Vector Competence of Culex quinquefasciatus  for Tembusu Virus and Viral Determinants for Virus Transmission by Mosquitoes

Vector Competence of Culex quinquefasciatus for Tembusu Virus and Viral Determinants for Virus Transmission by Mosquitoes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Vector Competence of Culex quinquefasciatus for Tembusu Virus and Viral Determinants for Virus Transmission by Mosquitoes Yibing Tang, Yu He, Xiaoli Wang, Zhen Wu, Senyan Du, Mingshu Wang, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4023085/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Sep, 2024 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Abstract The recent pandemic of flaviviruses all over the world has underscored the importance of studying flavivirus vector competence, as the evolutionary enhancement of mosquito transmission played a significant role in its spread. Tembusu virus is an avian-related mosquito-borane flavivirus, which is mainly epidemic in China and Southeast Asia since 2010. However, the reason for the outbreak of Tembusu virus in 2010 remains unclear, and it is unknown whether changes in vector transmission played an essential role in this process. To address these questions, we conducted a study using Culex quinquefasciatus as a model for Tembusu virus infection, employing both oral infection and microinjection methods. Our findings confirmed that both vertical and horizontal transmission collectively contribute to the cycle of Tembusu virus within the mosquito population, with persistent infection observed. Importantly, our data revealed that the prototypical Tembusu virus MM_1775 strain exhibited significantly higher infectivity and transmission rates in mosquitoes compared to a duck Tembusu virus (CQW1 strain). Furthermore, we identified that the viral E protein and 3' untranslated region are key elements responsible for these differences. In conclusion, our study sheds light on the mosquito transmission of Tembusu virus and provides valuable insights into the factors influencing its infectivity and transmission rates. These findings contribute to a better understanding of Tembusu virus epidemiology and can potentially aid in the development of strategies to control its spread. Tembusu virus Culex quinquefasciatus vector competence mosquito transmission vertical transmission venereal transmission Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Mosquito-borane flaviviruses, such as Zika virus (ZIKV), dengue virus (DENV), Japanese encephalitis viruses (JEV), and yellow fever virus (YFV), pose a significant threat to global public health, causing various diseases in animals and humans worldwide. Among these flaviviruses, Tembusu virus (TMUV) is an emerging mosquito-borane flavivirus that causes severe neurological and reproductive diseases in birds. TMUV (MM_1775 strain) was first isolated from Culex tritaeniorhynchus mosquitoes in Malaysia in 1955[1]. However, it was only sporadically reported in subsequent decades. In 2010, an infectious disease characterized by duck egg-drop syndrome broke out in China, resulting in enormous economic losses. The pathogen responsible for this outbreak was eventually confirmed as duck TMUV. Currently, TMUV strains have been classified into three clusters based on their major antigen gene E [2, 3]. Cluster 1 includes TMUV strains isolated from Southeast Asia, while Cluster 2 consists of most waterfowl-origin isolates from China and Southeast Asian countries. Most of the duck TMUV isolated in China since 2010 falls into Cluster 2.2. The mosquito-origin TMUV, including the MM_1775 strain, and the recent chicken-origin TMUV (since 2020) form Cluster 3[2]. TMUV exhibits a broad host tropism and has been isolated from mosquitoes and various avian species, including ducks, chickens, geese, and sparrows. In laboratory studies, TMUV has shown efficient replication in avian (i.e. DF-1, embryo fibroblasts of duck and goose), mosquito cells (i.e. C6/36), and mammalian (i.e. Vero, BHK21, HEK293, HepG2 and SH-SY5Y) cell lines. Although TMUV exhibits high neurovirulence in mice, it does not show neuroinvasiveness. Serological investigations in China[4] and Thailand[5] have detected high anti-TMUV antibody titers in individuals at risk, such as workers in duck farms or nearby residents, and high positive-rate of TMUV by RT-PCR in duck farm workers in China are also indicated. This raises the possibility of TMUV as a potential zoonotic flavivirus. Most mosquito-borane flaviviruses, such as ZIKV and DENV, undergo a cycle between mosquitoes and vertebrate hosts in nature. When mosquitoes bite and feed on infected hosts, they acquire virions circulating in the host's blood. Then the viruses establish an infection in the mosquitoes’ midgut and disseminate to other organs through the mosquito's haemocoel. After robust virus replication in the salivary glands, the viruses can be transmitted to naive hosts through mosquito biting. Within mosquito population, both vertical transmission and venereal transmission routes have been confirmed to maintain the flavivirus infection [6, 7]. In vertebrate hosts, the viruses are injected intradermally by mosquitoes during a new blood meal. Immune cells in the skin, such as dendritic cell subsets, monocytes, and macrophages, are permissive for initial flavivirus infection in hosts, which then disseminate to systemic tissues through blood circulation [8]. Enhanced mosquito vector transmission of flaviviruses can significantly contribute to their epidemic potential. For example, a single mutation within the NS1 protein has been shown to increase ZIKV infectivity and prevalence in Aedes aegypti , therefore could have facilitated ZIKV transmission during its epidemics in 2016[9]. Despite significant progress in understanding various aspects of TMUV over the past decade, our knowledge of its mosquito transmission remains limited. Although TMUV has been identified in different mosquitoes, such as Culex pipiens , and the vector competence of Culex pipiens has been experimentally confirmed, the mechanisms of TMUV cycling within mosquito populations are still unknown. Additionally, it is unclear whether evolutionary variations have an impact on viral infectivity and prevalence in mosquitoes. In this study, we established a Culex quinquefasciatus model for TMUV and conducted a detailed analysis of the transmission routes of TMUV within mosquito populations, as well as the viral determinants affecting TMUV infection in mosquitoes. These findings will contribute to a better understand of vector transmission of TMUV. Materials And Methods Viruses Both TMUV strains used in present study are rescued from infectious clones[10, 11], and all virus stocks were prepared in BHK-21 cells. The CQW1 (KM233707.1) is a duck-origin strain isolated in 2013, while the prototypical strain MM_1775 (JX477685.2) was isolated from Culex tritaeniorhynchus in Malaysia in 1955. The chimeric TMUV MM/CQ-3’UTR has been reported in the previously study [12]. MM/CQ-E and MM/CQ-NS1 were generated by replacing the entire MM_1775-E gene or -NS1 gene with the corresponding genes from CQW1 using reverse genetic techniques. Thoracic microinjection of TMUV in mosquitoes At 7~10 days post hatching, the mosquitoes were anaesthetized on a cold tray. Subsequently, 0.3µL of TMUV in DMEM (containing certain titer) was microinjected into the mosquito thoraxes under a stereo microscope (Phenix, China). The infected mosquitoes were then raised in a container at 28±2°C and 80% humidity under standard conditions, and the survival of injected mosquitoes was recorded at 24-48 hours post infection. Finally, live mosquitoes were collected at indicated time points and subjected to RT-qPCR analysis. Membrane blood feeding Commercial defibrinated sheep blood or heat-inactivated duck, mice, or rabbit blood (following a pretreated procedure similar to a previously reported method [9]) was gently mixed with TMUV at a 1:1 ratio. The mixed blood solution was then added into the feeder of membrane feeding system for blood-sucking insects (Hemotek, USA), and the temperature was maintained at 37℃. Subsequently, the feeder was placed into the mosquito cup containing female mosquitoes that had been pre-treated with hunger for 1-2 days. After 30~40 min of blood meal in dark, the feeder was removed, and engorged female mosquitoes were selected and transferred into new containers and kept under standard conditions. At indicated timepoints, the mosquitoes were killed for dissection under the stereo microscope, mosquitoes’ heads or salivary glands were isolated for virus load analysis using RT-qPCR. Mosquito transmission of MM_1775 and CQW1 At 7-10 days post hatching, a total of 240 female mosquitoes were randomly divided into 6 groups, with 40 mosquitoes in each group. After starvation treatment for 1-2 days, the mosquitoes were orally infected with MM_1775 or CQW1 at a titer of 10 5.5 TCID 50 /mL. At 4, 7, and 14 days post infection, tissue samples of mosquito midgut, head/leg and salivary glands were taken, respectively, and used for RT-qPCR detection to assess virus IR, DR and TR. To viral determinants for the difference of mosquito vector competence between MM_1775 and CQW1, female mosquitoes were oral infected with MM_1775 or TMUV MM/CQ-3’UTR or MM/CQ-E or MM/CQ-NS1, at a dose of 10 5 TCID 50 /mL. After 8 days post infection, mosquitoes were killed for detecting IR. To further confirm the result, 10 3 TCID 50 /mL of each virus were microinjected into mosquitoes, and 7 days post infection, mosquitoes were killed for detecting IR. Venereal transmission The experimental procedure for venereal transmission study is similar to a previously reported method [6] with slight modifications. In brief, culex mosquitoes were divided into 4 groups, consisting of two female groups and two male groups. After a 24-hour starvation period, one group of female mosquitoes and one group of male mosquitoes were injected with CQW1 at a concentration of 10 5 TCID 50 /mL, respectively. The remaining two groups were injected with MM_1775. After one day post-infection, the survival of mosquitoes was recorded, and each group was introduced to an equal number of naive female/male mosquitoes to allow for mating. A piece of cotton mesh soaked in a 10% sucrose solution was provided for mosquito feeding (the sucrose solution was replaced daily), placed on top of the cage to prevent oral contamination. Vertical transmission For the assessment of vertical transmission, at 7-10 days post eclosion, 40 female mosquitoes were microinjected with CQW1 virus at a dose of 10 5 TCID 50 /mL. These infected females were then housed with male mosquitoes. To stimulate egg-laying, anaesthetized Kunming mice were placed on top of the container for mosquito feeding and allowed to feed for approximately 30 minutes (the mosquitoes were starved for 24 hours prior to engorgement). After laying eggs, a portion of the eggs was directly subjected to virus detection, while the remaining eggs were hatched, and the resulting larvae were raised to adulthood for subsequent virus detection. RNA extraction and RT–qPCR The total RNA of mosquito was isolated using Total RNA Extraction Kit (Axygen, USA) per the manufacturer's instructions. Subsequently, 1st-strand cDNA was transcribed using a HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). To detect viral copies, RT–qPCR assays were performed using 2× Taq SYBR Green qPCR Premix (Innovagene, Changsha, China) with a CFX Connect Real-Time PCR Detect System (Bio–Rad, USA) following the manufacturer’s protocols. The primers for RT-qPCR are presented in Table 3. Quantification and statistical analysis The data from the analyses of the RT–qPCR data are presented as the mean ± Standard error of the mean (SEM). Using GraphPad Prism 9.5 software, the statistical significance was assessed by Student’s t test, and significance was defined by a P value < 0.05 (*). Results The Culex quinquefasciatus model for TMUV infection through membrane blood feeding To simulate the infection process through mosquito bites, we initially employed the membrane blood feeding method to establish a Culex quinquefasciatus model for studying TMUV transmission. We tested four different sources of blood from various animal hosts (duck, mouse, rabbit, and sheep) for infection (Figure. 1A). As shown in Figure. 1B-D, when feeding on duck blood, mosquito TMUV (MM_1775 strain) exhibited a significantly higher infection rate (IR) compared to duck TMUV (CQW1 strain). This may be attributed to the interaction between the duck host and the viruses. MM_1775 also showed a slightly higher IR than CQW1 when fed with blood from other sources, although the difference was not statistically significant. Nevertheless, the data indicate that all blood from different host sources are competent for TMUV infection through membrane blood feeding. To determine the minimum dose of TMUV required to establish infection in Culex mosquitoes through membrane blood feeding, we performed a series of 10-fold continuous dilutions of the MM_1775 virus solution (in DMEM) and mixed it with sheep blood for feeding. As shown in Figure. 1E, most mosquitoes survived at 2 days post-infection. Surprisingly, an IR of 61.1% (11/18) was observed only at a dose of 10 5 TCID 50 /mL, and no virus RNA was detected when the infection doses were less than 10 4 TCID 50 /mL. These findings suggest that Culex quinquefasciatus is competent for both MM_1775 and CQW1 strains through membrane blood feeding. Mosquito TMUV exhibits higher infectivity than duck TMUV in Culex quinquefasciatus Compared to membrane blood feeding, the microinjection method is a more convenient and effective approach for infecting mosquitoes. After confirming the competence of Culex quinquefasciatus for TMUV, we determined the infection dose required for establishing infection through microinjection (Figure. 2A). As shown in Figure 2B, the IR of the CQW1 strain dramatically decreased from 96.2% (20/21) to 7.7% (1/13) when the infection dose decreased from 10 5 TCID 50 /mL to 10 2 TCID 50 /mL. In contrast, the MM_1775 strain exhibited higher potency, maintaining a 100% IR when the infection dose was not less than 10 3 TCID 50 /mL (Figure. 2C). Even at a very low dose of 10 2 TCID 50 /mL, there was still a 68.8% IR. These data suggest that MM_1775 shows significantly higher efficiency in infecting Culex quinquefasciatus compared to CQW1 at the same dose. Once the virus and blood are ingested by mosquitoes, they enter the midgut where the initial infection must be established. However, before the viruses can disseminate throughout the mosquito's body, they need to overcome the midgut epithelial barrier. After robust replication in the mosquito's salivary glands, the viruses are then ready to be transmitted to vertebrates through intra-dermal injection. To determine mosquito vector competence, three indicators are used: IR, which measures the rate at which the virus is detectable in the midgut; Dissemination Rate (DR), which evaluates the presence of the virus in the head and legs of infected mosquitoes; and Transmission Rate (TR), which quantifies the presence of the virus in the salivary glands. Currently, there is limited data available on the vector transmission of TMUV. In order to better understand the effect of different virus strains on viral vector transmission, we compared the virus dissemination and transmission of the MM_1775 strain with the CQW1 strain. Culex mosquitoes were artificially infected by microinjection at an infection dose of 10 5.5 TCID 50 /mL. At specific timepoints (4/7/14 days post infection), virus dissemination and transmission were assessed using RT-qPCR. As shown in Table 1, virus dissemination of MM_1775 was consistently detected at all timepoints. In contrast, dissemination of CQW1 viruses was only detected at later timepoints. Most importantly, only MM_1775 viruses were detected in the mosquito's salivary glands, while no CQW1 virus RNA was detected under the same conditions. These results suggest that the mosquito-derived strain MM_1775 has a better transmission capability in mosquitoes compared to the duck-derived strain CQW1. The viral determinant of vector transmission of TMUV To further investigate the viral determinants affecting TMUV transmission, a set of chimeric viruses was generated using MM_1775 as the backbone. Following feeding with 10 5 TCID 50 /mL of TMUV in a blood meal, virus presence was detected to calculate the IR at 8 days post-infection (Figure. 3A-C). The IRs of MM/CQ-E virus and MM/CQW1-3’UTR were found to be 33.3% (5/15) and 23.5% (4/17), respectively, which were significantly lower than wild-type MM_1775 (93.8%). However, the replacement of NS1 showed little effect on IR in mosquito. When Culex mosquitoes were infected via microinjection, all chimeric TMUVs reached a 100% IR, but viral loads of MM/CQW1-3’UTR were lower than the others (Figure. 3D-F). The results suggest that variations in the E protein and 3’UTR, but not in NS1, are responsible for the differences in mosquito infection between MM_1775 and CQW1 strains. Venereal transmission of TMUV in paired mosquitoes In the natural cycle, mosquito-borane flaviviruses are transmitted by female mosquito bites. However, the possibility of male mosquitoes acting as virus reservoirs through sexual transmission cannot be excluded. Therefore, we measured viral loads and IRs of TMUV in both female and male mosquitoes (Figure.4A). Similar levels of CQW1 viral loads were detected in both female and male mosquitoes on days 4, 7 and 14 post infection (Figure.4B), with no significant difference in IRs between genders of Culex mosquitoes. Similar results were observed for the mosquito TMUV MM_1775 strain (Figure.4C), indicating that the gender of Culex mosquitoes has no effect on their vector competence. To assess whether TMUV can be transmitted from female to male or male to female mosquitoes, infected female or male mosquitoes were grouped into mating pairs with naive male or female mosquitoes, respectively (Figure.4D). Female-to-male transmission was observed for both MM_1775 and CQW1 viruses, with a minimum infection rate (MIR) of 4.8% and 6.66%, respectively (Figure.4E). Male-to-female transmission was also observed at an MIR of 3.84% for the MM_1775 virus. These findings indicate that TMUV can be transmitted in both directions, from male to female as well as from female to male. Vertical transmission of TMUV in Culex mosquitoes It is believed that vertical transmission is the primary route for maintaining flaviviruses within mosquito populations. To verify whether TMUV can be vertically transmitted, female mosquitoes were infected with CQW1 viruses through microinjection. At 7 days post-infection, the infected mosquitoes were co-raised with mice to encourage mosquito bites and blood-feeding, which would stimulate the females to lay eggs. A portion of the laid eggs was collected for virus detection, while the remaining eggs were used for hatching mosquito larvae (Figure.5A). Out of the collected mosquito egg samples, 13.8% (4/29) tested positive for TMUV, with a viral copy number of 10 5.091±0.9267 (Figure 5B, Table 2). After hatching and reaching adulthood, 25.9% (7/27) of the female mosquito sample pools were positive for TMUV, with a MIR of 5.2% (7/135) and a copy number of 10 5.469±0.0873 (Figure.5C, Table 2). Additionally, 47.2% (17/36) of the male mosquito sample pools were found to be positive, with an MIR of 9.4% (17/180) and a copy number of 10 5.609±0.0953 . These findings indicate that virus RNA can be detected in both the egg stage and adult stage, suggesting that TMUV can be vertically transmitted within Culex mosquitoes. The persistent infection of TMUV To determine the duration of TMUV infection in Culex mosquitoes, orally infected female mosquitoes with 10 5.5 TCID 50 /mL were continuously reared. The experiment was limited to 35 days as mosquitoes started to die after this timepoint. For MM_1775, the IR increased from 40% (2/5) to 100% (5/5) between day 7 and day 14 after infection. Importantly, MM_1775 still maintained a 60% IR at 35 days post-infection (Figure.6A). As expected, CQW1 displayed a lower IR compared to MM_1775, but viral RNA was still detected at 35 days post-infection (Figure.6B). These results indicate a persistent infection of TMUV in Culex mosquitoes. Discussion TMUV was first identified in Malaysia in 1955 from Culx tritaeniorhynchus mosquitoes. However, it was only occasionally reported in Southeast Asia in the following decades. In 2010, duck farms in most duck-breeding regions of China experienced an outbreak of an infectious disease known as duck egg-drop syndrome, and it was finally confirmed that TMUV was the cause. TMUV has since been detected in several species of Culex mosquitoes, including Culx tritaeniorhynchus , Culx vishnui, Culx quinquefasciatus , Culx annulus , and Culx pipiens [13]. therefore, Culex spp. mosquitoes have been proposed as the main transmission vector for TMUV, particularly Culx Tritaeniorhynchus [14]. However, the vector competence of Culex mosquitoes has not been thoroughly characterized in the past decade. In this study, we assessed the vector competence of Culx quinquefasciatus and analyzed the factors associated with vector transmission of TMUV in mosquitoes. Consistent with a previously report [14], only a high titer of TMUV (≥10 5 TCID 50 /ml) could resulted in a successful infection when Culx quinquefasciatus were challenged orally. This high titer requirement may be due to the lack of essential host factors or viral proteins that facilitate mosquitoes in acquiring the virions during the blood feeding process. This phenomenon has been widely reported in other mosquito-borane flaviviruses[8]. For example, ZIKV NS1 antigenemia could promote virion acquisition by mosquitoes, thereby facilitating transmission during the ZIKV epidemic in 2016 [9]. However, our data still indicates the successful establishment of the mosquito infection model for TMUV, and once again suggests that Culx quinquefasciatus is one of the main transmission vectors of TMUV in nature. The evolutionary increase in infectivity within mosquito vectors, leading to high epidemic potential, has been reported for several mosquito-borne viruses [9, 15, 16]. However, contrary to our expectations, the CQW1 strain showed significantly lower infectivity and prevalence in mosquitoes compared to the MM_1775 strain. CQW1 is a prevalent strain in ducks, belonging to Cluster 2.2, which mainly consists of avian-derived strains prevalent in China after 2010. On the other hand, MM_1775 is the prototypical mosquito TMUV and belongs to Cluster 3.1 [2]. This result suggests that the outbreak of duck TMUV in China since 2010 may not be correlated with increased mosquito transmission of TMUV, and other routes of viral transmission may play important roles in this process. Yan’s data[17] indicate that a serine residue at position 156 in the E protein of FX2010 (a duck TMUV strain) is substituted by a proline residue at the same position in MM_1775.This substitution disrupts N-linked glycosylation at amino acid 154 and causes a conformational change in the “150 loop”. This mutation is also responsible for the changed tissue tropism and the loss of contact-transmissibility of TMUV in ducks. Therefore, we propose that contact-transmissibility from bird-to-bird may be a critical route for TMUV transmission, in 2010 outbreak. This hypothesis is further supported by the data showing that TMUV-related disease still spreads in autumn when there is low or no mosquito activity[18]. Flavivirus evolution shapes virus fitness in both vertebrate hosts and mosquitoes. Various viral determinants, such as C, E, NS1 and 3'UTR, have been identified to influence flavivirus infectivity and transmission in mosquitoes[19]. In the present study, we identified that both E protein and 3’UTR of TMUV are contribute to differences in infectivity and transmission between MM_1775 and CQW1 in mosquitoes. Flavivirus E protein is a key envelope protein that controls virus attachment and entry, affecting viral host specificity and tissue/cell tropism. Additionally, the 3'UTR of flaviviruses, with its RNA structures and genomic variations, plays a role in host adaptation [20-22]. The 3’UTR is responsible for generating subgenomic flavivirus RNA (sfRNA), which can enhance mosquito transmission [23]. The structure of the 3’UTR determines the number and abundance of sfRNA species. In this study, we observed a significant decrease in the in vivo infectivity of TMUV in mosquitoes when the MM_1775 3'UTR was replaced with the CQW1 3'UTR, consistent with our previous findings [12] that TMUV 3’UTR is responsible for cell-specific adaptation. However, further research is needed to elucidate the detailed mechanism behind this phenomenon. In conclusion, the present study successfully established the Culx quinquefasciatus model for TMUV infection in the laboratory and investigated important factors associated with mosquito vector competence and transmission. These findings provide valuable insights for future research on TMUV mosquito transmission. Declarations Ethics approval and consent to participate The experiments were approved by the Institutional Animal Care and Use Committee of Sichuan Agriculture University in Sichuan, China (Protocol Permit Number: SYXK(川) 2019-187). Consent for publication Not applicable Availability of data and materials All data to understand and assess the conclusions of this study are available in this published article. The raw data that support the findings of this study are available from the corresponding author upon reasonable request. Competing interests The authors declared that there are no competing financial interests regarding the publication of this paper. Funding The National Key Research and Development Program of China (2022YFD1801900)，National Natural Science Foundation of China (32272976 & 32302848), Sichuan Provincial Department of Science and Technology international scientific and technological innovation cooperation (2022YFH0026), the earmarked fund for China Agriculture Research System(CARS-42-17), the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021-18). Authors' contributions SC, YT and XW designed research, YT and XW performed research, SD provided to this experimental material, YT, YH analyzed data; YH and SC wrote the paper. ZW, MW, RJ, DZ, ML, XZ, QY, YW, SZ, JH, XO, DS, and AC helped with the experiments. All authors read and approved the final manuscript. Acknowledgements This work was funded by grants from the National Key Research and Development Program of China (2022YFD1801900), National Natural Science Foundation of China (32272976 & 32302848), Sichuan Provincial Department of Science and Technology international scientific and technological innovation cooperation (2022YFH0026), the earmarked fund for China Agriculture Research System (CARS-42-17), and the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021-18). The funding bodies had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript. References US Army Medical Research Unit (Malaya). Institute for Medical Research FoM (1957) Annual Report. Kuala Lampur, Malaya Huang Y, Hu Z, Dong J, Li L, Zhang J, Kuang R, Gao S, Sun M, and Liao M (2023) Chicken-origin Cluster 3.2 Tembusu virus exhibits higher infectivity than duck-origin Cluster 2 Tembusu virus in chicks. Front Vet Sci 10:1152802 Yan D, Li X, Wang Z, Liu X, Dong X, Fu R, Su X, Xu B, Teng Q, Yuan C, Zhang Z, Liu Q, and Li Z (2022) The emergence of a disease caused by a mosquito origin Cluster 3.2 Tembusu virus in chickens in China. Vet Microbiol 272:109500 Tang Y, Gao X, Diao Y, Feng Q, Chen H, Liu X, Ge P, and Yu C (2013) Tembusu virus in human, China. Transbound Emerg Dis 60:193-6 Pulmanausahakul R, Ketsuwan K, Jaimipuk T, Smith DR, Auewarakul P, and Songserm T (2021) Detection of antibodies to duck tembusu virus in human population with or without the history of contact with ducks. Transbound Emerg Dis Campos SS, Fernandes RS, Dos Santos AAC, de Miranda RM, Telleria EL, Ferreira-de-Brito A, de Castro MG, Failloux AB, Bonaldo MC, and Lourenco-de-Oliveira R (2017) Zika virus can be venereally transmitted between Aedes aegypti mosquitoes. Parasit Vectors 10:605 Thangamani S, Huang J, Hart CE, Guzman H, and Tesh RB (2016) Vertical Transmission of Zika Virus in Aedes aegypti Mosquitoes. Am J Trop Med Hyg 95:1169-1173 Yu X, Zhu Y, Xiao X, Wang P, and Cheng G (2019) Progress towards Understanding the Mosquito-Borne Virus Life Cycle. Trends Parasitol 35:1009-1017 Liu Y, Liu J, Du S, Shan C, Nie K, Zhang R, Li XF, Zhang R, Wang T, Qin CF, Wang P, Shi PY, and Cheng G (2017) Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes. Nature 545:482-486 Wang X, He Y, Guo J, Jiang B, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Wu Y, Zhang S, Liu Y, Zhang L, Yu Y, Cheng A, and Chen S (2021) Construction of an Infectious Clone for Mosquito-Derived Tembusu Virus Prototypical Strain. Virol Sin 36:1678-1681 Guo J, He Y, Wang X, Jiang B, Lin X, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Wu Y, Chen S, and Cheng A (2020) Stabilization of a full-length infectious cDNA clone for duck Tembusu virus by insertion of an intron. J Virol Methods 283:113922 Mao L, He Y, Wu Z, Wang X, Guo J, Zhang S, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Mao S, Wu Y, Zhang S, Huang J, Ou X, Gao Q, Sun D, Cheng A, and Chen S (2022) Stem-Loop I of the Tembusu Virus 3'-Untranslated Region Is Responsible for Viral Host-Specific Adaptation and the Pathogenicity of the Virus in Mice. Microbiol Spectr 10:e0244922 Hamel R, Phanitchat T, Wichit S, Morales Vargas RE, Jaroenpool J, Diagne CT, Pompon J, and Misse D (2021) New Insights into the Biology of the Emerging Tembusu Virus. Pathogens 10:1010 Sanisuriwong J, Yurayart N, Thontiravong A, and Tiawsirisup S (2021) Vector competence of Culex tritaeniorhynchus and Culex quinquefasciatus (Diptera: Culicidae) for duck Tembusu virus transmission. Acta Trop 214:105785 Tsetsarkin KA, Vanlandingham DL, McGee CE, and Higgs S (2007) A single mutation in chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog 3:e201 Brault AC, Powers AM, Ortiz D, Estrada-Franco JG, Navarro-Lopez R, and Weaver SC (2004) Venezuelan equine encephalitis emergence: enhanced vector infection from a single amino acid substitution in the envelope glycoprotein. Proc Natl Acad Sci U S A 101:11344-9 Yan D, Shi Y, Wang H, Li G, Li X, Wang B, Su X, Wang J, Teng Q, Yang J, Chen H, Liu Q, Ma W, and Li Z (2018) A Single Mutation at Position 156 in the Envelope Protein of Tembusu Virus Is Responsible for Virus Tissue Tropism and Transmissibility in Ducks. J Virol 92 Su J, Li S, Hu X, Yu X, Wang Y, Liu P, Lu X, Zhang G, Hu X, Liu D, Li X, Su W, Lu H, Mok NS, Wang P, Wang M, Tian K, and Gao GF (2011) Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS One 6:e18106 Wang X, Usama A, Huanchun C, Cao S, and Ye J (2023) Biological determinants perpetuating the transmission dynamics of mosquito-borne flaviviruses. Emerg Microbes Infect 12:2212812 Villordo SM, Carballeda JM, Filomatori CV, and Gamarnik AV (2016) RNA Structure Duplications and Flavivirus Host Adaptation. Trends Microbiol 24:270-283 Filomatori CV, Carballeda JM, Villordo SM, Aguirre S, Pallarés HM, Maestre AM, Sánchez-Vargas I, Blair CD, Fabri C, Morales MA, Fernandez-Sesma A, and Gamarnik AV (2017) Dengue virus genomic variation associated with mosquito adaptation defines the pattern of viral non-coding RNAs and fitness in human cells. PLoS Pathog 13:e1006265 de Borba L, Villordo SM, Marsico FL, Carballeda JM, Filomatori CV, Gebhard LG, Pallarés HM, Lequime S, Lambrechts L, Sánchez Vargas I, Blair CD, and Gamarnik AV (2019) RNA Structure Duplication in the Dengue Virus 3' UTR: Redundancy or Host Specificity? mBio 10 Yeh SC and Pompon J (2018) Flaviviruses Produce a Subgenomic Flaviviral RNA That Enhances Mosquito Transmission. DNA Cell Biol 37:154-159 Tables Table 1. Viral infection, dissemination, and transmission of CQW1 and MM_1775 IR DR TR Days CQW1 MM_1775 CQW1 MM_1775 CQW1 MM_1775 4 100% （14/14） 90.9% （20/22） 0 15% （3/20） 0 0 7 100% （15/15） 73.7% （14/19） 33.3%（5/15） 14.3% （2/14） 0 50% （1/2） 14 76.9% （10/13） 100% （18/18） 20% （2/10） 27.8% （5/18） 0 20% （1/5） IR (Infection rate): number of positive midgut samples/ total number of female mosquitoes tested; DR (Dissemination rate): number of positive head and leg samples / number of total samples; TR (Transmission rate): number of positive salivary gland samples / number of total samples. Table 2. Analysis of infection rates of vertical transmission Strain Stage IR(%) MIR(%) RNA copy(Log/uL) CQW1 Egg 13.8(4/29) / 5.091±0.9267 Adult-Female 25.9(7/27) 5.2(7/135) 5.469±0.0873 Adult-male 47.2(17/36) 9.4(17/180) 5.609±0.0953 IR: number of positive pools / number of total pools MIR (Minimum infection rate): number of positive pools / number of total mosquitoes Table 3. qPCR primers used to detect TMUV Primer Sequence（5′-3′） CQW1-E-qPCR-F AATGGCTGTGGCTTGTTTGG CQW1-E-qPCR-R GGGCGTTATCACGAATCTA MM_1775-NS5-qPCR-F GAAATCGAATCTGCCAGGAC MM_1775-NS5-qPCR-F CCGCTCACCCAATACATC Cite Share Download PDF Status: Published Journal Publication published 18 Sep, 2024 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4023085","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":279099541,"identity":"1b6c0ec7-7fc9-4e5f-93a0-f705341cd5d0","order_by":0,"name":"Yibing Tang","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yibing","middleName":"","lastName":"Tang","suffix":""},{"id":279099542,"identity":"7c16de86-77a8-4d6d-b452-0c097f915c19","order_by":1,"name":"Yu He","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"He","suffix":""},{"id":279099543,"identity":"8355859e-47d7-4749-a9f9-d1a7f1033131","order_by":2,"name":"Xiaoli Wang","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoli","middleName":"","lastName":"Wang","suffix":""},{"id":279099544,"identity":"dcd1cabe-5108-4deb-ac53-f22602044459","order_by":3,"name":"Zhen Wu","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Wu","suffix":""},{"id":279099545,"identity":"c39a9bfd-b164-40ff-b76b-de255bce2fb5","order_by":4,"name":"Senyan Du","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Senyan","middleName":"","lastName":"Du","suffix":""},{"id":279099546,"identity":"0c0893af-3c0d-42cf-b9ba-bc95bc837dea","order_by":5,"name":"Mingshu Wang","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Mingshu","middleName":"","lastName":"Wang","suffix":""},{"id":279099547,"identity":"2bb93ffb-1f48-4e4a-9651-48e49e43b973","order_by":6,"name":"Renyong Jia","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Renyong","middleName":"","lastName":"Jia","suffix":""},{"id":279099548,"identity":"7efcc733-b1a2-4e1d-ae8f-3d213c3ed40e","order_by":7,"name":"Dekang Zhu","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dekang","middleName":"","lastName":"Zhu","suffix":""},{"id":279099549,"identity":"5912b12b-b282-4ea6-aa52-b2c3571efa09","order_by":8,"name":"Mafeng Liu","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Mafeng","middleName":"","lastName":"Liu","suffix":""},{"id":279099550,"identity":"554761e7-a0b3-4241-bed1-8fff24dd1d01","order_by":9,"name":"Xinxin Zhao","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xinxin","middleName":"","lastName":"Zhao","suffix":""},{"id":279099551,"identity":"813596ba-204f-4287-a22b-504d37cd0c56","order_by":10,"name":"Qiao Yang","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qiao","middleName":"","lastName":"Yang","suffix":""},{"id":279099552,"identity":"51ec9d61-2d35-4ca6-a376-a7134bc2d412","order_by":11,"name":"Ying Wu","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Wu","suffix":""},{"id":279099553,"identity":"58f8bb8c-503d-4487-8e06-de595b594a79","order_by":12,"name":"Shaqiu Zhang","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shaqiu","middleName":"","lastName":"Zhang","suffix":""},{"id":279099554,"identity":"14a9c939-fdd9-4f0d-9aa7-60e1f4e6f892","order_by":13,"name":"Juan Huang","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Huang","suffix":""},{"id":279099555,"identity":"54700efa-a2ee-4a05-aacc-41c5d5758bf9","order_by":14,"name":"Xumin Ou","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xumin","middleName":"","lastName":"Ou","suffix":""},{"id":279099556,"identity":"58419ebf-fca6-44e6-b2e5-d4818c24222d","order_by":15,"name":"Di Sun","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Di","middleName":"","lastName":"Sun","suffix":""},{"id":279099557,"identity":"bfb765de-2c1b-4a47-9dc2-ad54457e5828","order_by":16,"name":"Anchun Cheng","email":"","orcid":"","institution":"Sichuan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Anchun","middleName":"","lastName":"Cheng","suffix":""},{"id":279099558,"identity":"f8875cbf-0178-49ab-85fa-ab64bdae6128","order_by":17,"name":"Shun Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYDACCSBmbGBg4AeTIHCAWC2SDSRrMYCrJKRFfnaP2YOfO2zyjM8fbvzws41Bju9GAuPnAjxaDO6cMTfsPZNWbHYjsVmyt43BWPJGArP0DHxaJHLMpBnbDiduu8HYxsDbxpC44UYCGzMPPofNAGv5n7i5/2Ab4982hnqCWhhugLUcSNzAkNjGDLQlwYCQFoMbaWVALyQnzgD6RVrmnIThzDMPm6XxOyx5m8TPNrvE/v7jDz++KbOR5zuefPAzXoehAVg0jYJRMApGwSigCAAAN6pM9lUs5SMAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-7488-1037","institution":"Sichuan Agricultural University - Chengdu Campus","correspondingAuthor":true,"prefix":"","firstName":"Shun","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-03-07 06:06:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4023085/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4023085/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13567-024-01361-3","type":"published","date":"2024-09-18T15:57:38+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":52767014,"identity":"fef77492-b3fc-4dbd-ae64-0924df3cb25b","added_by":"auto","created_at":"2024-03-15 13:40:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":181090,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCulex quinquefasciatus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e model for TMUV infection through membrane blood feeding.\u003c/strong\u003e (A) Female \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e mosquitoes were orally infected with either CQW1 or MM_1775 viruses using different blood sources from mice, ducks, rabbits, or sheep. (B) At 8 days post-infection, the infection rates of CQW1 was determined using RT-qPCR. (C) The infection rates of MM_1775. (D) Infection rate comparison of MM_1775 and CQW1 from (B, C). (E) The minimum dose required for MM_1775 virus infection through membrane blood feeding was determined. Statistical significance: *, P\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/125a09d2b2d66ea269e0fc46.png"},{"id":52767011,"identity":"d4abd6bb-5e1c-48f3-926e-ebd41e864702","added_by":"auto","created_at":"2024-03-15 13:40:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":74466,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMosquito TMUV is more infectious than duck TMUV in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCulex quinquefasciatus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e (A) To compare the infectivity of mosquito-derived strain MM_1775 to duck-derived strain CQW1, \u003cem\u003eCulex\u003c/em\u003e mosquitoes were respectively infected with these two viruses through micro-injection. At 7 days post infection, the infection rates were determined using RT-qPCR. (B) \u003cem\u003eCulex\u003c/em\u003e mosquitoes were injected with CQW1 at various tires. (C) \u003cem\u003eCulex\u003c/em\u003e mosquitoes were injected with MM_1775 at various tires.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/d4e4c6f8e6ed87959d67c32b.png"},{"id":52767012,"identity":"285f16ff-ead3-4d6f-b0c7-f80c4ae3f16f","added_by":"auto","created_at":"2024-03-15 13:40:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":111858,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe viral determinant of vector transmission of TMUV.\u003c/strong\u003e A set of chimeric viruses were generated using reverse genetic techniques, with MM_1775 virus as the backbone but carrying the E, or NS1, or 3’UTR of CQW1. (A) The infection rate of \u003cem\u003eCulex\u003c/em\u003emosquitoes orally infected with these chimeric viruses. (B) Viral copies of positive samples from (A). (C) Comparison of the infection rate from (A). (D) The infection rate of \u003cem\u003eCulex\u003c/em\u003emosquitoes infected with these chimeric viruses by microinjection. © Viral copies of positive samples from (D). (F) Comparison of the infection rate from (D). These data were presented as the means ± SEM. Statistical significance: *, P\u0026lt;0.05; **, P \u0026lt; 0.01; ***, P \u0026lt; 0.001; ****, P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/0989d80c74c58e7956a4c8f1.png"},{"id":52767017,"identity":"a859f41a-42f6-4939-8cbe-581af376e232","added_by":"auto","created_at":"2024-03-15 13:40:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":227000,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVenereal transmission of TMUV in paired mosquitoes. \u003c/strong\u003e(A) To compare the sex of Culex mosquitoes on viral infection, female or male mosquitoes were infected with MM_1775 or CQW1 through micro-injection. (B) The infection rate of female or male mosquitoes infected with CQW1. (C) The infection rate of female or male mosquitoes infected with MM_1775. (D) The experimental procedure for detecting venereal transmission. Female (or male) mosquitoes were infected with CQW1 or MM_1775 through micro-injection. At 1day post-infection, virgin males (or females) were introduced into the respective female (or male) infected cages to allow them to freely mate for 5 days. Finally, virus infection was determined using RT-qPC©(E) The infection rate detected from (D). These data were presented as the means ±SEM.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/3acacfdfed39e34c6da96cc9.png"},{"id":52767013,"identity":"c68d1a69-8ba0-4a4f-beaf-ce512df3b136","added_by":"auto","created_at":"2024-03-15 13:40:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":93575,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVertical transmission of TMUV in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCulex\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emosquitoes.\u003c/strong\u003e (A) Female mosquitoes were micro-injected with CQW1 virus, and at 7 days post-infection, the mosquitoes were allowed to blood meal on mice by biting. The engorged mosquitoes were continuously reared for oviposition. (B) A portion of mosquito eggs was collected to detect virus infection. (C) The remaining mosquito eggs were allowed to hatch, and the virus infection rate was detected at the adult stage. The data were presented as the means ± SEM.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/c6174d277e9bee370fb7a6f5.png"},{"id":52767015,"identity":"4aa91561-9353-446f-b863-7ebf671ee43a","added_by":"auto","created_at":"2024-03-15 13:40:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":78594,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePersistent infection of TMUV in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCulex\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emosquitoes. \u003c/strong\u003eFemale mosquitoes were micro-injected with CQW1 or MM_1775 virus, and virus infections were detected at 7, 14, and 35 days post infection. (A) MM_1775 infection. (B) CQW1 infection.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/ce65dc1f9481de95f3b67f71.png"},{"id":65104024,"identity":"2cce98aa-c37f-4778-99cd-ac540b5c5885","added_by":"auto","created_at":"2024-09-23 16:10:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1306438,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4023085/v1/029ebc09-0d8d-48d2-a8f1-e8fac79b24d5.pdf"}],"financialInterests":"","formattedTitle":"Vector Competence of Culex quinquefasciatus for Tembusu Virus and Viral Determinants for Virus Transmission by Mosquitoes","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMosquito-borane flaviviruses, such as Zika virus (ZIKV), dengue virus (DENV), Japanese encephalitis viruses (JEV), and yellow fever virus (YFV), pose a significant threat to global public health, causing various diseases in animals and humans worldwide. Among these flaviviruses, Tembusu virus (TMUV) is an emerging mosquito-borane flavivirus that causes severe neurological and reproductive diseases in birds.\u003c/p\u003e\n\u003cp\u003eTMUV (MM_1775 strain) was first isolated from \u003cem\u003eCulex tritaeniorhynchus\u003c/em\u003e mosquitoes in Malaysia in 1955[1]. However, it was only sporadically reported in subsequent decades. In 2010, an infectious disease characterized by duck egg-drop syndrome broke out in China, resulting in enormous economic losses. The pathogen responsible for this outbreak was eventually confirmed as duck TMUV. Currently, TMUV strains have been classified into three clusters based on their major antigen gene E\u0026nbsp;[2, 3]. Cluster 1 includes TMUV strains isolated from Southeast Asia, while Cluster 2 consists of most waterfowl-origin isolates from China and Southeast Asian countries. Most of the duck TMUV isolated in China since 2010 falls into Cluster 2.2. The mosquito-origin TMUV, including the MM_1775 strain, and the recent chicken-origin TMUV (since 2020) form Cluster 3[2].\u003c/p\u003e\n\u003cp\u003eTMUV exhibits a broad host tropism and has been isolated from mosquitoes and various avian species, including ducks, chickens, geese, and sparrows. In laboratory studies, TMUV has shown efficient replication in avian (i.e. DF-1, embryo fibroblasts of duck and goose), mosquito cells (i.e. C6/36), and mammalian (i.e. Vero, BHK21, HEK293, HepG2 and SH-SY5Y) cell lines. Although TMUV exhibits high neurovirulence in mice, it does not show neuroinvasiveness. Serological investigations in China[4]\u0026nbsp;and Thailand[5]\u0026nbsp;have detected high anti-TMUV antibody titers in individuals at risk, such as workers in duck farms or nearby residents, and high positive-rate of TMUV by RT-PCR in duck farm workers in China are also indicated. This raises the possibility of TMUV as a potential zoonotic flavivirus.\u003c/p\u003e\n\u003cp\u003eMost mosquito-borane flaviviruses, such as ZIKV and DENV, undergo a cycle between mosquitoes and vertebrate hosts in nature. When mosquitoes bite and feed on infected hosts, they acquire virions circulating in the host\u0026apos;s blood. Then the viruses establish an infection in the mosquitoes\u0026rsquo; midgut and disseminate to other organs through the mosquito\u0026apos;s haemocoel. After robust virus replication in the salivary glands, the viruses can be transmitted to naive hosts through mosquito biting. Within mosquito population, both vertical transmission and venereal transmission routes have been confirmed to maintain the flavivirus infection\u0026nbsp;[6, 7]. In vertebrate hosts, the viruses are injected intradermally by mosquitoes during a new blood meal. Immune cells in the skin, such as dendritic cell subsets, monocytes, and macrophages, are permissive for initial flavivirus infection in hosts, which then disseminate to systemic tissues through blood circulation\u0026nbsp;[8]. Enhanced mosquito vector transmission of flaviviruses can significantly contribute to their epidemic potential. For example, a single mutation within the NS1 protein has been shown to increase ZIKV infectivity and prevalence in \u003cem\u003eAedes aegypti\u003c/em\u003e, therefore could have facilitated ZIKV transmission during its epidemics in 2016[9].\u003c/p\u003e\n\u003cp\u003eDespite significant progress in understanding various aspects of TMUV over the past decade, our knowledge of its mosquito transmission remains limited. Although TMUV has been identified in different mosquitoes, such as \u003cem\u003eCulex pipiens\u003c/em\u003e, and the vector competence of \u003cem\u003eCulex pipiens\u003c/em\u003e has been experimentally confirmed, the mechanisms of TMUV cycling within mosquito populations are still unknown. Additionally, it is unclear whether evolutionary variations have an impact on viral infectivity and prevalence in mosquitoes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, we established a \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e model for TMUV and conducted a detailed analysis of the transmission routes of TMUV within mosquito populations, as well as the viral determinants affecting TMUV infection in mosquitoes. These findings will contribute to a better understand of vector transmission of TMUV.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003ch2\u003eViruses\u003c/h2\u003e\n\u003cp\u003eBoth TMUV strains used in present study are rescued from infectious clones[10, 11], and all virus stocks were prepared in BHK-21 cells. The CQW1 (KM233707.1) is a duck-origin strain isolated in 2013, while the prototypical strain MM_1775 (JX477685.2) was isolated from \u003cem\u003eCulex tritaeniorhynchus\u003c/em\u003e in Malaysia in 1955.\u003c/p\u003e\n\u003cp\u003eThe chimeric TMUV MM/CQ-3\u0026rsquo;UTR has been reported in the previously study [12]. MM/CQ-E and MM/CQ-NS1 were generated by replacing the entire MM_1775-E gene or -NS1 gene with the corresponding genes from CQW1 using reverse genetic techniques. \u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eThoracic microinjection of TMUV in mosquitoes\u003c/h2\u003e\n\u003cp\u003eAt 7~10 days post hatching, the mosquitoes were anaesthetized on a cold tray. Subsequently, 0.3\u0026micro;L of TMUV in DMEM (containing certain titer) was microinjected into the mosquito thoraxes under a stereo microscope (Phenix, China). The infected mosquitoes were then raised in a container at 28\u0026plusmn;2\u0026deg;C and 80% humidity under standard conditions, and the survival of injected mosquitoes was recorded at 24-48 hours post infection. Finally, live mosquitoes were collected at indicated time points and subjected to RT-qPCR analysis.\u003c/p\u003e\n\u003ch2\u003eMembrane blood feeding\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eCommercial defibrinated sheep blood or heat-inactivated duck, mice, or rabbit blood (following a pretreated procedure similar to a previously reported method\u0026nbsp;[9]) was gently mixed with TMUV at a 1:1 ratio. The mixed blood solution was then added into the feeder of membrane feeding system for blood-sucking insects (Hemotek, USA), and the temperature was maintained at 37℃. Subsequently, the feeder was placed into the mosquito cup containing female mosquitoes that had been pre-treated with hunger for 1-2 days. After 30~40 min of blood meal in dark, the feeder was removed, and engorged female mosquitoes were selected and transferred into new containers and kept under standard conditions. At indicated timepoints, the mosquitoes were killed for dissection under the stereo microscope, mosquitoes\u0026rsquo; heads or salivary glands were isolated for virus load analysis using RT-qPCR.\u003c/p\u003e\n\u003ch2\u003eMosquito transmission of MM_1775 and CQW1\u003c/h2\u003e\n\u003cp\u003eAt 7-10 days post hatching, a total of 240 female mosquitoes were randomly divided into 6 groups, with 40 mosquitoes in each group. After starvation treatment for 1-2 days, the mosquitoes were orally infected with MM_1775 or CQW1 at a titer of 10\u003csup\u003e5.5\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e/mL. At 4, 7, and 14 days post infection, tissue samples of mosquito midgut, head/leg and salivary glands were taken, respectively, and used for RT-qPCR detection to assess virus IR, DR and TR.\u003c/p\u003e\n\u003cp\u003eTo viral determinants for the difference of mosquito vector competence between MM_1775 and CQW1, female mosquitoes were oral infected with MM_1775 or TMUV MM/CQ-3\u0026rsquo;UTR or MM/CQ-E or MM/CQ-NS1, at a dose of 10\u003csup\u003e5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL. After 8 days post infection, mosquitoes were killed for detecting IR. To further confirm the result, 10\u003csup\u003e3\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL of each virus were microinjected into mosquitoes, and 7 days post infection, mosquitoes were killed for detecting IR.\u003c/p\u003e\n\u003ch2\u003eVenereal transmission\u003c/h2\u003e\n\u003cp\u003eThe experimental procedure for venereal transmission study is similar to a previously reported method [6] with slight modifications. In brief, culex mosquitoes were divided into 4 groups, consisting of two female groups and two male groups. After a 24-hour starvation period, one group of female mosquitoes and one group of male mosquitoes were injected with CQW1 at a concentration of 10\u003csup\u003e5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL, respectively. The remaining two groups were injected with MM_1775. After one day post-infection, the survival of mosquitoes was recorded, and each group was introduced to an equal number of naive female/male mosquitoes to allow for mating. A piece of cotton mesh soaked in a 10% sucrose solution was provided for mosquito feeding (the sucrose solution was replaced daily), placed on top of the cage to prevent oral contamination.\u003c/p\u003e\n\u003ch2\u003eVertical transmission\u003c/h2\u003e\n\u003cp\u003eFor the assessment of vertical transmission, at 7-10 days post eclosion, 40 female mosquitoes were microinjected with CQW1 virus at a dose of 10\u003csup\u003e5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL. These infected females were then housed with male mosquitoes. To stimulate egg-laying, anaesthetized Kunming mice were placed on top of the container for mosquito feeding and allowed to feed for approximately 30 minutes (the mosquitoes were starved for 24 hours prior to engorgement). After laying eggs, a portion of the eggs was directly subjected to virus detection, while the remaining eggs were hatched, and the resulting larvae were raised to adulthood for subsequent virus detection.\u003c/p\u003e\n\u003ch2\u003eRNA extraction and RT\u0026ndash;qPCR\u003c/h2\u003e\n\u003cp\u003eThe total RNA of mosquito was isolated using Total RNA Extraction Kit (Axygen, USA) per the manufacturer\u0026apos;s instructions. Subsequently, 1st-strand cDNA was transcribed using a HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). To detect viral copies, RT\u0026ndash;qPCR assays were performed using 2\u0026times; Taq SYBR Green qPCR Premix (Innovagene, Changsha, China) with a CFX Connect Real-Time PCR Detect System (Bio\u0026ndash;Rad, USA) following the manufacturer\u0026rsquo;s protocols. The primers for RT-qPCR are presented in Table 3.\u003c/p\u003e\n\u003ch2\u003eQuantification and statistical analysis\u003c/h2\u003e\n\u003cp\u003eThe data from the analyses of the RT\u0026ndash;qPCR data are presented as the mean \u0026plusmn; Standard error of the mean (SEM). Using GraphPad Prism 9.5 software, the statistical significance was assessed by Student\u0026rsquo;s t test, and significance was defined by a P value \u0026lt; 0.05 (*).\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003eThe \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e model for TMUV infection through membrane blood feeding\u003c/h2\u003e\n\u003cp\u003eTo simulate the infection process through mosquito bites, we initially employed the membrane blood feeding method to establish a \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e model for studying TMUV transmission. We tested four different sources of blood from various animal hosts (duck, mouse, rabbit, and sheep) for infection (Figure. 1A). As shown in Figure. 1B-D, when feeding on duck blood, mosquito TMUV (MM_1775 strain) exhibited a significantly higher infection rate (IR) compared to duck TMUV (CQW1 strain). This may be attributed to the interaction between the duck host and the viruses. MM_1775 also showed a slightly higher IR than CQW1 when fed with blood from other sources, although the difference was not statistically significant. Nevertheless, the data indicate that all blood from different host sources are competent for TMUV infection through membrane blood feeding.\u003c/p\u003e\n\u003cp\u003eTo determine the minimum dose of TMUV required to establish infection in \u003cem\u003eCulex\u0026nbsp;\u003c/em\u003emosquitoes through membrane blood feeding, we performed a series of 10-fold continuous dilutions of the MM_1775 virus solution (in DMEM) and mixed it with sheep blood for feeding. As shown in Figure. 1E, most mosquitoes survived at 2 days post-infection. Surprisingly, an IR of 61.1% (11/18) was observed only at a dose of 10\u003csup\u003e5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL, and no virus RNA was detected when the infection doses were less than 10\u003csup\u003e4\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL. These findings suggest that \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e is competent for both MM_1775 and CQW1 strains through membrane blood feeding.\u003c/p\u003e\n\u003ch2\u003eMosquito TMUV exhibits higher infectivity than duck TMUV in \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e\u003c/h2\u003e\n\u003cp\u003eCompared to membrane blood feeding, the microinjection method is a more convenient and effective approach for infecting mosquitoes. After confirming the competence of \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e for TMUV, we determined the infection dose required for establishing infection through microinjection (Figure. 2A). As shown in Figure 2B, the IR of the CQW1 strain dramatically decreased from 96.2% (20/21) to 7.7% (1/13) when the infection dose decreased from 10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e/mL to 10\u003csup\u003e2\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL. In contrast, the MM_1775 strain exhibited higher potency, maintaining a 100% IR when the infection dose was not less than 10\u003csup\u003e3\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL (Figure. 2C). Even at a very low dose of 10\u003csup\u003e2\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL, there was still a 68.8% IR. These data suggest that MM_1775 shows significantly higher efficiency in infecting \u003cem\u003eCulex quinquefasciatus\u003c/em\u003e compared to CQW1 at the same dose.\u003c/p\u003e\n\u003cp\u003eOnce the virus and blood are ingested by mosquitoes, they enter the midgut where the initial infection must be established. However, before the viruses can disseminate throughout the mosquito\u0026apos;s body, they need to overcome the midgut epithelial barrier. After robust replication in the mosquito\u0026apos;s salivary glands, the viruses are then ready to be transmitted to vertebrates through intra-dermal injection. To determine mosquito vector competence, three indicators are used: IR, which measures the rate at which the virus is detectable in the midgut; Dissemination Rate (DR), which evaluates the presence of the virus in the head and legs of infected mosquitoes; and Transmission Rate (TR), which quantifies the presence of the virus in the salivary glands.\u003c/p\u003e\n\u003cp\u003eCurrently, there is limited data available on the vector transmission of TMUV. In order to better understand the effect of different virus strains on viral vector transmission, we compared the virus dissemination and transmission of the MM_1775 strain with the CQW1 strain. \u003cem\u003eCulex\u0026nbsp;\u003c/em\u003emosquitoes\u003cem\u003e\u0026nbsp;\u003c/em\u003ewere artificially infected by microinjection at an infection dose of 10\u003csup\u003e5.5\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e/mL. At specific timepoints (4/7/14 days post infection), virus dissemination and transmission were assessed using RT-qPCR. As shown in Table 1, virus dissemination of MM_1775 was consistently detected at all timepoints. In contrast, dissemination of CQW1 viruses was only detected at later timepoints. Most importantly, only MM_1775 viruses were detected in the mosquito\u0026apos;s salivary glands, while no CQW1 virus RNA was detected under the same conditions. These results suggest that the mosquito-derived strain MM_1775 has a better transmission capability in mosquitoes compared to the duck-derived strain CQW1.\u003c/p\u003e\n\u003ch2\u003eThe viral determinant of vector transmission of TMUV\u003c/h2\u003e\n\u003cp\u003eTo further investigate the viral determinants affecting TMUV transmission, a set of chimeric viruses was generated using MM_1775 as the backbone. Following feeding with 10\u003csup\u003e5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL of TMUV in a blood meal, virus presence was detected to calculate the IR at 8 days post-infection (Figure. 3A-C). The IRs of MM/CQ-E virus and MM/CQW1-3\u0026rsquo;UTR were found to be 33.3% (5/15) and 23.5% (4/17), respectively, which were significantly lower than wild-type MM_1775 (93.8%). However, the replacement of NS1 showed little effect on IR in mosquito. When \u003cem\u003eCulex\u003c/em\u003e mosquitoes were infected via microinjection, all chimeric TMUVs reached a 100% IR, but viral loads of MM/CQW1-3\u0026rsquo;UTR were lower than the others (Figure. 3D-F). The results suggest that variations in the E protein and 3\u0026rsquo;UTR, but not in NS1, are responsible for the differences in mosquito infection between MM_1775 and CQW1 strains.\u003c/p\u003e\n\u003ch2\u003eVenereal transmission of TMUV in paired mosquitoes\u003c/h2\u003e\n\u003cp\u003eIn the natural cycle, mosquito-borane flaviviruses are transmitted by female mosquito bites. However, the possibility of male mosquitoes acting as virus reservoirs through sexual transmission cannot be excluded. Therefore, we measured viral loads and IRs of TMUV in both female and male mosquitoes (Figure.4A). Similar levels of CQW1 viral loads were detected in both female and male mosquitoes on days 4, 7 and 14 post infection (Figure.4B), with no significant difference in IRs between genders of \u003cem\u003eCulex\u003c/em\u003e mosquitoes. Similar results were observed for the mosquito TMUV MM_1775 strain (Figure.4C), indicating that the gender of Culex mosquitoes has no effect on their vector competence.\u003c/p\u003e\n\u003cp\u003eTo assess whether TMUV can be transmitted from female to male or male to female mosquitoes, infected female or male mosquitoes were grouped into mating pairs with naive male or female mosquitoes, respectively (Figure.4D). Female-to-male transmission was observed for both MM_1775 and CQW1 viruses, with a minimum infection rate (MIR) of 4.8% and 6.66%, respectively (Figure.4E). Male-to-female transmission was also observed at an MIR of 3.84% for the MM_1775 virus. These findings indicate that TMUV can be transmitted in both directions, from male to female as well as from female to male.\u003c/p\u003e\n\u003ch2\u003eVertical transmission of TMUV in Culex mosquitoes\u003c/h2\u003e\n\u003cp\u003eIt is believed that vertical transmission is the primary route for maintaining flaviviruses within mosquito populations. To verify whether TMUV can be vertically transmitted, female mosquitoes were infected with CQW1 viruses through microinjection. At 7 days post-infection, the infected mosquitoes were co-raised with mice to encourage mosquito bites and blood-feeding, which would stimulate the females to lay eggs. A portion of the laid eggs was collected for virus detection, while the remaining eggs were used for hatching mosquito larvae (Figure.5A).\u003c/p\u003e\n\u003cp\u003eOut of the collected mosquito egg samples, 13.8% (4/29) tested positive for TMUV, with a viral copy number of 10\u003csup\u003e5.091\u0026plusmn;0.9267\u003c/sup\u003e (Figure 5B, Table 2). After hatching and reaching adulthood, 25.9% (7/27) of the female mosquito sample pools were positive for TMUV, with a MIR of 5.2% (7/135) and a copy number of 10\u003csup\u003e5.469\u0026plusmn;0.0873\u003c/sup\u003e(Figure.5C, Table 2). Additionally, 47.2% (17/36) of the male mosquito sample pools were found to be positive, with an MIR of 9.4% (17/180) and a copy number of 10\u003csup\u003e5.609\u0026plusmn;0.0953\u003c/sup\u003e. These findings indicate that virus RNA can be detected in both the egg stage and adult stage, suggesting that TMUV can be vertically transmitted within \u003cem\u003eCulex\u003c/em\u003e mosquitoes.\u003c/p\u003e\n\u003ch2\u003eThe persistent infection of TMUV\u003c/h2\u003e\n\u003cp\u003eTo determine the duration of TMUV infection in Culex mosquitoes, orally infected female mosquitoes with 10\u003csup\u003e5.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL were continuously reared. The experiment was limited to 35 days as mosquitoes started to die after this timepoint. For MM_1775, the IR increased from 40% (2/5) to 100% (5/5) between day 7 and day 14 after infection. Importantly, MM_1775 still maintained a 60% IR at 35 days post-infection (Figure.6A). As expected, CQW1 displayed a lower IR compared to MM_1775, but viral RNA was still detected at 35 days post-infection (Figure.6B). These results indicate a persistent infection of TMUV in \u003cem\u003eCulex\u0026nbsp;\u003c/em\u003emosquitoes.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eTMUV was first identified in Malaysia in 1955 from \u003cem\u003eCulx tritaeniorhynchus\u003c/em\u003e mosquitoes. However, it was only occasionally reported in Southeast Asia in the following decades. In 2010, duck farms in most duck-breeding regions of China experienced an outbreak of an infectious disease known as duck egg-drop syndrome, and it was finally confirmed that TMUV was the cause. TMUV has since been detected in several species of Culex mosquitoes, including \u003cem\u003eCulx tritaeniorhynchus\u003c/em\u003e, \u003cem\u003eCulx vishnui, Culx quinquefasciatus\u003c/em\u003e, \u003cem\u003eCulx annulus\u003c/em\u003e, and \u003cem\u003eCulx pipiens\u003c/em\u003e[13]. therefore, \u003cem\u003eCulex spp.\u003c/em\u003e mosquitoes have been proposed as the main transmission vector for TMUV, particularly \u003cem\u003eCulx Tritaeniorhynchus\u003c/em\u003e [14]. However, the vector competence of \u003cem\u003eCulex\u003c/em\u003e mosquitoes has not been thoroughly characterized in the past decade.\u003c/p\u003e\n\u003cp\u003eIn this study, we assessed the vector competence of \u003cem\u003eCulx quinquefasciatus\u0026nbsp;\u003c/em\u003eand analyzed the factors associated with vector transmission of TMUV in mosquitoes. Consistent with a previously report [14], only a high titer of TMUV (\u0026ge;10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e/ml) could resulted in a successful infection when \u003cem\u003eCulx quinquefasciatus\u003c/em\u003e were challenged orally. This high titer requirement may be due to the lack of essential host factors or viral proteins that facilitate mosquitoes in acquiring the virions during the blood feeding process. This phenomenon has been widely reported in other mosquito-borane flaviviruses[8]. For example, ZIKV NS1 antigenemia could promote virion acquisition by mosquitoes, thereby facilitating transmission during the ZIKV epidemic in 2016 [9]. However, our data still indicates the successful establishment of the mosquito infection model for TMUV, and once again suggests that \u003cem\u003eCulx quinquefasciatus\u003c/em\u003e is one of the main transmission vectors of TMUV in nature.\u003c/p\u003e\n\u003cp\u003eThe evolutionary increase in infectivity within mosquito vectors, leading to high epidemic potential, has been reported for several mosquito-borne viruses [9, 15, 16]. However, contrary to our expectations, the CQW1 strain showed significantly lower infectivity and prevalence in mosquitoes compared to the MM_1775 strain. CQW1 is a prevalent strain in ducks, belonging to Cluster 2.2, which mainly consists of avian-derived strains prevalent in China after 2010. On the other hand, MM_1775 is the prototypical mosquito TMUV and belongs to Cluster 3.1 [2]. This result suggests that the outbreak of duck TMUV in China since 2010 may not be correlated with increased mosquito transmission of TMUV, and other routes of viral transmission may play important roles in this process.\u003c/p\u003e\n\u003cp\u003eYan\u0026rsquo;s data[17] indicate that a serine residue at position 156 in the E protein of FX2010 (a duck TMUV strain) is substituted by a proline residue at the same position in MM_1775.This substitution disrupts N-linked glycosylation at amino acid 154 and causes a conformational change in the \u0026ldquo;150 loop\u0026rdquo;. This mutation is also responsible for the changed tissue tropism and the loss of contact-transmissibility of TMUV in ducks. Therefore, we propose that contact-transmissibility from bird-to-bird may be a critical route for TMUV transmission, in 2010 outbreak. This hypothesis is further supported by the data showing that TMUV-related disease still spreads in autumn when there is low or no mosquito activity[18].\u003c/p\u003e\n\u003cp\u003eFlavivirus evolution shapes virus fitness in both vertebrate hosts and mosquitoes. Various viral determinants, such as C, E, NS1 and 3\u0026apos;UTR, have been identified to influence flavivirus infectivity and transmission in mosquitoes[19]. In the present study, we identified that both E protein and 3\u0026rsquo;UTR of TMUV are contribute to differences in infectivity and transmission between MM_1775 and CQW1 in mosquitoes. Flavivirus E protein is a key envelope protein that controls virus attachment and entry, affecting viral host specificity and tissue/cell tropism. Additionally, the 3\u0026apos;UTR of flaviviruses, with its RNA structures and genomic variations, plays a role in host adaptation [20-22]. The 3\u0026rsquo;UTR is responsible for generating subgenomic flavivirus RNA (sfRNA), which can enhance mosquito transmission [23]. The structure of the 3\u0026rsquo;UTR determines the number and abundance of sfRNA species. In this study, we observed a significant decrease in the in vivo infectivity of TMUV in mosquitoes when the MM_1775 3\u0026apos;UTR was replaced with the CQW1 3\u0026apos;UTR, consistent with our previous findings [12] that TMUV 3\u0026rsquo;UTR is responsible for cell-specific adaptation. However, further research is needed to elucidate the detailed mechanism behind this phenomenon.\u003c/p\u003e\n\u003cp\u003eIn conclusion, the present study successfully established the \u003cem\u003eCulx quinquefasciatus\u003c/em\u003e model for TMUV infection in the laboratory and investigated important factors associated with mosquito vector competence and transmission. These findings provide valuable insights for future research on TMUV mosquito transmission.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eThe experiments were approved by the Institutional Animal Care and Use Committee of Sichuan Agriculture University in Sichuan, China (Protocol Permit Number: SYXK(川) 2019-187).\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e\n\u003cp\u003eAll data to understand and assess the conclusions of this study are available in this published article. The raw data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declared that there are no competing financial interests regarding the publication of this paper.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThe National Key Research and Development Program of China (2022YFD1801900)，National Natural Science Foundation of China (32272976 \u0026amp; 32302848), Sichuan Provincial Department of Science and Technology international scientific and technological innovation cooperation (2022YFH0026), the earmarked fund for China Agriculture Research System(CARS-42-17), the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021-18).\u003c/p\u003e\n\u003ch2\u003eAuthors\u0026apos; contributions\u003c/h2\u003e\n\u003cp\u003eSC, YT and XW designed research, YT and XW performed research, SD provided to this experimental material, YT, YH analyzed data; YH and SC wrote the paper. ZW, MW, RJ, DZ, ML, XZ, QY, YW, SZ, JH, XO, DS, and AC helped with the experiments. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eThis work was funded by grants from the National Key Research and Development Program of China (2022YFD1801900), National Natural Science Foundation of China (32272976 \u0026amp; 32302848), Sichuan Provincial Department of Science and Technology international scientific and technological innovation cooperation (2022YFH0026), the earmarked fund for China Agriculture Research System (CARS-42-17), and the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021-18). The funding bodies had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eUS Army Medical Research Unit (Malaya). Institute for Medical Research FoM (1957) Annual Report. Kuala Lampur, Malaya\u003c/li\u003e\n\u003cli\u003eHuang Y, Hu Z, Dong J, Li L, Zhang J, Kuang R, Gao S, Sun M, and Liao M (2023) Chicken-origin Cluster 3.2 Tembusu virus exhibits higher infectivity than duck-origin Cluster 2 Tembusu virus in chicks. Front Vet Sci 10:1152802\u003c/li\u003e\n\u003cli\u003eYan D, Li X, Wang Z, Liu X, Dong X, Fu R, Su X, Xu B, Teng Q, Yuan C, Zhang Z, Liu Q, and Li Z (2022) The emergence of a disease caused by a mosquito origin Cluster 3.2 Tembusu virus in chickens in China. Vet Microbiol 272:109500\u003c/li\u003e\n\u003cli\u003eTang Y, Gao X, Diao Y, Feng Q, Chen H, Liu X, Ge P, and Yu C (2013) Tembusu virus in human, China. Transbound Emerg Dis 60:193-6\u003c/li\u003e\n\u003cli\u003ePulmanausahakul R, Ketsuwan K, Jaimipuk T, Smith DR, Auewarakul P, and Songserm T (2021) Detection of antibodies to duck tembusu virus in human population with or without the history of contact with ducks. Transbound Emerg Dis\u003c/li\u003e\n\u003cli\u003eCampos SS, Fernandes RS, Dos Santos AAC, de Miranda RM, Telleria EL, Ferreira-de-Brito A, de Castro MG, Failloux AB, Bonaldo MC, and Lourenco-de-Oliveira R (2017) Zika virus can be venereally transmitted between Aedes aegypti mosquitoes. Parasit Vectors 10:605\u003c/li\u003e\n\u003cli\u003eThangamani S, Huang J, Hart CE, Guzman H, and Tesh RB (2016) Vertical Transmission of Zika Virus in Aedes aegypti Mosquitoes. Am J Trop Med Hyg 95:1169-1173\u003c/li\u003e\n\u003cli\u003eYu X, Zhu Y, Xiao X, Wang P, and Cheng G (2019) Progress towards Understanding the Mosquito-Borne Virus Life Cycle. Trends Parasitol 35:1009-1017\u003c/li\u003e\n\u003cli\u003eLiu Y, Liu J, Du S, Shan C, Nie K, Zhang R, Li XF, Zhang R, Wang T, Qin CF, Wang P, Shi PY, and Cheng G (2017) Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes. Nature 545:482-486\u003c/li\u003e\n\u003cli\u003eWang X, He Y, Guo J, Jiang B, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Wu Y, Zhang S, Liu Y, Zhang L, Yu Y, Cheng A, and Chen S (2021) Construction of an Infectious Clone for Mosquito-Derived Tembusu Virus Prototypical Strain. Virol Sin 36:1678-1681\u003c/li\u003e\n\u003cli\u003eGuo J, He Y, Wang X, Jiang B, Lin X, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Wu Y, Chen S, and Cheng A (2020) Stabilization of a full-length infectious cDNA clone for duck Tembusu virus by insertion of an intron. J Virol Methods 283:113922\u003c/li\u003e\n\u003cli\u003eMao L, He Y, Wu Z, Wang X, Guo J, Zhang S, Wang M, Jia R, Zhu D, Liu M, Zhao X, Yang Q, Mao S, Wu Y, Zhang S, Huang J, Ou X, Gao Q, Sun D, Cheng A, and Chen S (2022) Stem-Loop I of the Tembusu Virus 3\u0026apos;-Untranslated Region Is Responsible for Viral Host-Specific Adaptation and the Pathogenicity of the Virus in Mice. Microbiol Spectr 10:e0244922\u003c/li\u003e\n\u003cli\u003eHamel R, Phanitchat T, Wichit S, Morales Vargas RE, Jaroenpool J, Diagne CT, Pompon J, and Misse D (2021) New Insights into the Biology of the Emerging Tembusu Virus. Pathogens 10:1010\u003c/li\u003e\n\u003cli\u003eSanisuriwong J, Yurayart N, Thontiravong A, and Tiawsirisup S (2021) Vector competence of Culex tritaeniorhynchus and Culex quinquefasciatus (Diptera: Culicidae) for duck Tembusu virus transmission. Acta Trop 214:105785\u003c/li\u003e\n\u003cli\u003eTsetsarkin KA, Vanlandingham DL, McGee CE, and Higgs S (2007) A single mutation in chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog 3:e201\u003c/li\u003e\n\u003cli\u003eBrault AC, Powers AM, Ortiz D, Estrada-Franco JG, Navarro-Lopez R, and Weaver SC (2004) Venezuelan equine encephalitis emergence: enhanced vector infection from a single amino acid substitution in the envelope glycoprotein. Proc Natl Acad Sci U S A 101:11344-9\u003c/li\u003e\n\u003cli\u003eYan D, Shi Y, Wang H, Li G, Li X, Wang B, Su X, Wang J, Teng Q, Yang J, Chen H, Liu Q, Ma W, and Li Z (2018) A Single Mutation at Position 156 in the Envelope Protein of Tembusu Virus Is Responsible for Virus Tissue Tropism and Transmissibility in Ducks. J Virol 92\u003c/li\u003e\n\u003cli\u003eSu J, Li S, Hu X, Yu X, Wang Y, Liu P, Lu X, Zhang G, Hu X, Liu D, Li X, Su W, Lu H, Mok NS, Wang P, Wang M, Tian K, and Gao GF (2011) Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS One 6:e18106\u003c/li\u003e\n\u003cli\u003eWang X, Usama A, Huanchun C, Cao S, and Ye J (2023) Biological determinants perpetuating the transmission dynamics of mosquito-borne flaviviruses. Emerg Microbes Infect 12:2212812\u003c/li\u003e\n\u003cli\u003eVillordo SM, Carballeda JM, Filomatori CV, and Gamarnik AV (2016) RNA Structure Duplications and Flavivirus Host Adaptation. Trends Microbiol 24:270-283\u003c/li\u003e\n\u003cli\u003eFilomatori CV, Carballeda JM, Villordo SM, Aguirre S, Pallar\u0026eacute;s HM, Maestre AM, S\u0026aacute;nchez-Vargas I, Blair CD, Fabri C, Morales MA, Fernandez-Sesma A, and Gamarnik AV (2017) Dengue virus genomic variation associated with mosquito adaptation defines the pattern of viral non-coding RNAs and fitness in human cells. PLoS Pathog 13:e1006265\u003c/li\u003e\n\u003cli\u003ede Borba L, Villordo SM, Marsico FL, Carballeda JM, Filomatori CV, Gebhard LG, Pallar\u0026eacute;s HM, Lequime S, Lambrechts L, S\u0026aacute;nchez Vargas I, Blair CD, and Gamarnik AV (2019) RNA Structure Duplication in the Dengue Virus 3\u0026apos; UTR: Redundancy or Host Specificity? mBio 10\u003c/li\u003e\n\u003cli\u003eYeh SC and Pompon J (2018) Flaviviruses Produce a Subgenomic Flaviviral RNA That Enhances Mosquito Transmission. DNA Cell Biol 37:154-159\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1. Viral infection, dissemination, and transmission of CQW1 and MM_1775\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"550\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.815884476534295%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.061371841155236%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.700361010830324%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.880866425992778%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"0.5415162454873647%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.909090909090908%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDays\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCQW1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMM_1775\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.545454545454545%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCQW1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.181818181818183%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMM_1775\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.727272727272727%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCQW1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.363636363636363%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMM_1775\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.909090909090908%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14%\" valign=\"top\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003cp\u003e（14/14）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e90.9%\u003c/p\u003e\n \u003cp\u003e（20/22）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.545454545454545%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.181818181818183%\" valign=\"top\"\u003e\n \u003cp\u003e15%\u003c/p\u003e\n \u003cp\u003e（3/20）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.727272727272727%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.363636363636363%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.909090909090908%\" valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14%\" valign=\"top\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003cp\u003e（15/15）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e73.7%\u003c/p\u003e\n \u003cp\u003e（14/19）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.545454545454545%\" valign=\"top\"\u003e\n \u003cp\u003e33.3%（5/15）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.181818181818183%\" valign=\"top\"\u003e\n \u003cp\u003e14.3%\u003c/p\u003e\n \u003cp\u003e（2/14）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.727272727272727%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.363636363636363%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e50%\u003c/p\u003e\n \u003cp\u003e（1/2）\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.909090909090908%\" valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14%\" valign=\"top\"\u003e\n \u003cp\u003e76.9%\u003c/p\u003e\n \u003cp\u003e（10/13）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.272727272727273%\" valign=\"top\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003cp\u003e（18/18）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.545454545454545%\" valign=\"top\"\u003e\n \u003cp\u003e20%\u003c/p\u003e\n \u003cp\u003e（2/10）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.181818181818183%\" valign=\"top\"\u003e\n \u003cp\u003e27.8%\u003c/p\u003e\n \u003cp\u003e（5/18）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.727272727272727%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.363636363636363%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e20%\u003c/p\u003e\n \u003cp\u003e（1/5）\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.568306010928962%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"14.025500910746812%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"15.1183970856102%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"12.568306010928962%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"16.21129326047359%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"12.750455373406194%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"16.21129326047359%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"0.546448087431694%\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eIR (Infection rate):\u0026nbsp;number of positive midgut samples/ total number of female mosquitoes tested;\u003c/p\u003e\n\u003cp\u003eDR (Dissemination rate): number of positive head and leg samples / number of total samples;\u003c/p\u003e\n\u003cp\u003eTR (Transmission rate): number of positive salivary gland samples / number of total samples.\u003c/p\u003e\n\u003cp\u003eTable 2. Analysis of infection rates of vertical transmission\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"551\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.793103448275861%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eStrain\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.874773139745916%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eStage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.874773139745916%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIR(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.508166969147005%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMIR(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.9491833030853%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRNA copy(Log/uL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.793103448275861%\" rowspan=\"3\"\u003e\n \u003cp\u003eCQW1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.874773139745916%\" valign=\"top\"\u003e\n \u003cp\u003eEgg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.874773139745916%\" valign=\"top\"\u003e\n \u003cp\u003e13.8(4/29)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.508166969147005%\" valign=\"top\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.9491833030853%\" valign=\"top\"\u003e\n \u003cp\u003e5.091\u0026plusmn;0.9267\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.894736842105264%\" valign=\"top\"\u003e\n \u003cp\u003eAdult-Female\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.894736842105264%\" valign=\"top\"\u003e\n \u003cp\u003e25.9(7/27)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.789473684210527%\" valign=\"top\"\u003e\n \u003cp\u003e5.2(7/135)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.421052631578945%\" valign=\"top\"\u003e\n \u003cp\u003e5.469\u0026plusmn;0.0873\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.894736842105264%\" valign=\"top\"\u003e\n \u003cp\u003eAdult-male\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.894736842105264%\" valign=\"top\"\u003e\n \u003cp\u003e47.2(17/36)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.789473684210527%\" valign=\"top\"\u003e\n \u003cp\u003e9.4(17/180)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.421052631578945%\" valign=\"top\"\u003e\n \u003cp\u003e5.609\u0026plusmn;0.0953\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eIR: number of positive pools / number of total pools\u003c/p\u003e\n\u003cp\u003eMIR (Minimum infection rate): number of positive pools / number of total mosquitoes\u003c/p\u003e\n\u003cp\u003eTable 3. qPCR primers used to detect TMUV\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"45.02074688796681%\" valign=\"bottom\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.97925311203319%\" valign=\"bottom\"\u003e\n \u003cp\u003eSequence（5\u0026prime;-3\u0026prime;）\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"45.02074688796681%\" valign=\"bottom\"\u003e\n \u003cp\u003eCQW1-E-qPCR-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.97925311203319%\" valign=\"bottom\"\u003e\n \u003cp\u003eAATGGCTGTGGCTTGTTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"45.02074688796681%\" valign=\"bottom\"\u003e\n \u003cp\u003eCQW1-E-qPCR-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.97925311203319%\" valign=\"bottom\"\u003e\n \u003cp\u003eGGGCGTTATCACGAATCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"45.02074688796681%\" valign=\"bottom\"\u003e\n \u003cp\u003eMM_1775-NS5-qPCR-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.97925311203319%\" valign=\"bottom\"\u003e\n \u003cp\u003eGAAATCGAATCTGCCAGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"45.02074688796681%\" valign=\"bottom\"\u003e\n \u003cp\u003eMM_1775-NS5-qPCR-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"54.97925311203319%\" valign=\"bottom\"\u003e\n \u003cp\u003eCCGCTCACCCAATACATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Tembusu virus, Culex quinquefasciatus, vector competence, mosquito transmission, vertical transmission, venereal transmission","lastPublishedDoi":"10.21203/rs.3.rs-4023085/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4023085/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"The recent pandemic of flaviviruses all over the world has underscored the importance of studying flavivirus vector competence, as the evolutionary enhancement of mosquito transmission played a significant role in its spread. Tembusu virus is an avian-related mosquito-borane flavivirus, which is mainly epidemic in China and Southeast Asia since 2010. However, the reason for the outbreak of Tembusu virus in 2010 remains unclear, and it is unknown whether changes in vector transmission played an essential role in this process. To address these questions, we conducted a study using Culex quinquefasciatus as a model for Tembusu virus infection, employing both oral infection and microinjection methods. Our findings confirmed that both vertical and horizontal transmission collectively contribute to the cycle of Tembusu virus within the mosquito population, with persistent infection observed. Importantly, our data revealed that the prototypical Tembusu virus MM_1775 strain exhibited significantly higher infectivity and transmission rates in mosquitoes compared to a duck Tembusu virus (CQW1 strain). Furthermore, we identified that the viral E protein and 3' untranslated region are key elements responsible for these differences. In conclusion, our study sheds light on the mosquito transmission of Tembusu virus and provides valuable insights into the factors influencing its infectivity and transmission rates. These findings contribute to a better understanding of Tembusu virus epidemiology and can potentially aid in the development of strategies to control its spread.","manuscriptTitle":"Vector Competence of Culex quinquefasciatus for Tembusu Virus and Viral Determinants for Virus Transmission by Mosquitoes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-15 13:40:49","doi":"10.21203/rs.3.rs-4023085/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1982f08c-3b23-4987-a56d-9b01e16ac597","owner":[],"postedDate":"March 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-23T16:03:10+00:00","versionOfRecord":{"articleIdentity":"rs-4023085","link":"https://doi.org/10.1186/s13567-024-01361-3","journal":{"identity":"veterinary-research","isVorOnly":false,"title":"Veterinary Research"},"publishedOn":"2024-09-18 15:57:38","publishedOnDateReadable":"September 18th, 2024"},"versionCreatedAt":"2024-03-15 13:40:49","video":"","vorDoi":"10.1186/s13567-024-01361-3","vorDoiUrl":"https://doi.org/10.1186/s13567-024-01361-3","workflowStages":[]},"version":"v1","identity":"rs-4023085","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4023085","identity":"rs-4023085","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}