Histological and genetic changes induced by extracorporeal shockwave therapy after rotator cuff repair in a rat model with tears | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Histological and genetic changes induced by extracorporeal shockwave therapy after rotator cuff repair in a rat model with tears Masataka Kamiyama, Hitoshi Shitara, Tsuyoshi Ichinose, Tsuyoshi Sasaki, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4603175/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted 14 You are reading this latest preprint version Abstract The histological and genetic changes associated with significant tendon-to-bone differences after extracorporeal shockwave therapy (ESWT) are unknown. This controlled laboratory study investigated the histological and genetic changes in the rotator cuff induced by ESWT. Twenty-two retired male Wistar rats were induced with left supraspinatus tendon ruptures. Three weeks later, rotator cuff repair was performed. One week post-repair, the rats were randomly assigned into either the ESWT or control group, with 11 rats in each group. Compared with the control group, the ratio of cellularity was significantly lower, and that of collagen fiber orientation was significantly higher in the ESWT group. The number of blood vessels and the total histological scores were not significantly different between the two groups. Real-time polymerase chain reaction analysis revealed that the mRNA expressions of CCN2 and SCX were significantly higher in the ESWT group than in the control group. No statistically significant differences were found between the SOX9 and Tnmd expressions. ESWT induces histological changes and increases the messenger RNA expressions of CCN2 and SCX in rotator cuff repair of chronic tears in rats. ESWT is a potential method for promoting histological and cytological changes associated with improving the mechanical strength of rotator cuff repair. Health sciences/Anatomy/Musculoskeletal system/Cartilage Health sciences/Anatomy/Musculoskeletal system/Ligaments Health sciences/Anatomy/Musculoskeletal system/Tendons extracorporeal shockwave therapy rotator cuff tear tendon-to-bone CCN2 SCX Figures Figure 1 Figure 2 Figure 3 Introduction Arthroscopic rotator cuff repair is a widely used surgical treatment for rotator cuff tears. Although its clinical outcomes have improved with advancements in technology and instrumentation, numerous studies have reported postoperative retear rates ranging from 20–94% [ 1 – 3 ]. Retears lead to poor clinical outcomes and decreased quality of life [ 4 – 6 ]. Given that inadequate tendon-to-bone healing is a primary cause of retears, several studies have investigated the efficacy of adjunctive therapies aimed at facilitating biological tendon-to-bone healing [ 7 – 9 ]. Adjunctive therapies to reduce retear after surgery for rotator cuff tears include recombinant human parathyroid hormone (rh-PTH), platelet-rich plasma (PRP), stem cell autografts, and extracorporeal shockwave therapy (ESWT). rh-PTH therapy has been shown to reduce retear rates [ 10 ]. However, its clinical application is limited because it is primarily a treatment for osteoporosis. In addition, several studies have reported adverse effects of rh-PTH, including vomiting, hypertension, dizziness, and allergic reactions [ 10 – 13 ]. PRP therapy has also been reported to reduce the retear rate. However, its efficacy is controversial, and the associated costs are high [ 14 – 16 ]. Stem cell therapy, while reported to promote tendon attachment regeneration in rats, has led to the discontinuation of some human randomized controlled trials due to adverse events such as supraclavicular cyst formation and the development of subacromial inflammatory tissue, rendering its safety questionable [ 9 , 17 ]. Compared with treatments, such as rh-PTH, PRP, and stem cell autograft, ESWT is associated with fewer adverse effects and lower costs [ 18 , 19 ]. ESWT delivers shock waves, generated externally, to the targeted area in the body. Since the 1980s, it has been used in treating urolithiasis [ 20 , 21 ]. Recently, its effectiveness has been recognized in the field of orthopedics, where it is now used to treat conditions such as plantar fasciitis and lateral epicondylitis, among others [ 22 – 24 ]. Animal studies have shown that ESWT promotes meniscus healing and improves knee joint contractures [ 25 , 26 ]. Feichtinger et al. revealed that ESWT significantly improves the load-to-failure results in rats after rotator cuff tear repair. Moreover, they found that ESWT does not affect bone microstructure [ 27 , 28 ]. In their examination of gene expressions, specifically CXCL12 (C-X-C motif chemokine 12), TGF-β1 and TGF-β3 (transforming growth factor beta 1 and 3), and VEGFR2 (vascular endothelial growth factor receptor 2), Feichtinger et al. found no significant differences [ 27 , 28 ]. However, histological changes in structures other than bone microstructure, and the specifics of gene expression alteration by ESWT, remain to be elucidated. Recently, cellular communication network factor 2 ( CCN2 )/connective tissue growth factor has been shown to promote tenogenesis in cultured mesenchymal stromal cells and endogenous tendon stem cells [ 29 – 31 ]. SRY-box containing gene 9 ( SOX9 ), scleraxis ( SCX ), and tenomodulin ( Tnmd ) are recognized as tendon-related markers. SOX9 , an SRY-related transcription factor, contains a high-mobility group box DNA-binding domain. SCX , a basic helix-loop-helix transcription factor, is persistently expressed in tendons and ligaments. SOX9 and SCX regulate the formation of cartilage and tendon [ 32 ]. As a type II transmembrane protein, Tnmd is specifically expressed in hypovascular structures such as tendons and ligaments. The messenger (mRNA) expression of Tnmd is positively regulated by SCX [ 33 , 34 ]. This study aimed to investigate histological and genetic changes in the rotator cuff induced by ESWT irradiation. For histological evaluation, we assessed the histological appearance and maturation using three parameters: cellularity, vascularity, and collagen fiber orientation. For genetic evaluation, we investigated the mRNA expressions of CCN2 , SOX9 , SCX , and Tnmd . We hypothesized that ESWT would promote histological tendon-to-bone healing and induce changes in the expressions of these genes. Methods Animals This study was performed in accordance with the Guidelines by the NIH Office of Laboratory Animal Welfare regarding the care and use of animals for experimental procedures, and following the recommendations stated in the ARRIVE guidelines ( https://arriveguidelines.org/ ). This study was approved by the Animal Care and Experimentation Committee at our institution (approval number: 19–045). All efforts were made to minimize the number of animals used and their suffering. Male Wistar rats (mean ± SD body weight, 450.9 ± 11.1 g) were purchased from SLC Japan. All rats were housed at the Biological Resource Center of our institution under a controlled temperature (24°C) with a light/dark cycle and fed a standard commercial diet with ad libitum access to tap water. Study design We selected a chronic rotator cuff tear model, as previously reported [ 35 , 36 ]. In this model, the supraspinatus (SSP) tendon of the left shoulder was completely detached from its insertion site and surgically repaired 3 weeks later. In this study, 22 rats were randomly assigned to either the ESWT or control group, with 11 rats in each group. On the basis of a previous study [ 26 ], 1 week after surgical repair, the ESWT group received ESWT and the control group received sham stimulation. The rats were euthanized 4 weeks after the ESWT or sham stimulation via intraperitoneal injection of 150 mg/kg pentobarbital sodium. Six specimens per group were used for histological evaluation, and five specimens per group were used for gene expression evaluation using real-time polymerase chain reaction (RT-PCR) (Fig. 1 ). Randomization A computer-generated random number table was created using the RAND function in Excel (Microsoft, Washington, USA). Rats were assigned anonymous identification numbers and randomly allocated to either the ESWT or control group in a 1:1 ratio. This randomization was performed by using the generated random number table. Surgical procedure Surgery was performed as described in previous studies [ 35 , 36 ]. After inducing general anesthesia via intraperitoneal injection with ketamine (60 mg/kg) and xylazine (12 mg/kg), an incision was made in the anterolateral aspect of the left shoulder, and a deltoid muscle split was performed. After surgical exposure of the SSP tendon, it was then sharply detached from its insertion area. The end of the SSP tendon was marked with a nylon 5 − 0 suture (Natsume Seisakusho Co., Ltd., Tokyo, Japan), and the skin incision was closed using the same suture type. Three weeks after the primary surgery, tendon repair was performed. After general anesthesia, the torn tendons were exposed as in the primary surgery. The scar tissue in the insertion area was gently debrided, and the fibrocartilaginous layer between the tendon and bone was removed using a scalpel. A bone tunnel was drilled in an anteroposterior direction close to the greater tuberosity. The torn tendon was re-attached to the insertion area using a modified Mason-Allen nylon 5 − 0 suture (Natsume Seisakusho Co., Ltd.) that passed through the bone tunnel. Skin closure was performed as in the primary surgery. All rats were allowed unrestricted movement around their cages after both surgeries. ESWT protocol ESWT or sham stimulation was performed under general anesthesia. On the basis of a previous study [ 26 ], the ESWT group received 800 impulses of shockwave with an energy flux density of 0.22 mJ/mm 2 and a frequency of 3 Hz in a single session at 1 week after surgical repair (ARIES Vet; Dornier MedTech, Wessling, Germany). The ESWT probe was applied to the skin directly above the insertion site. In the control group, the probe was applied to the same area for the same amount of time, but no shockwaves were emitted. Histological evaluation The bilateral SSP and humeral heads were carefully removed 4 weeks after ESWT for histological evaluation. The specimens were fixed in 10% paraformaldehyde for 24 h, degreased in 90% ethanol for 48 h, decalcified in K-CX (FALMA, Tokyo, Japan) for 24 h, and embedded in an optimal cutting temperature compound (Sakura Finetek Japan Co., Ltd., Tokyo, Japan). Hematoxylin and eosin (HE)- and Picrosirius red-stained sections (4 µm) were prepared. The sections were viewed under a Keyence BZ-9000 fluorescence microscope (Keyence, Osaka, Japan). We assessed the histological appearance and maturation using a histological scoring system, focusing on three parameters: cellularity, vascularity, and collagen fiber orientation. This assessment was conducted with computerized image analysis using ImageJ software (National Institutes of Health, Bethesda, MD, USA), as previously described by Tokunaga et al. (Table 1 ) [ 37 – 39 ]. We obtained three sequential sections from each specimen for each staining method and calculated the average result for analysis. In summary, each segment was assessed by two colleagues (M.K. and T.I.), who were blinded to the group allocations. We evaluated cellularity and collagen fiber orientation by comparing the percentages of values measured in six intact right shoulders. For cellularity, we selected a region of interest (200 × 200 µm) at the insertion site (100–400 mm proximal to the bone surface) on HE-stained sections. Cell nuclei were counted to determine the number of cells per square millimeter. For vascularity, we counted all blood vessels at the insertion site using HE-stained sections and observed them under 100-fold magnification. For collagen fiber orientation, we randomly selected 10 areas (100 × 100 µm) at the insertion site, examining them under 12.5-fold magnification. Grayscale values were measured using ImageJ on an 8-bit grayscale image (black = 0, white = 255) obtained from Picrosirius red-stained sections captured using a polarizing microscope. Increased brightness indicates collagen fibers organized in a more parallel nature. The interobserver intraclass correlation coefficient for the total score was 0.81, and the intraobserver intraclass correlation coefficient was 0.77. Table 1 Histological scoring system Parameters Score 1 2 3 4 Cellularity, % a > 400 300 to 400 200 to < 300 15 10 to 15 6 to < 10 < 6 Collagen fiber orientation, % c 50 to 75 > 75 a Number of cells per region of interest from each section. Percentages represent relative values compared with those from non-operative tendon-to-bone sections (n = 6), which were set at 100%. b Number of blood vessels per low-power field (100-fold magnification) in each section. c Grayscale per region of interest from each section as measured using ImageJ. Percentages represent relative values compared with those from non-operative tendon-to-bone sections (n = 6), which were set at 100%. Gene expression For RT-PCR, the bilateral tendon-to-bone tissues were resected 4 weeks after ESWT. A Minilys homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France) and a Precellys lysing kit (Bertin Technologies) were used to crush the tendon-to-bone tissues (3200 rpm, 5 cycles of 30 s). Total RNA (500 ng) was isolated from the tendon-to-bone tissues using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Subsequently, cDNA was synthesized from the isolated total RNA using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Tokyo). SYBR Green Real-Time PCR Master Mix (Toyobo) and a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) were used for RT-PCR. The comparative Ct method was used to analyze relative expression levels. Delta-Ct values were calculated as the differences between the Ct values of the target genes and glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ). The results are presented as relative gene expression compared with the intact tendon set to 1. Nucleotide sequences of the primers used are listed in Table 2 . Table 2 Primer sequences for gene expression analyses Gene Primer Sequence (5′-3′) CCN2 Forward CCACCCGAGTTACCAATGAC Reverse GTGCAGCCAGAAAGCTCA SOX9 Forward AGACCAGTACCCGCATCT Reverse CGCTCCGCCTCCTCCAC SCX Forward CGTGCTACTGGTGGGTGA Reverse GTGGAAGACGGAGTCGTT Tnmd Forward AACAAATCGTAGCACGGGAG Reverse AGTCGGCTAACAGATGCCAG GAPDH Forward GTCTTCACTACCATGGAGAAGG Reverse TCATGGATGACCTTGGCCAG CCN2, cellular communication network factor 2; SOX9, SRY-box containing gene 9; SCX, scleraxis; Tnmd, tenomodulin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Statistical analysis All statistical analyses were performed using IBM SPSS Statistics version 26 (IBM Corp., Armonk, NY, USA). The Mann–Whitney U test was used to analyze data to detect differences between two groups. The significance level was set at < 5%. Results Histological analysis Histological findings of the tendon-to-bone area in the ESWT and control groups are shown in Fig. 2 . In the control group, the cells were disorganized and the tidemarks were blurred (Fig. 2 D, 2 E), whereas in the ESWT group, the cells were well aligned and similar to those in intact tissue as observed in HE-stained sections (Fig. 2 A, 2 B). In Picrosirius red-stained sections under polarized light, collagen fibers in the control group appeared predominantly birefringent green (typical of type III collagen; Fig. 2 C), whereas in the ESWT group, they appeared predominantly birefringent yellow (typical of type I collagen; Fig. 2 F) [ 40 , 41 ]. Compared with the control group, the ratio of cellularity was significantly lower, and that of collagen fiber orientation was significantly higher in the ESWT group. However, the number of blood vessels and the total histological scores were not significantly different between the two groups (Table 3 ). Table 3 Summary of histological testing Group Cellularity Vascularity Collagen Fiber Orientation Total Score ESWT 113.1 ± 40.7 0.5 ± 1.2 153.5 ± 33.4 12.0 ± 0.0 Control 204.2 ± 70.9 0.7 ± 1.6 118.4 ± 21.6 11.5 ± 0.5 P value 0.041* 0.937 0.041* 0.180 Values for continuous variables are presented as mean ± standard deviation. ESWT, extracorporeal shockwave therapy. * P < .05 (n = 6 for each group). Gene expression The mRNA expressions of CCN2 , SOX9 , SCX , and Tnmd were examined using RT-PCR 4 weeks after ESWT. RT-PCR results showed that the mRNA expressions of CCN2 and SCX were significantly higher in the ESWT group than in the control group ( P = .032 and P = .008, respectively) (Fig. 3 A, 3 C). However, no statistically significant difference was found between the expressions of SOX9 and Tnmd ( P = .690 and P = .151, respectively) (Fig. 3 ). Discussion Our findings support the hypothesis that ESWT promotes histological tendon-to-bone healing and induces genetic changes in a rat model of chronic rotator cuff tear. To our knowledge, this study is the first to report the histological and genetic changes induced by ESWT in rotator cuff repair. Histological findings The present study revealed a decrease in cell number and an increase in well-oriented collagen fibers in the ESWT group compared with the control group. The healing process of tendons can be divided into three phases: inflammatory, proliferative, and remodeling. In the first phase, cytokines are released and various types of cells, including erythrocytes, platelets, neutrophils, monocytes, and macrophages, migrate to the injury site. The migrated cells remove cellular debris and secrete cytokines and extracellular matrix proteins. The angiogenic factors released induce the formation of new blood vessels. In the succeeding phase, cell proliferation occurs, and an additional extracellular matrix is produced. During the proliferative phase, unorganized, highly cellular, and vascularized tissues form the initial scar tissue. The third stage involves extracellular matrix alignment and collagen type I synthesis, replacing collagen type III. The numbers of cells and blood vessels within the scar tissue decrease. The ratio of collagen type I to type III fibers changes to more collagen type I. The fibers are aligned longitudinally along the tendon axis and provide mechanical strength to the tendon [ 42 – 44 ]. The number of cells increases in the early stages of remodeling and decreases in the later stages. In general, a decrease in the number of cells during tissue healing indicates ongoing healing [ 45 ]. In our study, the number of cells was lower in the ESWT group, suggesting that the tendons were more mature. A study by Hettrich et al., in which rh-PTH was administered to rats undergoing rotator cuff repair, demonstrated that the timing of the decrease in load to failure corresponds to an increase in neovascularization. They suggested that increased angiogenesis may induce a decrease in load to failure [ 13 ]. In this study, no significant differences were found in the number of vessels between the ESWT and control groups. Tokunaga et al. evaluated the effect of FGF-2-soaked gelatin hydrogels on rotator cuff healing and reported that the number of blood vessels is not significantly different between the FGF-2 and control groups until after 8 weeks [ 37 ]. Therefore, we considered that no significant difference was observed between the two groups at the time of evaluation in this experiment. For collagen fiber orientation, Wildemann et al. reported that the ratio between collagen type Ⅰ and type Ⅲ fibers changes toward more type Ⅰ and the fibers arrange longitudinally along the tendon axis, providing the mechanical strength of the tendon [ 42 ]. Maffulli et al. found that a ruptured Achilles tendon has a significantly higher percentage of type III collagen, rendering it more susceptible to rupture [ 46 ]. Liu et al. demonstrated that type I collagen is organized longitudinally along the axis of the tendon and is responsible for the mechanical strength of the regenerating tissue [ 47 ]. Our results that collagen fiber orientation was significantly improved in the ESWT group suggest that the type I collagen increased, and the strength of the healed tendon was enhanced. Genetic findings In the present study, we showed that ESWT induced the upregulation of CCN2 and SCX mRNA, but the mRNA expressions of SOX9 and Tnmd were not demonstrated. CCN2 is a cysteine-rich protein that stimulates chondrocyte proliferation and hypertrophic differentiation by strongly promoting the production of cartilage matrix proteins [ 48 ]. Previous studies showed excessive scar formation at the tendon-to-bone interface and lack of fibrocartilage formation for long periods of time after surgery in rat models of acute rotator cuff repair [ 45 , 49 ]. Hashimoto et al. applied ESWT to the rat meniscus and found an increase in mRNA expression of CCN2 [ 26 ]. In addition, Furumatsu et al. reported that human meniscal cells exhibit a chondrocyte morphology expressing CCN2 and SOX9 , and they possess the ability to produce cartilage-specific extracellular matrix components, similar to articular cartilage [ 50 , 51 ]. Nishida et al. revealed that CCN2 upregulates the gene expression of bone matrix proteins, such as type I collagen [ 52 ]. Yilmaz et al. also reported that ESWT has systemic proliferative and regenerative effects on cartilage in a rat knee osteoarthritis model [ 48 ]. Therefore, ESWT may also affect the formation of cartilage and collagen in the shoulder joint through CCN2 expression. Schweitzer et al. found that the basic helix-loop-helix transcription factor SCX is a highly specific marker for all connective tissues that attach chick and mouse muscle to bone, including limb tendons, and that early expression of SCX marks the progenitor cell populations of these tissues [ 53 ]. Murchison et al. reported that in tendons sustained in the SCX -/- mutant, tendon matrix is reduced and unorganized. At the cellular level, there was disorganization with a mixture of tendon and endotendon cells. Sakabe et al. also described SCX as a transcription factor likely involved in the regulation of tendon cell fate [ 54 ]. They observed the healing of Achilles tendon injuries in SCX-deficient mice. In the control wounds, type III collagen deposited at the wound site was gradually replaced by type I collagen fibers between 2 and 4 weeks after injury. By contrast, mutant wounds showed no replacement of type III collagen by type I collagen fibers by 4 weeks [ 55 ]. Gulotta et al. assessed the presence of fibrocartilage and collagen fiber organization and conducted biomechanical testing on rats that received adenoviral-mediated SCX -transduced mesenchymal stromal cells. They revealed that at 4 weeks, the SCX group had more fibrocartilage, higher ultimate load to failure, higher ultimate stress to failure, and higher stiffness values than the control group [ 56 ]. In our study, the mRNA expression of SCX was increased and collagen fiber orientation was improved, suggesting that ESWT may promote tendon-to-bone healing mediated by collagen fibers. Because histological changes and increased mRNA expressions of CCN2 and SCX suggest improved tissue healing and cellular responses, ESWT may be a promising method for promoting histological and cytological changes related to improving the mechanical strength of rotator cuff repair. This insight may guide future clinical approaches aimed at improving outcomes for patients with chronic rotator cuff tears. However, further research and clinical validation in human participants are essential. Limitations The present study has several limitations. First, the effect of ESWT was assessed 4 weeks after ESWT administration. The healing of the bone-to-tendon junction requires a relatively long period of time [ 43 ]. Tokunaga et al. evaluated the effect of FGF-2-soaked gelatin hydrogels on rotator cuff healing and reported that the histological changes do not differ between the FGF-2 and control groups 2 weeks after the intervention [ 57 ]. Therefore, the authors considered that histological and genetic changes in the early period (e.g., within 2 weeks) may not differ between the ESWT and control groups. However, because the histological and genetic changes in the late period were affected by both ESWT and the natural healing process, the authors considered that the effect of ESWT may not have been evaluated properly in the late period. Second, the present study did not evaluate the load to failure. As Feichtinger et al. showed that ESWT irradiation after rotator cuff repair increases load to failure [ 28 ], the authors considered ethical validity. Third, since ESWT was not limited to the repaired cuff tendon, it might have affected tissues surrounding the shoulder other than the repaired cuff tendon. Therefore, genetic changes in the repaired bone-to-tendon junction may be affected by surrounding tissues, such as the synovium, cartilage, and bone. Further studies are required to resolve this issue. Finally, this study included only a small number of rats. Although this issue may be related to the weak statistical power, the authors believe that ethical validity takes precedence over statistical validity. Conclusion ESWT induces histological changes and increases the mRNA expressions of CCN2 and SCX in rat rotator cuff repair of chronic tears. Declarations Competing interests statement : The authors declare no competing interests. Funding: This research was partially supported by grants from the Ministry of Education, Culture, Sports, Science and Technology/Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Scientific Research (KAKENHI) Grant No. 22K09347 to Tsuyoshi Ichinose and Research Grant, Smith and Nephew K.K to Hitoshi Shitara. The funding sources were not involved in the study design; collection, analysis, interpretation of data; writing of the report; or decision to submit the article for publication. Author Contribution M.K., T.I., H.S., and H.C. conceived the idea of the study. M.K., T.I., and H.S. developed the statistical analysis plan and conducted statistical analyses. T.S., R.M., F.I., N.H., and K.N. contributed to the interpretation of the results. M.K. drafted the original manuscript. N.K. and H.C. supervised the conduct of this study. All authors reviewed the manuscript draft and revised it critically for intellectual content. All authors approved the final version of the manuscript to be published. Acknowledgement The authors thank the Bioresource Center, Gunma University Graduate School of Medicine for its gracious help. Data Availability The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. References Avanzi, P. et al. Prospective randomized controlled trial for patch augmentation in rotator cuff repair: 24-month outcomes. J. Shoulder Elbow Surg. 28, 1918–1927 (2019). https://doi.org/10.1016/j.jse.2019.05.043 Chalmers, P. N. & Tashjian, R. Z. Patch augmentation in rotator cuff repair. Curr. Rev. Musculoskelet. Med. 13, 561–571 (2020). https://doi.org/10.1007/s12178-020-09658-4 Neri, B. R., Chan, K. W. & Kwon, Y. W. Management of massive and irreparable rotator cuff tears. J. Shoulder Elbow Surg. 18, 808–818 (2009). https://doi.org/10.1016/j.jse.2009.03.013 Boileau, P. et al. Arthroscopic repair of full-thickness tears of the supraspinatus: does the tendon really heal? J. Bone Joint Surg. Am. 87, 1229–1240 (2005). https://doi.org/10.2106/JBJS.D.02035 Lafosse, L., Brozska, R., Toussaint, B. & Gobezie, R. The outcome and structural integrity of arthroscopic rotator cuff repair with use of the double-row suture anchor technique. J. Bone Joint Surg. Am. 89, 1533–1541 (2007). https://doi.org/10.2106/JBJS.F.00305 Sugaya, H., Maeda, K., Matsuki, K. & Moriishi, J. Repair integrity and functional outcome after arthroscopic double-row rotator cuff repair. A prospective outcome study. J. Bone Joint Surg. Am. 89, 953–960 (2007). https://doi.org/10.2106/JBJS.F.00512 Xu, J. et al. Abaloparatide improves rotator cuff healing via anabolic effects on bone remodeling in a chronic rotator cuff tear model of rat with osteoporosis: a comparison with denosumab: response. Am. J. Sports Med. 51, NP3-NP4 (2023). https://doi.org/10.1177/03635465221139116 Celikten, M. et al. The effect of platelet-rich fibrin, platelet-rich plasma, and concentrated growth factor in the repair of full thickness rotator cuff tears. J. Shoulder Elbow Surg. 33, e261-e277 (2023). https://doi.org/10.1016/j.jse.2023.09.028 Cai, J. et al. Exosomes derived from kartogenin-preconditioned mesenchymal stem cells promote cartilage formation and collagen maturation for enthesis regeneration in a rat model of chronic rotator cuff tear. Am. J. Sports Med. 51, 1267–1276 (2023). https://doi.org/10.1177/03635465231155927 Oh, J. H., Kim, D. H., Jeong, H. J., Park, J. H. & Rhee, S. M. Effect of recombinant human parathyroid hormone on rotator cuff healing after arthroscopic repair. Arthroscopy. 35, 1064–1071 (2019). https://doi.org/10.1016/j.arthro.2018.11.038 Migliaccio, S. et al. Evaluation of persistence and adherence to teriparatide treatment in patients affected by severe osteoporosis (PATT): a multicenter observational real life study. Clin. Cases Miner. Bone Metab. 10, 56–60 (2013). https://doi.org/10.11138/ccmbm/2013.10.1.056 Han, J., Rhee, S. M., Kim, Y. W., Park, S. H. & Oh, J. H. Three-dimensionally printed recombinant human parathyroid hormone-soaked nanofiber sheet accelerates tendon-to-bone healing in a rabbit model of chronic rotator cuff tear. J. Shoulder Elbow Surg. 31, 1628–1639 (2022). https://doi.org/10.1016/j.jse.2022.02.013 Hettrich, C. M. et al. The effect of rhPTH on the healing of tendon to bone in a rat model. J. Orthop. Res. 30, 769–774 (2012). https://doi.org/10.1002/jor.22006 Randelli, P. S., Stoppani, C. A., Santarsiero, G., Nocerino, E. & Menon, A. Platelet-rich plasma in arthroscopic rotator cuff repair: clinical and radiological results of a prospective randomized controlled trial study at 10-year follow-up. Arthroscopy. 38, 51–61 (2022). https://doi.org/10.1016/j.arthro.2021.05.017 Jo, C. H. et al. Platelet-rich plasma for arthroscopic repair of medium to large rotator cuff tears: a randomized controlled trial. Am. J. Sports Med. 43, 2102–2110 (2015). https://doi.org/10.1177/0363546515587081 Tauberg, B. M., Su, J. C., Warth, R. J. & Gregory, J. M. Use of intraoperative platelet-rich plasma during rotator cuff repair is correlated with increased patient-level charges across multiple categories. J. Shoulder Elbow Surg. 32, e408-e414 (2023). https://doi.org/10.1016/j.jse.2023.01.031 Lamas, J. R. et al. Adverse effects of xenogenic scaffolding in the context of a randomized double-blind placebo-controlled study for repairing full-thickness rotator cuff tears. Trials. 20, 387 (2019). https://doi.org/10.1186/s13063-019-3504-3 Li, C., Xiao, Z., Chen, L. & Pan, S. Efficacy and safety of extracorporeal shock wave on low back pain: a systematic review and meta-analysis. Medicine (Baltimore). 101, e32053 (2022). https://doi.org/10.1097/MD.0000000000032053 Haake, M., Rautmann, M. & Wirth, T. Assessment of the treatment costs of extracorporeal shock wave therapy versus surgical treatment for shoulder diseases. Int. J. Technol. Assess. Health Care. 17, 612–617 (2001). Lingeman, J. E., Woods, J., Toth, P. D., Evan, A. P. & McAteer, J. A. The role of lithotripsy and its side effects. J. Urol. 141, 793–797 (1989). https://doi.org/10.1016/s0022-5347(17)41012-3 Brendel, W. Shock waves: a new physical principle in medicine. Eur. Surg. Res. 18, 177–180 (1986). https://doi.org/10.1159/000128523 Li, H., Lv, H. & Lin, T. Comparison of efficacy of eight treatments for plantar fasciitis: A network meta-analysis. J. Cell Physiol. 234, 860–870 (2018). https://doi.org/10.1002/jcp.26907 Tognolo, L. et al. Myofascial points treatment with focused extracorporeal shock wave therapy (f-ESWT) for plantar fasciitis: an open label randomized clinical trial. Eur. J. Phys. Rehabil. Med. 58, 85–93 (2022). https://doi.org/10.23736/S1973-9087.21.06814-3 Liu, W. C. et al. Extracorporeal shock wave therapy shows superiority over injections for pain relief and grip strength recovery in lateral epicondylitis: a systematic review and network meta-analysis. Arthroscopy. 38, 2018–2034.e2012 (2022). https://doi.org/10.1016/j.arthro.2022.01.025 Li, Y. et al. Extracorporeal shock wave therapy improves nontraumatic knee contracture in a rat model. Clin. Orthop. Relat. Res. 481, 822–834 (2023). https://doi.org/10.1097/CORR.0000000000002559 Hashimoto, S., Ichinose, T., Ohsawa, T., Koibuchi, N. & Chikuda, H. Extracorporeal shockwave therapy accelerates the healing of a meniscal tear in the avascular region in a rat model. Am. J. Sports Med. 47, 2937–2944 (2019). https://doi.org/10.1177/0363546519871059 Feichtinger, X. et al. Improved biomechanics in experimental chronic rotator cuff repair after shockwaves is not reflected by bone microarchitecture. PLoS One. 17, e0262294 (2022). https://doi.org/10.1371/journal.pone.0262294 Feichtinger, X. et al. Substantial biomechanical improvement by extracorporeal shockwave therapy after surgical repair of rodent chronic rotator cuff tears. Am. J. Sports Med. 47, 2158–2166 (2019). https://doi.org/10.1177/0363546519854760 Lee, C. H., Shah, B., Moioli, E. K. & Mao, J. J. CTGF directs fibroblast differentiation from human mesenchymal stem/stromal cells and defines connective tissue healing in a rodent injury model. J. Clin. Invest. 125, 3992 (2015). https://doi.org/10.1172/JCI84508 Liu, J. et al. CTGF positively regulates BMP12 induced tenogenic differentiation of tendon stem cells and signaling. Cell Physiol. Biochem. 35, 1831–1845 (2015). https://doi.org/10.1159/000373994 Lee, C. H. et al. Harnessing endogenous stem/progenitor cells for tendon regeneration. J. Clin. Invest. 125, 2690–2701 (2015). https://doi.org/10.1172/JCI81589 Sugimoto, Y. et al. Scx+/Sox9 + progenitors contribute to the establishment of the junction between cartilage and tendon/ligament. Development. 140, 2280–2288 (2013). https://doi.org/10.1242/dev.096354 Shukunami, C., Oshima, Y. & Hiraki, Y. Chondromodulin-I and tenomodulin: a new class of tissue-specific angiogenesis inhibitors found in hypovascular connective tissues. Biochem. Biophys. Res. Commun. 333, 299–307 (2005). https://doi.org/10.1016/j.bbrc.2005.05.133 Shukunami, C. et al. Scleraxis is a transcriptional activator that regulates the expression of Tenomodulin, a marker of mature tenocytes and ligamentocytes. Sci. Rep. 8, 3155 (2018). https://doi.org/10.1038/s41598-018-21194-3 Buchmann, S. et al. Refixation of the supraspinatus tendon in a rat model–influence of continuous growth factor application on tendon structure. J. Orthop. Res. 31, 300–305 (2013). https://doi.org/10.1002/jor.22211 Buchmann, S. et al. Rotator cuff changes in a full thickness tear rat model: verification of the optimal time interval until reconstruction for comparison to the healing process of chronic lesions in humans. Arch. Orthop. Trauma Surg. 131, 429–435 (2011). https://doi.org/10.1007/s00402-010-1246-5 Tokunaga, T. et al. FGF-2 stimulates the growth of tenogenic progenitor cells to facilitate the generation of tenomodulin-positive tenocytes in a rat rotator cuff healing model. Am. J. Sports Med. 43, 2411–2422 (2015). https://doi.org/10.1177/0363546515597488 Tokunaga, T. et al. Enhancement of rotator cuff tendon-bone healing with fibroblast growth factor 2 impregnated in gelatin hydrogel sheets in a rabbit model. J. Shoulder Elbow Surg. 26, 1708–1717 (2017). https://doi.org/10.1016/j.jse.2017.03.020 Tokunaga, T. et al. Local application of gelatin hydrogel sheets impregnated with platelet-derived growth factor BB promotes tendon-to-bone healing after rotator cuff repair in rats. Arthroscopy. 31, 1482–1491 (2015). https://doi.org/10.1016/j.arthro.2015.03.008 Chen, C. C., Hijaz, A., Drazba, J. A., Damaser, M. S. & Daneshgari, F. Collagen remodeling and suburethral inflammation might account for preserved anti-incontinence effects of cut polypropylene sling in rat model. Urology. 73, 415–420 (2009). https://doi.org/10.1016/j.urology.2008.07.033 Junqueira, L. C., Cossermelli, W. & Brentani, R. Differential staining of collagens type I, II and III by Sirius Red and polarization microscopy. Arch. Histol. Jpn. 41, 267–274 (1978). https://doi.org/10.1679/aohc1950.41.267 Wildemann, B. & Klatte, F. Biological aspects of rotator cuff healing. Muscles Ligaments Tendons J. 1, 161–168 (2011). Chartier, C. et al. Tendon: principles of healing and repair. Semin. Plast. Surg. 35, 211–215 (2021). https://doi.org/10.1055/s-0041-1731632 Zumstein, M. A., Lädermann, A., Raniga, S. & Schär, M. O. The biology of rotator cuff healing. Orthop. Traumatol. Surg. Res. 103, S1-S10 (2017). https://doi.org/10.1016/j.otsr.2016.11.003 Galatz, L. M. et al. Characteristics of the rat supraspinatus tendon during tendon-to-bone healing after acute injury. J. Orthop. Res. 24, 541–550 (2006). https://doi.org/10.1002/jor.20067 Maffulli, N., Ewen, S. W., Waterston, S. W., Reaper, J. & Barrass, V. Tenocytes from ruptured and tendinopathic achilles tendons produce greater quantities of type III collagen than tenocytes from normal achilles tendons. An in vitro model of human tendon healing. Am. J. Sports Med. 28, 499–505 (2000). https://doi.org/10.1177/03635465000280040901 Liu, S. H., Yang, R. S., al-Shaikh, R. & Lane, J. M. Collagen in tendon, ligament, and bone healing. A current review. Clin. Orthop. Relat. Res. 265–278 (1995). Xing, X., Li, Z., Yu, Z., Cheng, G. & Li, D. Effects of connective tissue growth factor (CTGF/CCN2) on condylar chondrocyte proliferation, migration, maturation, differentiation and signalling pathway. Biochem. Biophys. Res. Commun. 495, 1447–1453 (2018). https://doi.org/10.1016/j.bbrc.2017.11.190 Benjamin, M. et al. The skeletal attachment of tendons–tendon "entheses". Comp. Biochem. Physiol. A Mol. Integr. Physiol. 133, 931–945 (2002). https://doi.org/10.1016/s1095-6433(02)00138-1 Furumatsu, T. et al. Mechanical stretch increases Smad3-dependent CCN2 expression in inner meniscus cells. J. Orthop. Res. 30, 1738–1745 (2012). https://doi.org/10.1002/jor.22142 Furumatsu, T., Kanazawa, T., Yokoyama, Y., Abe, N. & Ozaki, T. Inner meniscus cells maintain higher chondrogenic phenotype compared with outer meniscus cells. Connect Tissue Res. 52, 459–465 (2011). https://doi.org/10.3109/03008207.2011.562061 Nishida, T., Nakanishi, T., Asano, M., Shimo, T. & Takigawa, M. Effects of CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, on the proliferation and differentiation of osteoblastic cells in vitro. J. Cell. Physiol. 184, 197–206 (2000). https://doi.org/10.1002/1097-4652(200008)184:23.0.CO;2-R Schweitzer, R. et al. Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development. 128, 3855–3866 (2001). https://doi.org/10.1242/dev.128.19.3855 Murchison, N. D. et al. Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development. 134, 2697–2708 (2007). https://doi.org/10.1242/dev.001933 Sakabe, T. et al. Transcription factor scleraxis vitally contributes to progenitor lineage direction in wound healing of adult tendon in mice. J. Biol. Chem. 293, 5766–5780 (2018). https://doi.org/10.1074/jbc.RA118.001987 Gulotta, L. V., Kovacevic, D., Packer, J. D., Deng, X. H. & Rodeo, S. A. Bone marrow-derived mesenchymal stem cells transduced with scleraxis improve rotator cuff healing in a rat model. Am. J. Sports Med. 39, 1282–1289 (2011). https://doi.org/10.1177/0363546510395485 Yonemitsu, R. et al. Fibroblast growth factor 2 enhances tendon-to-bone healing in a rat rotator cuff repair of chronic tears. Am. J. Sports Med. 47, 1701–1712 (2019). https://doi.org/10.1177/0363546519836959 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 12 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 14 Aug, 2025 Reviewers agreed at journal 16 Jul, 2025 Reviews received at journal 06 Jun, 2025 Reviews received at journal 01 Jun, 2025 Reviewers agreed at journal 28 May, 2025 Reviewers agreed at journal 26 May, 2025 Reviews received at journal 22 Jul, 2024 Reviewers agreed at journal 21 Jul, 2024 Reviewers agreed at journal 21 Jul, 2024 Reviewers invited by journal 21 Jul, 2024 Editor assigned by journal 13 Jul, 2024 Editor invited by journal 24 Jun, 2024 Submission checks completed at journal 24 Jun, 2024 First submitted to journal 19 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4603175","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":326557957,"identity":"3636b75b-6425-4014-be3d-748fe801ed09","order_by":0,"name":"Masataka Kamiyama","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Masataka","middleName":"","lastName":"Kamiyama","suffix":""},{"id":326557958,"identity":"63ab56b6-b5e0-4e80-adc4-94478c462dcf","order_by":1,"name":"Hitoshi Shitara","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBACAwYehgMgBj+KsAQhLSA9kg2kaAFbY3CAWIeZ8589ePhDzT154/NrzB7dqGFIbGA//IDBcgduLZYz8hIOHDhWbLjtxhtz45xjQC08aQYMkmfwOOwGj8GBA2wJjNtunDGTzmH7n9jAkAP0WRseLefPALX8S7DfPAOk5R/QFv43BLQcyDE4cLAtIXEDf4+ZdG4bUIsEIVtuALWc7UtInnGDrUw6t4/BuE3imcEBvH45f8b4Q8W3BNv+/sPbpHO+Mcj28yc/fCyJJ8QQQCIBQrMB8WHUiMUF+A8g2IwfidIyCkbBKBgFIwQAAJRSVoSWV+uuAAAAAElFTkSuQmCC","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Hitoshi","middleName":"","lastName":"Shitara","suffix":""},{"id":326557959,"identity":"9d3bc1e2-beee-48a7-bb4d-356307168dc0","order_by":2,"name":"Tsuyoshi Ichinose","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Tsuyoshi","middleName":"","lastName":"Ichinose","suffix":""},{"id":326557960,"identity":"0b12c878-bc98-4ca1-95e4-bcae40a3c782","order_by":3,"name":"Tsuyoshi Sasaki","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Tsuyoshi","middleName":"","lastName":"Sasaki","suffix":""},{"id":326557961,"identity":"291d7981-9ecd-4dbc-9fba-c617582e985e","order_by":4,"name":"Ryosuke Miyamoto","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ryosuke","middleName":"","lastName":"Miyamoto","suffix":""},{"id":326557962,"identity":"74b76532-9f53-46f4-bbed-264902665084","order_by":5,"name":"Fukuhisa Ino","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Fukuhisa","middleName":"","lastName":"Ino","suffix":""},{"id":326557963,"identity":"95edb290-19ca-4c25-b618-4a3e4874447c","order_by":6,"name":"Noritaka Hamano","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Noritaka","middleName":"","lastName":"Hamano","suffix":""},{"id":326557964,"identity":"155c91dd-1fa8-4cc7-88a4-579a6e8dc91e","order_by":7,"name":"Kurumi Nakase","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kurumi","middleName":"","lastName":"Nakase","suffix":""},{"id":326557965,"identity":"6684279f-fef0-45e7-bf83-c94b7431c566","order_by":8,"name":"Noriyuki Koibuchi","email":"","orcid":"","institution":"Department of Integrative Physiology, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Noriyuki","middleName":"","lastName":"Koibuchi","suffix":""},{"id":326557966,"identity":"0fb6a76e-6276-4972-8b9b-33d1cff4cf8b","order_by":9,"name":"Hirotaka Chikuda","email":"","orcid":"","institution":"Department of Orthopaedic Surgery, Gunma University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Hirotaka","middleName":"","lastName":"Chikuda","suffix":""}],"badges":[],"createdAt":"2024-06-19 04:46:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4603175/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4603175/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-35072-w","type":"published","date":"2026-01-12T16:30:29+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60280973,"identity":"b7dc7cb9-bc3e-4a1e-9e61-0ddb92fb7d8d","added_by":"auto","created_at":"2024-07-15 06:31:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":78961,"visible":true,"origin":"","legend":"\u003cp\u003eFlowchart of the study. ESWT, extracorporeal shockwave therapy\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4603175/v1/93d05f315f71138f57c50cdb.png"},{"id":60280968,"identity":"f8057cf8-db51-47b3-9b3d-df795a8365f6","added_by":"auto","created_at":"2024-07-15 06:31:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":572029,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrographs of the specimens: (A-C) control group and (D-F) ESWT group. (A, B, D, and E) Hematoxylin and eosin-stained sections and (C and F) Picrosirius red-stained sections under polarized light. Black-boxed areas in (A and D) are shown at higher magnification in (B and E). Bars, 200 μm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4603175/v1/ee94c03d4d241c16f512b334.png"},{"id":60281437,"identity":"191479f2-1087-4f93-8fe9-79acc626674d","added_by":"auto","created_at":"2024-07-15 06:39:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":42882,"visible":true,"origin":"","legend":"\u003cp\u003eThe mRNA expressions of (A) \u003cem\u003eCCN2\u003c/em\u003e, (B) \u003cem\u003eSOX9\u003c/em\u003e, (C) \u003cem\u003eSCX\u003c/em\u003e, and (D) \u003cem\u003eTmnd\u003c/em\u003e was analyzed using real-time polymerase chain reaction. The amounts of these mRNAs were normalized to the amount of GAPDH mRNA and then to the intact supraspinatus tendon tissues set to 1. Error bars represent the standard deviation. \u003cem\u003eP\u003c/em\u003e values were obtained using the Mann–Whitney U test. *\u003cem\u003eP\u003c/em\u003e\u0026lt; .05 (n = 5 for each group).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4603175/v1/f6651e4c359d4f3a362b0294.png"},{"id":100614745,"identity":"07ef680d-b282-403c-b121-df2ae05d51dc","added_by":"auto","created_at":"2026-01-19 17:23:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1349268,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4603175/v1/7795f219-be44-4d32-a7e1-756f89a16ab0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Histological and genetic changes induced by extracorporeal shockwave therapy after rotator cuff repair in a rat model with tears","fulltext":[{"header":"Introduction","content":"\u003cp\u003eArthroscopic rotator cuff repair is a widely used surgical treatment for rotator cuff tears. Although its clinical outcomes have improved with advancements in technology and instrumentation, numerous studies have reported postoperative retear rates ranging from 20\u0026ndash;94% [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Retears lead to poor clinical outcomes and decreased quality of life [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Given that inadequate tendon-to-bone healing is a primary cause of retears, several studies have investigated the efficacy of adjunctive therapies aimed at facilitating biological tendon-to-bone healing [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAdjunctive therapies to reduce retear after surgery for rotator cuff tears include recombinant human parathyroid hormone (rh-PTH), platelet-rich plasma (PRP), stem cell autografts, and extracorporeal shockwave therapy (ESWT). rh-PTH therapy has been shown to reduce retear rates [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. However, its clinical application is limited because it is primarily a treatment for osteoporosis. In addition, several studies have reported adverse effects of rh-PTH, including vomiting, hypertension, dizziness, and allergic reactions [\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. PRP therapy has also been reported to reduce the retear rate. However, its efficacy is controversial, and the associated costs are high [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Stem cell therapy, while reported to promote tendon attachment regeneration in rats, has led to the discontinuation of some human randomized controlled trials due to adverse events such as supraclavicular cyst formation and the development of subacromial inflammatory tissue, rendering its safety questionable [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Compared with treatments, such as rh-PTH, PRP, and stem cell autograft, ESWT is associated with fewer adverse effects and lower costs [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eESWT delivers shock waves, generated externally, to the targeted area in the body. Since the 1980s, it has been used in treating urolithiasis [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Recently, its effectiveness has been recognized in the field of orthopedics, where it is now used to treat conditions such as plantar fasciitis and lateral epicondylitis, among others [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Animal studies have shown that ESWT promotes meniscus healing and improves knee joint contractures [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Feichtinger et al. revealed that ESWT significantly improves the load-to-failure results in rats after rotator cuff tear repair. Moreover, they found that ESWT does not affect bone microstructure [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In their examination of gene expressions, specifically \u003cem\u003eCXCL12\u003c/em\u003e (C-X-C motif chemokine 12), \u003cem\u003eTGF-β1\u003c/em\u003e and \u003cem\u003eTGF-β3\u003c/em\u003e (transforming growth factor beta 1 and 3), and \u003cem\u003eVEGFR2\u003c/em\u003e (vascular endothelial growth factor receptor 2), Feichtinger et al. found no significant differences [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, histological changes in structures other than bone microstructure, and the specifics of gene expression alteration by ESWT, remain to be elucidated.\u003c/p\u003e \u003cp\u003eRecently, cellular communication network factor 2 (\u003cem\u003eCCN2\u003c/em\u003e)/connective tissue growth factor has been shown to promote tenogenesis in cultured mesenchymal stromal cells and endogenous tendon stem cells [\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. SRY-box containing gene 9 (\u003cem\u003eSOX9\u003c/em\u003e), scleraxis (\u003cem\u003eSCX\u003c/em\u003e), and tenomodulin (\u003cem\u003eTnmd\u003c/em\u003e) are recognized as tendon-related markers. \u003cem\u003eSOX9\u003c/em\u003e, an SRY-related transcription factor, contains a high-mobility group box DNA-binding domain. \u003cem\u003eSCX\u003c/em\u003e, a basic helix-loop-helix transcription factor, is persistently expressed in tendons and ligaments. \u003cem\u003eSOX9\u003c/em\u003e and \u003cem\u003eSCX\u003c/em\u003e regulate the formation of cartilage and tendon [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. As a type II transmembrane protein, \u003cem\u003eTnmd\u003c/em\u003e is specifically expressed in hypovascular structures such as tendons and ligaments. The messenger (mRNA) expression of \u003cem\u003eTnmd\u003c/em\u003e is positively regulated by \u003cem\u003eSCX\u003c/em\u003e [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis study aimed to investigate histological and genetic changes in the rotator cuff induced by ESWT irradiation. For histological evaluation, we assessed the histological appearance and maturation using three parameters: cellularity, vascularity, and collagen fiber orientation. For genetic evaluation, we investigated the mRNA expressions of \u003cem\u003eCCN2\u003c/em\u003e, \u003cem\u003eSOX9\u003c/em\u003e, \u003cem\u003eSCX\u003c/em\u003e, and \u003cem\u003eTnmd\u003c/em\u003e. We hypothesized that ESWT would promote histological tendon-to-bone healing and induce changes in the expressions of these genes.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eThis study was performed in accordance with the Guidelines by the NIH Office of Laboratory Animal Welfare regarding the care and use of animals for experimental procedures, and following the recommendations stated in the ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org/\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). This study was approved by the Animal Care and Experimentation Committee at our institution (approval number: 19\u0026ndash;045). All efforts were made to minimize the number of animals used and their suffering. Male Wistar rats (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD body weight, 450.9\u0026thinsp;\u0026plusmn;\u0026thinsp;11.1 g) were purchased from SLC Japan. All rats were housed at the Biological Resource Center of our institution under a controlled temperature (24\u0026deg;C) with a light/dark cycle and fed a standard commercial diet with ad libitum access to tap water.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStudy design\u003c/h2\u003e \u003cp\u003eWe selected a chronic rotator cuff tear model, as previously reported [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In this model, the supraspinatus (SSP) tendon of the left shoulder was completely detached from its insertion site and surgically repaired 3 weeks later. In this study, 22 rats were randomly assigned to either the ESWT or control group, with 11 rats in each group. On the basis of a previous study [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], 1 week after surgical repair, the ESWT group received ESWT and the control group received sham stimulation. The rats were euthanized 4 weeks after the ESWT or sham stimulation via intraperitoneal injection of 150 mg/kg pentobarbital sodium. Six specimens per group were used for histological evaluation, and five specimens per group were used for gene expression evaluation using real-time polymerase chain reaction (RT-PCR) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRandomization\u003c/h2\u003e \u003cp\u003eA computer-generated random number table was created using the RAND function in Excel (Microsoft, Washington, USA). Rats were assigned anonymous identification numbers and randomly allocated to either the ESWT or control group in a 1:1 ratio. This randomization was performed by using the generated random number table.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSurgical procedure\u003c/h2\u003e \u003cp\u003eSurgery was performed as described in previous studies [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. After inducing general anesthesia via intraperitoneal injection with ketamine (60 mg/kg) and xylazine (12 mg/kg), an incision was made in the anterolateral aspect of the left shoulder, and a deltoid muscle split was performed. After surgical exposure of the SSP tendon, it was then sharply detached from its insertion area. The end of the SSP tendon was marked with a nylon 5\u0026thinsp;\u0026minus;\u0026thinsp;0 suture (Natsume Seisakusho Co., Ltd., Tokyo, Japan), and the skin incision was closed using the same suture type. Three weeks after the primary surgery, tendon repair was performed. After general anesthesia, the torn tendons were exposed as in the primary surgery. The scar tissue in the insertion area was gently debrided, and the fibrocartilaginous layer between the tendon and bone was removed using a scalpel. A bone tunnel was drilled in an anteroposterior direction close to the greater tuberosity. The torn tendon was re-attached to the insertion area using a modified Mason-Allen nylon 5\u0026thinsp;\u0026minus;\u0026thinsp;0 suture (Natsume Seisakusho Co., Ltd.) that passed through the bone tunnel. Skin closure was performed as in the primary surgery. All rats were allowed unrestricted movement around their cages after both surgeries.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eESWT protocol\u003c/h2\u003e \u003cp\u003eESWT or sham stimulation was performed under general anesthesia. On the basis of a previous study [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], the ESWT group received 800 impulses of shockwave with an energy flux density of 0.22 mJ/mm\u003csup\u003e2\u003c/sup\u003e and a frequency of 3 Hz in a single session at 1 week after surgical repair (ARIES Vet; Dornier MedTech, Wessling, Germany). The ESWT probe was applied to the skin directly above the insertion site. In the control group, the probe was applied to the same area for the same amount of time, but no shockwaves were emitted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eHistological evaluation\u003c/h2\u003e \u003cp\u003eThe bilateral SSP and humeral heads were carefully removed 4 weeks after ESWT for histological evaluation. The specimens were fixed in 10% paraformaldehyde for 24 h, degreased in 90% ethanol for 48 h, decalcified in K-CX (FALMA, Tokyo, Japan) for 24 h, and embedded in an optimal cutting temperature compound (Sakura Finetek Japan Co., Ltd., Tokyo, Japan). Hematoxylin and eosin (HE)- and Picrosirius red-stained sections (4 \u0026micro;m) were prepared. The sections were viewed under a Keyence BZ-9000 fluorescence microscope (Keyence, Osaka, Japan). We assessed the histological appearance and maturation using a histological scoring system, focusing on three parameters: cellularity, vascularity, and collagen fiber orientation. This assessment was conducted with computerized image analysis using ImageJ software (National Institutes of Health, Bethesda, MD, USA), as previously described by Tokunaga et al. (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. We obtained three sequential sections from each specimen for each staining method and calculated the average result for analysis. In summary, each segment was assessed by two colleagues (M.K. and T.I.), who were blinded to the group allocations. We evaluated cellularity and collagen fiber orientation by comparing the percentages of values measured in six intact right shoulders. For cellularity, we selected a region of interest (200 \u0026times; 200 \u0026micro;m) at the insertion site (100\u0026ndash;400 mm proximal to the bone surface) on HE-stained sections. Cell nuclei were counted to determine the number of cells per square millimeter. For vascularity, we counted all blood vessels at the insertion site using HE-stained sections and observed them under 100-fold magnification. For collagen fiber orientation, we randomly selected 10 areas (100 \u0026times; 100 \u0026micro;m) at the insertion site, examining them under 12.5-fold magnification. Grayscale values were measured using ImageJ on an 8-bit grayscale image (black\u0026thinsp;=\u0026thinsp;0, white\u0026thinsp;=\u0026thinsp;255) obtained from Picrosirius red-stained sections captured using a polarizing microscope. Increased brightness indicates collagen fibers organized in a more parallel nature. The interobserver intraclass correlation coefficient for the total score was 0.81, and the intraobserver intraclass correlation coefficient was 0.77.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHistological scoring system\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eScore\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCellularity, %\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e300 to 400\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 to \u0026lt;\u0026thinsp;300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVascularity\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 to 15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6 to \u0026lt;\u0026thinsp;10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCollagen fiber orientation, %\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25 to 50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;50 to 75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003csup\u003ea\u003c/sup\u003eNumber of cells per region of interest from each section. Percentages represent relative values compared with those from non-operative tendon-to-bone sections (n\u0026thinsp;=\u0026thinsp;6), which were set at 100%.\u003c/p\u003e \u003cp\u003e \u003csup\u003eb\u003c/sup\u003eNumber of blood vessels per low-power field (100-fold magnification) in each section.\u003c/p\u003e \u003cp\u003e \u003csup\u003ec\u003c/sup\u003eGrayscale per region of interest from each section as measured using ImageJ. Percentages represent relative values compared with those from non-operative tendon-to-bone sections (n\u0026thinsp;=\u0026thinsp;6), which were set at 100%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGene expression\u003c/h2\u003e \u003cp\u003eFor RT-PCR, the bilateral tendon-to-bone tissues were resected 4 weeks after ESWT. A Minilys homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France) and a Precellys lysing kit (Bertin Technologies) were used to crush the tendon-to-bone tissues (3200 rpm, 5 cycles of 30 s). Total RNA (500 ng) was isolated from the tendon-to-bone tissues using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Subsequently, cDNA was synthesized from the isolated total RNA using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Tokyo). SYBR Green Real-Time PCR Master Mix (Toyobo) and a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) were used for RT-PCR. The comparative Ct method was used to analyze relative expression levels. Delta-Ct values were calculated as the differences between the Ct values of the target genes and glyceraldehyde 3-phosphate dehydrogenase (\u003cem\u003eGAPDH\u003c/em\u003e). The results are presented as relative gene expression compared with the intact tendon set to 1. Nucleotide sequences of the primers used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for gene expression analyses\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCN2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACCCGAGTTACCAATGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGCAGCCAGAAAGCTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSOX9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACCAGTACCCGCATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCTCCGCCTCCTCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSCX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTGCTACTGGTGGGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGAAGACGGAGTCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTnmd\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAAATCGTAGCACGGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTCGGCTAACAGATGCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTTCACTACCATGGAGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATGGATGACCTTGGCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCCN2, cellular communication network factor 2; SOX9, SRY-box containing gene 9; SCX, scleraxis; Tnmd, tenomodulin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed using IBM SPSS Statistics version 26 (IBM Corp., Armonk, NY, USA). The Mann\u0026ndash;Whitney U test was used to analyze data to detect differences between two groups. The significance level was set at \u0026lt;\u0026thinsp;5%.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eHistological analysis\u003c/p\u003e \u003cp\u003eHistological findings of the tendon-to-bone area in the ESWT and control groups are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. In the control group, the cells were disorganized and the tidemarks were blurred (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), whereas in the ESWT group, the cells were well aligned and similar to those in intact tissue as observed in HE-stained sections (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In Picrosirius red-stained sections under polarized light, collagen fibers in the control group appeared predominantly birefringent green (typical of type III collagen; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), whereas in the ESWT group, they appeared predominantly birefringent yellow (typical of type I collagen; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Compared with the control group, the ratio of cellularity was significantly lower, and that of collagen fiber orientation was significantly higher in the ESWT group. However, the number of blood vessels and the total histological scores were not significantly different between the two groups (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of histological testing\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCellularity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVascularity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCollagen Fiber Orientation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal Score\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eESWT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e113.1\u0026thinsp;\u0026plusmn;\u0026thinsp;40.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e153.5\u0026thinsp;\u0026plusmn;\u0026thinsp;33.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e204.2\u0026thinsp;\u0026plusmn;\u0026thinsp;70.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e118.4\u0026thinsp;\u0026plusmn;\u0026thinsp;21.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.041*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.937\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.041*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.180\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eValues for continuous variables are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation.\u003c/p\u003e \u003cp\u003eESWT, extracorporeal shockwave therapy.\u003c/p\u003e \u003cp\u003e*\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;.05 (n\u0026thinsp;=\u0026thinsp;6 for each group).\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eGene expression\u003c/h2\u003e \u003cp\u003eThe mRNA expressions of \u003cem\u003eCCN2\u003c/em\u003e, \u003cem\u003eSOX9\u003c/em\u003e, \u003cem\u003eSCX\u003c/em\u003e, and \u003cem\u003eTnmd\u003c/em\u003e were examined using RT-PCR 4 weeks after ESWT. RT-PCR results showed that the mRNA expressions of \u003cem\u003eCCN2\u003c/em\u003e and \u003cem\u003eSCX\u003c/em\u003e were significantly higher in the ESWT group than in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;.032 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;.008, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). However, no statistically significant difference was found between the expressions of \u003cem\u003eSOX9\u003c/em\u003e and \u003cem\u003eTnmd\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;.690 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;.151, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur findings support the hypothesis that ESWT promotes histological tendon-to-bone healing and induces genetic changes in a rat model of chronic rotator cuff tear. To our knowledge, this study is the first to report the histological and genetic changes induced by ESWT in rotator cuff repair.\u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eHistological findings\u003c/h2\u003e \u003cp\u003eThe present study revealed a decrease in cell number and an increase in well-oriented collagen fibers in the ESWT group compared with the control group. The healing process of tendons can be divided into three phases: inflammatory, proliferative, and remodeling. In the first phase, cytokines are released and various types of cells, including erythrocytes, platelets, neutrophils, monocytes, and macrophages, migrate to the injury site. The migrated cells remove cellular debris and secrete cytokines and extracellular matrix proteins. The angiogenic factors released induce the formation of new blood vessels. In the succeeding phase, cell proliferation occurs, and an additional extracellular matrix is produced. During the proliferative phase, unorganized, highly cellular, and vascularized tissues form the initial scar tissue. The third stage involves extracellular matrix alignment and collagen type I synthesis, replacing collagen type III. The numbers of cells and blood vessels within the scar tissue decrease. The ratio of collagen type I to type III fibers changes to more collagen type I. The fibers are aligned longitudinally along the tendon axis and provide mechanical strength to the tendon [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe number of cells increases in the early stages of remodeling and decreases in the later stages. In general, a decrease in the number of cells during tissue healing indicates ongoing healing [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In our study, the number of cells was lower in the ESWT group, suggesting that the tendons were more mature. A study by Hettrich et al., in which rh-PTH was administered to rats undergoing rotator cuff repair, demonstrated that the timing of the decrease in load to failure corresponds to an increase in neovascularization. They suggested that increased angiogenesis may induce a decrease in load to failure [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In this study, no significant differences were found in the number of vessels between the ESWT and control groups. Tokunaga et al. evaluated the effect of FGF-2-soaked gelatin hydrogels on rotator cuff healing and reported that the number of blood vessels is not significantly different between the FGF-2 and control groups until after 8 weeks [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Therefore, we considered that no significant difference was observed between the two groups at the time of evaluation in this experiment. For collagen fiber orientation, Wildemann et al. reported that the ratio between collagen type Ⅰ and type Ⅲ fibers changes toward more type Ⅰ and the fibers arrange longitudinally along the tendon axis, providing the mechanical strength of the tendon [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Maffulli et al. found that a ruptured Achilles tendon has a significantly higher percentage of type III collagen, rendering it more susceptible to rupture [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Liu et al. demonstrated that type I collagen is organized longitudinally along the axis of the tendon and is responsible for the mechanical strength of the regenerating tissue [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Our results that collagen fiber orientation was significantly improved in the ESWT group suggest that the type I collagen increased, and the strength of the healed tendon was enhanced.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eGenetic findings\u003c/h2\u003e \u003cp\u003eIn the present study, we showed that ESWT induced the upregulation of \u003cem\u003eCCN2\u003c/em\u003e and \u003cem\u003eSCX\u003c/em\u003e mRNA, but the mRNA expressions of \u003cem\u003eSOX9\u003c/em\u003e and \u003cem\u003eTnmd\u003c/em\u003e were not demonstrated. \u003cem\u003eCCN2\u003c/em\u003e is a cysteine-rich protein that stimulates chondrocyte proliferation and hypertrophic differentiation by strongly promoting the production of cartilage matrix proteins [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Previous studies showed excessive scar formation at the tendon-to-bone interface and lack of fibrocartilage formation for long periods of time after surgery in rat models of acute rotator cuff repair [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Hashimoto et al. applied ESWT to the rat meniscus and found an increase in mRNA expression of \u003cem\u003eCCN2\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addition, Furumatsu et al. reported that human meniscal cells exhibit a chondrocyte morphology expressing \u003cem\u003eCCN2\u003c/em\u003e and \u003cem\u003eSOX9\u003c/em\u003e, and they possess the ability to produce cartilage-specific extracellular matrix components, similar to articular cartilage [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Nishida et al. revealed that \u003cem\u003eCCN2\u003c/em\u003e upregulates the gene expression of bone matrix proteins, such as type I collagen [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Yilmaz et al. also reported that ESWT has systemic proliferative and regenerative effects on cartilage in a rat knee osteoarthritis model [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Therefore, ESWT may also affect the formation of cartilage and collagen in the shoulder joint through \u003cem\u003eCCN2\u003c/em\u003e expression. Schweitzer et al. found that the basic helix-loop-helix transcription factor \u003cem\u003eSCX\u003c/em\u003e is a highly specific marker for all connective tissues that attach chick and mouse muscle to bone, including limb tendons, and that early expression of \u003cem\u003eSCX\u003c/em\u003e marks the progenitor cell populations of these tissues [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Murchison et al. reported that in tendons sustained in the \u003cem\u003eSCX\u003c/em\u003e-/- mutant, tendon matrix is reduced and unorganized. At the cellular level, there was disorganization with a mixture of tendon and endotendon cells. Sakabe et al. also described \u003cem\u003eSCX\u003c/em\u003e as a transcription factor likely involved in the regulation of tendon cell fate [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. They observed the healing of Achilles tendon injuries in SCX-deficient mice. In the control wounds, type III collagen deposited at the wound site was gradually replaced by type I collagen fibers between 2 and 4 weeks after injury. By contrast, mutant wounds showed no replacement of type III collagen by type I collagen fibers by 4 weeks [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Gulotta et al. assessed the presence of fibrocartilage and collagen fiber organization and conducted biomechanical testing on rats that received adenoviral-mediated \u003cem\u003eSCX\u003c/em\u003e-transduced mesenchymal stromal cells. They revealed that at 4 weeks, the \u003cem\u003eSCX\u003c/em\u003e group had more fibrocartilage, higher ultimate load to failure, higher ultimate stress to failure, and higher stiffness values than the control group [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In our study, the mRNA expression of SCX was increased and collagen fiber orientation was improved, suggesting that ESWT may promote tendon-to-bone healing mediated by collagen fibers.\u003c/p\u003e \u003cp\u003eBecause histological changes and increased mRNA expressions of CCN2 and SCX suggest improved tissue healing and cellular responses, ESWT may be a promising method for promoting histological and cytological changes related to improving the mechanical strength of rotator cuff repair. This insight may guide future clinical approaches aimed at improving outcomes for patients with chronic rotator cuff tears. However, further research and clinical validation in human participants are essential.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLimitations\u003c/h2\u003e \u003cp\u003eThe present study has several limitations. First, the effect of ESWT was assessed 4 weeks after ESWT administration. The healing of the bone-to-tendon junction requires a relatively long period of time [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Tokunaga et al. evaluated the effect of FGF-2-soaked gelatin hydrogels on rotator cuff healing and reported that the histological changes do not differ between the FGF-2 and control groups 2 weeks after the intervention [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Therefore, the authors considered that histological and genetic changes in the early period (e.g., within 2 weeks) may not differ between the ESWT and control groups. However, because the histological and genetic changes in the late period were affected by both ESWT and the natural healing process, the authors considered that the effect of ESWT may not have been evaluated properly in the late period. Second, the present study did not evaluate the load to failure. As Feichtinger et al. showed that ESWT irradiation after rotator cuff repair increases load to failure [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], the authors considered ethical validity. Third, since ESWT was not limited to the repaired cuff tendon, it might have affected tissues surrounding the shoulder other than the repaired cuff tendon. Therefore, genetic changes in the repaired bone-to-tendon junction may be affected by surrounding tissues, such as the synovium, cartilage, and bone. Further studies are required to resolve this issue. Finally, this study included only a small number of rats. Although this issue may be related to the weak statistical power, the authors believe that ethical validity takes precedence over statistical validity.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eESWT induces histological changes and increases the mRNA expressions of \u003cem\u003eCCN2\u003c/em\u003e and \u003cem\u003eSCX\u003c/em\u003e in rat rotator cuff repair of chronic tears.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cb\u003eCompeting interests statement\u003c/b\u003e: The authors declare no competing interests.\u003c/p\u003e \u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThis research was partially supported by grants from the Ministry of Education, Culture, Sports, Science and Technology/Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Scientific Research (KAKENHI) Grant No. 22K09347 to Tsuyoshi Ichinose and Research Grant, Smith and Nephew K.K to Hitoshi Shitara. The funding sources were not involved in the study design; collection, analysis, interpretation of data; writing of the report; or decision to submit the article for publication.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eM.K., T.I., H.S., and H.C. conceived the idea of the study. M.K., T.I., and H.S. developed the statistical analysis plan and conducted statistical analyses. T.S., R.M., F.I., N.H., and K.N. contributed to the interpretation of the results. M.K. drafted the original manuscript. N.K. and H.C. supervised the conduct of this study. All authors reviewed the manuscript draft and revised it critically for intellectual content. All authors approved the final version of the manuscript to be published.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors thank the Bioresource Center, Gunma University Graduate School of Medicine for its gracious help.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAvanzi, P. \u003cem\u003eet al.\u003c/em\u003e Prospective randomized controlled trial for patch augmentation in rotator cuff repair: 24-month outcomes. J. Shoulder Elbow Surg. 28, 1918\u0026ndash;1927 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jse.2019.05.043\u003c/span\u003e\u003cspan address=\"10.1016/j.jse.2019.05.043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChalmers, P. N. \u0026amp; Tashjian, R. Z. Patch augmentation in rotator cuff repair. Curr. Rev. Musculoskelet. Med. 13, 561\u0026ndash;571 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12178-020-09658-4\u003c/span\u003e\u003cspan address=\"10.1007/s12178-020-09658-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeri, B. R., Chan, K. W. \u0026amp; Kwon, Y. W. Management of massive and irreparable rotator cuff tears. J. Shoulder Elbow Surg. 18, 808\u0026ndash;818 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jse.2009.03.013\u003c/span\u003e\u003cspan address=\"10.1016/j.jse.2009.03.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoileau, P. \u003cem\u003eet al.\u003c/em\u003e Arthroscopic repair of full-thickness tears of the supraspinatus: does the tendon really heal? J. Bone Joint Surg. Am. 87, 1229\u0026ndash;1240 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2106/JBJS.D.02035\u003c/span\u003e\u003cspan address=\"10.2106/JBJS.D.02035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLafosse, L., Brozska, R., Toussaint, B. \u0026amp; Gobezie, R. The outcome and structural integrity of arthroscopic rotator cuff repair with use of the double-row suture anchor technique. J. Bone Joint Surg. Am. 89, 1533\u0026ndash;1541 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2106/JBJS.F.00305\u003c/span\u003e\u003cspan address=\"10.2106/JBJS.F.00305\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugaya, H., Maeda, K., Matsuki, K. \u0026amp; Moriishi, J. Repair integrity and functional outcome after arthroscopic double-row rotator cuff repair. A prospective outcome study. J. Bone Joint Surg. Am. 89, 953\u0026ndash;960 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2106/JBJS.F.00512\u003c/span\u003e\u003cspan address=\"10.2106/JBJS.F.00512\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, J. \u003cem\u003eet al.\u003c/em\u003e Abaloparatide improves rotator cuff healing via anabolic effects on bone remodeling in a chronic rotator cuff tear model of rat with osteoporosis: a comparison with denosumab: response. Am. J. Sports Med. 51, NP3-NP4 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/03635465221139116\u003c/span\u003e\u003cspan address=\"10.1177/03635465221139116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCelikten, M. \u003cem\u003eet al.\u003c/em\u003e The effect of platelet-rich fibrin, platelet-rich plasma, and concentrated growth factor in the repair of full thickness rotator cuff tears. J. Shoulder Elbow Surg. 33, e261-e277 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jse.2023.09.028\u003c/span\u003e\u003cspan address=\"10.1016/j.jse.2023.09.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai, J. \u003cem\u003eet al.\u003c/em\u003e Exosomes derived from kartogenin-preconditioned mesenchymal stem cells promote cartilage formation and collagen maturation for enthesis regeneration in a rat model of chronic rotator cuff tear. Am. J. Sports Med. 51, 1267\u0026ndash;1276 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/03635465231155927\u003c/span\u003e\u003cspan address=\"10.1177/03635465231155927\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh, J. H., Kim, D. H., Jeong, H. J., Park, J. H. \u0026amp; Rhee, S. M. Effect of recombinant human parathyroid hormone on rotator cuff healing after arthroscopic repair. Arthroscopy. 35, 1064\u0026ndash;1071 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arthro.2018.11.038\u003c/span\u003e\u003cspan address=\"10.1016/j.arthro.2018.11.038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMigliaccio, S. \u003cem\u003eet al.\u003c/em\u003e Evaluation of persistence and adherence to teriparatide treatment in patients affected by severe osteoporosis (PATT): a multicenter observational real life study. Clin. Cases Miner. Bone Metab. 10, 56\u0026ndash;60 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.11138/ccmbm/2013.10.1.056\u003c/span\u003e\u003cspan address=\"10.11138/ccmbm/2013.10.1.056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan, J., Rhee, S. M., Kim, Y. W., Park, S. H. \u0026amp; Oh, J. H. Three-dimensionally printed recombinant human parathyroid hormone-soaked nanofiber sheet accelerates tendon-to-bone healing in a rabbit model of chronic rotator cuff tear. J. Shoulder Elbow Surg. 31, 1628\u0026ndash;1639 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jse.2022.02.013\u003c/span\u003e\u003cspan address=\"10.1016/j.jse.2022.02.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHettrich, C. M. \u003cem\u003eet al.\u003c/em\u003e The effect of rhPTH on the healing of tendon to bone in a rat model. J. Orthop. Res. 30, 769\u0026ndash;774 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jor.22006\u003c/span\u003e\u003cspan address=\"10.1002/jor.22006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRandelli, P. S., Stoppani, C. A., Santarsiero, G., Nocerino, E. \u0026amp; Menon, A. Platelet-rich plasma in arthroscopic rotator cuff repair: clinical and radiological results of a prospective randomized controlled trial study at 10-year follow-up. Arthroscopy. 38, 51\u0026ndash;61 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arthro.2021.05.017\u003c/span\u003e\u003cspan address=\"10.1016/j.arthro.2021.05.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo, C. H. \u003cem\u003eet al.\u003c/em\u003e Platelet-rich plasma for arthroscopic repair of medium to large rotator cuff tears: a randomized controlled trial. Am. J. Sports Med. 43, 2102\u0026ndash;2110 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0363546515587081\u003c/span\u003e\u003cspan address=\"10.1177/0363546515587081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTauberg, B. M., Su, J. C., Warth, R. J. \u0026amp; Gregory, J. M. Use of intraoperative platelet-rich plasma during rotator cuff repair is correlated with increased patient-level charges across multiple categories. J. Shoulder Elbow Surg. 32, e408-e414 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jse.2023.01.031\u003c/span\u003e\u003cspan address=\"10.1016/j.jse.2023.01.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamas, J. R. \u003cem\u003eet al.\u003c/em\u003e Adverse effects of xenogenic scaffolding in the context of a randomized double-blind placebo-controlled study for repairing full-thickness rotator cuff tears. Trials. 20, 387 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13063-019-3504-3\u003c/span\u003e\u003cspan address=\"10.1186/s13063-019-3504-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, C., Xiao, Z., Chen, L. \u0026amp; Pan, S. Efficacy and safety of extracorporeal shock wave on low back pain: a systematic review and meta-analysis. Medicine (Baltimore). 101, e32053 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/MD.0000000000032053\u003c/span\u003e\u003cspan address=\"10.1097/MD.0000000000032053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaake, M., Rautmann, M. \u0026amp; Wirth, T. Assessment of the treatment costs of extracorporeal shock wave therapy versus surgical treatment for shoulder diseases. Int. J. Technol. Assess. Health Care. 17, 612\u0026ndash;617 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLingeman, J. E., Woods, J., Toth, P. D., Evan, A. P. \u0026amp; McAteer, J. A. The role of lithotripsy and its side effects. J. Urol. 141, 793\u0026ndash;797 (1989). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0022-5347(17)41012-3\u003c/span\u003e\u003cspan address=\"10.1016/s0022-5347(17)41012-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrendel, W. Shock waves: a new physical principle in medicine. Eur. Surg. Res. 18, 177\u0026ndash;180 (1986). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000128523\u003c/span\u003e\u003cspan address=\"10.1159/000128523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, H., Lv, H. \u0026amp; Lin, T. Comparison of efficacy of eight treatments for plantar fasciitis: A network meta-analysis. J. Cell Physiol. 234, 860\u0026ndash;870 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcp.26907\u003c/span\u003e\u003cspan address=\"10.1002/jcp.26907\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTognolo, L. \u003cem\u003eet al.\u003c/em\u003e Myofascial points treatment with focused extracorporeal shock wave therapy (f-ESWT) for plantar fasciitis: an open label randomized clinical trial. Eur. J. Phys. Rehabil. Med. 58, 85\u0026ndash;93 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.23736/S1973-9087.21.06814-3\u003c/span\u003e\u003cspan address=\"10.23736/S1973-9087.21.06814-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, W. C. \u003cem\u003eet al.\u003c/em\u003e Extracorporeal shock wave therapy shows superiority over injections for pain relief and grip strength recovery in lateral epicondylitis: a systematic review and network meta-analysis. Arthroscopy. 38, 2018\u0026ndash;2034.e2012 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arthro.2022.01.025\u003c/span\u003e\u003cspan address=\"10.1016/j.arthro.2022.01.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y. \u003cem\u003eet al.\u003c/em\u003e Extracorporeal shock wave therapy improves nontraumatic knee contracture in a rat model. Clin. Orthop. Relat. Res. 481, 822\u0026ndash;834 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/CORR.0000000000002559\u003c/span\u003e\u003cspan address=\"10.1097/CORR.0000000000002559\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashimoto, S., Ichinose, T., Ohsawa, T., Koibuchi, N. \u0026amp; Chikuda, H. Extracorporeal shockwave therapy accelerates the healing of a meniscal tear in the avascular region in a rat model. Am. J. Sports Med. 47, 2937\u0026ndash;2944 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0363546519871059\u003c/span\u003e\u003cspan address=\"10.1177/0363546519871059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeichtinger, X. \u003cem\u003eet al.\u003c/em\u003e Improved biomechanics in experimental chronic rotator cuff repair after shockwaves is not reflected by bone microarchitecture. PLoS One. 17, e0262294 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0262294\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0262294\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeichtinger, X. \u003cem\u003eet al.\u003c/em\u003e Substantial biomechanical improvement by extracorporeal shockwave therapy after surgical repair of rodent chronic rotator cuff tears. Am. J. Sports Med. 47, 2158\u0026ndash;2166 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0363546519854760\u003c/span\u003e\u003cspan address=\"10.1177/0363546519854760\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, C. H., Shah, B., Moioli, E. K. \u0026amp; Mao, J. J. CTGF directs fibroblast differentiation from human mesenchymal stem/stromal cells and defines connective tissue healing in a rodent injury model. J. Clin. Invest. 125, 3992 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI84508\u003c/span\u003e\u003cspan address=\"10.1172/JCI84508\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, J. \u003cem\u003eet al.\u003c/em\u003e CTGF positively regulates BMP12 induced tenogenic differentiation of tendon stem cells and signaling. Cell Physiol. Biochem. 35, 1831\u0026ndash;1845 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000373994\u003c/span\u003e\u003cspan address=\"10.1159/000373994\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, C. H. \u003cem\u003eet al.\u003c/em\u003e Harnessing endogenous stem/progenitor cells for tendon regeneration. J. Clin. Invest. 125, 2690\u0026ndash;2701 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI81589\u003c/span\u003e\u003cspan address=\"10.1172/JCI81589\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugimoto, Y. \u003cem\u003eet al.\u003c/em\u003e Scx+/Sox9\u0026thinsp;+\u0026thinsp;progenitors contribute to the establishment of the junction between cartilage and tendon/ligament. Development. 140, 2280\u0026ndash;2288 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.096354\u003c/span\u003e\u003cspan address=\"10.1242/dev.096354\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShukunami, C., Oshima, Y. \u0026amp; Hiraki, Y. Chondromodulin-I and tenomodulin: a new class of tissue-specific angiogenesis inhibitors found in hypovascular connective tissues. Biochem. Biophys. Res. Commun. 333, 299\u0026ndash;307 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2005.05.133\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2005.05.133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShukunami, C. \u003cem\u003eet al.\u003c/em\u003e Scleraxis is a transcriptional activator that regulates the expression of Tenomodulin, a marker of mature tenocytes and ligamentocytes. Sci. Rep. 8, 3155 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-018-21194-3\u003c/span\u003e\u003cspan address=\"10.1038/s41598-018-21194-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuchmann, S. \u003cem\u003eet al.\u003c/em\u003e Refixation of the supraspinatus tendon in a rat model\u0026ndash;influence of continuous growth factor application on tendon structure. J. Orthop. Res. 31, 300\u0026ndash;305 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jor.22211\u003c/span\u003e\u003cspan address=\"10.1002/jor.22211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuchmann, S. \u003cem\u003eet al.\u003c/em\u003e Rotator cuff changes in a full thickness tear rat model: verification of the optimal time interval until reconstruction for comparison to the healing process of chronic lesions in humans. Arch. Orthop. Trauma Surg. 131, 429\u0026ndash;435 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00402-010-1246-5\u003c/span\u003e\u003cspan address=\"10.1007/s00402-010-1246-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTokunaga, T. \u003cem\u003eet al.\u003c/em\u003e FGF-2 stimulates the growth of tenogenic progenitor cells to facilitate the generation of tenomodulin-positive tenocytes in a rat rotator cuff healing model. Am. J. Sports Med. 43, 2411\u0026ndash;2422 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0363546515597488\u003c/span\u003e\u003cspan address=\"10.1177/0363546515597488\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTokunaga, T. \u003cem\u003eet al.\u003c/em\u003e Enhancement of rotator cuff tendon-bone healing with fibroblast growth factor 2 impregnated in gelatin hydrogel sheets in a rabbit model. J. Shoulder Elbow Surg. 26, 1708\u0026ndash;1717 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jse.2017.03.020\u003c/span\u003e\u003cspan address=\"10.1016/j.jse.2017.03.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTokunaga, T. \u003cem\u003eet al.\u003c/em\u003e Local application of gelatin hydrogel sheets impregnated with platelet-derived growth factor BB promotes tendon-to-bone healing after rotator cuff repair in rats. Arthroscopy. 31, 1482\u0026ndash;1491 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arthro.2015.03.008\u003c/span\u003e\u003cspan address=\"10.1016/j.arthro.2015.03.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, C. C., Hijaz, A., Drazba, J. A., Damaser, M. S. \u0026amp; Daneshgari, F. Collagen remodeling and suburethral inflammation might account for preserved anti-incontinence effects of cut polypropylene sling in rat model. Urology. 73, 415\u0026ndash;420 (2009). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.urology.2008.07.033\u003c/span\u003e\u003cspan address=\"10.1016/j.urology.2008.07.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJunqueira, L. C., Cossermelli, W. \u0026amp; Brentani, R. Differential staining of collagens type I, II and III by Sirius Red and polarization microscopy. Arch. Histol. Jpn. 41, 267\u0026ndash;274 (1978). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1679/aohc1950.41.267\u003c/span\u003e\u003cspan address=\"10.1679/aohc1950.41.267\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWildemann, B. \u0026amp; Klatte, F. Biological aspects of rotator cuff healing. Muscles Ligaments Tendons J. 1, 161\u0026ndash;168 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChartier, C. \u003cem\u003eet al.\u003c/em\u003e Tendon: principles of healing and repair. Semin. Plast. Surg. 35, 211\u0026ndash;215 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1055/s-0041-1731632\u003c/span\u003e\u003cspan address=\"10.1055/s-0041-1731632\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZumstein, M. A., L\u0026auml;dermann, A., Raniga, S. \u0026amp; Sch\u0026auml;r, M. O. The biology of rotator cuff healing. Orthop. Traumatol. Surg. Res. 103, S1-S10 (2017). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.otsr.2016.11.003\u003c/span\u003e\u003cspan address=\"10.1016/j.otsr.2016.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalatz, L. M. \u003cem\u003eet al.\u003c/em\u003e Characteristics of the rat supraspinatus tendon during tendon-to-bone healing after acute injury. J. Orthop. Res. 24, 541\u0026ndash;550 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jor.20067\u003c/span\u003e\u003cspan address=\"10.1002/jor.20067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaffulli, N., Ewen, S. W., Waterston, S. W., Reaper, J. \u0026amp; Barrass, V. Tenocytes from ruptured and tendinopathic achilles tendons produce greater quantities of type III collagen than tenocytes from normal achilles tendons. An in vitro model of human tendon healing. Am. J. Sports Med. 28, 499\u0026ndash;505 (2000). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/03635465000280040901\u003c/span\u003e\u003cspan address=\"10.1177/03635465000280040901\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, S. H., Yang, R. S., al-Shaikh, R. \u0026amp; Lane, J. M. Collagen in tendon, ligament, and bone healing. A current review. Clin. Orthop. Relat. Res. 265\u0026ndash;278 (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing, X., Li, Z., Yu, Z., Cheng, G. \u0026amp; Li, D. Effects of connective tissue growth factor (CTGF/CCN2) on condylar chondrocyte proliferation, migration, maturation, differentiation and signalling pathway. Biochem. Biophys. Res. Commun. 495, 1447\u0026ndash;1453 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2017.11.190\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2017.11.190\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenjamin, M. \u003cem\u003eet al.\u003c/em\u003e The skeletal attachment of tendons\u0026ndash;tendon \"entheses\". Comp. Biochem. Physiol. A Mol. Integr. Physiol. 133, 931\u0026ndash;945 (2002). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s1095-6433(02)00138-1\u003c/span\u003e\u003cspan address=\"10.1016/s1095-6433(02)00138-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFurumatsu, T. \u003cem\u003eet al.\u003c/em\u003e Mechanical stretch increases Smad3-dependent CCN2 expression in inner meniscus cells. J. Orthop. Res. 30, 1738\u0026ndash;1745 (2012). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jor.22142\u003c/span\u003e\u003cspan address=\"10.1002/jor.22142\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFurumatsu, T., Kanazawa, T., Yokoyama, Y., Abe, N. \u0026amp; Ozaki, T. Inner meniscus cells maintain higher chondrogenic phenotype compared with outer meniscus cells. Connect Tissue Res. 52, 459\u0026ndash;465 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/03008207.2011.562061\u003c/span\u003e\u003cspan address=\"10.3109/03008207.2011.562061\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishida, T., Nakanishi, T., Asano, M., Shimo, T. \u0026amp; Takigawa, M. Effects of CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, on the proliferation and differentiation of osteoblastic cells in vitro. J. Cell. Physiol. 184, 197\u0026ndash;206 (2000). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/1097-4652(200008)184:2\u0026lt;197::AID-JCP7\u0026gt;3.0.CO;2-R\u003c/span\u003e\u003cspan address=\"10.1002/1097-4652(200008)184:2%3C197::AID-JCP7%3E3.0.CO;2-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchweitzer, R. \u003cem\u003eet al.\u003c/em\u003e Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development. 128, 3855\u0026ndash;3866 (2001). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.128.19.3855\u003c/span\u003e\u003cspan address=\"10.1242/dev.128.19.3855\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurchison, N. D. \u003cem\u003eet al.\u003c/em\u003e Regulation of tendon differentiation by scleraxis distinguishes force-transmitting tendons from muscle-anchoring tendons. Development. 134, 2697\u0026ndash;2708 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/dev.001933\u003c/span\u003e\u003cspan address=\"10.1242/dev.001933\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakabe, T. \u003cem\u003eet al.\u003c/em\u003e Transcription factor scleraxis vitally contributes to progenitor lineage direction in wound healing of adult tendon in mice. J. Biol. Chem. 293, 5766\u0026ndash;5780 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.RA118.001987\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA118.001987\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGulotta, L. V., Kovacevic, D., Packer, J. D., Deng, X. H. \u0026amp; Rodeo, S. A. Bone marrow-derived mesenchymal stem cells transduced with scleraxis improve rotator cuff healing in a rat model. Am. J. Sports Med. 39, 1282\u0026ndash;1289 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0363546510395485\u003c/span\u003e\u003cspan address=\"10.1177/0363546510395485\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYonemitsu, R. \u003cem\u003eet al.\u003c/em\u003e Fibroblast growth factor 2 enhances tendon-to-bone healing in a rat rotator cuff repair of chronic tears. Am. J. Sports Med. 47, 1701\u0026ndash;1712 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/0363546519836959\u003c/span\u003e\u003cspan address=\"10.1177/0363546519836959\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"extracorporeal shockwave therapy, rotator cuff tear, tendon-to-bone, CCN2, SCX","lastPublishedDoi":"10.21203/rs.3.rs-4603175/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4603175/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe histological and genetic changes associated with significant tendon-to-bone differences after extracorporeal shockwave therapy (ESWT) are unknown. This controlled laboratory study investigated the histological and genetic changes in the rotator cuff induced by ESWT. Twenty-two retired male Wistar rats were induced with left supraspinatus tendon ruptures. Three weeks later, rotator cuff repair was performed. One week post-repair, the rats were randomly assigned into either the ESWT or control group, with 11 rats in each group. Compared with the control group, the ratio of cellularity was significantly lower, and that of collagen fiber orientation was significantly higher in the ESWT group. The number of blood vessels and the total histological scores were not significantly different between the two groups. Real-time polymerase chain reaction analysis revealed that the mRNA expressions of \u003cem\u003eCCN2\u003c/em\u003e and \u003cem\u003eSCX\u003c/em\u003e were significantly higher in the ESWT group than in the control group. No statistically significant differences were found between the \u003cem\u003eSOX9\u003c/em\u003e and \u003cem\u003eTnmd\u003c/em\u003e expressions. ESWT induces histological changes and increases the messenger RNA expressions of \u003cem\u003eCCN2\u003c/em\u003e and \u003cem\u003eSCX\u003c/em\u003e in rotator cuff repair of chronic tears in rats. ESWT is a potential method for promoting histological and cytological changes associated with improving the mechanical strength of rotator cuff repair.\u003c/p\u003e","manuscriptTitle":"Histological and genetic changes induced by extracorporeal shockwave therapy after rotator cuff repair in a rat model with tears","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-15 06:31:02","doi":"10.21203/rs.3.rs-4603175/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-14T14:22:30+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"167525758121167557923903748036446928535","date":"2025-07-16T05:44:38+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-06T08:09:10+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-02T02:19:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"109546471219175374976666283823922860350","date":"2025-05-29T02:25:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"48128442431628568890925151145702105937","date":"2025-05-27T00:22:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-23T03:26:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"4860852033969897607708444654031242880","date":"2024-07-21T23:38:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"206431165608177936018551201468632952034","date":"2024-07-21T18:41:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-21T17:56:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-13T16:58:34+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-24T12:31:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-24T05:15:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-06-19T04:44:36+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a5aa6e3d-21ab-4fe6-b00a-9cb221b46c41","owner":[],"postedDate":"July 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":34554821,"name":"Health sciences/Anatomy/Musculoskeletal system/Cartilage"},{"id":34554822,"name":"Health sciences/Anatomy/Musculoskeletal system/Ligaments"},{"id":34554823,"name":"Health sciences/Anatomy/Musculoskeletal system/Tendons"}],"tags":[],"updatedAt":"2026-01-19T16:48:11+00:00","versionOfRecord":{"articleIdentity":"rs-4603175","link":"https://doi.org/10.1038/s41598-026-35072-w","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-01-12 16:30:29","publishedOnDateReadable":"January 12th, 2026"},"versionCreatedAt":"2024-07-15 06:31:02","video":"","vorDoi":"10.1038/s41598-026-35072-w","vorDoiUrl":"https://doi.org/10.1038/s41598-026-35072-w","workflowStages":[]},"version":"v1","identity":"rs-4603175","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4603175","identity":"rs-4603175","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.