Full text
68,378 characters
· extracted from
preprint-html
· click to expand
Tau Clearance Reverses Neuronal Dysfunction in Both Young and Aged C. elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Tau Clearance Reverses Neuronal Dysfunction in Both Young and Aged C. elegans View ORCID Profile T. Carroll , View ORCID Profile G.V.W. Johnson , View ORCID Profile K. Nehrke doi: https://doi.org/10.1101/2025.06.23.661052 T. Carroll 1 University of Rochester School of Medicine and Dentistry, Department of Pathology and Laboratory Medicine Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for T. Carroll G.V.W. Johnson 2 University of Rochester School of Medicine and Dentistry, Department of Anesthesiology and Perioperative Medicine Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for G.V.W. Johnson For correspondence: Keith_Nehrke{at}urmc.rochester.edu Gail_Johnsonvoll{at}urmc.rochester.edu K. Nehrke 3 University of Rochester School of Medicine and Dentistry, Department of Medicine, Nephrology Division Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for K. Nehrke For correspondence: Keith_Nehrke{at}urmc.rochester.edu Gail_Johnsonvoll{at}urmc.rochester.edu Abstract Full Text Info/History Metrics Preview PDF Abstract Alzheimer’s Disease (AD) is an age-related dementia and presents a growing medical and economic burden as the average human lifespan continues to rise. AD is classically diagnosed via the accumulation and aggregation of two major proteins: amyloid-β and tau. To date, potential and FDA-approved therapies designed to clear these aggregates at best delay rather than prevent disease, indicating that the root cause of AD lay upstream of aggregate formation. Tau protein’s phosphorylation is critical for AD progression, and phosphorylation at Threonine 231 is thought to be an early disease-associated, “gatekeeper” event. Previously, we showed that genomic, single-copy insertion of phosphomimetic human tau (T231E) into C. elegans mechanosensory neurons induced age-dependent deficits in light-touch sensation. Herein, we have generated new C. elegans models which express pan-neuronal human tau to assess the idea of selective vulnerability and whether specific neuronal behaviors might be impacted preferentially. We also tested whether tau clearance via an Auxin Inducible Degron (AID) could reverse these deficits. Despite our hypothesis that prolonged stress in older animals would induce irreversible metabolic rewiring or maladaptation, tau depletion rescued known behavioral deficits at all ages tested, including in old worms which displayed the most overt phenotypes. Taken together, our data suggest that neuronal dysfunction induced by phosphorylated tau is reversible and provides reassurance that current early-phase therapeutic efforts aimed at reducing soluble tau levels in AD patients may prove effective. Background and Introduction Alzheimer’s disease (AD) is classically and clinically defined by the accumulation of two insoluble protein aggregates: extracellular amyloid-β plaques and intraneuronal neurofibrillary tangles (NFTs) composed of aberrantly modified tau protein 1 . Despite decades of intensive research, AD etiology is poorly understood, available therapies are scarce, and AD progression can be slowed but cannot be halted 2 . Elucidating the mechanisms that drive AD is thus paramount for developing effective treatments that alleviate AD burden. Many modern AD therapies aim to clear or degrade amyloid-β and tau, hoping to prevent their aggregation and thus halt disease progression. However, emerging evidence suggests that clearance- based strategies may not be as straightforward or effective as initially hoped. Aducanumab, an amyloid- β targeting immunotherapy, was the first FDA approved AD drug 3 . However, applying the exclusion criteria associated with aducanumab significantly limits patient access despite its FDA approval, and even in eligible patients its effectiveness in slowing cognitive decline is still being researched. 3 . Many other amyloid-β and tau targeting clearance strategies are currently in the pipeline, and while early results have claimed mixed success, none have proved to be the silver bullet the AD field had envisioned 4 , 5 . There could be many reasons that clearance strategies to date have proved ineffective, including a treatment window applied after overt neurodegeneration has already occurred, permanent cellular changes which aren’t reversed upon clearance, or the mis-targeting of epitopes which are downstream and simply correlative to the root cause of disease. As AD progresses, tau protein undergoes many post-translational modifications (PTMs), and its pathologic contribution to AD may begin upstream of its oligomerization or aggregation. Tau accumulates PTMs as it transitions from soluble monomer to insoluble aggregate in AD, with phosphorylation being the earliest and most abundant modification 6 . Early-disease phosphorylation events modulate tau conformations 7 , 8 , tau localization 9 , 10 and tau oligomerization 11 . Phosphorylated threonine 231 (pT231) is one of the earliest tau PTMs to enrich in AD 6 , 12 , heralds subsequent NFT formation where it enriches 13 , and is a promising biomarker for AD diagnosis well before aggregate formation 14 . Furthermore, studies in post-mortem human tissue suggest that tau PTMs accumulate in a stereotypical pattern as sporadic AD progresses – highlighting the potential for pT231 as an early marker for disease inception 6 . In line with this, our previous work in C. elegans demonstrated that single-copy expression of T231E drives functional deficits in neurons in the absence of apparent aggregates and suppresses stress-induced mitophagy, which is not observed in strains expressing wild-type human tau 15 . Herein, we report generating a novel transgenic C. elegans which pan-neuronally expresses the pathologic human tau variant (T231E), use it to explore whether T231E tau preferentially impacts certain behaviors, and address whether clearance can rescue observed phenotypes. By using Mos-mediated Single Copy Insertion to generate integrated, single-copy transgenes, we have focused on expressing tau at physiologically relevant levels and attempted to avoid confounds related to overexpression of an aggregation prone protein. Moreover, tau expression in our strains is driven by the Ultra Pan-Neuronal (UPN) promoter, a synthetic promoter designed to express equally in all neurons 16 , which facilitates defining selective vulnerability to T231E tau among the 302 well characterized neurons of the adult hermaphrodite nervous system. Surprisingly, while our results show that pan-neuronal expression of an early-disease, pathologic tau variant leads to deficits within the touch neurons of C. elegans , as previously reported, there are relatively few other behaviors that are significantly impacted, and those only subtly. Even more surprising was the finding that depleting the toxic T231E tau can completely restore the touch-deficit phenotype at any age tested, including in older worms. Although further study will be necessary to determine the molecular mechanisms behind this transient disruption of mechanosensory neuron function, these initial results provide reassurance that emerging therapeutic strategies designed to eliminate soluble tau may prove to be effective at treating AD. Materials and Methods C. elegans Growth and Maintenance Nematodes were maintained at 20°C on Nematode Growth Media (NGM) plates and seeded with live E. coli strain OP50, cultured overnight at 37°C at 220 rpm, as previously described 17 , 18 . For experimental assays, after synchronization by standard procedure with sodium hypochlorite, 4th larval stage (L4) hermaphrodites were selected and moved to test plates. The day after moving was considered adult Day 1. Animals were transferred daily to avoid populations of mixed age. Plasmid Construction Briefly, individual elements and coding sequences for each sub-component of pUPN::AID::eGFP::tbb-2 3’UTR and pUPN::AID::eGFP::TauT4::tbb-2 3’UTR constructs were amplified using primers with overlapping homology and then stitched together using overlap extension PCR cloning ( Table 1 ) 19 . pTC4 codes for human tau tagged with a minimal degron sequence in a pFH6.II C. elegans expression vector that includes GFP, synthetic introns, and a 3’ untranslated region. PCR sewing products were inserted into pCFJ151 (Addgene, Watertown, MA) using traditional restriction-site cloning to generate MosSCI vectors for insertion at the ttTi5605 Ch. II site 20 . Final plasmids, pTC10 (AID::eGFP) and pTC11 (AID::eGFP::TauT4), were sequenced completely (Plasmidsaurus, San Francisco, CA, USA). View this table: View inline View popup Download powerpoint Table 1 - Primers Used to Amplify Genetic Sub-elements for Overlap Extension PCR C. elegans Strain Generation For all strains herein (see Table 2 ), the wild-type background strain is Bristol-N2 and all lab-generated and externally acquired strains were outcrossed to Bristol-N2 at least four times. Single-copy, pan- neuronal transgenic strains were created by integrating pTC10 and pTC11 into Ch. II site ttTi5605 using Mos-mediated Single-Copy Insertion 20 . Both strains were sequenced completely through the insertion site. CRISPR-Cas9 gene editing was used to introduce site-specific mutations into the rnySi58 tau coding region via a dpy-10 co-CRISPR strategy and oligonucleotide-mediated HDR using purified Cas9 RNP injection 22 , 23 . Targeting crRNAs were from Dharmacon (GE Healthcare Dharmacon, Lafayette, CO) and were complexed to scaffolding RNAs for Cas9, with genomic recognition sites as follows: Tau T231 targeting RNA, 5’ACGGCGACTTGGGTGGAGTA’3 Tau T231E ssODN, 5’GTCCCTTCCAACCCCACCCACCCGGGAGCCCAAGAAGGTGGCCGTGGTCAGAGAGCCACCCAAGTCGCCGTCTT CCGCCAAGAGCCGCCTGCAGA’3 Strains were selected via pan-neuronal eGFP fluorescence, homozygosed, confirmed for successful gene insertion via genomic PCR with the following primers, and then outcrossed 4x to N2 to remove the co- CRISPR dpy-10 mutant marker. View this table: View inline View popup Download powerpoint Table 2 - C. elegans Strains Used in This Work MosSCI ttTi5605-F, 5’GTTTTTGATTGCGTGCGTTA3’ MosSCI ttTi5605-R, 5’ACATGCTTCGTGCAAAACAG3’ MosSCI ttTi5605 insert-F, 5’CATCCCGGTTTCTGTCAAAT3’ Tau mutations were confirmed using the following genotyping primers: Tau geno-F2 5’ATCAGGGGATCGCAGCGG3’ Tau geno-R2 5’TGGTTTATGATGGATGTTGCCT3’ Confocal Imaging For pan-neuronal imaging, Day 1 animals were mounted on 2% agarose pads on glass slides and immobilized with 1 mM tetramisole hydrochloride (#L-9756; Sigma-Aldrich, St. Louis, MO). Imaging was performed using a Laser Scanning Confocal microscope (Inverted Leica DMi8 and LAX software). All images were acquired under the same exposure conditions with a 20x/0.75 objective (Air – HC PL Apochromat C52), and all genotypes were represented and imaged the same day. For clarity, autofluorescence was manually identified and pseudo-colored red in each image. AID Depletion and Validation Age-synchronized animals were transferred to either regular NGM plates or NGM plates containing 4mM indole-3-acetic acid (IAA, A10556; Thermo Scientific Chemicals, Haverhill, MA) and left to deplete for 24 hours before assessing their protein content via fluorescent intensity. Imaging was performed using a Nikon Eclipse inverted microscope coupled to a six channel LED light source (Intelligent Imaging Innovation, Denver, CO), an ORCA-Flash4.0 V2 Digital CMOS camera (Hamamatsu Photonics, Bridgewater Township, NJ) and Slidebook6 software (Intelligent Imaging Innovation, Denver, CO). All images were acquired under the same exposure conditions and each experiment was imaged in one session. A depletion time course was established by taking Day 1 animals of a highly expressing, integrated tau strain containing pan-neuronal TIR1 (KWN1025) and imaging 1, 2, 4, and 24 hours after being transferred to 4mM IAA plates. Western Blot Animals were maintained on 60mm NGM plates until nearly starved and collected using ice-cold M9 and washed 3x. The supernatant was discarded, and worm pellets were resuspended in 1x radioimmunoprecipitation assay (RIPA) buffer with 0.1% sodium dodecyl sulfate (SDS) and supplemented with protease and phosphatase inhibitors: 10 µM Bestatin (#200484; Calbiochem, San Diego, CA), 15 µM Pepstatin (#AG-CP3-7001; AdipoGen Life Sciences, San Diego, CA), 10µg/mL Leupeptin (#AG-CP3-7000M025; AdipoGen), 2µg/mL Aprotinin (#9087-70-1; MilliporeSigma, Burlington, MA), 1 mM PMSF (#837091, Roche, Basel, Switzerland), and 1x Halt TM phosphatase inhibitor cocktail (#XB340823; Thermo-Fisher Scientific). Samples were freeze-cracked using liquid nitrogen three times, sonicated using a micro-tip at max amplitude for 20s two times (#S-3000; MISONIX Inc, Farmingdale, NY ), and then centrifuged at 4°C for 10min at 16,000g. Protein content was quantified using a bicinchoninic acid (BCA) assay, and 10µg protein was loaded into 4-15% gradient polyacrylamide gels (#4561083; Bio-Rad Laboratories, Hercules, CA) for separation then transferred to a nitrocellulose membrane. The membrane was blocked using 5% non-fat milk in Tris-buffered saline containing 0.05% Tween 20 (TBS-T). The membrane was probed using a 1:150,000 dilution of Dako rabbit, anti-tau antibody (1° - #A0024; Agilent, Santa Clara, CA)) overnight, washed three times using TBS-T, and then probed using a 1:5000 dilution of horse radish peroxidase (HRP) conjugated anti-rabbit antibody (2° - #R1006; Kindle Biosciences, Greenwich, CT) for 1 hour. Bands were developed using chemiluminescence (211595, Millipore, Immobilon Crescendo) and imaged using a KwikQuant Imager (Kindle Biosciences). Touch Sensitivity Assay The behavioral response to being touched by an eyelash was adapted from an assay previously described 25 . The animals were touched anteriorly specifically behind the terminal bulb of the pharynx with the eyelash, 10 times per animal, with a 10s gap between each touch. Typically, if the animal demonstrates an omega turn or if it reversed its direction after an anterior touch, the animal was scored as giving a positive response. Touch response percentage was generated by the number of times an animal responded to the touch stimulus over the total number of times they were touched. All touch response assays reported here were blinded by an independent researcher before experimentation. Thrashing Assays A drop of 2% agarose (#BP164-500; Thermo Fisher Scientific) was poured over a glass slide and allowed to dry and then 20 μl of M9 was poured on it. Age-synchronized animals were picked to that drop of M9 buffer. After 2 min in M9, thrashing rates were counted and recorded manually. A single thrash was defined as a complete change in the direction of the body down the midline. Animals that were motionless for 10 s were discarded from the analysis. Life-Span Assays Embryos were obtained through conventional alkaline-hypochlorite treatment and placed on freshly grown OP50 seeded NGM plates. Fifteen animals from the 4th larval stage (L4) were transferred to individual 35 mm seeded NGM plates with a total 3 plates for each genotype. Each day they were transferred to new plates to avoid mixing of populations until they stopped producing offspring. Simultaneously the worms were counted alive visually or with gentle prodding on the head. Animals were censored in the event of internal hatching of larva, body rupture, or crawling off the plate. The experiment was conducted at 20°C and scored until all the worms died 26 . Locomotion Assays Approximately 10 animals were transferred to NGM-agar plates and allowed to acclimate for 30 minutes before recording their movement for 10 minutes at 15 FP using a Nikon SMZ800 dissecting microscope equipped with Diagnostic Instruments Camera HRP042-CMT and XIMEA CamTool v4.28 capture software. Experiments examining locomotory speed (BLPS) were analyzed using the ImageJ plugin WrmTrck 27 . Holistic locomotory experiments were conducted using Tierpsy Tracker to skeletonize and track more than 4,000 different aspects of worm locomotion, as described 28 . Heatshock Assays Twenty Day 1 animals were placed on NGM-agar plates, which were then covered with parafilm and placed in a 37°C incubator for 1 hour and 15 minutes 29 . The animals were then visually scored as Normal, Paralyzed, or Dead after prodding with a platinum wire. PQT Stress Assays Lifespan of animals experiencing chronic ROS stress induced by paraquat (PQT, #227320010, Thermo Scientific) exposure was assessed by moving Day 1 animals to plates containing 8mM PQT, adapted from 30 . Animals were transferred daily to avoid mixed populations, and they were scored as alive or dead via visual examination and gentle prodding on the head with a platinum wire. Associative Memory Briefly, for each experimental strain, Day 1 animals were washed in M9 and transferred to conditioning NGM-agar plates (without food) in the presence or absence of isoamyl alcohol (IA, #AX1440-1, EM Science, Gibbstown, NJ) and left to starve for 90 minutes. Conditioned animals were then washed with M9 and transferred to assay plates to assess their chemotactic attraction or aversion to isoamyl alcohol, as previously described 31 . The chemotactic index is calculated as (IA - T)/ (IA + T + S), where IA equals the number of worms residing in the quadrant containing IA, T equals the number of worms residing in the quadrant opposite the IA quadrant, and S equals the number of worms within the starting quadrant, at the end of the assay period. Statistical Analysis All statistical analyses were conducted using Prism 8.0 (GraphPad Software Inc, Boston, MA), with alpha-error level of p < 0.05 considered to be significant. Data were averaged and represented as mean ± standard error (mean ± SEM) or as mean ± standard deviation (mean ± SD), depending upon the number of experimental replicates. In general, differences between matched pairs of samples were analyzed using student t-tests, and group differences were analyzed with either one-way or two-way ANOVA, depending upon the variables. For all tests herein, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Results Pan-Neuronal, Single-copy Human Tau Phosphomimetic Strains Possess Selective Deficits Transgenic strains expressing Tau have historically utilized extrachromosomal arrays which can be stabilized by integration into the genome. While these strains have proven useful models 32 , they do come with caveats regarding tau expression level, uniformity among tissues, and potential synthetic phenotypes due to disruption of endogenous genes during integration 33 , 34 . Previously, we showed that human tau expressed specifically in the mechanosensory neurons of C. elegans from single-copy gene insertions into a genomic safe-harbor loci could produce subtle, yet consistent, neuronal dysfunction that was selective to a phosphomimetic T231E AD associated mutation 15 . Here, we expanded on this previous approach by generating a pan-neuronal equivalent to assess whether dysfunction occurs in other neuronal subtypes and if so, which subtypes are selectively vulnerable. In brief, the Ultra Pan- Neuronal (UPN) Promoter, an artificial, chimeric promoter comprised of regulatory sub-elements from unc-11 , rgef-1 , ehs-1 , and ric-19 16 , was used to drive equal levels of tau expression in all 302 neurons of the adult hermaphrodite. The primary expression construct consisted of 0N4R human tau 35 , translationally fused to an eGFP fluorescent reporter to facilitate visualization, and an Auxin Inducible Degron (AID) tag for inducible degradation 36 , inserted into a genomic safe-harbor loci using MosSCI ( Fig 1 ) 20 . Like our previous model, T231E tau was generated via CRISPR-Cas9 gene editing of the transgenic cassette. An additional control strain was also generated, adopting an identical transgenic/genomic architecture to express AID::eGFP ( Fig 1 ) Download figure Open in new tab Figure 1 – Expression Pattern Characterization for Novel, Pan-Neuronal Tau Models (A) Western blot demonstrating measurable tau expression in the single-copy AID::eGFP::T231E animals. 10µg of protein lysate from wildtype (N2-Bristol), eGFP (KWN904, a single copy strain), and T231E (KWN906, a single copy strain) homogenates were separated on a 4-15% gradient polyacrylamide gel and transferred to a nitrocellulose membrane for western analysis. In addition, conventional transgenic strains were run as additional negative (KWN1021 for eGFP) and positive (KWN1025 for T231E Tau) controls. The red arrow indicates the specific band at the expected size of 72kDa. All other bands are non-specific. All samples were run on the same gel, transferred to the same membrane, and probed using a primary antibody for total tau. All lanes were exposed for the same amount of time, and the vertical lines denote where intervening lanes were removed for clarity. Extended blots can be found in Supplemental Figure 1. (B) Confocal images demonstrating the pan-neuronal expression of eGFP in strain KWN904 under the UPN promoter, a chimeric promoter specifically designed to drive equal levels of expression in all neurons 16 . Autofluorescence has been manually pseudo-colored red for clarity. Scale bars = 50 µM. (C) Confocal images for N2 and pan-neuronal AID::eGFP (KWN904), AID::eGFP::TauT4 (KWN905), and AID::eGFP::T231E (KWN906) containing strains highlighting the expression pattern within C. elegans head neurons. In accordance with tau’s affinity for microtubules, the fluorescence for both AID::eGFP::TauT4 and AID::eGFP::T231E is predominantly localized to the nerve ring – a bundle of processes derived from the nearby head ganglia that wraps around the pharynx of the animal. The single-copy pan-neuronal strains were imaged via confocal microscopy to confirm ubiquitous neuronal expression ( Fig 1B-C ). Interestingly, while eGFP was localized indiscriminately to the processes, soma, and even the nucleus, as has been observed previously in C. elegans 37 , tau localization was more prominent in the processes, with the most visible fluorescent feature in both the TauT4 and T231E tau strains being the nerve ring, where many neuronal processes converge ( Fig 1C ). In addition, we confirmed that the expression level of the transgenes was approximately equivalent between cells, as expected from use of the UPN promoter ( Fig 1 ). Finally, western blot analysis confirmed the expression of a polypeptide unique to the transgenic strains of the expected size of 72kDa for the fusion proteins ( Fig 1A ). Behaviorally, pan-neuronal expression of T231E tau elicited a touch deficit ( Fig 2A ), like that reported previously in strains where tau expression was limited to mechanosensory neurons 15 , 38 . In contrast to previous studies, we also observed a small but significant deficit in strains expressing wildtype TauT4 when compared to non-transgenic wild type animals (N2-Bristol) ( Fig 2A ). This suggests that a palpable deficit requires its expression in non-mechanosensory neurons within the circuit, though whether these are independent or additive to its expression in mechanosensory neurons is unclear. Download figure Open in new tab Figure 2. Touch-Sensation and Body Curvature are Impacted in T231E Tau Animals (A) Quantification of touch responsiveness in Day 5 adult N2 controls and animals expressing pan- neuronal eGFP, eGFP::TauT4, or eGFP::T231E. Data were calculated as percent responsiveness following ten repetitive light touches to the anterior body, and are plotted with the mean ± SD. Each point represents an individual animal, N = 30 animals from three biological replicates. Statistical analysis was performed using a one-way ANOVA followed by Tukey-corrected multiple comparisons. (B and D) An unbiased, clustering heat-map comparing locomotory features within the Tierpsy_256 library at day 3 (B) and day 5 (D). The Tierpsy_256 library is a hand curated list of the features generated through Tierpsy analysis that reduces the number of redundant comparisons between samples and is tailored to wholesale exploration of phenotypic differences in locomotion 39 . Reported values are z-scores calculated using the grand mean and standard deviation of all samples, including controls. Initial analysis indicated that approximately a quarter of Tierpsy_256 features are different within the eGFP::T231E samples. (C and E) A heatmap focusing on the 20 features from (B) and (D), respectively, where the absolute eGFP::T231E z-score was highest, thereby highlighting the features where mimetic animals differ most. Nearly all these features relate to animal curvature on both days. Although the transgenic strains lacked overt physiologic or behavioral abnormalities, T231E tau worms were still identifiable through blinded visual assessment by an experienced C. elegans experimentalist (data not shown), indicating that their locomotion was abnormal, albeit subtly and in a way that was not readily apparent. Hence, to obtain a robust and holistic picture of animal locomotion, we used Tierpsy Tracker, a complex worm tracking algorithm that measures and extracts 4,083 different features from videos of C. elegans foraging on solid media 28 , 39 . These features are categorized into ones that measure the morphology, path attributes, posture and curvature, as well as speed and velocity of the whole animal and individual body parts. Since Tierpsy’s inception, feature libraries have been established to highlight which measurements are most useful for determining phenotypic differences between animals. One such library is referred to as Tierpsy_256 and contains the top 256 most informative features for comparing worm locomotion 28 . Tierpsy_256 analysis of our pan-neuronal T231E tau animals demonstrated that approximately a quarter of the features in the Tierpsy_256 library were strikingly different compared to controls at adult Days 3 and 5 ( Fig 2B and 2D ). By focusing the heatmap on the top 20 terms, it is apparent that nearly all of these relate to the posture, or curvature of the animal ( Fig 2C and 2E ). For example, the standard deviation of the curvature was different among all body parts for the T231E tau animals, indicating that the amplitude of their curvature was more erratic than that of the controls. Interestingly, this phenotype was limited to the T231E tau worms and was not apparent in the wildtype TauT4 expressing strain. Next, we assessed other outputs, expecting to find additional, albeit perhaps subtle, impacts of T231E tau being expressed in every neuron. To our surprise, we were unable to identify such a phenotype. A selection of negative results is presented in Supplemental Figure S1 including: lifespan ( Supplemental Fig S1A ), thrashing rates in liquid and basal locomotor speed on solid media, both of which are commonly reported phenotypes in pan-neuronal C. elegans tau models 32 ( Supplemental Figure S1D and S1E ), chemotaxis learning, which is a form of associative memory 40 , 41 ( Supplemental Fig S1D ), and stress tolerance, including to acute heat and chronic exposure to paraquat (PQT), a redox cycler that generates ROS ( Supplemental Figure S1B and S1C ) 30 . While these negative results do not preclude a role for tau in mediating other behaviors, the apparent selectivity may suggest that less nuanced effects are limited to mechanosensory touch neurons, which have remarkably long processes, as explored below in the Discussion. AID-tagged Tau Depletion Rescues Touch Deficits at All Ages To determine whether our phosphomimetic tau creates irreversible dysfunction with age, we next asked whether T231E depletion could suppress our most robust phenotype: the touch deficit. Briefly, the Auxin Inducible Degron (AID) system requires three major components to mediate depletion of a select protein: 1) a protein labeled with an AID tag which binds auxin, a naturally occurring plant hormone, 2) a TIR1 protein complex which also binds auxin and poly-ubiquitinates the AID tagged protein and targets it for degradation by the proteasome, and 3) exogenous auxin supplementation to bring the AID tag and TIR1 complexes together 36 ( Fig 3A ). In our case, the transgenic proteins were labeled with AID, TIR1 was expressed from a pan-neuronal integrated transgene ( otIs730 ) 42 , and NGM plates were supplemented with a natural auxin (IAA). Download figure Open in new tab Figure 3. Auxin Treatment Rapidly Depletes Pan-Neuronal Tau (A) Schematic model illustrating the mechanism of auxin inducible depletion. Briefly, auxin mediates the interaction between the AID-tagged protein of interest and a TIR1-ubiquitin ligase complex, thereby targeting the tagged protein for proteasomal degradation. (B) Fluorescent images demonstrating FP::Tau levels without treatment (-) or with IAA auxin treatment for 24 hours (+). Scale bars are 50 µM. (C) Quantification of FP::Tau fluorescence with or without IAA treatment. Data shown is the backgrounded subtracted sum intensity of fluorescence in the head of each animal. Each bar represents the mean of each sample +/- SD with individual points representing individual animals. Individual t-test comparisons between untreated and IAA treated samples, p = 0.05, N = 5 animals. (D-E) Fluorescent quantification of auxin-mediated depletion of an integrated eGFP::T231E overexpression strain (KWN1025) at Days 1 (D) and 8 (E). Each point represents an individual animal, N = 4-5. For each time- course, fluorescent intensity was normalized to the starting intensity as a value of 100. Because the single copy strains were quite dim ( Fig 1 ), we utilized integrated overexpression strains to confirm rapid and complete depletion of the same AID-tagged tau transgene ( Fig 3B and 3C ). A pan- neuronal tau strain lacking the necessary cofactor TIR1 was used as a negative control, and a strain containing an AID tagged protein in smooth body wall muscle alongside pan-somatic TIR1 was used as a positive control ( Fig 3B ). To determine how quickly depletion occurred, we quantified fluorescent intensity over time following auxin exposure, in both young (Day 1) and aged (Day 8) animals. In Day 1 animals, approximately 99% of the fluorescently tagged tau had been degraded by 2 hours ( Fig 2D ). While slower in Day 8 animals, 98% of the fluorescent protein was still degraded within 24 hours ( Fig 2E ). These results are consistent with previous reports using an AID system to degrade other targets and the known decrease in protein turnover seen in aged C. elegans 36 , 43 . The caveat here is that we are not able to ensure robust depletion in every neuron, particularly in the single-copy strains. However, this would only emerge as a concern if the depletion strategy failed to suppress the tau-induced phenotypic deficit. Single-copy pan-neuronal T231E strains were crossed with the pan-neuronal TIR1 otIs730 allele and assayed for touch responsiveness following auxin treatment. Assays were performed at adult Days 3, 5, and 8 to interrogate the role of age in the phenotypic deficit and its reversibility ( Fig 4A ). As expected, the touch deficit was exacerbated with age, but to our surprise, T231E depletion rescued the touch deficit completely at all ages tested, in a manner that was entirely dependent upon both TIR1 and IAA ( Fig 4B , 4C, and 4D ). This finding refutes our hypothesis that stress adaptation over time may result in irreversible abnormalities that preclude restoring normal neuronal function 44 . We conclude that tau inhibition of mechanosensory neuronal function is a transient and completely reversible phenomenon, at least in our model, which bodes well for therapeutic clearance strategies’ effectiveness. Download figure Open in new tab Figure 4. Tau Depletion via AID Rescues Touch Deficits at All Ages (A) A schematic demonstrating the experimental outline used to test how AID depletion of Tau affects eGFP::T231E-dependent touch deficits with age. Briefly, animals were synchronized and moved to control NGM plates or NGM plates containing 4mM IAA at adult days 2, 4, and 7, then assayed at days 3, 5, and 8, respectively. (B-D) Quantification of touch sensitivity at adult Days 3, 5, and 8. Pan-neuronal AID::eGFP strains containing pan-neuronal TIR1 were used as a negative control (red), and AID::eGFP::T231E strains lacking TIR1, and therefore incapable of tau depletion upon treatment with IAA, were used as a positive control (blue). Experimental strains containing both pan-neuronal AID::eGFP::T231E and TIR1 are denoted in yellow. Each dot represents an individual animal, N = 30 animals from three biological replicates for each condition. Statistical analysis was performed using a one-way ANOVA followed by Tukey-corrected multiple comparisons. Discussion The AD field has largely acknowledged that tau’s primary toxicity likely occurs upstream of aggregation, as seminal studies have demonstrated that aggregates may be protective in disease contexts 45 , 46 . Many studies have demonstrated that specific tau phosphorylation events contribute to AD development 47 , 48 , yet the precise mechanisms through which these early-disease PTMS alter tau’s oligomerization and contribute to pathology is not clearly defined. A large contributor to this lack of information arises from the complexity and ambiguity inherent to disease models, particularly on those which rely on overexpression and report phenotypes which may not be relevant to AD pathology 32 , 33 . Modern approaches to AD diagnosis appreciate that molecular changes occur years before overt neurodegeneration and AD symptoms manifest 49 – 51 . In this light, physiologic expression models which highlight subtle, yet reproducible phenotypes are of increasing importance, as they may help to illuminate the earliest events in tau pathogenesis. Given the fact that the greatest risk factor for AD is aging, the field requires models which develop normally and possess normal lifespans, unlike overexpression models, which commonly have shortened lifespans and gross morphological differences 32 . Our novel model expresses single copy levels of tau equally in all neurons using the UPN promoter ( Fig 1 ) and possesses a mild, age-dependent touch deficit ( Fig 3 ). The localization of both TauT4 and T231E tau to the neuronal processes suggests that the T231E mutation does not majorly impacting tau’s ability to bind microtubules ( Fig 1C ). The lifespan, stress resistance, and overall health of the animals seems unaffected by pan-neuronal T231E in any context tested ( Fig S1 ). Furthermore, we are confident in the ability of the AID system to rapidly and robustly deplete our phosphomimetic tau at any age, given we observe nearly complete depletion of pan- neuronal AID-tagged proteins within 24 hours of 4mM IAA treatment at all ages ( Fig 2 ). Tau pathology in sporadic AD cases follows a defined spatial progression, indicating that certain regions of the brain are more susceptible to AD pathology 52 . This phenomenon is broadly referred to as selective vulnerability, and understanding the mechanisms that confer susceptibility may provide insights into how early-disease tau modifications contribute to neuronal dysfunction. Selective vulnerability is not limited to brain regions, however, as specific neuronal subtypes in each region can alter susceptibility. For example, excitatory neurons in human AD cases are more prone to tau pathology than inhibitory neurons 53 . Many studies have proposed mechanisms for this enhanced susceptibility, such as differential expression of tau isoforms 54 or differences in chaperone activity, such as observed with BAG3 53 . As mentioned above, the mechanosensory neurons were the only neuronal subset that showed quantifiable deficits that could be attributed to cell autonomous action of tau, based on this work ( Fig 3A ) and previous publications 15 , 38 . Other commonly reported phenotypes observed in pan-neuronal tau models were not present, including thrashing deficits 55 , overt locomotor deficits 56 , and associative memory deficits 41 . The specificity of the touch deficit in our model could indicate that the morphology of mechanosensory neurons plays a part in their vulnerability to tau pathology. Specifically, excitatory neurons typically possess much longer neuronal processes than inhibitory neurons 53 . Similarly, the mechanosensory neurons in C. elegans possess the longest neuronal processes in the animal 57 , indicating that axonal length or microtubule abundance may modulate AD susceptibility on a cellular scale. Single nucleus RNA sequencing within susceptible vs. resistant subpopulations of neurons within the entorhinal cortex Layer II (ECII) supports this finding by highlighting that vulnerable ECII neurons differentially express axon-localized proteins 58 . Previously we demonstrated that axonal trafficking in mechanosensory neurons of T231E mutants is impaired and that mito-lysosomal trafficking along the mechanosensory neurite progressively declines with age 38 . These observations highlight the intersection of tau, axonal maintenance, and mitochondrial trafficking as a critical component of incipient neuronal dysfunction in our AD model. It is possible that simply clearing pathological proteins may not be sufficient for reversing disease progression, in part due to lasting consequences of the toxic moiety 59 . The most obvious example of this would be if a toxic protein caused neuronal death, a phenomenon which protein clearance could not reverse in a population of post-mitotic neurons. Permanent changes could also occur in more subtle ways, such as through maladaptive stress responses. For example, we hypothesized that tau may cause irreversible metabolic changes in neurons by triggering chronic mitochondrial stress and eliciting the mitochondrial unfolded protein response. Several studies, including our own 15 , 38 , 60 , 61 , have demonstrated that tau containing disease-associated PTMs can affect mitochondrial function and mitochondrial quality control (MQC), a set of dedicated molecular pathways designed to ensure healthy mitochondrial networks 60 – 62 . Chronic mitochondrial unfolded protein response signaling can inhibit mitophagy, a form of selective autophagy specific to mitochondria and a key part of MQC 63 . Long-term disruption of MQC skews mitochondrial homeostasis through the accumulation of damaged mitochondria and abnormal mitochondrial DNA 63 , 64 . Maladaptive changes such as these present a potential confound for studies and therapies based on the protective effects of tau reduction and clearance 65 – 67 , which may only be effective if administered before adaptive responses become chronic. However, despite our hypothesis that T231E would cause irreversible changes as animals aged, we saw a complete rescue of the touch deficit regardless of the age at which tau was depleted ( Figure 4 ). While the touch assay measures the direct function of mechanosensory neurons, we also observed that the pan-neuronal T231E animals have discernable alterations in their curvature as they move on solid media ( Fig 3B and 3E ). Coordinated movement in C. elegans relies on a complex network of excitatory and inhibitory neurons 68 , and T231E’s impact on curvature suggests that perhaps synaptic signaling throughout the neuronal motor circuit is impaired. Further studies in our laboratory aim to elucidate if specific neuronal subsets within this circuit are selectively impacted, or whether synaptic transmission is less efficient within this model. Additionally, the subtle differences in T231E tau animal’s curvature are likely the earliest manifestation of overt locomotor deficits observed in other tau overexpression models 32 . This further highlights the importance of carefully accounting for tau expression levels in animal models to separate physiologically relevant disease findings from artifacts of protein overexpression. In sum, our results suggest that the pathologic effect of T231E is completely reversible, but they also highlight that early-disease phosphorylation events such as occur at T231 might independently lead to subtle, pre-clinical neuronal dysfunction. Most clinical trials for tau clearance are currently in the early stages. Many of these are based on immunotherapy and rely on antibodies to target tau, with degradation occurring through the host immune system 67 . Our results suggest that therapies which degrade tau species associated with early- disease progression can prevent subtle neuronal dysfunction and may protect neurons from stress that could culminate into more severe neuronal damage with age. Unlike our AID approach, however, many Alzheimer’s clearance strategies target extracellular tau, which have limited intracellular access and thus may slow tau’s transfer between neurons but ultimately fail to prevent disease 69 . In this light, the most effective therapies will likely be those which target a gamut of early-disease tau epitopes and degrade them before toxic tau incites intracellular stress and before more overt symptoms manifest 70 . Conclusion Our study uses a single-copy approach in C. elegans to model the functional impact of pan-neuronal tau expression, focused on achieving very low tau expression levels and equivalent expression in each neuron. Additionally, we tested whether phenotypic defects were reversible via tau depletion using an AID approach. This is particularly relevant to AD in older worms where irreversible changes or maladaptation may have occurred through life-long exposure to toxic tau. We demonstrated surprising selectivity in the behavior(s) impacted by an AD-relevant phosphomimetic tau, which is one of the earliest biomarkers of disease. Finally, we clearly showed that neuronal dysfunction caused by phosphomimetic human tau is entirely reversible, regardless of age, supporting the idea that tau clearance may prove an effective therapy for slowing AD progression. Further study is needed to determine the molecular mechanisms behind the selective and transient mechanosensory dysfunction observed in our model, and connecting single-copy to overexpression phenotypes will benefit from models that express defined amounts of tau from safe-harbor insertions such as described here that bridge a range of expression levels from low to high. Author Contributions Carroll, T. - Conceptualization, Data Curation, Writing – Original Draft, Writing – Review and Editing, Visualization. Nehrke, K. and Johnson, G.V.W. – Writing – Review and Editing, Supervision. Ethical Considerations Not applicable. Consent to Participate Not applicable. Consent for Publication Not applicable. Declaration of Conflicting Interests The authors declare no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. Funding This work was supported by the National Institute of Health [NIA Grant Number R01 AG067617]. Data Availability Statement The data supporting the findings of this study are available within the article and/or its supplemental material. Download figure Open in new tab Supplemental Figure S1. Full Lane Overview of Single-Copy Tau Western Blot Full-scale images of the Western Blot from Fig. 1A . Lanes shown in Fig. 1A are denoted by black boxes. Lysates from N2, single-copy eGFP (KWN904), single-copy T231E (KWN906), a strain overexpressing eGFP (KWN1021) as a negative control, and a strain overexpressing T231E (KWN1025) as a positive control were separated on a 4-15% gradient polyacrylamide gel and transferred to a nitrocellulose membrane. All samples were run on the same gel, transferred to the same membrane, and imaged with the same exposure time. Ponceau staining (right) was used to qualitatively visualize protein content in each lane. The membrane was probed using a rabbit, anti-tau antibody (1° - A0024, Dako, 1:150,000) overnight, washed three times using TBS-T, and then probed using a horse radish peroxidase (HRP) conjugated anti-rabbit antibody (2° - R1006, Kindle Biosciences, 1:5000) for 1 hour. Download figure Open in new tab Supplemental Figure S2. Phenotypes Not Impacted by Tau (A) Survival curve demonstrating baseline lifespan of the single-copy Tau mutants versus controls. N = 1 replicate of 20 individual animals. (B) Survival curve during chronic exposure to 8mM PQT. N = 1 replicate of 20 individual animals. (C) Score distribution of Tau expressing Day 1 animals after 1.25 hours of heat shock at 37°C. Animals were categorized as dead if no movement was observed after gentle prodding with a platinum wire, and they were considered paralyzed if they could move their head, but not the rest of their body. N = 1 replicate of 20 individual animals. (D) Chemotactic indexes to isoamyl alcohol (IA), normally an attractant for C. elegans , reflecting the associative memory when animals are exposed to IA in the absence of food. “N” denotes the non-conditioned starvation control for each strain, whereas “C” denotes the starvation + IA conditioned sample. For each strain, animals were initially attracted to IA but learned to avoid it when starved in its presence. Each point represents a population of 50-100 animals, N=4. (E) Quantification of thrashing rate at Day 5 in M9 liquid after 1 minute of acclimatization. Each point represents an individual animal. F) Normalized quantification for the average speed of Day 5 animals in body lengths per second. Each point represents an individual animal. Acknowledgements The authors would like to thank the lab of Oliver Hobert for providing plasmids containing the UPN promoter. We would also like to acknowledge BioRender for aide in figure preparation. Additionally, we would like to thank Dylan Pfendler for helpful discussions during this work. Funder Information Declared National Institute on Aging , 5R01AG067617-05 Footnotes Author e-mail addresses: Trae_Carroll{at}urmc.rochester.edu References 1. ↵ 2025 Alzheimer’s disease facts and figures . Alzheimer’s & Dementia 2025 ; 21 . DOI: 10.1002/alz.70235 . OpenUrl CrossRef 2. ↵ Cummings J , Zhou Y , Lee G , et al. [Not Available]. Alzheimers Dement (N Y) 2024; 10 : e12465 . 20240424. DOI: 10.1002/trc2.12465 . OpenUrl CrossRef 3. ↵ Heidebrink JL and Paulson HL . Lessons Learned from Approval of Aducanumab for Alzheimer’s Disease . Annual Review of Medicine 2024 ; 75 : 99 – 111 . DOI: 10.1146/annurev-med-051022-043645 . OpenUrl CrossRef PubMed 4. ↵ Imbimbo BP , Ippati S , Watling M , et al. A critical appraisal of tau-targeting therapies for primary and secondary tauopathies . Alzheimer’s & Dementia 2022 ; 18 : 1008 – 1037 . DOI: 10.1002/alz.12453 . OpenUrl CrossRef PubMed 5. ↵ Self WK and Holtzman DM . Emerging diagnostics and therapeutics for Alzheimer disease . Nature Medicine 2023 ; 29 : 2187 – 2199 . DOI: 10.1038/s41591-023-02505-2 . OpenUrl CrossRef 6. ↵ Wesseling H , Mair W , Kumar M , et al. Tau PTM Profiles Identify Patient Heterogeneity and Stages of Alzheimer’s Disease . Cell 2020 ; 183 : 1699 – 1713 .e1613. DOI: 10.1016/j.cell.2020.10.029 . OpenUrl CrossRef PubMed 7. ↵ Jeganathan S , Hascher A , Chinnathambi S , et al. Proline-directed pseudo-phosphorylation at AT8 and PHF1 epitopes induces a compaction of the paperclip folding of Tau and generates a pathological (MC-1) conformation . J Biol Chem 2008 ; 283 : 32066 – 32076 . 20080825. DOI: 10.1074/jbc.M805300200 . OpenUrl Abstract / FREE Full Text 8. ↵ Schwalbe M , Kadavath H , Biernat J , et al. Structural Impact of Tau Phosphorylation at Threonine 231 . Structure 2015 ; 23 : 1448 – 1458 . DOI: 10.1016/j.str.2015.06.002 . OpenUrl CrossRef PubMed 9. ↵ Cho JH and Johnson GV . Primed phosphorylation of tau at Thr231 by glycogen synthase kinase 3beta (GSK3beta) plays a critical role in regulating tau’s ability to bind and stabilize microtubules . J Neurochem 2004 ; 88 : 349 – 358 . DOI: 10.1111/j.1471-4159.2004.02155.x . OpenUrl CrossRef PubMed Web of Science 10. ↵ Aragão Gomes L , Uytterhoeven V , Lopez-Sanmartin D , et al. Maturation of neuronal AD-tau pathology involves site-specific phosphorylation of cytoplasmic and synaptic tau preceding conformational change and fibril formation . Acta Neuropathologica 2021 ; 141 : 173 – 192 . DOI: 10.1007/s00401-020-02251-6 . OpenUrl CrossRef PubMed 11. ↵ Despres C , Byrne C , Qi H , et al. Identification of the Tau phosphorylation pattern that drives its aggregation . Proc Natl Acad Sci U S A 2017 ; 114 : 9080 – 9085 . 20170807. DOI: 10.1073/pnas.1708448114 . OpenUrl Abstract / FREE Full Text 12. ↵ Luna-Muñoz J , Chávez-Macías L , García-Sierra F , et al. Earliest stages of tau conformational changes are related to the appearance of a sequence of specific phospho-dependent tau epitopes in Alzheimer’s disease . J Alzheimers Dis 2007 ; 12 : 365 – 375 . DOI: 10.3233/jad-2007-12410 . OpenUrl CrossRef PubMed 13. ↵ Moszczynski AJ , Gohar M , Volkening K , et al. Thr175-phosphorylated tau induces pathologic fibril formation via GSK3β-mediated phosphorylation of Thr231 in vitro . Neurobiol Aging 2015 ; 36 : 1590 – 1599 . 20141213. DOI: 10.1016/j.neurobiolaging.2014.12.001 . OpenUrl CrossRef PubMed 14. ↵ Ashton NJ , Benedet AL , Pascoal TA , et al. Cerebrospinal fluid p-tau231 as an early indicator of emerging pathology in Alzheimer’s disease . EBioMedicine 2022 ; 76 : 103836 . 20220212 . DOI: 10.1016/j.ebiom.2022.103836 . OpenUrl CrossRef 15. ↵ Guha S , Fischer S , Johnson GVW , et al. Tauopathy-associated tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model . Mol Neurodegener 2020 ; 15 : 65 . 20201109 . DOI: 10.1186/s13024-020-00410-7 . OpenUrl CrossRef 16. ↵ Yemini E , Lin A , Nejatbakhsh A , et al. NeuroPAL: A Multicolor Atlas for Whole-Brain Neuronal Identification in C. elegans . Cell 2021 ; 184 : 272 – 288 .e211. DOI: 10.1016/j.cell.2020.12.012 . OpenUrl CrossRef PubMed 17. ↵ Brenner S . The genetics of Caenorhabditis elegans . Genetics 1974 ; 77 : 71 – 94 . DOI: 10.1093/genetics/77.1.71 . OpenUrl Abstract / FREE Full Text 18. ↵ Stiernagle T . Maintenance of C. elegans . WormBook 2006 : 1 – 11 . 20060211. DOI: 10.1895/wormbook.1.101.1 . OpenUrl CrossRef PubMed 19. ↵ Bryksin A and Matsumura I. Overlap Extension PCR Cloning. Humana Press , 2013 , pp. 31 – 42 . 20. ↵ Frøkjær-Jensen C , Wayne Davis M , Hopkins CE , et al. Single-copy insertion of transgenes in Caenorhabditis elegans . Nature Genetics 2008 ; 40 : 1375 – 1383 . DOI: 10.1038/ng.248 . OpenUrl CrossRef PubMed Web of Science 21. Stevenson ZC , Moerdyk-Schauwecker MJ , Jamison B , et al. Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans . G3 Genes|Genomes|Genetics 2020 ; 10 : 3775 – 3782 . DOI: 10.1534/g3.120.401400 . OpenUrl Abstract / FREE Full Text 22. ↵ Paix A , Folkmann A , Rasoloson D , et al. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes . Genetics 2015 ; 201 : 47 – 54 . DOI: 10.1534/genetics.115.179382 . OpenUrl Abstract / FREE Full Text 23. ↵ Kim H , Ishidate T , Ghanta KS , et al. A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans . Genetics 2014 ; 197 : 1069 - 1080 . DOI: 10.1534/genetics.114.166389 . OpenUrl Abstract / FREE Full Text 24. El Mouridi S , Alkhaldi F and Frøkjær-Jensen C. Modular safe-harbor transgene insertion for targeted single-copy and extrachromosomal array integration in Caenorhabditis elegans . G3 Genes|Genomes|Genetics 2022 ; 12 . DOI: 10.1093/g3journal/jkac184 . OpenUrl CrossRef 25. ↵ Chen X and Chalfie M. Modulation of C. elegans Touch Sensitivity Is Integrated at Multiple Levels . The Journal of Neuroscience 2014 ; 34 : 6522 – 6536 . DOI: 10.1523/jneurosci.0022-14.2014 . OpenUrl Abstract / FREE Full Text 26. ↵ Sutphin GL and Kaeberlein M. Measuring Caenorhabditis elegans Life Span on Solid Media . Journal of Visualized Experiments 2009 . DOI: 10.3791/1152 . OpenUrl CrossRef PubMed 27. ↵ Nussbaum-Krammer CI , Neto MF , Brielmann RM , et al. Investigating the Spreading and Toxicity of Prion-like Proteins Using the Metazoan Model Organism C. elegans . Journal of Visualized Experiments 2015 . DOI: 10.3791/52321 . OpenUrl CrossRef PubMed 28. ↵ Javer A , Currie M , Lee CW , et al. An open-source platform for analyzing and sharing worm-behavior data . Nature Methods 2018 ; 15 : 645 – 646 . DOI: 10.1038/s41592-018-0112-1 . OpenUrl CrossRef PubMed 29. ↵ Zevian SC and Yanowitz JL . Methodological considerations for heat shock of the nematode Caenorhabditis elegans . Methods 2014 ; 68 : 450 – 457 . DOI: 10.1016/j.ymeth.2014.04.015 . OpenUrl CrossRef PubMed 30. ↵ Senchuk MM , Dues DJ and Van Raamsdonk JM . Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays . Bio Protoc 2017 ; 7 . DOI: 10.21769/BioProtoc.2086 . OpenUrl CrossRef 31. ↵ Cao SQ , Wang HL , Palikaras K , et al. Chemotaxis assay for evaluation of memory-like behavior in wild-type and Alzheimer’s-disease-like C. elegans models . STAR Protoc 2023 ; 4 : 102250 . 20230426 . DOI: 10.1016/j.xpro.2023.102250 . OpenUrl CrossRef 32. ↵ Natale C , Barzago MM and Diomede L . Caenorhabditis elegans Models to Investigate the Mechanisms Underlying Tau Toxicity in Tauopathies . Brain Sciences 2020 ; 10 : 838 . DOI: 10.3390/brainsci10110838 . OpenUrl CrossRef PubMed 33. ↵ Wang C , Saar V , Leung KL , et al. Human amyloid β peptide and tau co-expression impairs behavior and causes specific gene expression changes in Caenorhabditis elegans . Neurobiol Dis 2018 ; 109 : 88 – 101 . 20171002. DOI: 10.1016/j.nbd.2017.10.003 . OpenUrl CrossRef PubMed 34. ↵ Miyasaka T , Shinzaki Y , Yoshimura S , et al. Imbalanced Expression of Tau and Tubulin Induces Neuronal Dysfunction in C. elegans Models of Tauopathy . Front Neurosci 2018 ; 12 : 415 . 20180620 . DOI: 10.3389/fnins.2018.00415 . OpenUrl CrossRef 35. ↵ Buchholz S and Zempel H . The six brain-specific TAU isoforms and their role in Alzheimer’s disease and related neurodegenerative dementia syndromes . Alzheimer’s & Dementia 2024 ; 20 : 3606 – 3628 . DOI: 10.1002/alz.13784 . OpenUrl CrossRef 36. ↵ Ashley GE , Duong T , Levenson MT , et al. An expanded auxin-inducible degron toolkit for Caenorhabditis elegans . Genetics 2021 ; 217 . DOI: 10.1093/genetics/iyab006 . OpenUrl CrossRef PubMed 37. ↵ Bessa C , Maciel P and Rodrigues A . Using C. elegans to Decipher the Cellular and Molecular Mechanisms Underlying Neurodevelopmental Disorders . Molecular neurobiology 2013 ; 48 . DOI: 10.1007/s12035-013-8434-6 . OpenUrl CrossRef PubMed 38. ↵ Guha S , Cheng A , Carroll T , et al. Selective disruption of Drp1-independent mitophagy and mitolysosome trafficking by an Alzheimer’s disease relevant tau modification in a novel Caenorhabditis elegans model . Genetics 2022 ; 222 . DOI: 10.1093/genetics/iyac104 . OpenUrl CrossRef 39. ↵ Javer A , Ripoll-Sánchez L and Brown AEX. Powerful and interpretable behavioural features for quantitative phenotyping of Caenorhabditis elegans . Philosophical Transactions of the Royal Society B: Biological Sciences 2018 ; 373 : 20170375 . DOI: 10.1098/rstb.2017.0375 . OpenUrl CrossRef PubMed 40. ↵ Voglis G and Tavernarakis N . A synaptic DEG/ENaC ion channel mediates learning in C. elegans by facilitating dopamine signalling . The EMBO Journal 2008 ; 27 : 3288 – 3299 . DOI: 10.1038/emboj.2008.252 . OpenUrl Abstract / FREE Full Text 41. ↵ Fang EF , Hou Y , Palikaras K , et al. Mitophagy inhibits amyloid-β and tau pathology and reverses cognitive deficits in models of Alzheimer’s disease . Nature Neuroscience 2019 ; 22 : 401 – 412 . DOI: 10.1038/s41593-018-0332-9 . OpenUrl CrossRef PubMed 42. ↵ Aghayeva U , Bhattacharya A , Sural S , et al. DAF-16/FoxO and DAF-12/VDR control cellular plasticity both cell-autonomously and via interorgan signaling . PLOS Biology 2021 ; 19 : e3001204 . DOI: 10.1371/journal.pbio.3001204 . OpenUrl CrossRef PubMed 43. ↵ Dhondt I , Petyuk VA , Bauer S , et al. Changes of Protein Turnover in Aging Caenorhabditis elegans . Mol Cell Proteomics 2017 ; 16 : 1621 – 1633 . 20170705. DOI: 10.1074/mcp.RA117.000049 . OpenUrl Abstract / FREE Full Text 44. ↵ Guha S , Fischer S , Cheng A , et al. A T231E Mutant that Mimics Pathologic Phosphorylation of Tau in Alzheimer’s disease Causes Activation of the Mitochondrial Unfolded Protein Response in C. elegans touch neurons . MicroPubl Biol 2020 ; 2020 20200909 . DOI: 10.17912/micropub.biology.000306 . OpenUrl CrossRef 45. ↵ Santacruz K . Tau Suppression in a Neurodegenerative Mouse Model Improves Memory Function . Science 2005 ; 309 : 476 – 481 . DOI: 10.1126/science.1113694 . OpenUrl Abstract / FREE Full Text 46. ↵ Mroczko B , Groblewska M and Litman-Zawadzka A . The Role of Protein Misfolding and Tau Oligomers (TauOs) in Alzheimer′s Disease (AD) . International Journal of Molecular Sciences 2019 ; 20 : 4661 . DOI: 10.3390/ijms20194661 . OpenUrl CrossRef PubMed 47. ↵ Augustinack JC , Schneider A , Mandelkow E-M , et al. Specific tau phosphorylation sites correlate with severity of neuronal cytopathology in Alzheimer’s disease . Acta Neuropathologica 2002 ; 103 : 26 – 35 . DOI: 10.1007/s004010100423 . OpenUrl CrossRef PubMed Web of Science 48. ↵ Mi K and Johnson GV . The role of tau phosphorylation in the pathogenesis of Alzheimer’s disease . Curr Alzheimer Res 2006 ; 3 : 449 – 463 . DOI: 10.2174/156720506779025279 . OpenUrl CrossRef PubMed 49. ↵ Janelidze S , Mattsson N , Palmqvist S , et al. Plasma P-tau181 in Alzheimer’s disease: relationship to other biomarkers, differential diagnosis, neuropathology and longitudinal progression to Alzheimer’s dementia . Nature Medicine 2020 ; 26 : 379 – 386 . DOI: 10.1038/s41591-020-0755-1 . OpenUrl CrossRef PubMed 50. Janelidze S , Palmqvist S , Leuzy A , et al. Detecting amyloid positivity in early Alzheimer’s disease using combinations of plasma Aβ42/Aβ40 and p-tau . Alzheimer’s & Dementia 2022 ; 18 : 283 – 293 . DOI: 10.1002/alz.12395 . OpenUrl CrossRef 51. ↵ Neddens J , Temmel M , Flunkert S , et al. Phosphorylation of different tau sites during progression of Alzheimer’s disease . Acta Neuropathologica Communications 2018 ; 6 . DOI: 10.1186/s40478-018-0557-6 . OpenUrl CrossRef PubMed 52. ↵ Braak H and Braak E . Neuropathological stageing of Alzheimer-related changes . Acta Neuropathologica 1991 ; 82 : 239 – 259 . DOI: 10.1007/bf00308809 . OpenUrl CrossRef PubMed Web of Science 53. ↵ Fu H , Possenti A , Freer R , et al. A tau homeostasis signature is linked with the cellular and regional vulnerability of excitatory neurons to tau pathology . Nature Neuroscience 2019 ; 22 : 47 – 56 . DOI: 10.1038/s41593-018-0298-7 . OpenUrl CrossRef PubMed 54. ↵ Espíndola SL , Damianich A , Alvarez RJ , et al. Modulation of Tau Isoforms Imbalance Precludes Tau Pathology and Cognitive Decline in a Mouse Model of Tauopathy . Cell Reports 2018 ; 23 : 709 – 715 . DOI: 10.1016/j.celrep.2018.03.079 . OpenUrl CrossRef PubMed 55. ↵ Kraemer BC , Zhang B , Leverenz JB , et al. Neurodegeneration and defective neurotransmission in a Caenorhabditis elegans model of tauopathy . Proceedings of the National Academy of Sciences 2003 ; 100 : 9980 – 9985 . DOI: 10.1073/pnas.1533448100 . OpenUrl Abstract / FREE Full Text 56. ↵ Aquino Nunez W , Combs B , Gamblin TC , et al. Age-dependent accumulation of tau aggregation in Caenorhabditis elegans . Front Aging 2022 ; 3 : 928574 . 20220819 . DOI: 10.3389/fragi.2022.928574 . OpenUrl CrossRef PubMed 57. ↵ Schafer WR . Mechanosensory molecules and circuits in C. elegans . Pflügers Archiv - European Journal of Physiology 2015 ; 467 : 39 – 48 . DOI: 10.1007/s00424-014-1574-3 . OpenUrl CrossRef PubMed 58. ↵ Leng K , Li E , Eser R , et al. Molecular characterization of selectively vulnerable neurons in Alzheimer’s disease . Nature Neuroscience 2021 ; 24 : 276 – 287 . DOI: 10.1038/s41593-020-00764-7 . OpenUrl CrossRef PubMed 59. ↵ Eisner V , Picard M and Hajnóczky G . Mitochondrial dynamics in adaptive and maladaptive cellular stress responses . Nature Cell Biology 2018 ; 20 : 755 – 765 . DOI: 10.1038/s41556-018-0133-0 . OpenUrl CrossRef PubMed 60. ↵ Quintanilla RA , von Bernhardi R , Godoy JA , et al. Phosphorylated tau potentiates Aβ-induced mitochondrial damage in mature neurons . Neurobiol Dis 2014 ; 71 : 260 – 269 . 20140816. DOI: 10.1016/j.nbd.2014.08.016 . OpenUrl CrossRef PubMed 61. ↵ Pérez MJ , Vergara-Pulgar K , Jara C , et al. Caspase-Cleaved Tau Impairs Mitochondrial Dynamics in Alzheimer’s Disease . Mol Neurobiol 2018 ; 55 : 1004 – 1018 . 20170113. DOI: 10.1007/s12035-017-0385-x . OpenUrl CrossRef PubMed 62. ↵ Cai Q and Tammineni P . Alterations in Mitochondrial Quality Control in Alzheimer’s Disease . Frontiers in Cellular Neuroscience 2016 ; 10 . DOI: 10.3389/fncel.2016.00024 . OpenUrl CrossRef 63. ↵ Shpilka T and Haynes CM . The mitochondrial UPR: mechanisms, physiological functions and implications in ageing . Nat Rev Mol Cell Biol 2018 ; 19 : 109 – 120 . 20171122. DOI: 10.1038/nrm.2017.110 . OpenUrl CrossRef PubMed 64. ↵ Lin YF , Schulz AM , Pellegrino MW , et al. Maintenance and propagation of a deleterious mitochondrial genome by the mitochondrial unfolded protein response . Nature 2016 ; 533 : 416 – 419 . 20160502. DOI: 10.1038/nature17989 . OpenUrl CrossRef PubMed 65. ↵ Roberson ED , Scearce-Levie K , Palop JJ , et al. Reducing endogenous tau ameliorates amyloid beta- induced deficits in an Alzheimer’s disease mouse model . Science 2007 ; 316 : 750 – 754 . DOI: 10.1126/science.1141736 . OpenUrl Abstract / FREE Full Text 66. DeVos SL , Miller RL , Schoch KM , et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy . Sci Transl Med 2017 ; 9 . DOI: 10.1126/scitranslmed.aag0481 . OpenUrl Abstract / FREE Full Text 67. ↵ Congdon EE , Ji C , Tetlow AM , et al. Tau-targeting therapies for Alzheimer disease: current status and future directions . Nature Reviews Neurology 2023 ; 19 : 715 – 736 . DOI: 10.1038/s41582-023-00883-2 . OpenUrl CrossRef 68. ↵ Sakamoto K , Soh Z , Suzuki M , et al. Forward and backward locomotion patterns in C. elegans generated by a connectome-based model simulation . Scientific Reports 2021 ; 11 . DOI: 10.1038/s41598-021-92690-2 . OpenUrl CrossRef 69. ↵ Congdon EE and Sigurdsson EM . Tau-targeting therapies for Alzheimer disease . Nature Reviews Neurology 2018 ; 14 : 399 – 415 . DOI: 10.1038/s41582-018-0013-z . OpenUrl CrossRef PubMed 70. ↵ Theunis C , Crespo-Biel N , Gafner V , et al. Efficacy and Safety of A Liposome-Based Vaccine against Protein Tau, Assessed in Tau.P301L Mice That Model Tauopathy . PLoS ONE 2013 ; 8 : e72301 . DOI: 10.1371/journal.pone.0072301 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted June 25, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Tau Clearance Reverses Neuronal Dysfunction in Both Young and Aged C. elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Tau Clearance Reverses Neuronal Dysfunction in Both Young and Aged C. elegans T. Carroll , G.V.W. Johnson , K. Nehrke bioRxiv 2025.06.23.661052; doi: https://doi.org/10.1101/2025.06.23.661052 Share This Article: Copy Citation Tools Tau Clearance Reverses Neuronal Dysfunction in Both Young and Aged C. elegans T. Carroll , G.V.W. Johnson , K. Nehrke bioRxiv 2025.06.23.661052; doi: https://doi.org/10.1101/2025.06.23.661052 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41951) Biophysics (21456) Cancer Biology (18594) Cell Biology (25520) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22510) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88622) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.