HeLa cells stably expressing Apaf1-GFP, treated with ABT-737 and QVD. F) Cryo-fluorescence image of a cell grown on an EM grid, imaged before cryo-FIB milling; Apaf1-GFP (green) and MitoTracker DeepRed (magenta). The white dashed circle indicates the target Apaf1-GFP focus. G) Virtual slice from cryo-electron tomogram acquired in the target area indicated in F. White square indicates area shown in H and I. H) Zoomed-in area from the cryo-electron tomogram shown in G. Here shown virtual slice corresponds to a different z-position than the virtual slice shown in G. White arrows indicate putative ribosomes. I) Segmentation model indicating area shown in H that contains meshwork structure. J-N) Pre- and post-FIB milling cryo-CLEM of vitreous HeLa cells transiently expressing Apaf1-SNAP labelled with SNAP-Cell 647-SiR (Apaf1-SNAP647), treated with ABT-737 and QVD. J) Cryo-fluorescence image of a cell grown on an EM grid, imaged before cryo-FIB milling; Apaf1-SNAP647 (magenta) and MitoSpy Green (green). White square indicates area targeted by cryo-FIB milling. K) Cryo-fluorescence image of the cell area indicated in J, imaged after cryo-FIB milling. The white dashed circle indicates the Apaf1-SNAP647 (magenta) focus that was imaged by cryo-ET in L. L) Virtual slice from cryo-electron tomogram acquired in the area indicated in K. White square indicates area shown in M and N. Green arrow indicates mitochondrion. M) Zoomed-in area from the cryo-electron tomogram shown in L. Here shown virtual slice corresponds to a different z-position than the virtual slice shown in L. N) Segmentation model indicating area shown in M that contains meshwork structure. Scale bars in A: 2 μm. In B, D, G and L: 100 nm. In C, E, H and M: 50 nm. In F and K: 3 μm. In J: 10 μm. While CLEM on resin-sections reliably established that Apaf1-GFP signals correlate to cloud-like meshworks, the interpretability of the identified structures might be impaired by the resin embedding. We therefore turned to cryo-electron tomography (cryo-ET), a method for imaging cellular components in a near-native state ( 31 , 32 ), which we combined with two different cryo-CLEM approaches (Suppl. Fig. S4B and C) ( 33 , 34 ). We thereby targeted Apaf1 foci in HeLa cells expressing Apaf1-GFP ( Fig. 3F-I ) or Apaf1-SNAP-tag ( Fig. 3J-N ). In the cryo-ET data obtained from both CLEM approaches we observed structures similar in appearance to those visualised by CLEM in resin-embedded cells, validating our observations ( Fig. 3G and L , Movie S6 and S7). The cloud-like, continuous meshwork associated with Apaf1 foci displayed irregular overall shapes with uneven edges ( Fig. 3H, I, M and N ). The meshwork structure appeared to correspond to dense, interconnected macromolecular assemblies. Within these assemblies we did not discern discrete structures that would be indicative of a gathering of individual apoptosome wheels. Collectively, our CLEM data indicate that Apaf1 foci consist of a higher-order assembly with a pleiomorphic ultrastructure. Formation of Apaf1 foci depends on Bax/Bak activity Although the structure of Apaf1 foci does not resemble discrete protein complexes, Apaf1 foci might be equivalent to the apoptosome. To test this hypothesis, we asked whether Apaf1 foci form through a similar mechanism as the apoptosome complex. In vitro , apoptosome formation requires binding of cyt c to Apaf1 ( 9 , 10 ). Since the release of cyt c from mitochondria depends on permeabilisation of the outer mitochondrial membrane by Bax or Bak ( 4 ), we expressed Apaf1-GFP in an established Bax/Bak double knockout (KO) HCT116 cell line ( 35 ) and wildtype HCT116 cells. We found that in absence of Bax and Bak, almost no cells displayed Apaf1-GFP foci upon induction of apoptosis, compared to 39% of wildtype cells ( Fig. 4A ). Thus, the formation of Apaf1 foci depends on Bax/Bak activity. Download figure Open in new tab Figure 4: Bax/Bak are required for Apaf1 foci formation. A) Percentage of HCT116 wild type (WT) and Bax/Bak DKO cells that form Apaf1 foci upon ABT-737 treatment, among all imaged cells. Lines correspond to means and SD. WT: Mean=39%, SD=10%, N=3 experiments. Bax/Bak DKO: Mean=1%, SD=1%, N=3 experiments. At least 48 cells were imaged per condition and experiment. Welch’s t-test P=0.0234. B) Live fluorescence imaging of HeLa cells stably expressing Apaf1-GFP (green) and transiently expressing RFP-Bax (magenta) showing Apaf1 foci assembly and disassembly followed by Bax cluster formation. Apoptosis was induced by RFP-Bax overexpression and cells were treated with QVD. Image acquisition time since RFP-Bax transfection is indicated on large images. White squares in the large images indicate areas shown as close-ups (from left to right: RFP-Bax; Apaf1-GFP; merge). C) Percentage of cells forming both Apaf1 foci and Bax clusters, among all RFP-Bax transfected cells. Lines correspond to mean and SD. Mean= 46%, SD=9%, N=6 experiments. At least 59 cells were imaged per experiment. D) Timing of assembly and disassembly of Apaf1 foci and Bax cluster formation per individual cell, imaged as shown in B. Grey lines indicate Apaf1-GFP foci lifetimes; red dots time points of RFP-Bax cluster appearance. E) Live fluorescence imaging of HeLa cells stably expressing Apaf1-GFP (green) and transiently expressing RFP-Bax (magenta) in a rare case when Apaf1 foci and Bax clusters are simultaneously observable in a cell. White square in the large image indicate area shown as close-ups (from left to right: RFP-Bax; Apaf1-GFP; merge). Scale bars in B and E: 10 μm in large images, 3 μm in close-ups. We next asked which stage of Bax/Bak activity drives Apaf1 foci formation. Bax/Bak accumulate on the outer mitochondrial membrane to perforate it, and eventually form large cytosolic clusters ( 36 ). To assess which of these phases is relevant for Apaf1 foci assembly, we overexpressed RFP-Bax in the Apaf1-GFP HeLa cells. Bax overexpression directly induces apoptosis and allows studying Bax cluster formation ( 33 , 37 ). Upon transfection with RFP-Bax, 46% of cells formed Apaf1-GFP foci within 20 hours 15 minutes ( Fig. 4B and C ). This observation confirms dependence of Apaf1 foci formation on Bax and shows that foci can form by other apoptosis inducers than ABT-737. Interestingly, Apaf1-GFP foci appeared within 2 hours before RFP-Bax clusters could be detected ( Fig. 4D ). As the cells were QVD treated, the majority of Apaf1-GFP foci disassembled within those 2 hours, in most cases before RFP-Bax clusters were detectable. In the rare cases when Bax clusters and Apaf1 foci were present in a cell at the same time, the RFP-Bax and Apaf1-GFP signals did not colocalize ( Fig. 4E ). In conclusion, Apaf1 foci and Bax cluster formation are temporally and spatially distinct events. Apaf1 foci formation is dependent on Bax activity and precedes cytosolic Bax cluster formation. Apaf1 foci form through specific interactions with cyt c We next wanted to directly assess whether Apaf1 foci were induced by the release of cyt c. We first microinjected bovine cyt c into Apaf1-GFP expressing HeLa cells treated with QVD ( 38 , 39 ). Importantly, we did not induce apoptosis in these cells. Cyt c was co-injected with fluorescent dextran to track microinjected cells ( Fig. 5A ). As a control, cells were microinjected only with fluorescent dextran. Cyt c microinjection promoted Apaf1 foci formation in 42% of the microinjected cells, while no Apaf1 foci were observed in cells microinjected with dextran only ( Fig. 5B , Movie S8). The foci were transient, similarly to those induced by ABT-737 in presence of QVD ( Fig. 2C ). In summary, the availability of cyt c in the cytosol is sufficient to trigger Apaf1 foci formation. Download figure Open in new tab Figure 5: Apaf1 foci formation depends on specific interactions with cytochrome c and on caspase-9. A) Live fluorescence imaging of HeLa cells stably expressing Apaf1-GFP (green) microinjected with bovine cyt c and fluorescent dextran (magenta). White squares indicate two areas shown as close-ups (from top to bottom: Dextran; Apaf1-GFP; merge). B) Percentages of cells forming Apaf1 foci upon microinjection of cyt c and dextran, or dextran only. Lines correspond to means and SD. Cyt c + dextran: Mean=42%, SD=16%, N=3 experiments. Dextran: Mean=0%, SD=0%, N=3 experiments. Welch’s t-test P=0.0478. At least 16 cells were microinjected and imaged per condition and experiment. C) Percentages of ABT-737-treated HeLa cells transiently expressing Apaf1-GFP or Apaf1-dead-GFP showing Apaf1 foci formation. Lines correspond to mean and SD. Apaf1-GFP: Mean= 41%, SD=21%, N=4 experiments. Apaf1-dead-GFP: Mean=5%, SD=5%, N=5 experiments. Welch’s t-test P=0.0363. At least 60 cells were imaged per condition and experiment. D) Percentages of HeLa cells stably expressing Apaf1-GFP, microinjected with cyt c twice within 10 hours, that formed Apaf1 foci twice, once, never, or that disintegrated upon double microinjection. N=1 experiment; 41 cells were microinjected and imaged twice. E) Live fluorescence imaging of HeLa cells showing Apaf1 foci assembly and disassembly upon transient expression of Apaf1-ΔWD40-GFP (green). Mitochondria were stained with MitoTracker DeepRed (magenta). Image acquisition time after transfection is indicated on large image. White squares in the large images indicate areas shown as close-ups (from left to right: MitoTracker DeepRed; Apaf1-GFP; merge). F ) Percentage of cells that form Apaf1-ΔWD40-GFP foci during imaging. Mean=59%, SD=14%, N=5 experiments. At least 74 cells were imaged per experiment. G) Lifetimes of Apaf1-ΔWD40-GFP foci. Each dot represents an individual cell, each colour represents an experiment. Mean lifetimes of each experiment are indicated by triangles. Black lines indicate the overall mean and SD. Mean=75 min, SD=7 min, N=5 experiments. At least 74 cells were imaged per experiment. H) Percentages of HeLa cells transiently expressing Apaf1-ΔWD40-GFP or Apaf1-GFP, in presence or absence of ABT-737, that shrank (indicating cell death) among all cells showing foci over 20 hours 45 minutes of imaging. Lines correspond to means and SD. Apaf1-ΔWD40-GFP: Mean=2%, SD=2%, N=5 experiments. Apaf1-ΔWD40-GFP with ABT-737: Mean=34%, SD=15%, N=3 experiments. WT Apaf1-GFP with ABT-737: Mean=81%, SD=18%, N=4 experiments. Brown-Forsythe and Welch ANOVA test P=0.1353 for comparing Apaf1-ΔWD40-GFP and Apaf1-ΔWD40-GFP + ABT-737; P=0.0077 for comparing Apaf1-ΔWD40-GFP and Apaf1-GFP + ABT-737; P=0.0355 for comparing Apaf1-ΔWD40-GFP + ABT-737 and Apaf1-GFP + ABT-737. At least 92 cells were imaged per condition and experiment. I) Percentage of cells forming foci among all transfected cells. HCT116 wild type, HCT116 caspase-9KO, or HeLa caspase-9KO cells transiently expressing Apaf1-GFP or Apaf1-ΔWD40-GFP, as indicated. Cells expressing Apaf1-GFP were treated with ABT-737. Lines correspond to means and SD. N=3 experiments for each condition. HCT116 WT + Apaf1-GFP: Mean=40%, SD=13%. HCT116 caspase-9KO + Apaf1-GFP: Mean=4% SD=0.5%. HeLa caspase-9KO + Apaf1-GFP: Mean=0%, SD=0%. HeLa caspase-9KO + Apaf1-ΔWD40-GFP: Mean=0%, SD=0.5%. At least 84 cells were imaged per condition and experiment. Welch’s t-test P=0.0409. Scale bars in A and E: 10 μm in large images, 3 μm in close-ups. In vitro , cyt c is known to bind to the Apaf1-WD40 repeats, leading to apoptosome formation ( 10 , 14 , 17 – 19 , 23 , 40 ). To understand the molecular interactions underlying Apaf1 foci formation in cells, we generated a mutant Apaf1 expected to be unable to bind cyt c and consequently to remain inactive, which we refer to as Apaf1-dead-GFP. Specifically, we mutated Trp884 and Trp1179 in the WD40 repeats to aspartates. These two tryptophans were described as crucial for binding of cyt c to Apaf1 in the apoptosome complex ( 19 ). We transiently expressed Apaf1-dead-GFP in HeLa cells subsequently treated with ABT-737 (Suppl. Fig. S1). Only 5% of the cells expressing Apaf1-dead-GFP formed foci, compared to 41% of cells transiently expressing wildtype Apaf1-GFP ( Fig. 5C and Suppl. Fig. S5A). Thus, foci formation by the Apaf1-dead-GFP mutant is impaired. The low percentage of cells that displayed Apaf1-dead-GFP foci might arise from the presence of endogenous Apaf1 in these cells (Suppl. Fig. S1), possibly promoting formation of heterotypic foci and cell death (Suppl. Fig. S5B). Nevertheless, these experiments show that the specific interface between cyt c and the Apaf1-WD40 repeats ( 19 ) is critical for formation of Apaf1 foci. While these results are in line with the expectation that cyt c and Apaf1 would directly interact ( 9 , 10 ), we did not observe enrichment of cyt c in the Apaf1 foci by immunofluorescence (Suppl. Fig. S5C). This could be due to epitope inaccessibility of Apaf1-bound cyt c. However, it could also reflect a transient interaction between Apaf1 and cyt c, as previously suggested ( 27 , 41 ). To test this possibility, we microinjected individual Apaf1-GFP expressing cells twice with cyt c, at an interval of 10 hours. We reasoned that if doubly microinjected cells formed Apaf1 foci only once, it would mean that Apaf1 is not reactivatable by fresh cyt c, despite foci disassembly. Such a result could support a stable interaction between cyt c and Apaf1. However, we observed that 39% of doubly microinjected cells formed foci twice ( Fig. 5D ), hence after each microinjection event, suggesting that foci formation does not irreversibly affect Apaf1. This result is in line with our observation that cells treated with ABT-737 occasionally showed repeated Apaf1 foci appearances during imaging ( Fig. 1D and I , Movie S2). Altogether, these results are compatible with a transient activation of Apaf1 by the specific interaction with cyt c. We next expressed an Apaf1 mutant known to be constitutively active, as it forms the apoptosome complex and activates caspase-9 in absence of cyt c in vitro ( 13 , 42 – 45 ). This construct lacks the entire WD40 repeats and is referred to as the Apaf1-ΔWD40 mutant ( 13 , 42 )(Suppl. Fig. S1). The WD40 repeats of Apaf1 were shown to inhibit Apaf1 activation and oligomerisation, unless cyt c is bound ( 43 , 45 , 46 ). Thus, if Apaf1 foci form through similar mechanisms as the apoptosome, Apaf1-ΔWD40-GFP should form foci immediately upon expression, without requiring cyt c through induction of apoptosis. Indeed, 59% of HeLa cells transfected with Apaf1-ΔWD40-GFP formed foci within one hour after GFP fluorescence was detectable in the cytoplasm ( Fig. 5E and F , Movie S9, Suppl. Fig. S5D and E). In contrast, no cells expressing full-length Apaf1-GFP displayed foci in absence of apoptosis induction (Suppl. Fig. S5D). Thus, the lack of the WD40 repeats promotes Apaf1 foci formation in absence of apoptotic stimuli. Furthermore, for foci assembly, the N-terminal part of Apaf1 is sufficient, consisting of the CARD and the NOD domains known to drive oligomerisation into the apoptosome complex ( 18 , 19 , 42 ). Together with our results on cyt c microinjection and the Apaf1-dead-GFP mutant, these data suggest that Apaf1 foci form through molecular interactions similar to in vitro formation of the apoptosome complex. Caspase-9 is required for formation of Apaf1 foci Intriguingly, the foci formed by Apaf1-ΔWD40-GFP in absence of apoptotic stimuli were transient, with an average lifetime of 75 minutes ( Fig. 5G , Suppl. Fig. S5F, Movie S9). Thus, despite Apaf1-ΔWD40-GFP being spontaneously active regarding foci formation ( Fig. 5E ) similarly to apoptosome formation ( 13 , 42 – 45 ), this activity was evanescent. This means that foci disassembly does not require Apaf1 to go back to its autoinhibited state, since the Apaf1-ΔWD40 mutant cannot adopt it ( 45 ). Furthermore, the ability to both assemble and disassemble foci lies in the N-terminal part of Apaf1. We also observed that very few cells with Apaf1-ΔWD40-GFP foci proceeded to cell death despite absence of QVD ( Fig. 5H ). When we induced apoptosis with ABT-737, 34% of cells with Apaf1-ΔWD40-GFP foci died ( Fig. 5H ), probably due to the presence of endogenous Apaf1 in these cells (Suppl. Fig. S1). In contrast, most cells with foci of transiently expressed full-length Apaf1-GFP died upon induction of apoptosis ( Fig. 5H ). In line with this, we observed caspase activity when full-length Apaf1-GFP was expressed and apoptosis induced, but not when Apaf1-ΔWD40-GFP was expressed (Suppl. Fig. S5G). Thus, the constitutive formation of foci by Apaf1-ΔWD40-GFP does not promote cell death, in line with the behaviour of this mutant Apaf1 in the apoptosome ( 43 , 44 ). In the apoptosome complex, procaspase-9 binds to Apaf1 via CARD-CARD interactions ( 14 , 23 , 24 ). Given the ability of Apaf1-ΔWD40-GFP to form foci while consisting only of the N-terminal NOD and CARD domains, we wondered if caspase-9 plays a role in the formation of Apaf1 foci. We first expressed full-length Apaf1-GFP in HCT116 wildtype and caspase-9KO cells (Suppl. Fig. S5H), and induced apoptosis with ABT-737. Only 4% of the caspase-9KO cells displayed Apaf1-GFP foci, compared to 40% of wildtype cells ( Fig. 5I ). We next expressed Apaf1-ΔWD40-GFP and full-length Apaf1-GFP in HeLa caspase-9KO cells ( 47 ), the latter treated with ABT-737. In both cases, the percentage of transfected cells showing foci was almost zero ( Fig. 5I ). Thus, neither Apaf1-ΔWD40-GFP nor full-length Apaf1-GFP formed foci in absence of caspase-9. These results suggest that Apaf1 foci formation depends on caspase-9, and this dependence pertains to the N-terminal part of Apaf1 which includes the CARD domain. Discussion During mitochondrial apoptosis, activation and oligomerisation of Apaf1 into the apoptosome initiate the caspase cascade which orchestrates cell death ( 48 , 49 ). Here, we discovered that these events involve accumulation of Apaf1 molecules into multiple foci per cell, consisting of a pleiomorphic cloud-like meshwork of organelle-like dimensions. Formation of Apaf1 foci depends on a specific interaction between the WD40 repeats of Apaf1 and cyt c, described before by the in vitro apoptosome structure ( 19 ). Foci form spontaneously when Apaf1 cannot adopt an inhibited conformation, also in line with the apoptosome in vitro ( 44 , 45 ). Furthermore, CARD and NOD domains are sufficient for foci formation which is caspase-9 dependent, in accordance with the interactions between Apaf1 and caspase-9 being based on CARD-CARD binding and the NOD driving Apaf1 apoptosome oligomerisation ( 13 , 14 , 23 , 24 ). Thus, while the molecular interactions driving foci formation correspond to those in the apoptosome complex, the overall appearance of the foci is reminiscent of membrane-less compartments ( 50 ). Remarkably, Apaf1 foci can disassemble, which we observed to correlate with cell survival. Collectively, our results suggest that Apaf1 foci are a cellular form of the apoptosome, yet with an irregular ultrastructural organisation and an inherent tendency to dissociate, related to evasion from cell death. The accumulation of Apaf1 into areas of high density is consistent with activation of caspase-9 requiring its high local concentration ( 51 – 53 ). For full activity, caspase-9 needs to dimerise and additionally interact with oligomeric Apaf1 ( 13 , 20 , 21 , 42 , 54 , 55 ). Interestingly, other initiator caspase activation platforms show a similar behaviour. The NLRP3-ASC inflammasome forms upon the oligomerisation of the adapter protein into a single large cellular speck for activation of caspase-1 ( 56 – 58 ). Caspase-8 filaments oligomerise into the death-inducing signalling complex (DISC), a higher-order oligomeric structure at the plasma membrane, upon accumulation of death receptors such as CD95 and adaptor proteins ( 59 – 61 ). The association into higher-order oligomeric assemblies of organelle-like dimensions might thus be a general principle for initiating caspase activity cascades. Such assemblies could spatially constrain activities and thereby facilitate their regulation. Our observation that disassembly of Apaf1 foci correlates with evasion of apoptosis points to a regulatory function. There is growing evidence for cellular mechanisms that facilitate recovery from cell death at various stages of the pathway ( 62 ). For instance, incomplete permeabilisation of the outer mitochondrial membrane can lead to limited caspase activation and thereby cell survival, suggesting the necessity to reach a threshold in caspase activity for completion of apoptosis ( 63 ). In line with this, when we limited effector caspase activity by treating cells with QVD, we observed disassembly of Apaf1 foci and cell survival. It has been suggested that the amount of available procaspase-9 restricts caspase activity to a limited time window for completion of apoptosis ( 64 ). Since caspase-9 is only active when bound to the apoptosome and becomes displaced by new procaspase-9 upon cleavage, its activity would end when procaspase-9 is depleted. This model of a molecular timer ( 64 ) is supported by the dynamics of Apaf1 foci. Given that foci formation requires caspase-9, which is expressed as procaspase-9, disassembly of Apaf1 foci could be indicative of depletion of procaspase-9. If this occurred before the threshold of effector caspase activity was reached, cells would survive. This model can also explain our observations of inherent foci disassembly and cell survival upon expression of Apaf1-ι1WD40-GFP. Because this Apaf1 mutant promotes procaspase-9 auto-processing but does not activate effector caspases ( 13 , 43 , 44 ), depletion of the cytosolic pool of procaspase-9 would occur without eliciting the downstream caspase cascade, resulting in foci disassembly and cell survival. Thus, Apaf1 foci, specifically their disassembly, could underlie a late opportunity for escape from apoptosis. In our electron tomograms, Apaf1 foci appeared as cloud-like, continuous meshwork structures. The specificity of the molecular interactions required for foci formation indicate a higher-order organisation of the foci. Notably, foci formation depends on caspase-9, which from in vitro data was thought to be recruited to the Apaf1 CARDs once they are in an oligomeric arrangement ( 10 ). Our observation suggests that caspase-9 has a role in the organisation of Apaf1 foci. Interestingly, in vitro assembled apoptosomes have been observed to cluster in presence of procaspase-9 ( 17 ). The irregular meshwork ultrastructure of Apaf1-foci might underpin the instability of the foci. Disassembly and the ability to form repeatedly indicate that the structural arrangement of molecules in the foci is labile and reversible. In line with this, our data support previous reports that binding of cyt c to Apaf1 is transient ( 27 , 41 ). In contrast to the formation of discrete, stable complexes, a labile assembly could facilitate fast dissociation for ending apoptotic activity. In addition, the irregular, continuous organisation might allow fast bulk sequestration of components without requiring precise stoichiometry. In summary, our findings suggest that apoptosome function in the cell is based on a dynamic supramolecular organisation of its components. Our study points up structured, large-scale molecular assemblies as a cellular mechanism for spatiotemporal regulation of signalling pathways. Materials and Methods Cloning To generate the plasmid for expressing Apaf1-GFP and GFP-Apaf1, the Homo sapiens Apaf1-XL ( 43 ) cDNA (referred as Apaf1 throughout the text) was amplified from a total human brain mRNA extract (gift from Madeline Lancaster’s lab) and introduced into a pCI-C-terminal-mEGFP-Gateway and pCI-N-terminal-mEGFP-Gateway destination vectors (gift from Harvey McMahon’s lab) using the NheI-HF and KpnI-HF restriction sites or the Gateway recombination sites, respectively. To generate a stable cell line, the Apaf1-mEGFP sequence was introduced into the pLenti6/V5-DEST Gateway vector (Thermo Fisher Scientific, V36820) using the Gateway recombination sites. To generate the plasmid for expressing pCI-Apaf1-ΔWD40-GFP, Apaf1 amino acids 1 to 559 were cloned into the pCI-C-terminal-mEGFP-Gateway destination vector using the NheI-HF and KpnI-HF restriction sites. To generate the plasmid for expressing Apaf1-dead-mEGFP, base pairs 2034 to 3812 of the Apaf1-EGFP sequence were amplified as three separate PCR fragments with primers containing modified codons corresponding to Trp884Asp and Trp1179Asp mutations. The three PCR fragments were assembled by overlapping PCR and introduced into the pCI-Apaf1-mEGFP vector using the EcoRI-HF and KpnI-HF restriction sites. To generate a plasmid for expressing Apaf1-SNAP-tag, the SNAP-tag sequence was amplified by PCR from a gBlock (IDT), digested at Acc65I and Not1 restriction sites and ligated into the pCI-Apaf1-mEGFP vector to replace mEGFP. Bacterial strains transformed with all Apaf1-related plasmids were grown at room temperature for 2 days for subsequent purification or cloning procedure because when bacteria were grown at 37° C, the plasmids could not be recovered. At each cloning step, the desired cDNA sequence was verified by sequencing. Generation of the HeLa cell line stably expressing Apaf1-GFP A HeLa cell line stably expressing Apaf1-GFP was generated by lentiviral transduction. To produce lentiviruses, HEK293T cells were transfected with 6 μg of pLenti6/V5-EXPR-Apaf1-mEGFP mixed with 4 μg of pCMVR8.74 (gift from Didier Trono, Addgene #22036) and 4 μg of pMD2.G (gift from Didier Trono, Addgene #12259) plasmids in Opti-MEM (Gibco, 31985088) using polyethyleneimine (PEI) (1 mg/mL in PBS) transfection reagent at a 1 ng DNA to 4 μl PEI ratio. 48 hours later, the medium containing lentivirus was harvested, filtered through a 0.22 μm filter (Elkay, E25PV4550S) and added to HeLa-TetON-WTOTC cells ( 65 ) cultured in a media supplemented with 8 μg/mL polybrene (Sigma Aldrich, H9268). 48 hours later, the medium was replaced with fresh medium containing 10 μg/mL of blasticidin (Thermo Fisher Scientific, A1113903) to select the transduced clones. After 10 days, the transduced cells were arbitrary separated in three non-clonal populations according to their Apaf1-GFP expression level by FACS. All three cell populations showed Apaf1-GFP foci appearance. The population expressing the lowest levels of Apaf1-GFP was designated as the stably expressing cell line, hereafter called HeLa-Apaf1-GFP, and was used for all subsequent experiments. Generation of the HCT116 caspase-9 KO cell line To generate HCT116 caspase-9 KO cells, the sgRNA sequence (CGCAGCAGTCCAGAGCACCG) was cloned into LentiCRISPRv2-blasti ( 66 ) between Esp3I sites. 293FT cells were co-transfected with 1.86 μg psPAX2 (gift from Didier Trono, Addgene #12260), 1 μg VSVG (gift from Bob Weinberg, Addgene #8454)( 67 ) and 5 μg LentiCRISPRv2blasti hcaspase-9 using Lipofectamine 2000 (Life Technologies). The following day the medium was changed to fresh medium containing 20% FBS. Supernatant containing viral particles was harvested at 48 h and 72 h post-transfection and used to infect HCT116 cells. After 24 h of infection, HCT116 cells were allowed to recover in fresh medium without antibiotics for 24 h, and then selected with 10 μg/mL blasticidin (Invitrogen) until untransduced cells were killed. Caspase-9 expression in the lysates from the resulting polyclonal cell line was determined by western blotting as described below. Cell culture All HeLa cells and the U2OS cells were cultured in DMEM/GlutaMAX medium (Gibco, 31966). All HCT116 cells were cultured in McCoy’s 5A/GlutaMAX medium (Thermo Fisher Scientific, 36600). Both types of media were supplemented with 10% heat-inactivated FBS (Gibco, 10270), 1x MEM-NEAA (Gibco, 11140050) and 10 mM HEPES buffer. HeLa-Apaf1-GFP cells were cultured in a medium additionally supplemented with 10 μg/mL blasticidin (Thermo Fisher Scientific, A1113903) when maintained or stocked for the lab collection. For experiment purposes, a medium without antibiotic was used. All cells were cultured at 37° C in a 5% humidified CO2 atmosphere. The cell lines were regularly tested for mycoplasma contamination and never tested positive. Cellular staining, transfections, and apoptosis induction To stain mitochondria for all live imaging, room temperature CLEM and cryo-CLEM experiments, the cells were incubated with MitoTracker Deep Red (Thermo Fisher Scientific, 22426) at a concentration of 20 nM for 15 minutes or with MitoSpy Green (BioLegend, 424805) at a concentration of 100 nM for 15 minutes. The cells were washed three times with PBS before fresh medium addition. HeLa cells transfected with Apaf1-SNAP-tag were stained with 1.5 nM SNAP-Cell 647-SiR substrate (NEB, S9102S), according to the manufacturer’s instructions. HeLa, HCT116 and U2OS cells were transfected with X-treme-GENE-9 (Roche, 06365787001), FuGENE-HD (Promega, E2311) and PEI transfection reagents, respectively, all at a ratio of 1 μg DNA for 3 μL of transfection reagent, in Opti-MEM medium (Gibco, 31985088), according to manufacturers’ instructions. The HeLa caspase-9KO cells were transfected using JetPRIME (Polyplus, 101000027) transfection reagent at a ratio of 1:2, according to the manufacturer’s instructions. Whenever used, ABT-737 (Cayman, 11501) was added to the culture medium at a concentration of 10 μM. Whenever used, the caspase inhibitor QVD-OPh (APExBIO, A1901), referred to as QVD in the main text, was added at a concentration of 10 μM, except for cells transfected with C3-eGFP-hBax plasmid, where 20 μM of QVD-OPh was used. Western blots For western blots detecting endogenous Apaf1 and tagged Apaf1 constructs, proteins were extracted in RIPA buffer supplemented with Halt Protease inhibitor (Thermo Fisher Scientific, 78430). 10 μg of total proteins were loaded onto 7% Tricine gels, which ran in cathode buffer (100 mM Tris-base, 100 mM Tricine, 0.1% SDS) and anode buffer (200 mM Tris-HCl, pH=8.8). The proteins were transferred to a nitrocellulose membrane (Bio-Rad, 1620097) in transfer buffer (192 mM glycine, 25 mM Tris-base, 20% methanol). The membrane was blocked in 5% milk powder in PBS and incubated with primary antibodies (1:1000 rabbit α-Apaf1 SY22-02 (Invitrogen, MA5-32082) and 1:200 mouse α-beta-actin (Sigma, A5316) diluted in 3% BSA in 0.1% PBS-Tween 20) overnight at 4°C. Secondary antibodies (1:3000 α-rabbit-HRP (Invitrogen, 65-6120) and 1:3000 α-mouse-HRP (Dako, P0260)), diluted in 3% BSA in 0.1% PBS-Tween 20) were incubated for 1 hour at RT. Membranes were treated with the Pierce™ ECL Western Blotting Substrate kit (Thermo Fisher Scientific, 32106) according to the manufacturer instructions and developed using a Western Blot Fusion FX7 Imager (Vilber). For western blots monitoring caspase-9 and PARP cleavage, the culture medium was collected, the cells were washed with PBS and the wash was collected. The cells were trypsinized, harvested and mixed with both the collected culture medium and the PBS wash to collect all dying cells that are detaching from the culture plate. Proteins were extracted similarly as for the Apaf1 western blot. 40 μg of total protein were loaded onto NuPAGE 4-12% Bis-Tris gels (Invitrogen, NP0321) and run in MES buffer. Transfer, blocking, antibody treatment and revelation were done as for the Apaf1 western blot, except that the primary antibodies were mouse α-caspase-9 (full length and cleaved) (1:1000) (Cell Signaling, 9508) in 5% milk-PBS-Tween 20 and mouse α-PARP antibody (1:500) (BD Biosciences, 556362) in 1% BSA-PBS-Tween 20. As secondary antibodies, 1:20’000 α-rabbit-HRP (Invitrogen, 65-6120) and 1:20’000 α-mouse-HRP (Dako, P0260) in 5% milk-PBS-Tween 20 were used. Fluorescence microscopy For all immunofluorescence (except the time-course immunofluorescence), live imaging (except HeLa caspase-9 KO live imaging) and microinjection experiments, a Zeiss LSM 710 confocal microscope was used, equipped with a 20x Plan-Apochromat objective with NA=0.8 and a 63x PlanApo oil-immersion objective with NA=1.4, operated with the ZEN imaging software (Zeiss). The microscope was equipped with a BiG (binary GaAsP) detector. For live imaging of HeLa caspase-9 KO cells, a Zeiss LSM 880 confocal microscope was used, equipped with a 63x oil-immersion objective with NA=1.4, operated with the ZEN imaging software (Zeiss). The microscope was equipped with a spectral detector 32 channel GaAsP PMT detector. For both microscopes, lasers at 488 nm, 561 nm, 633 nm were used for green, red and deep red, respectively. During live cell imaging, cells were kept at 37°C with a 5% humidified CO2 atmosphere. The time-course immunofluorescence imaging was done on a Nikon Eclipse Ti2 microscope equipped with an CFI Apochromat TIRF 100x/1.49 NA oil objective, controlled by the NIS-Elements software. A Lumencor SpectraX light source (Chroma) with 470 nm, 555 nm and 640 nm LEDs was used for excitation, with quad band filter set 89000 ET Sedat Quad (Chroma). The emission filter wheel (Nikon) was set to 535 nm, 638 nm and 708 nm for green, red and deep-red fluorescence, respectively. Fluorescence images of resin sections for room-temperature CLEM were acquired using a Ti2 widefield microscope (Nikon) equipped with a 100x oil-immersion TIRF objective (NA = 1.49), a Niji LED light source (bluebox optics), a Neo sCMOS DC-152Q-C00-FI camera (Andor) and the following filter sets: 49002 ET-GFP (chroma), 49005 ET-DSRed (chroma), 49006 ET-Cy5 (chroma). All confocal fluorescence images (live imaging and immunofluorescence) shown in the figures are single z-planes. Immunofluorescence experiments At time-points of interest after required treatment, cells plated on coverslips were washed and fixed with 4% paraformaldehyde in PBS, pH 7.2. The coverslips were washed, blocked in 10% goat serum (Sigma, G6767) and 1% saponin (Sigma, 8047152) solution and incubated overnight at 4°C with the primary antibodies. The samples were washed and incubated with secondary antibodies. The coverslips were washed and mounted with ProLong Diamond Antifade Mountant (Invitrogen, P36965) on imaging slides. Antibodies were used as follows. Primary: rabbit anti-Apaf1 (Invitrogen, PA5-19893) 1:50, mouse IgG 2 a anti-Tom20 (Santa Cruz Biotechnology, Sc-17764) 1:200, rabbit anti-Bax (Rabbit Millipore, ABC11) 1:200, and mouse anti-cytochrome c (BD Pharmingen, 556432) 1:200. Secondary: goat anti-rabbit Alexa-Fluor 488 (Invitrogen, A11034) 1:200, goat anti-rabbit Alexa-Fluor 488 (Invitrogen, A21206) 1:200, goat anti-mouse Alexa-Fluor 647 (Invitrogen, A32728) 1:200, goat anti-mouse IgG2a Alexa-Fluor 647 (Invitrogen, A21241) 1:200, goat anti-rabbit Alexa-Fluor 568 (Invitrogen, A11011) 1:200, and goat anti-mouse-IgG1 Alexa-Fluor 568 (Invitrogen, A21124) 1:200. Microinjection of cytochrome c All microinjections were performed according to a published protocol ( 39 ). Cells were treated with QVD-OPh for 30 min to 1 h prior to microinjections. The injection solution contained 10 mg/mL bovine cytochrome c (Sigma, C2037) in 100 mM KCl, 10 mM KPi and 4-8 mg/mL 3,000MW tetramethylrhodamine dextran (Invitrogen, D3308) solution. The control microinjection solution was identical but did not contain cytochrome c. Microinjections were performed using a Narishige micromanipulator and an Eppendorf Femtojet microinjector mounted on a Zeiss LSM 710 confocal microscope (see fluorescence microscopy section) using a 20x objective. Needles (Eppendorf femtotip, EP5242952008-20EA) were loaded with 1 - 2 μL microinjection solution. The medium was changed for fresh medium containing QVD-OPh when the microinjection process was completed. The cells were then imaged for at least 4 hours using a 63x objective. For the double microinjection experiment, the cells were imaged for about 10 h before the second microinjection round, which was identical to the first round except that the solution contained 0.125 mg/mL 10,000 MW Alexa Fluor 647 dextran (Life technology, D22914) instead of tetramethylrhodamine dextran. Quantification of cell death by flow cytometry HeLa cells stably expressing Apaf1-GFP were treated with ABT-737 and after 7 h, 10 h, 16 h, 24 h and 48 h, the culture medium was collected. Cells were scraped and collected with the medium. The cells were washed with FACS buffer (150 mM NaCl, 4 mM KCl, 2.5 mM CaCl 2 , 1 mM MgSO 4 , 15 mM HEPES pH 7.2, 2% FCS and 10 mM NaN 3 ) and incubated with Atto633-Annexin V for at least 20 min on ice in the dark. Cells were then washed in FACS buffer and resuspended in 200 μL FACS buffer. Propidium iodide (Sigma, 81845) was added to a final concentration of 2 μg/mL and cells examined by flow cytometry using a FACSLyric flow cytometer (BD Biosciences). For controls (negative: unstained, positive: stained with Atto633-Annexin V and propidium iodide), HeLa cells stably expressing Apaf1-GFP were treated with 1μM staurosporine for 2 hours to obtain a 1:1 population of apoptotic to healthy cells. For calibration of the FACS machine, staurosporine-induced cells were stained with Atto633-Annexin V or Propidium iodide. Correlative microscopy of resin-embedded cells Correlative microscopy of resin-embedded samples was performed as described before ( 30 , 33 ), with the following modifications: Cells were grown on carbon-coated 3 mm sapphire disks (Art. 500, Engineering Office M. Wohlwend, Switzerland). High pressure freezing was performed using a Leica HPM100. Freeze-substitution was done using 0.008% (w/v) uranyl acetate. The resin blocks were cut into 300 to 350 nm thick sections which were collected onto 200 mesh carbon-coated copper electron microscopy (EM) grids (Agar Scientific, Ltd. S160). As fiducial markers for correlation, 50 nm TetraSpeck microspheres (Invitrogen, custom order) were diluted 1:200 in PBS and adsorbed for 5 minutes to the sections. After fluorescence imaging, 15 nm colloidal gold beads (Agar Scientific, Ltd) were adsorbed to both sides of the grids. Electron tomography was done on a Tecnai F20 (FEI) operated at 200 kV using a high tilt tomography holder (Fischione, Model 2020). Data acquisition was done with SerialEM ( 68 ). 2D montages of regions of interest were acquired by transmission electron microscopy (TEM) at approximately 100-130 μm defocus and a pixel size of 1.1 nm. To determine areas of ET acquisition, the montages were correlated to the fluorescence images using TetraSpeck fiducials using MATLAB ( 30 ). In some cases, MitoTracker signals were used for correlation to anchor maps from tomogram acquisition. Dual axis tilt-series ( 69 ) were acquired from 60° to -60° with 1° increment in Scanning TEM (STEM) mode on an axial bright field detector ( 70 ), with a 50 μm C2 aperture at a pixel size of 1.1 nm over a 2048x2048 pixel image. Tomographic reconstructions were done using IMOD ( 71 , 72 ). 3D median filtering was applied for better visibility in the figure panels and movies. Vitrification of cells HeLa WT cells or HeLa cells stably expressing Apaf1-GFP were plated on 200 mesh gold EM grids with a holey carbon film R2/2 (Quantifoil). HeLa WT cells were transfected with Apaf1-SNAP-tag, labelled with SNAP-Cell 647-SiR. All cells were treated with ABT-737 and QVD-OPh for around 7 to 8 hours. Grids were vitrified using a manual plunger with a cryostat ( 73 ), and were manually backside-blotted for 12 to 15 seconds using filter paper (Whatman No.1). Cryo-fluorescence imaging of vitrified grids Vitrified cells on EM grids were screened for Apaf1 foci by cryo-fluorescence microscopy (cryo-FM) on a Leica EM Cryo CLEM (Leica Microsystems) equipped with a HCX PL APO 50x cryo-objective with NA = 0.9, a DFC9000 GT sCMOS camera (Leica Microsystems), and an EL 6000 light source (Leica Microsystems) in a humidity-controlled room. 1.5 x 1.5 mm montages of the grids were acquired in the green channel (L5 filter), far red channel (Y5 filter) and bright field channel. At grid squares of interest containing cells with Apaf1 foci, z-stacks were collected. To distinguish between autofluorescent specks in the green channel ( 74 ) and Apaf1-GFP signal, the grid squares were additionally imaged in the red channel (N21 filter). These cryo-FM images were used to identify grids with areas of interest for cryo-focused ion beam (FIB) milling. Cryo-focused ion beam milling Thin lamellae of HeLa cells expressing either Apaf1-GFP or Apaf1-SNAP-tag labelled with SNAP-Cell 647-SiR (referred to as SNAP647) were obtained by cryo-FIB milling in an Aquilos 2 Cryo-FIB (Thermo Fisher Scientific) equipped with an integrated fluorescence light microscope (iFLM). Grids were first sputter coated and subjected to GIS coating for 1 minute 30 seconds. Lamellae were prepared semi-automatically with eucentricity, milling angle, stress relief cuts ( 75 ), rough, medium and fine milling steps performed automatically using AutoTEM Cryo software (Thermo Fisher Scientific) followed by manual polishing to a target thickness of 200-250 nm. The milling steps with decreasing ion beam current and voltage were similar to those published before ( 33 , 76 , 77 ). After rough and fine milling, fluorescence z-stacks of the lamellae were acquired using the iFLM to assess presence of Apaf1 foci ( 78 , 79 ). For Apaf1-SNAP647, these z-stacks contained signals of interest and were correlated to overview cryo-EM maps of the lamellae to locate positions for cryo-ET acquisition, using either MATLAB scripts ( 30 ) or ec-CLEM ( 80 ). Apaf1-GFP signals were not detected after fine milling. However, the iFLM images were used as intermediates to correlate the position of the signal in the pre-milling cryo-FM images to the overview cryo-EM maps and thereby determine the position for cryo-ET. Cryo-electron tomography Cryo-ET data of cryo-FIB-milled cells was obtained on a Krios G4 C-FEG cryo-TEM operated at 300kV equipped with a Falcon 4 detector used in counting mode and a Selectris energy filter, using Tomography 5 Software (Thermo Fisher Scientific). Montage maps of lamellae were acquired at 100 μm defocus at a pixel size of 53.7 Å. These maps were correlated with iFLM images acquired during FIB-milling. At regions of interest, tilt series were acquired using a dose-symmetric tilt scheme ( 81 ) using groups of 4 between ±60° at 1° increment and a pixel size of 2.97 Å. A dose of approximately 1 e-/Å 2 was applied per tilt image. The target defocus was -5 μm. Tilt series were aligned using patch tacking and tomograms reconstructed by SIRT at bin 2 using IMOD ( 71 ). Median filtering was applied for better visibility in the figure panels and movies. Segmentation of the meshwork was done in IMOD ( 72 ) using the isosurface function on further median-filtered tomograms. Segmentation models were visualised using UCSF ChimeraX ( 82 ). Cryo-CLEM data set Using the pre-milling cryo-CLEM approach (Suppl. Fig. S4B), we targeted 4 Apaf1-GFP signals in vitreous cells, from which we obtained 3 tomograms that contained the meshwork identified as Apaf1 assembly, and 1 tomogram that did not contain the meshwork. The latter is likely due to the position of the lamella in z-direction not matching the z-position of the Apaf1-GFP signal of interest. Inaccurate correlation in z-direction is a disadvantage of pre-milling CLEM. Using the post-milling cryo-CLEM approach (Suppl. Fig. S4C), we targeted 9 Apaf1-SNAP647 signals on lamellae, from which we obtained 8 tomograms that contained the meshwork identified as Apaf1 foci, and 1 tomogram that did not contain the meshwork. In this one case, the overlay of the fluorescence image and the cryo-EM map of the lamella revealed an imprecise correlation of the MitoSpy Green signal to the mitochondria in the region of interest, indicating that this tomogram might have been mispositioned. Fluorescence image analysis Live cell imaging time points were extracted using the Fiji multi-point marker tool and its multi-point series option ( 83 , 84 ). To determine the image frames of foci appearance, disappearance, and cell death, we used the following criteria. 1) At least two frames should separate a disappearance from a new appearance event. 2) Occasionally, one or two foci remained visible despite all others having disappeared. In this case, the first frame in which all other foci had disappeared was considered the disappearance frame. 3) Cell death was assigned to the first frame in which a cell shrank, often followed by detachment. 4) When the timepoint of foci appearance or disappearance could not be unambiguously determined although it had clearly occurred, the event was included in the percentage analysis but not in the time point or lifetime analyses. For the percentage analysis, cells were counted using the Fiji multi-point marker tool and its multi-point series option ( 83 , 84 ). For cells dying over the course of imaging, the total number of cells was determined in the first image frame, while the number of cells that shrank (indicating death) was determined over the entire time of imaging. Since 16% of ABT-737 treated and 26% of ABT-737 and QVD-OPh treated cells divided during imaging, the percentage of cells that shrank and thus died is likely overestimated. For the analysis of the percentages of foci forming cells at different time points (shown in Fig. 2E ) only those four out of six live-imaging experiments analysed in Fig. 2B-D were considered in which more than 30% of cells imaged over the entire imaging session of 18 h showed foci. In the two experiments that were not considered, the percentage of cells with foci was very low at individual time points. Further quantitative analyses were done in R/Rstudio (R Core Team, 2021). Parametric unpaired statistical tests (simple t-test or Welch’s t-test, Brown-Forsythe and Welch Anova test) were used to calculate P values, depending on whether the standard deviation within the different groups was statistically different, as determined in GraphPad Prism. The P value threshold was 0.05 (95%). Superplots ( 85 ) were prepared in GraphPad Prism. Fluorescence intensity analysis The fluorescence intensities of Apaf1-expressing cells that shrank (indicating cell death) with or without foci (Suppl. Fig. S2F) were analysed using a custom-written python script. The frame prior to foci appearance, or, if no foci appeared, prior to cell shrinkage, was extracted, as well as the frames corresponding to 2 h before these events. The cells were masked and CellProfiler ( 86 ) was used to segment the cytosol based on the MitoTracker and Apaf1-GFP signals. The fluorescence intensity of the Apaf1-GFP signal was integrated per cell area based on masks and segmentation. The results were manually curated to remove poorly segmented cells. Analysis was done using GraphPad Prism. Authors contributions A.C.B., I.G., C.K., A.S., D.R.-K., L.W., J.S.R. carried out experiments and analysed data. T.K., T.L. and S.W.G.T. contributed to experiment planning and data analysis, and supervised parts of the work. W.K. supervised the project and analysed data. A.C.B. and W.K. conceived the study, planned experiments, and wrote the manuscript, with input from all authors. Acknowledgements We thank Leonardo Almeida-Souza for help with generating the stable Apaf1-GFP cell line, Anja Hagting for help with the microinjection experiments, as well as Antonina Andreeva and Alexey Murzin for help with designing mutant Apaf1. We are grateful to Georg Häcker, Madeline Lancaster and Harvey McMahon for sharing cell lines, cDNA and plasmids. We thank the electron and light microscopy facilities of the MRC-LMB as well as the Microscopy Imaging Center (MIC) of the University of Bern and the Dubochet Center for Imaging (DCI Bern) for microscope access and support with data collection. We thank the Flow Cytometry facility of the MRC-LMB for help with cell sorting. We thank Ori Avinoam for critical reading of the manuscript and members of the Kukulski group for helpful discussions. Work in the group of W.K. was supported by the Medical Research Council, as part of United Kingdom Research and Innovation (also known as UK Research and Innovation) under award MC_UP_1201/8, by the University of Bern, the NCCR TransCure a National Center of Competence in Research of the Swiss National Science Foundation (SNSF) (185544) and the SNSF project 201158. Work in the group of T.K. was supported by the SNSF project 201199. Work in the group of S.W.G.T. was supported by the Cancer Research UK (DRCNPG-Jun22\100011 and A20145). References 1. ↵ Green , D. R. A Matter of Life and Death . Cold Spring Harb Perspect Biol 14 , ( 2022 ). 2. ↵ Taylor , R. C. , Cullen , S. P. & Martin , S. J . Apoptosis: controlled demolition at the cellular level . Nat Rev Mol Cell Biol 9 , 231 – 241 , ( 2008 ). OpenUrl CrossRef PubMed Web of Science 3. ↵ Kluck , R. M. , Bossy-Wetzel , E. , Green , D. R. & Newmeyer , D. D . The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis . Science 275 , 1132 – 1136 , ( 1997 ). OpenUrl Abstract / FREE Full Text 4. ↵ Jurgensmeier , J. M. , Xie , Z. , Deveraux , Q. , Ellerby , L. , Bredesen , D. & Reed , J. C . Bax directly induces release of cytochrome c from isolated mitochondria . Proc Natl Acad Sci U S A 95 , 4997 – 5002 , ( 1998 ). OpenUrl Abstract / FREE Full Text 5. Antonsson , B. , Montessuit , S. , Lauper , S. , Eskes , R. & Martinou , J. C . Bax oligomerization is required for channel-forming activity in liposomes and to trigger cytochrome c release from mitochondria . Biochem J 345 Pt 2 , 271 – 278 , ( 2000 ). OpenUrl Abstract / FREE Full Text 6. Lovell , J. F. , Billen , L. P. , Bindner , S. , Shamas-Din , A. , Fradin , C. , Leber , B. & Andrews , D. W . Membrane binding by tBid initiates an ordered series of events culminating in membrane permeabilization by Bax . Cell 135 , 1074 – 1084 , ( 2008 ). OpenUrl CrossRef PubMed Web of Science 7. ↵ Czabotar , P. E. , Westphal , D. , Dewson , G. , Ma , S. , Hockings , C. , Fairlie , W. D. , Lee , E. F. , Yao , S. , Robin , A. Y. , Smith , B. J. , Huang , D. C. , Kluck , R. M. , Adams , J. M. & Colman , P. M . Bax crystal structures reveal how BH3 domains activate Bax and nucleate its oligomerization to induce apoptosis . Cell 152 , 519 – 531 , ( 2013 ). OpenUrl CrossRef PubMed Web of Science 8. ↵ Liu , X. , Kim , C. N. , Yang , J. , Jemmerson , R. & Wang , X . Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c . Cell 86 , 147 – 157 , ( 1996 ). OpenUrl CrossRef PubMed Web of Science 9. ↵ Zou , H. , Henzel , W. J. , Liu , X. , Lutschg , A. & Wang , X . Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3 . Cell 90 , 405 – 413 , ( 1997 ). OpenUrl CrossRef PubMed Web of Science 10. ↵ Zou , H. , Li , Y. , Liu , X. & Wang , X . An APAF-1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9 . J Biol Chem 274 , 11549 – 11556 , ( 1999 ). OpenUrl Abstract / FREE Full Text 11. Riedl , S. J. , Li , W. , Chao , Y. , Schwarzenbacher , R. & Shi , Y . Structure of the apoptotic protease-activating factor 1 bound to ADP . Nature 434 , 926 – 933 , ( 2005 ). OpenUrl CrossRef PubMed Web of Science 12. ↵ Reubold , T. F. , Wohlgemuth , S. & Eschenburg , S . Crystal structure of full-length Apaf-1: how the death signal is relayed in the mitochondrial pathway of apoptosis . Structure 19 , 1074 – 1083 , ( 2011 ). OpenUrl CrossRef PubMed 13. ↵ Srinivasula , S. M. , Ahmad , M. , Fernandes-Alnemri , T. & Alnemri , E. S . Autoactivation of procaspase-9 by Apaf-1-mediated oligomerization . Mol Cell 1 , 949 – 957 , ( 1998 ). OpenUrl CrossRef PubMed Web of Science 14. ↵ Yuan , S. , Yu , X. , Topf , M. , Ludtke , S. J. , Wang , X. & Akey , C. W . Structure of an apoptosome-procaspase-9 CARD complex . Structure 18 , 571 – 583 , ( 2010 ). OpenUrl CrossRef PubMed 15. ↵ Li , P. , Nijhawan , D. , Budihardjo , I. , Srinivasula , S. M. , Ahmad , M. , Alnemri , E. S. & Wang , X . Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade . Cell 91 , 479 – 489 , ( 1997 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ Rodriguez , J. & Lazebnik , Y . Caspase-9 and APAF-1 form an active holoenzyme . Genes Dev 13 , 3179 – 3184 , ( 1999 ). OpenUrl Abstract / FREE Full Text 17. ↵ Acehan , D. , Jiang , X. , Morgan , D. G. , Heuser , J. E. , Wang , X. & Akey , C. W . Three-dimensional structure of the apoptosome: implications for assembly, procaspase-9 binding, and activation . Mol Cell 9 , 423 – 432 , ( 2002 ). OpenUrl CrossRef PubMed Web of Science 18. ↵ Yu , X. , Acehan , D. , Menetret , J. F. , Booth , C. R. , Ludtke , S. J. , Riedl , S. J. , Shi , Y. , Wang , X. & Akey , C. W . A structure of the human apoptosome at 12.8 A resolution provides insights into this cell death platform . Structure 13 , 1725 – 1735 , ( 2005 ). OpenUrl CrossRef PubMed 19. ↵ Zhou , M. , Li , Y. , Hu , Q. , Bai , X. C. , Huang , W. , Yan , C. , Scheres , S. H. & Shi , Y . Atomic structure of the apoptosome: mechanism of cytochrome c- and dATP-mediated activation of Apaf-1 . Genes Dev 29 , 2349 – 2361 , ( 2015 ). OpenUrl Abstract / FREE Full Text 20. ↵ Renatus , M. , Stennicke , H. R. , Scott , F. L. , Liddington , R. C. & Salvesen , G. S . Dimer formation drives the activation of the cell death protease caspase 9 . Proc Natl Acad Sci U S A 98 , 14250 – 14255 , ( 2001 ). OpenUrl Abstract / FREE Full Text 21. ↵ Shiozaki , E. N. , Chai , J. & Shi , Y . Oligomerization and activation of caspase-9, induced by Apaf-1 CARD . Proc Natl Acad Sci U S A 99 , 4197 – 4202 , ( 2002 ). OpenUrl Abstract / FREE Full Text 22. Yuan , S. , Yu , X. , Asara , J. M. , Heuser , J. E. , Ludtke , S. J. & Akey , C. W . The holo-apoptosome: activation of procaspase-9 and interactions with caspase-3 . Structure 19 , 1084 – 1096 , ( 2011 ). OpenUrl CrossRef PubMed 23. ↵ Cheng , T. C. , Hong , C. , Akey , I. V. , Yuan , S. & Akey , C. W . A near atomic structure of the active human apoptosome . Elife 5 , ( 2016 ). 24. ↵ Li , Y. , Zhou , M. , Hu , Q. , Bai , X. C. , Huang , W. , Scheres , S. H. & Shi , Y . Mechanistic insights into caspase-9 activation by the structure of the apoptosome holoenzyme . Proc Natl Acad Sci U S A 114 , 1542 – 1547 , ( 2017 ). OpenUrl Abstract / FREE Full Text 25. ↵ van Delft , M. F. , Wei , A. H. , Mason , K. D. , Vandenberg , C. J. , Chen , L. , Czabotar , P. E. , Willis , S. N. , Scott , C. L. , Day , C. L. , Cory , S. , Adams , J. M. , Roberts , A. W. & Huang , D. C . The BH3 mimetic ABT-737 targets selective Bcl-2 proteins and efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized . Cancer Cell 10 , 389 – 399 , ( 2006 ). OpenUrl CrossRef PubMed Web of Science 26. ↵ Hausmann , G. , O’Reilly , L. A. , van Driel , R. , Beaumont , J. G. , Strasser , A. , Adams , J. M. & Huang , D. C . Pro-apoptotic apoptosis protease-activating factor 1 (Apaf-1) has a cytoplasmic localization distinct from Bcl-2 or Bcl-x(L) . J Cell Biol 149 , 623 – 634 , ( 2000 ). OpenUrl Abstract / FREE Full Text 27. ↵ Potokar , M. , Kreft , M. , Chowdhury , H. H. , Vardjan , N. & Zorec , R . Subcellular localization of Apaf-1 in apoptotic rat pituitary cells . Am J Physiol Cell Physiol 290 , C672 – 677 , ( 2006 ). OpenUrl CrossRef PubMed 28. ↵ Martinou , J. C. & Youle , R. J . Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics . Dev Cell 21 , 92 – 101 , ( 2011 ). OpenUrl CrossRef PubMed Web of Science 29. ↵ Caserta , T. M. , Smith , A. N. , Gultice , A. D. , Reedy , M. A. & Brown , T. L . Q-VD-OPh, a broad spectrum caspase inhibitor with potent antiapoptotic properties . Apoptosis 8 , 345 – 352 , ( 2003 ). OpenUrl CrossRef PubMed Web of Science 30. ↵ Kukulski , W. , Schorb , M. , Welsch , S. , Picco , A. , Kaksonen , M. & Briggs , J. A . Correlated fluorescence and 3D electron microscopy with high sensitivity and spatial precision . J Cell Biol 192 , 111 – 119 , ( 2011 ). OpenUrl Abstract / FREE Full Text 31. ↵ Dubochet , J. & Sartori Blanc , N . The cell in absence of aggregation artifacts . Micron 32 , 91 – 99 , ( 2001 ). OpenUrl CrossRef PubMed Web of Science 32. ↵ Beck , M. & Baumeister , W . Cryo-Electron Tomography: Can it Reveal the Molecular Sociology of Cells in Atomic Detail? Trends Cell Biol 26 , 825 – 837 , ( 2016 ). OpenUrl CrossRef PubMed 33. ↵ Ader , N. R. , Hoffmann , P. C. , Ganeva , I. , Borgeaud , A. C. , Wang , C. , Youle , R. J. & Kukulski , W . Molecular and topological reorganizations in mitochondrial architecture interplay during Bax-mediated steps of apoptosis . Elife 8 , e40712 , ( 2019 ). OpenUrl CrossRef 34. ↵ Wozny , M. R. , Di Luca , A. , Morado , D. R. , Picco , A. , Khaddaj , R. , Campomanes , P. , Ivanovic , L. , Hoffmann , P. C. , Miller , E. A. , Vanni , S. & Kukulski , W . In situ architecture of the ER-mitochondria encounter structure . Nature 618 , 188 – 192 , ( 2023 ). OpenUrl 35. ↵ Wang , C. & Youle , R. J . Predominant requirement of Bax for apoptosis in HCT116 cells is determined by Mcl-1’s inhibitory effect on Bak . Oncogene 31 , 3177 – 3189 , ( 2012 ). OpenUrl CrossRef PubMed 36. ↵ Nechushtan , A. , Smith , C. L. , Lamensdorf , I. , Yoon , S. H. & Youle , R. J . Bax and Bak coalesce into novel mitochondria-associated clusters during apoptosis . J Cell Biol 153 , 1265 – 1276 , ( 2001 ). OpenUrl Abstract / FREE Full Text 37. ↵ Pastorino , J. G. , Chen , S. T. , Tafani , M. , Snyder , J. W. & Farber , J. L . The overexpression of Bax produces cell death upon induction of the mitochondrial permeability transition . J Biol Chem 273 , 7770 – 7775 , ( 1998 ). OpenUrl Abstract / FREE Full Text 38. ↵ Brustugun , O. T. , Fladmark , K. E. , Doskeland , S. O. , Orrenius , S. & Zhivotovsky , B . Apoptosis induced by microinjection of cytochrome c is caspase-dependent and is inhibited by Bcl-2 . Cell Death Differ 5 , 660 – 668 , ( 1998 ). OpenUrl CrossRef PubMed Web of Science 39. ↵ Kole , A. J. , Knight , E. R. & Deshmukh , M . Activation of apoptosis by cytoplasmic microinjection of cytochrome c . J Vis Exp , ( 2011 ). 40. ↵ Cheng , T. C. , Akey , I. V. , Yuan , S. , Yu , Z. , Ludtke , S. J. & Akey , C. W . A Near-Atomic Structure of the Dark Apoptosome Provides Insight into Assembly and Activation . Structure 25 , 40 – 52 , ( 2017 ). OpenUrl CrossRef 41. ↵ Hill , M. M. , Adrain , C. , Duriez , P. J. , Creagh , E. M. & Martin , S. J . Analysis of the composition, assembly kinetics and activity of native Apaf-1 apoptosomes . EMBO J 23 , 2134 – 2145 , ( 2004 ). OpenUrl Abstract / FREE Full Text 42. ↵ Hu , Y. , Ding , L. , Spencer , D. M. & Nunez , G . WD-40 repeat region regulates Apaf-1 self-association and procaspase-9 activation . J Biol Chem 273 , 33489 – 33494 , ( 1998 ). OpenUrl Abstract / FREE Full Text 43. ↵ Hu , Y. , Benedict , M. A. , Ding , L. & Nunez , G . Role of cytochrome c and dATP/ATP hydrolysis in Apaf-1-mediated caspase-9 activation and apoptosis . EMBO J 18 , 3586 – 3595 , ( 1999 ). OpenUrl Abstract / FREE Full Text 44. ↵ Saleh , A. , Srinivasula , S. M. , Acharya , S. , Fishel , R. & Alnemri , E. S . Cytochrome c and dATP-mediated oligomerization of Apaf-1 is a prerequisite for procaspase-9 activation . J Biol Chem 274 , 17941 – 17945 , ( 1999 ). OpenUrl Abstract / FREE Full Text 45. ↵ Adrain , C. , Slee , E. A. , Harte , M. T. & Martin , S. J . Regulation of apoptotic protease activating factor-1 oligomerization and apoptosis by the WD-40 repeat region . J Biol Chem 274 , 20855 – 20860 , ( 1999 ). OpenUrl Abstract / FREE Full Text 46. ↵ Benedict , M. A. , Hu , Y. , Inohara , N. & Nunez , G . Expression and functional analysis of Apaf-1 isoforms. Extra Wd-40 repeat is required for cytochrome c binding and regulated activation of procaspase-9 . J Biol Chem 275 , 8461 – 8468 , ( 2000 ). OpenUrl Abstract / FREE Full Text 47. ↵ Gradzka-Boberda , S. , Gentle , I. E. & Hacker , G . Pattern Recognition Receptors of Nucleic Acids Can Cause Sublethal Activation of the Mitochondrial Apoptosis Pathway during Viral Infection . J Virol 96 , e0121222 , ( 2022 ). OpenUrl 48. ↵ Slee , E. A. , Harte , M. T. , Kluck , R. M. , Wolf , B. B. , Casiano , C. A. , Newmeyer , D. D. , Wang , H. G. , Reed , J. C. , Nicholson , D. W. , Alnemri , E. S. , Green , D. R. & Martin , S. J . Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and - 10 in a caspase-9-dependent manner . J Cell Biol 144 , 281 – 292 , ( 1999 ). OpenUrl Abstract / FREE Full Text 49. ↵ Riedl , S. J. & Salvesen , G. S . The apoptosome: signalling platform of cell death . Nat Rev Mol Cell Biol 8 , 405 – 413 , ( 2007 ). OpenUrl CrossRef PubMed Web of Science 50. ↵ Musacchio , A . On the role of phase separation in the biogenesis of membraneless compartments . EMBO J 41 , e109952 , ( 2022 ). OpenUrl CrossRef 51. ↵ Boatright , K. M. , Renatus , M. , Scott , F. L. , Sperandio , S. , Shin , H. , Pedersen , I. M. , Ricci , J. E. , Edris , W. A. , Sutherlin , D. P. , Green , D. R. & Salvesen , G. S . A unified model for apical caspase activation . Mol Cell 11 , 529 – 541 , ( 2003 ). OpenUrl CrossRef PubMed Web of Science 52. Salvesen , G. S. & Dixit , V. M . Caspase activation: the induced-proximity model . Proc Natl Acad Sci U S A 96 , 10964 – 10967 , ( 1999 ). OpenUrl Abstract / FREE Full Text 53. ↵ Shi , Y . Caspase activation: revisiting the induced proximity model . Cell 117 , 855 – 858 , ( 2004 ). OpenUrl CrossRef PubMed Web of Science 54. ↵ Chao , Y. , Shiozaki , E. N. , Srinivasula , S. M. , Rigotti , D. J. , Fairman , R. & Shi , Y . Engineering a dimeric caspase-9: a re-evaluation of the induced proximity model for caspase activation . PLoS Biol 3 , e183 , ( 2005 ). OpenUrl CrossRef PubMed 55. ↵ Yin , Q. , Park , H. H. , Chung , J. Y. , Lin , S. C. , Lo , Y. C. , da Graca , L. S. , Jiang , X. & Wu , H . Caspase-9 holoenzyme is a specific and optimal procaspase-3 processing machine . Mol Cell 22 , 259 – 268 , ( 2006 ). OpenUrl CrossRef PubMed Web of Science 56. ↵ Liu , Y. , Zhai , H. , Alemayehu , H. , Boulanger , J. , Hopkins , L. J. , Borgeaud , A. C. , Heroven , C. , Howe , J. D. , Leigh , K. E. , Bryant , C. E. & Modis , Y . Cryo-electron tomography of NLRP3-activated ASC complexes reveals organelle co-localization . Nat Commun 14 , 7246 , ( 2023 ). OpenUrl 57. Stehlik , C. , Lee , S. H. , Dorfleutner , A. , Stassinopoulos , A. , Sagara , J. & Reed , J. C . Apoptosis-associated speck-like protein containing a caspase recruitment domain is a regulator of procaspase-1 activation . J Immunol 171 , 6154 – 6163 , ( 2003 ). OpenUrl Abstract / FREE Full Text 58. ↵ Proell , M. , Gerlic , M. , Mace , P. D. , Reed , J. C. & Riedl , S. J . The CARD plays a critical role in ASC foci formation and inflammasome signalling . Biochem J 449 , 613 – 621 , ( 2013 ). OpenUrl Abstract / FREE Full Text 59. ↵ Wang , L. , Yang , J. K. , Kabaleeswaran , V. , Rice , A. J. , Cruz , A. C. , Park , A. Y. , Yin , Q. , Damko , E. , Jang , S. B. , Raunser , S. , Robinson , C. V. , Siegel , R. M. , Walz , T. & Wu , H . The Fas-FADD death domain complex structure reveals the basis of DISC assembly and disease mutations . Nat Struct Mol Biol 17 , 1324 – 1329 , ( 2010 ). OpenUrl CrossRef PubMed 60. Dickens , L. S. , Boyd , R. S. , Jukes-Jones , R. , Hughes , M. A. , Robinson , G. L. , Fairall , L. , Schwabe , J. W. , Cain , K. & Macfarlane , M . A death effector domain chain DISC model reveals a crucial role for caspase-8 chain assembly in mediating apoptotic cell death . Mol Cell 47 , 291 – 305 , ( 2012 ). OpenUrl CrossRef PubMed Web of Science 61. ↵ Fu , T. M. , Li , Y. , Lu , A. , Li , Z. , Vajjhala , P. R. , Cruz , A. C. , Srivastava , D. B. , DiMaio , F. , Penczek , P. A. , Siegel , R. M. , Stacey , K. J. , Egelman , E. H. & Wu , H . Cryo-EM Structure of Caspase-8 Tandem DED Filament Reveals Assembly and Regulation Mechanisms of the Death-Inducing Signaling Complex . Mol Cell 64 , 236 – 250 , ( 2016 ). OpenUrl CrossRef PubMed 62. ↵ Killarney , S. T. , Tait , S. W. G. , Green , D. R. & Wood , K. C . Sublethal engagement of apoptotic pathways in residual cancer . Trends Cell Biol 34 , 225 – 238 , ( 2024 ). OpenUrl 63. ↵ Ichim , G. , Lopez , J. , Ahmed , S. U. , Muthalagu , N. , Giampazolias , E. , Delgado , M. E. , Haller , M. , Riley , J. S. , Mason , S. M. , Athineos , D. , Parsons , M. J. , van de Kooij , B. , Bouchier-Hayes , L. , Chalmers , A. J. , Rooswinkel , R. W. , Oberst , A. , Blyth , K. , Rehm , M. , Murphy , D. J. & Tait , S. W. G . Limited mitochondrial permeabilization causes DNA damage and genomic instability in the absence of cell death . Mol Cell 57 , 860 – 872 , ( 2015 ). OpenUrl CrossRef PubMed 64. ↵ Malladi , S. , Challa-Malladi , M. , Fearnhead , H. O. & Bratton , S. B . The Apaf-1*procaspase-9 apoptosome complex functions as a proteolytic-based molecular timer . EMBO J 28 , 1916 – 1925 , ( 2009 ). OpenUrl Abstract / FREE Full Text 65. ↵ Jin , S. M. & Youle , R. J . The accumulation of misfolded proteins in the mitochondrial matrix is sensed by PINK1 to induce PARK2/Parkin-mediated mitophagy of polarized mitochondria . Autophagy 9 , 1750 – 1757 , ( 2013 ). OpenUrl CrossRef PubMed 66. ↵ Lopez , J. , Bessou , M. , Riley , J. S. , Giampazolias , E. , Todt , F. , Rochegue , T. , Oberst , A. , Green , D. R. , Edlich , F. , Ichim , G. & Tait , S. W . Mito-priming as a method to engineer Bcl-2 addiction . Nat Commun 7 , 10538 , ( 2016 ). 67. ↵ Stewart , S. A. , Dykxhoorn , D. M. , Palliser , D. , Mizuno , H. , Yu , E. Y. , An , D. S. , Sabatini , D. M. , Chen , I. S. , Hahn , W. C. , Sharp , P. A. , Weinberg , R. A. & Novina , C. D . Lentivirus-delivered stable gene silencing by RNAi in primary cells . RNA 9 , 493 – 501 , ( 2003 ). OpenUrl Abstract / FREE Full Text 68. ↵ Mastronarde , D. N . Automated electron microscope tomography using robust prediction of specimen movements . J Struct Biol 152 , 36 – 51 , ( 2005 ). OpenUrl CrossRef PubMed Web of Science 69. ↵ Mastronarde , D. N . Dual-axis tomography: an approach with alignment methods that preserve resolution . J Struct Biol 120 , 343 – 352 , ( 1997 ). OpenUrl CrossRef PubMed Web of Science 70. ↵ Hohmann-Marriott , M. F. , Sousa , A. A. , Azari , A. A. , Glushakova , S. , Zhang , G. , Zimmerberg , J. & Leapman , R. D . Nanoscale 3D cellular imaging by axial scanning transmission electron tomography . Nat Methods 6 , 729 – 731 , ( 2009 ). OpenUrl CrossRef PubMed Web of Science 71. ↵ Mastronarde , D. N. & Held , S. R . Automated tilt series alignment and tomographic reconstruction in IMOD . J Struct Biol 197 , 102 – 113 , ( 2017 ). OpenUrl CrossRef PubMed 72. ↵ Kremer , J. R. , Mastronarde , D. N. & McIntosh , J. R . Computer visualization of three-dimensional image data using IMOD . J. Struct. Biol . 116 , 71 – 76 , ( 1996 ). OpenUrl CrossRef PubMed Web of Science 73. ↵ Russo , C. J. , Scotcher , S. & Kyte , M . A precision cryostat design for manual and semi-automated cryo-plunge instruments . Rev Sci Instrum 87 , 114302 , ( 2016 ). 74. ↵ Carter , S. D. , Mageswaran , S. K. , Farino , Z. J. , Mamede , J. I. , Oikonomou , C. M. , Hope , T. J. , Freyberg , Z. & Jensen , G. J . Distinguishing signal from autofluorescence in cryogenic correlated light and electron microscopy of mammalian cells . J Struct Biol 201 , 15 – 25 , ( 2018 ). OpenUrl CrossRef 75. ↵ Wolff , G. , Limpens , R. , Zheng , S. , Snijder , E. J. , Agard , D. A. , Koster , A. J. & Barcena , M . Mind the gap: Micro-expansion joints drastically decrease the bending of FIB-milled cryo-lamellae . J Struct Biol 208 , 107389 , ( 2019 ). 76. ↵ Schaffer , M. , Engel , B. D. , Laugks , T. , Mahamid , J. , Plitzko , J. M. & Baumeister , W . Cryo-focused Ion Beam Sample Preparation for Imaging Vitreous Cells by Cryo-electron Tomography . Bio Protoc 5 , ( 2015 ). 77. ↵ Ganeva , I. , Lim , K. , Boulanger , J. , Hoffmann , P. C. , Muriel , O. , Borgeaud , A. C. , Hagen , W. J. H. , Savage , D. B. & Kukulski , W . The architecture of Cidec-mediated interfaces between lipid droplets . Cell Rep 42 , 112107 , ( 2023 ). 78. ↵ Bieber , A. , Capitanio , C. , Erdmann , P. S. , Fiedler , F. , Beck , F. , Lee , C. W. , Li , D. , Hummer , G. , Schulman , B. A. , Baumeister , W. & Wilfling , F . In situ structural analysis reveals membrane shape transitions during autophagosome formation . Proc Natl Acad Sci U S A 119 , e2209823119 , ( 2022 ). OpenUrl 79. ↵ Yang , J. , Vrbovska , V. , Franke , T. , Sibert , B. , Larson , M. , Coomes , T. , Rigort , A. , Mitchels , J. & Wright , E. R . Precise 3D Localization by Integrated Fluorescence Microscopy (iFLM) for Cryo-FIB-milling and In-situ Cryo-ET . Microsc Microanal 29 , 1055 – 1057 , ( 2023 ). OpenUrl 80. ↵ Paul-Gilloteaux , P. , Heiligenstein , X. , Belle , M. , Domart , M. C. , Larijani , B. , Collinson , L. , Raposo , G. & Salamero , J . eC-CLEM: flexible multidimensional registration software for correlative microscopies . Nat Methods 14 , 102 – 103 , ( 2017 ). OpenUrl CrossRef PubMed 81. ↵ Hagen , W. J. , Wan , W. & Briggs , J. A . Implementation of a cryo-electron tomography tilt-scheme optimized for high resolution subtomogram averaging . J Struct Biol 197 , 191 – 198 , ( 2017 ). OpenUrl CrossRef 82. ↵ Meng , E. C. , Goddard , T. D. , Pettersen , E. F. , Couch , G. S. , Pearson , Z. J. , Morris , J. H. & Ferrin , T. E . UCSF ChimeraX: Tools for structure building and analysis . Protein Sci 32 , e4792 , ( 2023 ). OpenUrl CrossRef 83. ↵ Schindelin , J. , Arganda-Carreras , I. , Frise , E. , Kaynig , V. , Longair , M. , Pietzsch , T. , Preibisch , S. , Rueden , C. , Saalfeld , S. , Schmid , B. , Tinevez , J. Y. , White , D. J. , Hartenstein , V. , Eliceiri , K. , Tomancak , P. & Cardona , A. Fiji: an open-source platform for biological-image analysis . Nat Methods 9 , 676 – 682 , ( 2012 ). OpenUrl CrossRef PubMed Web of Science 84. ↵ Schindelin , J. , Rueden , C. T. , Hiner , M. C. & Eliceiri , K. W . The ImageJ ecosystem: An open platform for biomedical image analysis . Mol Reprod Dev 82 , 518 – 529 , ( 2015 ). OpenUrl CrossRef PubMed 85. ↵ Lord , S. J. , Velle , K. B. , Mullins , R. D. & Fritz-Laylin , L. K . SuperPlots: Communicating reproducibility and variability in cell biology . J Cell Biol 219 , ( 2020 ). 86. ↵ Stirling , D. R. , Swain-Bowden , M. J. , Lucas , A. M. , Carpenter , A. E. , Cimini , B. A. & Goodman , A . CellProfiler 4: improvements in speed, utility and usability . BMC Bioinformatics 22 , 433 , ( 2021 ). OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted July 03, 2024. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Large transient assemblies of Apaf1 constitute the apoptosome in cells Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Large transient assemblies of Apaf1 constitute the apoptosome in cells Alicia C. Borgeaud , Iva Ganeva , Calvin Klein , Amandine Stooss , Daniela Ross-Kaschitza , Liyang Wu , Joel S. Riley , Stephen W.G. Tait , Thomas Lemmin , Thomas Kaufmann , Wanda Kukulski bioRxiv 2024.07.01.600688; doi: https://doi.org/10.1101/2024.07.01.600688 Share This Article: Copy Citation Tools Large transient assemblies of Apaf1 constitute the apoptosome in cells Alicia C. Borgeaud , Iva Ganeva , Calvin Klein , Amandine Stooss , Daniela Ross-Kaschitza , Liyang Wu , Joel S. Riley , Stephen W.G. Tait , Thomas Lemmin , Thomas Kaufmann , Wanda Kukulski bioRxiv 2024.07.01.600688; doi: https://doi.org/10.1101/2024.07.01.600688 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7651) Biochemistry (17746) Bioengineering (13928) Bioinformatics (42066) Biophysics (21499) Cancer Biology (18650) Cell Biology (25579) Clinical Trials (138) Developmental Biology (13409) Ecology (19947) Epidemiology (2067) Evolutionary Biology (24374) Genetics (15633) Genomics (22557) Immunology (17775) Microbiology (40505) Molecular Biology (17217) Neuroscience (88796) Paleontology (667) Pathology (2845) Pharmacology and Toxicology (4836) Physiology (7664) Plant Biology (15179) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9839) Zoology (2272)