ATPIF-1 knockout attenuates mitochondrial mPTP opening but does not diminish cardiac ischemic/reperfusion injury.

ATPIF-1 knockout attenuates mitochondrial mPTP opening but does not diminish cardiac ischemic/reperfusion injury. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article ATPIF-1 knockout attenuates mitochondrial mPTP opening but does not diminish cardiac ischemic/reperfusion injury. B. Daan Westenbrink, Pablo Sánchez-Aguilera, Huitzilihuitl Saucedo-Orozco, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4602126/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Ischemic conditions can flip the action of mitochondrial ATP-synthase from an ATP producing to an ATP consuming enzyme. The mitochondrial protein ATPase inhibitory factor 1 (ATPIF-1) prevents ATP-synthase reversal, thereby preserving ATP during ischemia. Recent evidence suggests that ATPIF-1 may also have detrimental effects on mitochondrial calcium (Ca2+) handling and mitochondrial permeability transition pore (mPTP) opening under ischemic conditions, challenging conventional views on the function of ATPIF-1. To determine the role of ATPIF-1 during myocardial ischemia we studied Ca2+ retention capacity, cardiac injury and cardiac remodeling after myocardial infarction (MI) in ATPIF-1 knockout (ATPIF-1 KO) mice and wild-type (WT) littermates. Mitochondrial Ca2+ retention capacity of isolated cardiac mitochondria of ATPIF-1 KO of ATPIF1-KO mice displayed a 1.3-fold higher threshold for mPTP opening compared to WT mice. However, when subjected 45 minutes left coronary artery (LCA) ligation followed by 48 hours of reperfusion, myocardial infarct size, left ventricular function and remodeling were all comparable between genotypes. Moreover, when subjected to permanent LCA ligation loss of ATPIF-1 KO also did not influence cardiac function or cardiac remodeling. Instead, ATPIF-1 KO mice displayed a 57.3% increase in interstitial fibrosis compared to WT mice. In conclusion, ATPIF-1 KO attenuates mPTP formation, however it does not mitigate myocardial I/R injury or post-MI remodeling. These findings challenge the concept that ATPIF-1 is critical for the response to I/R injury. Health sciences/Diseases/Cardiovascular diseases/Acute coronary syndromes/Myocardial infarction Biological sciences/Physiology/Metabolism/Mitochondria Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Ischemic heart disease ranks as the primary cause of cardiovascular mortality worldwide and represents the leading cause of heart failure (HF) ( 1 ). Prompt reperfusion strategies have been able to substantially reduces myocardial infarction formation, it also culminates into a second wave of cell death that is potentially amendable to therapeutic interventions ( 2 ). Despite decades of research and numerous clinical trials testing a variety of compounds, an effective treatment of ischemia/reperfusion (I/R) injury has not reached the clinical arena ( 3 ). Mitochondria play a pivotal role in the mechanism of I/R injury. During ischemia, oxygen deprivation leads to the inhibition of the electron transport chain (ETC) and the dissipation of mitochondrial membrane potential which ceases ATP synthesis ( 4 ). In addition, mitochondrial depolarization causes ATP-synthase to work in reverse mode where it starts to hydrolyze ATP. Under these conditions mitochondria can become ATP consumers, which is thought to further exacerbates energy depletion, reactive oxygen species (ROS) emission, and cellular demise ( 5 ). Conversely, during reperfusion, the restoration of oxygen reactivates the ETC, leading to hyperpolarization of the mitochondrial membrane. This process induces mitochondrial Ca 2+ overload and ROS formation, which in turn triggers the opening of the mitochondrial permeability transition pore (mPTP), a high-conductance pore that facilitates the release of apoptotic factors such as cytochrome C, thereby exacerbating cell death ( 6 ). The pivotal role of mitochondria in both ischemia and reperfusion has put them center stage as a pharmacological target to mitigating I/R injury. During oxygen deprivation ATPase inhibitory factor 1 (ATPIF-1), a unidirectional inhibitor of mitochondrial ATP hydrolysis, becomes active during mitochondrial depolarization to block ATP hydrolysis and target dysfunctional mitochondria for degradation ( 7 , 8 ). Consequently, increasing the bioavailability of ATPIF-1 has been proposed as a valuable approach to counteract energy depletion during acute cardiac ischemia ( 9 ). However, we and others recently showed that overexpression of ATPIF-1 levels impairs mitochondrial respiration, compromises mitochondrial Ca 2+ buffering capacity, and contributes to the opening of the mPTP, thereby exacerbating maladaptive remodeling in various cardiac pathologies, including myocardial infarction ( 10 – 12 ). Here, we hypothesize that ATPIF-1 promotes mPTP opening induced by Ca 2+ overload, thereby facilitating scar formation during I/R. If confirmed, this would not only challenge contemporary views of the role of ATPIF-1, but it would also suggest that strategies to inhibit ATPIF-1 could attenuate I/R injury. In our study, we employed an ATPIF-1 KO mouse to evaluate the effect of loss of ATPIF-1 on mitochondrial Ca 2+ retention capacity and its repercussions on cardiac function and infarct size after transient or permanent ligation of the LCA. These experimental conditions allowed us to investigate the potential of ATPIF-1 silencing in mitigating cardiac damage across both acute and chronic ischemic scenarios. Materials and Methods Experimental animals. Animal experiments were conducted in accordance with the ARRIVE guidelines and approved by the Dutch Central Committee for Animal Experimentation and the Animal Ethical Committee of the University of Groningen (permit number IVD199001-02-002). ATPIF-1 KO mice were generated as previously described ( 13 ). These mice, along with their WT littermates, were maintained under standard conditions with ad libitum access to food and water and monitored weekly. In vivo procedures were conducted under continuous isoflurane anesthesia (2%, TEVA Pharmachemie, Haarlem, The Netherlands). Sample sizes for both WT and ATPIF-1 KO groups were determined through power analysis for infarct size and mitochondrial Ca 2+ retention capacity, with 11 animals per group for infarct size and 6 animals per group for mitochondrial Ca 2+ retention capacity, assuming a desired power of 0.8 and an alpha level of 0.05. Animals were randomly allocated to experimental groups by investigators who were blinded to ensure unbiased assignment. Myocardial infarction induced by I/R injury. In vivo I/R injury was performed according to Booij et al. ( 14 ). In brief, 8 to 12-week-old mice underwent a 45-minute ligation of the left anterior descending (LAD) coronary artery, followed by 48 hours of reperfusion. The untied suture was left for later ex vivo cardiac blue staining. MI induced by permanent ligation of the LAC. In vivo, permanent ligation of the LCA was performed under identical surgical conditions as the I/R injury model, with the exception that tied sutures were retained for 5 weeks. At this time, the animals were sacrificed to evaluate chronic cardiac remodeling. Echocardiography . Transaortic echocardiography was performed at baseline and 24 hours after I/R surgery and at 5 weeks after PL surgery using a Vevo imaging station (FUJIFILM VisualSonics, Toronto, Canada) as previously described ( 15 ). Briefly, animals were anesthetized and placed in supine position in a heating pad. Parasternal LV short-axis M-mode recordings were obtained at the mid-papillary level and used to determine heart rate, cardiac output, LV end-diastolic internal diameter, anterior wall thickness, posterior wall thickness, and fractional shortening. Long-axis B-mode recordings were used to determine global longitudinal strain (GLS). Images deemed of insufficient quality were excluded from the analysis. The data were processed and analyzed in the Vevo Lab 3.2.6 software (FUJIFILM VisualSonics). Phthalo blue preparation and combined Phthalo blue and Triphenyltetrazolium chloride (TTC) cardiac staining. A 10% solution of Copper(II) Phthalocyanine (Phthalo Blue) (Sigma Aldrich, Cat number: 252980) was prepared following the method described by Bohl et al. ( 16 ) with some modifications. In brief, 10% Phthalo Blue was dispersed in 25 mL of NaCl 0.9% solution supplemented with 1 mL of Tween80. The stain was visually monitored under a microscope after vigorous mixing and decanting for 1 to 2 hours. Additional Tween80 was added if aggregates were observed in the solution. Cardiac ex vivo staining was conducted following the method described by Bohl et al. ( 16 ). Briefly, hearts were excised and cannulated with a blunt needle. After priming with a saline solution, the loose suture placed during I/R injury was re-ligated. Subsequently, the Phthalo blue staining solution was injected until the heart became uniformly blue. Following staining, hearts were frozen and sliced into 5 sections with a thickness of 1 mm using surgical blades in a 3D slicing mold. Each slice was then incubated in 1% TTC (Sigma Aldrich, Cat number: T8877) in phosphate saline buffer for 15 minutes at 37°C. Finally, cardiac slices were incubated in 4% paraformaldehyde at room temperature for 1 hour and subsequently weighed. Determination of remote area, area at risk, and necrotic area. The cardiac slices were photographed using a digital camera to capture both sides of each slice, distinguishing the ischemic in red, the infarcted area in white, and the remote area in blue. Subsequently, the total area of the slice, excluding the lumen of the right and left ventricle, was manually selected and stored in the ROI manager utilizing the ImageJ software. Then, the summary red and white areas (representing the areas at risk) were selected and stored in the ROI manager, followed by the selection of the white area alone, representing the infarcted area. This process was repeated for both sides of the slice, and the total area, area at risk, and infarcted area were averaged using data from both sides of the slide. Afterwards, the averaged areas were corrected for the weight of the slice. Area at risk below 15% were excluded from the analysis. Histological processing, embedding, and deparaffinization. Standard histological procedures were carried out following the protocol outlined in Booij et al. ( 14 ). In brief, transverse mid-papillary slices of the heart were fixed overnight in 10% paraformaldehyde (Klinipath, Duiven, The Netherlands). Subsequently, they were dehydrated and infiltrated with histological paraffin wax (Klinipath) using a Leica TP1020 automated tissue processor (Leica Microsystems, Wetzlar, Germany). Tissue specimens were then embedded in histological paraffin and sectioned into 4-µm thick slices using a Leica RM2255 microtome (Leica Microsystems). Prior to tissue staining, slides underwent deparaffinization by overnight heating at 60°C, followed by sequential incubations in xylene and ethanol dilutions. Quantification of cardiac fibrosis. Deparaffinized tissues underwent staining with Masson's trichrome stain to assess collagen deposition (stained in blue). Whole tissue image acquisition was conducted using the NanoZoomer 2.0-HT digital slide scanner. The percentage of fibrosis was determined utilizing the positive Pixel Count v9 algorithm of Aperio’s ImageScope 12.4.0 software (Leica Microsystems), employing default settings with a hue value of 0.66 and a hue width of 0.2. Determination of cardiomyocyte cross-sectional area. Cardiomyocyte cross-sectional area was determined by staining the deparaffinized tissues with fluorescein isothiocyanate (FITC)-conjugated wheat germ agglutinin (WGA) and 4’,6-diamidino-2-phenylindole (DAPI). Imaging of the fluorescent signals was conducted using a Leica AF6000 fluorescent imaging system (Leica Microsystems, Wetzlar, Germany), and the cell area was quantified using ImageJ. Mitochondrial isolation. According to Nijholt et al. ( 17 ), fresh cardiac mitochondrial isolation was carried out. In brief, hearts were kept on ice in 0.9% KCL directly after sacrifice and cut into smaller pieces in medium A (220 mM mannitol, 70 mM sucrose, 5 mM TES, 0.1 mM EGTA, pH 7.3 at 4°C with 1N KOH) with added proteinase (P8038, Sigma-Aldrich) for five minutes. Subsequently, 20 mL of medium A supplemented with 1 mg/mL bovine serum albumin was introduced, and the contents were transferred to a Potter-Elvehjem homogenizer for complete homogenization. Next, 3 centrifugation steps were conducted at 4°C for 10 minutes, resulting in a mitochondrial pellet. The pellet was finally resuspended in 150 to 300 µL of medium A and stored at 4°C for subsequent use. Mitochondrial Ca 2+ retention capacity. Mitochondrial Ca 2+ retention capacity was assessed according to Maxwell et al. ( 18 ). In summary, 200 µg of freshly isolated mitochondria were incubated in 197 µL of KCL buffer (composed of 125 mM KCl, 20 mM HEPES, 1 mM KH 2 PO 4 , 2 mM MgCl 2 , 40 µM EGTA, pH adjusted to 7.2 with KOH), along with 1 µL of 1 M pyruvate, 1 µL of 500 mM malate and 1 µL of 1 mM calcium green-5N (a non-permeant fluorescent Ca 2+ sensor, Thermo Fischer). Additionally, either 1 µM cyclosporine A (CsA, Merck KGaA, Darmstadt, Germany) or 10 µM ru360 (Sigma-Aldrich) was included to respectively inhibit the opening of the mPTP or the mitochondrial Ca 2+ uniporter. Fluorescence intensity was monitored using the Biotech Synergy H1 plate reader (Agilent Technologies, Santa Clara, CA, USA), while automated injectors delivered 6x 1 mM and 8x 1.2 mM CaCl 2 . mPTP opening was defined as the rise in fluorescence intensity during the decay phase of the curve, indicative of mitochondrial Ca 2+ release. RNA isolation, reverse transcription, and quantitative PCR. Frozen left ventricular (LV) samples underwent pulverization at -60°C and subsequent homogenization utilizing a Tissuelyser LT (Qiagen N.V., Hilden, Germany) in 1 mL of TRI Reagent solution (Thermo Fischer Scientific). mRNA extraction followed standard protocols, with quantification performed using a NanoDrop spectrophotometer (Thermo Fischer Scientific). Synthesis of cDNA was achieved employing the QuantiTect RT kit (Qiagen) according to the manufacturer’s instructions. Atpif-1 (Forward: 5’ GGAGCCTTCGGAAAACGAGA 3’; Reverse: 5’ ATGGTGTTTCCTCAGGGCAG 3’) and Nppa (Forward: 5’ GCTTCCAGGCCATATTGGAG 3’; Reverse: 5’ GGTGGTCTAGCAGGTTCTTG 3’) were designed utilizing Primer-Blast software (NCBI, Bethesda, MD, USA) and internally validated. Quantitative PCR (qPCR) was conducted employing the SYBR® Green Master Mix (Bio-Rad, Hercules, CA, USA) in the CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Statistical analysis. All results were presented as mean ± SE derived from a minimum of three independent assays. For data with normal distribution and equal variances, a two-sided t-test or one-way ANOVA followed by the Tukey post-hoc test or mixed-effects analysis were employed for multiple comparisons. Conversely, non-normally distributed data were analyzed using the U Mann-Whitney test or the Kruskal–Wallis test, followed by the Dunn post-hoc test for multiple comparisons. Statistical significance was established at p < 0.05. Data analysis and visualization were performed using GraphPad Prism 9 software (GraphPad Software Inc., San Diego, CA, United States). Results ATPIF-1 KO increases mitochondrial Ca 2+ retention capacity. ATPIF-1 has recently been linked with decreased mitochondrial Ca 2+ handling ( 10 , 19 ). Given that mitochondrial Ca 2+ overload is a crucial step in mitochondrial swelling and mPTP formation during I/R injury, it is plausible that ATPIF-1 may promote mPTP formation and subsequent myocardial damage during reperfusion. To investigate this hypothesis, cardiac mitochondria were isolated from ATPIF-1 KO mice (( 13 ), see Fig. 1 A) or their WT littermates and subjected to a Ca 2+ retention capacity assay. As depicted in Fig. 1 B and C, ATPIF-1 KO mitochondria display greater resilience to Ca 2+ overload, as evidenced by their increased capacity for Ca 2+ uptake (measured as fluorescence decay after CaCl 2 injection) without mPTP opening (measured as fluorescence increase after CaCl 2 injection). Notably, treatment with the mPTP inhibitor cyclosporine A (CsA) eliminated the differences between genotypes (Fig. 1 D), indicating that the differences observed are dependent on mPTP opening. Furthermore, we confirmed mitochondrial Ca 2+ uptake by blocking the mitochondrial Ca 2+ uniporter (MCU) with ru360 (Fig. 1 E). Based on these results and the observation that in vitro ATPIF-1 upregulation promotes mitochondrial Ca 2+ overload and subsequent mPTP formation, argues against a beneficial role for ATPIF-1 during I/R ( 10 , 11 ). We therefore investigated the in vivo impact of ATPIF-1 KO on I/R injury, as well as on chronic remodeling following myocardial infarction (MI), as illustrated in Fig. 2 . Cardiac function following I/R injury. The findings from experiment 1 revealed a reduction in anterior wall (AW) motion 24 hours post-reperfusion, resulting in a notable decrease in fractional shortening observed in both genotypes (Fig. 3 A and B). However, parameters such as left ventricular internal diastolic dimension (LVIDD) and cardiac output exhibited no significant differences between the groups (Fig. 3 B). Furthermore, there were no disparities noted in left ventricular fractional shortening or other conventional echocardiographic parameters between genotypes, suggesting that ATPIF-1 KO does not impact myocardial function following I/R injury (summarized in Table S1 ). Assessment of myocardial deformation via strain analysis offers a more sensitive measure of myocardial contractility. I/R injury led to a notable reduction in global longitudinal strain (GLS) (Fig. 4 ). Nevertheless, GLS values were equally impaired in ATPIF-1 KO and WT mice. ATPIF-1 KO does not mitigate cardiac damage in response to I/R injury. Consistent with the echocardiographic results, myocardial infarcted area (IA), expressed as a percentage of the area at risk (AAR), was comparable between WT and KO mice (Fig. 5 ). Additionally, the myocardial AAR and remote area (RA) showed no significant differences between the groups. These findings suggest that, despite its role in reducing mPTP formation, the absence of ATPIF-1 does not alleviate acute myocardial damage caused by I/R injury. Effect of ATPIF-1 KO on chronic post-MI remodeling. Next, we explored whether ATPIF-1 KO influenced chronic post-MI remodeling by subjecting mice to PL of the left coronary artery (LCA) and monitoring them for 5 weeks (Fig. 2 C). Cardiac function assessed via M-mode echocardiography at the 5-week mark revealed no discernible differences in fractional shortening, LVIDD, or cardiac output between the genotypes (Fig. 6 and Table S2 ). Moreover, ATPIF-1 KO did not affect cardiac hypertrophy, as indicated by comparable cardiac mass and cardiomyocyte cross-sectional area between genotypes (Fig. 7 A and B). However, cardiac sections from ATPIF-1 KO animals displayed 3.29% of interstitial fibrosis in the LV myocardium remote from the infarct, which corresponds to 57,3% increase in comparison to WT mice (Fig. 7 C). Discussion ATPIF-1 has been primarily recognized for its role in preventing ATP hydrolysis and averting energetic crisis during severe mitochondrial depolarization, commonly observed in acute cardiac ischemia ( 20 ). However, recent in vitro evidence shows that ATPIF-1 overexpression promotes pathological cardiomyocyte hypertrophy, mitochondrial Ca 2+ mishandling, and the premature mPTP formation ( 10 , 11 ). While our study showed that mitochondria of ATPIF-1 KO are more tolerant to Ca 2+ induced mPTP formation, ATPIF-1 KO mice were surprisingly not protected from myocardial I/R injury. Furthermore, ATPIF-1 KO also did not influence cardiac remodeling after permanent LCA ligation. Instead, ATPIF-1 KO resulted in higher levels of interstitial fibrosis upon chronic MI. These findings challenge conventional views on the function of ATPIF-1 and suggest that ATPIF-1 inhibition does not offer a nodal point for the mitigation of myocardial I/R injury. During an ischemic event, ATPIF-1 act as a unidirectional inhibitor of ATP hydrolysis, preventing cellular ATP wasting and targeting dysfunctional mitochondria for mitophagy ( 7 , 8 ). While historically considered an adaptive response against ischemic damage, recent evidence implicates ATPIF-1 upregulation in maladaptive cardiac metabolic rewiring in various cardiac diseases ( 10 , 12 , 21 , 22 ). Our research, along with others', has demonstrated that increased ATPIF-1 expression diminishes mitochondrial Ca 2+ handling and ATP synthesis, leading to heightened ROS emission and a shift towards glycolysis ( 10 , 12 ). Consequently, inhibiting ATPIF-1 has been suggested as a viable approach to postpone or prevent detrimental metabolic changes following a cardiac injury ( 12 ). Mitochondrial Ca 2+ concentrations exhibit a homeostatic range that enables mitochondria to enhance NADH generation and ATP synthesis ( 23 ). Nevertheless, Ca 2+ concentrations exceeding the physiological range initially trigger a reversible and transient low-conductance mPTP opening, which prevents the accumulation of Ca 2+ and ROS. Further Ca 2+ accumulation in mitochondria stimulates permanent high-conductance mPTP opening, leading to irreversible damage to mitochondrial structure and the release of apoptotic factors, such as cytochrome C ( 6 ). In our study, we induced massive and irreversible mPTP opening with increasing Ca 2+ concentrations and observed that mitochondria lacking ATPIF-1 exhibited a significantly higher threshold for mPTP opening, suggesting potential positive implications during reperfusion. While we did not delve into the biological mechanism underlying the increased mitochondrial Ca 2+ retention capacity, in vitro studies have shown a negative correlation between ATPIF-1 protein expression and mitochondrial capacity for Ca 2+ uptake and storage. Overexpression of ATPIF-1 in neonatal rat ventricular myocytes leads to severe mitochondrial dysfunction, characterized by mitochondrial Ca 2+ mishandling and higher sensitivity to open the mPTP ( 10 , 11 ). In contrast, knockdown of ATPIF-1 in HeLa cells induces the opposite effect, significantly increasing MCU-mediated mitochondrial Ca 2+ uptake ( 19 ). Further biochemical analysis is required to confirm the role MCU complex or changes in mPTP regulatory proteins in the ATPIF-1 KO in vivo model. Despite the positive effects on mitochondrial Ca 2+ retention capacity, our study demonstrated that ATPIF-1 KO did not confer additional protection against contractile dysfunction and necrosis following acute I/R injury. This contrasts with the effects of other mPTP inhibitors such as CsA, Sanglifehrin A, or NIM811, which also improve mitochondrial Ca 2+ retention capacity by specifically inhibiting cyclophilin-D, showing positive effects on reducing infarct size and myocardial contractile dysfunction after in vivo and in vitro experimental I/R damage ( 3 ). This may be explained by the fact that ATPIF-1 not only regulates ATP hydrolysis and mPTP formation. There is extensive evidence that ATPIF-1 also intervenes in mitochondrial cristae remodeling, mitophagy, ROS signaling, and the adaptive metabolic rewiring ( 12 , 24 – 26 ). Therefore, we cannot discard other effects on mitochondrial function and structure besides the higher mitochondrial Ca 2+ tolerance, which could influence cardiomyocyte function after an I/R injury. Supporting this idea, a recent report performed in mouse embryonic fibroblasts showed that both overexpression and silencing of ATPIF-1 induced cell proliferation during hypoxia, with a completely opposite metabolic signature ( 27 ). These results suggest that ATPIF-1 controls other cellular processes beyond mitochondrial function that are relevant in both normal normoxia and hypoxia. Based on the above, we propose that ATPIF-1 KO may exert contrasting effects on mitochondrial function during both ischemic and reperfusion phases, potentially triggering a complex compensatory mechanism that neutralizes its impact on cardiomyocytes. Supporting this notion, in the PL model, where the reperfusion phase and potential benefits of ATPIF-1 KO are absent, the lack of ATPIF-1 exacerbated interstitial fibrosis. These findings hold significant clinical implications, suggesting that inhibiting ATPIF-1 may not effectively prevent functional or structural alterations following I/R injury. Instead, it could exacerbate maladaptive cardiac remodeling after chronic MI, rendering it a potentially detrimental therapeutic strategy. In contrast to our results, Zhou et al. showed that cardiac-specific ATPIF-1 KO significantly reduced cardiac dysfunction and hypertrophy after MI induced by permanent ligation of the LCA ( 12 ). However, they did not assess cardiac fibrosis, and like our study, they found no differences in infarct size. Of note, the myocardial infarct size in their mean infarct size was 40%, twice as high as the infarct size in our study (~ 20%, data not shown). The consequences of ATPIF-1 KO might have been different if we would have employed a more severe form of myocardial injury. A primary limitation of our study is the use of whole-body, non-inducible ATPIF-1 KO mice. Cardiac ischemia involves multiple organ systems, and ATPIF-1 KO in other organs may influence the cardiac response to ischemia. We did not investigate potential regulatory mechanisms underlying improvements in Ca 2+ retention capacity and the efficacy of reducing cell death during reperfusion. Further experiments are required to elucidate the role of the MCU complex or mitochondrial ROS, as ROS are upregulated in ATPIF-1 overexpression models and have been shown to decrease the mPTP opening threshold and increase MCU open probability ( 10 , 28 ). Finally, it is important to note that the extent of MI induced in the PL model was relatively small, making comparisons with other studies challenging ( 12 , 14 ). Declarations Conflict of Interest The authors declare no conflicts of interest. Acknowledgments Martin Dokter, Silke Oberdorf, Susanne Feringa, and Sietske Zijlstra for expert technical assistance and advice. Data availability The data supporting the findings of this study are available from the corresponding author upon reasonable request. References GBD Results Seattle, WA: IHME, University of Washington: Institute for Health Metrics and Evaluation (IHME); 2020 [Available from: https://vizhub.healthdata.org/gbd-results/ . Heusch G. Myocardial ischaemia-reperfusion injury and cardioprotection in perspective. Nat Rev Cardiol. 2020;17(12):773–89. Naryzhnaya NV, Maslov LN, Oeltgen PR. Pharmacology of mitochondrial permeability transition pore inhibitors. Drug Dev Res. 2019;80(8):1013–30. Hausenloy DJ, Yellon DM. Myocardial ischemia-reperfusion injury: a neglected therapeutic target. J Clin Invest. 2013;123(1):92–100. Chinopoulos C, Adam-Vizi V. Mitochondria as ATP consumers in cellular pathology. Biochim Biophys Acta. 2010;1802(1):221–7. Endlicher R, Drahota Z, Stefkova K, Cervinkova Z, Kucera O. The Mitochondrial Permeability Transition Pore-Current Knowledge of Its Structure, Function, and Regulation, and Optimized Methods for Evaluating Its Functional State. Cells. 2023;12(9). Carroll J, Watt IN, Wright CJ, Ding S, Fearnley IM, Walker JE. The inhibitor protein IF(1) from mammalian mitochondria inhibits ATP hydrolysis but not ATP synthesis by the ATP synthase complex. J Biol Chem. 2024;300(3):105690. Ng AC, Baird SD, Screaton RA. High-content functional genomic screening to identify novel regulators of the PINK1-Parkin pathway. Methods Enzymol. 2014;547:1–20. Wu JW, Hu H, Hua JS, Ma LK. ATPase inhibitory factor 1 protects the heart from acute myocardial ischemia/reperfusion injury through activating AMPK signaling pathway. Int J Biol Sci. 2022;18(2):731–41. Pavez-Giani MG, Sanchez-Aguilera PI, Bomer N, Miyamoto S, Booij HG, Giraldo P, et al. ATPase Inhibitory Factor-1 Disrupts Mitochondrial Ca(2+) Handling and Promotes Pathological Cardiac Hypertrophy through CaMKIIdelta. Int J Mol Sci. 2021;22(9). Guo L. Mitochondrial ATP synthase inhibitory factor 1 interacts with the p53-cyclophilin D complex and promotes opening of the permeability transition pore. J Biol Chem. 2022;298(5):101858. Zhou B, Caudal A, Tang X, Chavez JD, McMillen TS, Keller A, et al. Upregulation of mitochondrial ATPase inhibitory factor 1 (ATPIF1) mediates increased glycolysis in mouse hearts. J Clin Invest. 2022;132(10). Nakamura J, Fujikawa M, Yoshida M. IF1, a natural inhibitor of mitochondrial ATP synthase, is not essential for the normal growth and breeding of mice. Biosci Rep. 2013;33(5). Booij HG, Yu H, De Boer RA, van de Kolk CW, van de Sluis B, Van Deursen JM, et al. Overexpression of A kinase interacting protein 1 attenuates myocardial ischaemia/reperfusion injury but does not influence heart failure development. Cardiovasc Res. 2016;111(3):217–26. Eijgenraam TR, Boogerd CJ, Stege NM, Oliveira Nunes Teixeira V, Dokter MM, Schmidt LE, et al. Protein Aggregation Is an Early Manifestation of Phospholamban p.(Arg14del)-Related Cardiomyopathy: Development of PLN-R14del-Related Cardiomyopathy. Circ Heart Fail. 2021;14(11):e008532. Bohl S, Medway DJ, Schulz-Menger J, Schneider JE, Neubauer S, Lygate CA. Refined approach for quantification of in vivo ischemia-reperfusion injury in the mouse heart. Am J Physiol Heart Circ Physiol. 2009;297(6):H2054-8. Nijholt KT, Sanchez-Aguilera PI, Mahmoud B, Gerding A, Wolters JC, Wolters AHG, et al. A Kinase Interacting Protein 1 regulates mitochondrial protein levels in energy metabolism and promotes mitochondrial turnover after exercise. Sci Rep. 2023;13(1):18822. Maxwell JT, Tsai C-H, Mohiuddin TA, Kwong JQ. Analyses of Mitochondrial Calcium Influx in Isolated Mitochondria and Cultured Cells. J Vis Exp. 2018(134). Faccenda D, Gorini G, Jones A, Thornton C, Baracca A, Solaini G, et al. The ATPase Inhibitory Factor 1 (IF(1)) regulates the expression of the mitochondrial Ca(2+) uniporter (MCU) via the AMPK/CREB pathway. Biochim Biophys Acta Mol Cell Res. 2021;1868(1):118860. Gore E, Duparc T, Genoux A, Perret B, Najib S, Martinez LO. The Multifaceted ATPase Inhibitory Factor 1 (IF1) in Energy Metabolism Reprogramming and Mitochondrial Dysfunction: A New Player in Age-Associated Disorders? Antioxid Redox Signal. 2022;37(4–6):370–93. Ylitalo K, Ala-Rami A, Vuorinen K, Peuhkurinen K, Lepojarvi M, Kaukoranta P, et al. Reversible ischemic inhibition of F(1)F(0)-ATPase in rat and human myocardium. Biochim Biophys Acta. 2001;1504(2–3):329–39. Fujikawa M, Imamura H, Nakamura J, Yoshida M. Assessing actual contribution of IF1, inhibitor of mitochondrial FoF1, to ATP homeostasis, cell growth, mitochondrial morphology, and cell viability. J Biol Chem. 2012;287(22):18781–7. Sanchez-Aguilera P, Lopez-Crisosto C, Norambuena-Soto I, Penannen C, Zhu J, Bomer N, et al. IGF-1 boosts mitochondrial function by a Ca(2+) uptake-dependent mechanism in cultured human and rat cardiomyocytes. Front Physiol. 2023;14:1106662. Faccenda D, Tan CH, Seraphim A, Duchen MR, Campanella M. IF1 limits the apoptotic-signalling cascade by preventing mitochondrial remodelling. Cell Death Differ. 2013;20(5):686–97. Lefebvre V, Du Q, Baird S, Ng AC, Nascimento M, Campanella M, et al. Genome-wide RNAi screen identifies ATPase inhibitory factor 1 (ATPIF1) as essential for PARK2 recruitment and mitophagy. Autophagy. 2013;9(11):1770–9. Romero-Carraminana I, Esparza-Molto PB, Dominguez-Zorita S, Nuevo-Tapioles C, Cuezva JM. IF1 promotes oligomeric assemblies of sluggish ATP synthase and outlines the heterogeneity of the mitochondrial membrane potential. Commun Biol. 2023;6(1):836. Lauterboeck L, Kang SW, White D, 3rd, Bao R, Mobasheran P, Yang Q. IF1 Promotes Cellular Proliferation and Inhibits Oxidative Phosphorylation in Mouse Embryonic Fibroblasts under Normoxia and Hypoxia. Cells. 2024;13(6). Dong Z, Shanmughapriya S, Tomar D, Siddiqui N, Lynch S, Nemani N, et al. Mitochondrial Ca(2+) Uniporter Is a Mitochondrial Luminal Redox Sensor that Augments MCU Channel Activity. Mol Cell. 2017;65(6):1014–28 e7. Additional Declarations (Not answered) Supplementary Files TableS1.xlsx TableS2.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4602126","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":322633627,"identity":"4b55787f-cafa-4d6d-a759-ef1f217d296e","order_by":0,"name":"B. Daan Westenbrink","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYBACAzACAx4GhgSGBDkoz4KgFgmYFmOohASRWoCaEhsIaTFnYN7AzFNRV8cv3Xvsw8Mdaekbrh1+/IJxB24tlg1sBcw8Zw5LSM45lzwj8UxO7obbaWYWjGfwOOwAjwFzbtsBCYMbOcYMiW0VQC05bAaMbYS0/KuTsIdqSTcgTksDs4SBBFhLTgJQC/MDfFosm9kKDv85dlhyxo28ZKCWNMOZQL8AGXhCjL1548MZNXX8/DNyDzP+bEuW57ud/PjDxzYbnFoYmBkYDqCLsUkk4NaAw5gPpOoYBaNgFIyCYQ0AtVlP8I2Nhj0AAAAASUVORK5CYII=","orcid":"","institution":"University Medical Center Groningen","correspondingAuthor":true,"prefix":"","firstName":"B.","middleName":"Daan","lastName":"Westenbrink","suffix":""},{"id":322633628,"identity":"a33879c7-df0b-4f22-b044-a5dbb0ccebe4","order_by":1,"name":"Pablo Sánchez-Aguilera","email":"","orcid":"https://orcid.org/0000-0001-9207-2500","institution":"University Medical Center Groningen","correspondingAuthor":false,"prefix":"","firstName":"Pablo","middleName":"","lastName":"Sánchez-Aguilera","suffix":""},{"id":322633629,"identity":"2713a97a-5323-4206-95eb-a7cea52c7983","order_by":2,"name":"Huitzilihuitl Saucedo-Orozco","email":"","orcid":"","institution":"University Medical Center Groningen","correspondingAuthor":false,"prefix":"","firstName":"Huitzilihuitl","middleName":"","lastName":"Saucedo-Orozco","suffix":""},{"id":322633630,"identity":"6278483d-d51b-4b26-ad96-c14c508a5374","order_by":3,"name":"Marloes Schouten","email":"","orcid":"","institution":"University Medical Center Groningen","correspondingAuthor":false,"prefix":"","firstName":"Marloes","middleName":"","lastName":"Schouten","suffix":""},{"id":322633631,"identity":"ab4b37e4-a0db-479b-85a2-02b862883e90","order_by":4,"name":"Sergio Lavandero","email":"","orcid":"https://orcid.org/0000-0003-4258-1483","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Sergio","middleName":"","lastName":"Lavandero","suffix":""},{"id":322633632,"identity":"e3323cbf-302f-45f7-b39f-b098fe81ffcb","order_by":5,"name":"Rudolf de Boer","email":"","orcid":"https://orcid.org/0000-0002-4775-9140","institution":"Erasmus Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Rudolf","middleName":"","lastName":"de Boer","suffix":""},{"id":322633633,"identity":"a229a232-160c-4cd6-afa6-8ec434802926","order_by":6,"name":"Herman Silljé","email":"","orcid":"","institution":"University Medical Center Groningen","correspondingAuthor":false,"prefix":"","firstName":"Herman","middleName":"","lastName":"Silljé","suffix":""},{"id":322633634,"identity":"af5c85e3-43c6-41be-9cac-9192429a5f0c","order_by":7,"name":"R.A.D.A Puspitarani","email":"","orcid":"","institution":"University Medical Center Groningen","correspondingAuthor":false,"prefix":"","firstName":"R.A.D.A","middleName":"","lastName":"Puspitarani","suffix":""}],"badges":[],"createdAt":"2024-06-18 22:05:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4602126/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4602126/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61322964,"identity":"6393ac4e-7107-4483-99ac-7188d585c524","added_by":"auto","created_at":"2024-07-29 13:26:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":846030,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eATPIF-1 KO increases mitochondrial Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e retention capacity. (A) \u003c/strong\u003eRelative\u003cem\u003e Atpif1\u003c/em\u003e mRNA levels in 3 months-old WT and ATPIF-1 KO mice. (n = 8/11). \u003cstrong\u003e(B\u003c/strong\u003e) Relative fluorescence units of Calcium Green-5N in isolated mitochondria exposed to 6 injections of 1 mM CaCl\u003csub\u003e2\u003c/sub\u003e followed by 8 injections of 1.2 mM CaCl\u003csub\u003e2\u003c/sub\u003e. \u003cstrong\u003e(C)\u003c/strong\u003e Ca\u003csup\u003e2+\u003c/sup\u003e concentration in the well required to open the mPTP, defined as an increase in Calcium Green-5N fluorescence after a CaCl\u003csub\u003e2\u003c/sub\u003e injection (n = 6/6). ** = p-value \u0026lt; 0.01 vs. WT, determined by Student’s t-test. Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity assay in isolated mitochondria in the presence of \u003cstrong\u003e(D) \u003c/strong\u003ethe mPTP inhibitor Cyclosporine A (CsA) or (C) the MCU inhibitor ru360 (n = 6/6).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/eef5635456c6379767188ecc.png"},{"id":61322965,"identity":"cb2fa701-d27b-4ba5-b032-e6352241835d","added_by":"auto","created_at":"2024-07-29 13:26:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1186805,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExperimental design of in vivo ischemia/reperfusion injury and myocardial infarction. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Graphical representation of the LCA ligation and the anticipated ischemic zone. (\u003cstrong\u003eB\u003c/strong\u003e) Experiment 1 consists of a 45-minute ischemic phase followed by a 48-hours of reperfusion. The removal of the ligation restores perfusion to the ischemic area. Cardiac function was evaluated by echocardiography (Echo) before and 24 hours after surgery. Animals were terminated 48 hours post-surgery, and hearts were immediately stained with phthalo blue and TTC staining. (\u003cstrong\u003eC\u003c/strong\u003e) Experiment 2 involves permanent LCA ligation to induce a large chronic myocardial infarction. Cardiac function was assessed by echocardiography at 5 weeks post-surgery.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/8d464a2d125ff1f232efaa45.png"},{"id":61322238,"identity":"e9bb3691-d0e3-4192-813d-9897cc344797","added_by":"auto","created_at":"2024-07-29 13:18:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":9639577,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eShort-axis M-mode echocardiographic parameters in the I/R injury model. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Representative short-axis M-mode echo images of WT and KO mice at baseline and after 24 hours of reperfusion. Arrows indicate the direction and magnitude of myocardial wall deformation at the onset of systole. (\u003cstrong\u003eB\u003c/strong\u003e) Pairwise analysis of global longitudinal strain before and at 24 hours after the reperfusion phase (n = 14/10). Analysis was performed using a two-way ANOVA, followed by Tukey's post-hoc test for pairwise comparisons. Significance is indicated as * = p-value \u0026lt; 0.05 and ** = p-value \u0026lt; 0.01 versus the matched baseline condition.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/37cc583e129921f6447258ab.png"},{"id":61322243,"identity":"bebb5051-6ece-45d0-938c-ffbc5c327a1b","added_by":"auto","created_at":"2024-07-29 13:18:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3794535,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLong-axis B-mode global longitudinal strain analysis in the I/R injury model. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Representative long-axis B-mode Echo images of WT and KO mice at baseline and after 24 hours of reperfusion. Arrows in-dicate the direction and magnitude of myocardial wall deformation at the onset of systole. (\u003cstrong\u003eB\u003c/strong\u003e) Pairwise analysis of global longitudinal strain before and at 24 hours after the reperfusion phase (n = 14/10). Analysis was performed using a two-way ANOVA, followed by Tukey's post-hoc test for pairwise comparisons. Significance is indicated as **** = p-value \u0026lt; 0.0001 versus the matched baseline condition.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/869ef2dbde5f92f878b5c8a0.png"},{"id":61322241,"identity":"8211a68d-deb5-4d52-b721-ff597fb9f331","added_by":"auto","created_at":"2024-07-29 13:18:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1228327,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetermination of infrared area (IA), area at risk (AAR) and remote area (RA) induced by I/R injury. (A)\u003c/strong\u003e Example illustrating the determination of NA, AAR, and RA on one side of a cardiac section. \u003cstrong\u003e(B)\u003c/strong\u003e Representative cardiac sections from WT and KO mice stained with Phthalo blue and TTC stains after I/R injury\u003cstrong\u003e. (C)\u003c/strong\u003e Quantification of the percentage of each area of interest in cardiac sections from WT and KO mice after 48 hours of reperfusion (n = 16/9).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/e2b1b3634c46842d2e6de5ce.png"},{"id":61322244,"identity":"80b62d58-47c9-4a0b-bb19-94fce8ed123d","added_by":"auto","created_at":"2024-07-29 13:18:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4606570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eShort-axis M-mode echocardiographic parameters achter permanent LAD ligation. (A\u003c/strong\u003e) Representative M-mode Echo images of WT and KO mice. Cyan traces delineate left ventricle (LV) anterior (top traces) and posterior wall (bottom traces) during systole and diastole. \u003cstrong\u003e(B)\u003c/strong\u003e Fractional shortening\u003cstrong\u003e, (C)\u003c/strong\u003e LV diameter, and \u003cstrong\u003e(D\u003c/strong\u003e) cardiac output at 5 weeks after surgery for WT and KO mice. (n = 13/13).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/5d6d226508b4e6031b491e50.png"},{"id":61322242,"identity":"8e082e68-d9d7-4221-9c0b-a119569ac19f","added_by":"auto","created_at":"2024-07-29 13:18:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6817399,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCardiac structure and histological analysis after 5 weeks of myocardial infarction (MI).\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Cardiac weight relative to tibia length. (\u003cstrong\u003eB)\u003c/strong\u003eRepresentative images of FITC-conjugated WGA and DAPI fluorescence of mid-papillary cardiac sections, and quantification of the cardiomyocyte cross-sectional area observed in WGA-stained tissues. (n = 6/6). Scale bar = 50µm (\u003cstrong\u003eC\u003c/strong\u003e) Representative mid-papillary slice of the heart stained with Masson's trichrome stain of WT and KO mice. Arrowheads in insets indicate interstitial fibrosis in blue. Scale bar = 90µm. (\u003cstrong\u003eD\u003c/strong\u003e) Quantification of interstitial fibrosis percentage assessed in the remote wall relative to the MI site (n = 10/13). * = p-value \u0026lt; 0.05 vs. WT, determined by Student’s t-test.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/ecc553b05be1eb540b520955.png"},{"id":70562937,"identity":"5f51da79-4a73-4061-b2fe-5ff8c6edbfb7","added_by":"auto","created_at":"2024-12-04 12:10:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":30997759,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/b8a3feac-0d3a-473a-a0e5-4f92579fe440.pdf"},{"id":61322966,"identity":"b0366587-4909-40ad-b726-303c608e585d","added_by":"auto","created_at":"2024-07-29 13:26:36","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10934,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/aa271637c238fb48af5fecfb.xlsx"},{"id":61322236,"identity":"256aeb3f-0e03-429f-878b-6e4075d49503","added_by":"auto","created_at":"2024-07-29 13:18:36","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":9990,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4602126/v1/44bf13e049959378782f5f4c.xlsx"}],"financialInterests":"(Not answered)","formattedTitle":"ATPIF-1 knockout attenuates mitochondrial mPTP opening but does not diminish cardiac ischemic/reperfusion injury.","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIschemic heart disease ranks as the primary cause of cardiovascular mortality worldwide and represents the leading cause of heart failure (HF) (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Prompt reperfusion strategies have been able to substantially reduces myocardial infarction formation, it also culminates into a second wave of cell death that is potentially amendable to therapeutic interventions (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Despite decades of research and numerous clinical trials testing a variety of compounds, an effective treatment of ischemia/reperfusion (I/R) injury has not reached the clinical arena (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMitochondria play a pivotal role in the mechanism of I/R injury. During ischemia, oxygen deprivation leads to the inhibition of the electron transport chain (ETC) and the dissipation of mitochondrial membrane potential which ceases ATP synthesis (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). In addition, mitochondrial depolarization causes ATP-synthase to work in reverse mode where it starts to hydrolyze ATP. Under these conditions mitochondria can become ATP consumers, which is thought to further exacerbates energy depletion, reactive oxygen species (ROS) emission, and cellular demise (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Conversely, during reperfusion, the restoration of oxygen reactivates the ETC, leading to hyperpolarization of the mitochondrial membrane. This process induces mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e overload and ROS formation, which in turn triggers the opening of the mitochondrial permeability transition pore (mPTP), a high-conductance pore that facilitates the release of apoptotic factors such as cytochrome C, thereby exacerbating cell death (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). The pivotal role of mitochondria in both ischemia and reperfusion has put them center stage as a pharmacological target to mitigating I/R injury.\u003c/p\u003e \u003cp\u003eDuring oxygen deprivation ATPase inhibitory factor 1 (ATPIF-1), a unidirectional inhibitor of mitochondrial ATP hydrolysis, becomes active during mitochondrial depolarization to block ATP hydrolysis and target dysfunctional mitochondria for degradation (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Consequently, increasing the bioavailability of ATPIF-1 has been proposed as a valuable approach to counteract energy depletion during acute cardiac ischemia (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). However, we and others recently showed that overexpression of ATPIF-1 levels impairs mitochondrial respiration, compromises mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e buffering capacity, and contributes to the opening of the mPTP, thereby exacerbating maladaptive remodeling in various cardiac pathologies, including myocardial infarction (\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Here, we hypothesize that ATPIF-1 promotes mPTP opening induced by Ca\u003csup\u003e2+\u003c/sup\u003e overload, thereby facilitating scar formation during I/R. If confirmed, this would not only challenge contemporary views of the role of ATPIF-1, but it would also suggest that strategies to inhibit ATPIF-1 could attenuate I/R injury.\u003c/p\u003e \u003cp\u003eIn our study, we employed an ATPIF-1 KO mouse to evaluate the effect of loss of ATPIF-1 on mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity and its repercussions on cardiac function and infarct size after transient or permanent ligation of the LCA. These experimental conditions allowed us to investigate the potential of ATPIF-1 silencing in mitigating cardiac damage across both acute and chronic ischemic scenarios.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cem\u003eExperimental animals.\u003c/em\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e Animal experiments were conducted in accordance with the ARRIVE guidelines and approved by the Dutch Central Committee for Animal Experimentation and the Animal Ethical Committee of the University of Groningen (permit number IVD199001-02-002). ATPIF-1 KO mice were generated as previously described (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). These mice, along with their WT littermates, were maintained under standard conditions with ad libitum access to food and water and monitored weekly. In vivo procedures were conducted under continuous isoflurane anesthesia (2%, TEVA Pharmachemie, Haarlem, The Netherlands). Sample sizes for both WT and ATPIF-1 KO groups were determined through power analysis for infarct size and mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity, with 11 animals per group for infarct size and 6 animals per group for mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity, assuming a desired power of 0.8 and an alpha level of 0.05. Animals were randomly allocated to experimental groups by investigators who were blinded to ensure unbiased assignment.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eMyocardial infarction induced by I/R injury.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn vivo I/R injury was performed according to Booij et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In brief, 8 to 12-week-old mice underwent a 45-minute ligation of the left anterior descending (LAD) coronary artery, followed by 48 hours of reperfusion. The untied suture was left for later ex vivo cardiac blue staining.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eMI induced by permanent ligation of the LAC.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn vivo, permanent ligation of the LCA was performed under identical surgical conditions as the I/R injury model, with the exception that tied sutures were retained for 5 weeks. At this time, the animals were sacrificed to evaluate chronic cardiac remodeling.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eEchocardiography\u003c/em\u003e.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eTransaortic echocardiography was performed at baseline and 24 hours after I/R surgery and at 5 weeks after PL surgery using a Vevo imaging station (FUJIFILM VisualSonics, Toronto, Canada) as previously described (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Briefly, animals were anesthetized and placed in supine position in a heating pad. Parasternal LV short-axis M-mode recordings were obtained at the mid-papillary level and used to determine heart rate, cardiac output, LV end-diastolic internal diameter, anterior wall thickness, posterior wall thickness, and fractional shortening. Long-axis B-mode recordings were used to determine global longitudinal strain (GLS). Images deemed of insufficient quality were excluded from the analysis. The data were processed and analyzed in the Vevo Lab 3.2.6 software (FUJIFILM VisualSonics).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003ePhthalo blue preparation and combined Phthalo blue and Triphenyltetrazolium chloride (TTC) cardiac staining.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eA 10% solution of Copper(II) Phthalocyanine (Phthalo Blue) (Sigma Aldrich, Cat number: 252980) was prepared following the method described by Bohl et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) with some modifications. In brief, 10% Phthalo Blue was dispersed in 25 mL of NaCl 0.9% solution supplemented with 1 mL of Tween80. The stain was visually monitored under a microscope after vigorous mixing and decanting for 1 to 2 hours. Additional Tween80 was added if aggregates were observed in the solution. Cardiac ex vivo staining was conducted following the method described by Bohl et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Briefly, hearts were excised and cannulated with a blunt needle. After priming with a saline solution, the loose suture placed during I/R injury was re-ligated. Subsequently, the Phthalo blue staining solution was injected until the heart became uniformly blue. Following staining, hearts were frozen and sliced into 5 sections with a thickness of 1 mm using surgical blades in a 3D slicing mold. Each slice was then incubated in 1% TTC (Sigma Aldrich, Cat number: T8877) in phosphate saline buffer for 15 minutes at 37\u0026deg;C. Finally, cardiac slices were incubated in 4% paraformaldehyde at room temperature for 1 hour and subsequently weighed.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eDetermination of remote area, area at risk, and necrotic area.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe cardiac slices were photographed using a digital camera to capture both sides of each slice, distinguishing the ischemic in red, the infarcted area in white, and the remote area in blue. Subsequently, the total area of the slice, excluding the lumen of the right and left ventricle, was manually selected and stored in the ROI manager utilizing the ImageJ software. Then, the summary red and white areas (representing the areas at risk) were selected and stored in the ROI manager, followed by the selection of the white area alone, representing the infarcted area. This process was repeated for both sides of the slice, and the total area, area at risk, and infarcted area were averaged using data from both sides of the slide. Afterwards, the averaged areas were corrected for the weight of the slice. Area at risk below 15% were excluded from the analysis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eHistological processing, embedding, and deparaffinization.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eStandard histological procedures were carried out following the protocol outlined in Booij et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In brief, transverse mid-papillary slices of the heart were fixed overnight in 10% paraformaldehyde (Klinipath, Duiven, The Netherlands). Subsequently, they were dehydrated and infiltrated with histological paraffin wax (Klinipath) using a Leica TP1020 automated tissue processor (Leica Microsystems, Wetzlar, Germany). Tissue specimens were then embedded in histological paraffin and sectioned into 4-\u0026micro;m thick slices using a Leica RM2255 microtome (Leica Microsystems). Prior to tissue staining, slides underwent deparaffinization by overnight heating at 60\u0026deg;C, followed by sequential incubations in xylene and ethanol dilutions.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eQuantification of cardiac fibrosis.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eDeparaffinized tissues underwent staining with Masson's trichrome stain to assess collagen deposition (stained in blue). Whole tissue image acquisition was conducted using the NanoZoomer 2.0-HT digital slide scanner. The percentage of fibrosis was determined utilizing the positive Pixel Count v9 algorithm of Aperio\u0026rsquo;s ImageScope 12.4.0 software (Leica Microsystems), employing default settings with a hue value of 0.66 and a hue width of 0.2.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eDetermination of cardiomyocyte cross-sectional area.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eCardiomyocyte cross-sectional area was determined by staining the deparaffinized tissues with fluorescein isothiocyanate (FITC)-conjugated wheat germ agglutinin (WGA) and 4\u0026rsquo;,6-diamidino-2-phenylindole (DAPI). Imaging of the fluorescent signals was conducted using a Leica AF6000 fluorescent imaging system (Leica Microsystems, Wetzlar, Germany), and the cell area was quantified using ImageJ.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eMitochondrial isolation.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAccording to Nijholt et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), fresh cardiac mitochondrial isolation was carried out. In brief, hearts were kept on ice in 0.9% KCL directly after sacrifice and cut into smaller pieces in medium A (220 mM mannitol, 70 mM sucrose, 5 mM TES, 0.1 mM EGTA, pH 7.3 at 4\u0026deg;C with 1N KOH) with added proteinase (P8038, Sigma-Aldrich) for five minutes. Subsequently, 20 mL of medium A supplemented with 1 mg/mL bovine serum albumin was introduced, and the contents were transferred to a Potter-Elvehjem homogenizer for complete homogenization. Next, 3 centrifugation steps were conducted at 4\u0026deg;C for 10 minutes, resulting in a mitochondrial pellet. The pellet was finally resuspended in 150 to 300 \u0026micro;L of medium A and stored at 4\u0026deg;C for subsequent use.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eMitochondrial Ca\u003c/em\u003e \u003csup\u003e \u003cem\u003e2+\u003c/em\u003e \u003c/sup\u003e \u003cem\u003eretention capacity.\u003c/em\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eMitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity was assessed according to Maxwell et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). In summary, 200 \u0026micro;g of freshly isolated mitochondria were incubated in 197 \u0026micro;L of KCL buffer (composed of 125 mM KCl, 20 mM HEPES, 1 mM KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 40 \u0026micro;M EGTA, pH adjusted to 7.2 with KOH), along with 1 \u0026micro;L of 1 M pyruvate, 1 \u0026micro;L of 500 mM malate and 1 \u0026micro;L of 1 mM calcium green-5N (a non-permeant fluorescent Ca\u003csup\u003e2+\u003c/sup\u003e sensor, Thermo Fischer). Additionally, either 1 \u0026micro;M cyclosporine A (CsA, Merck KGaA, Darmstadt, Germany) or 10 \u0026micro;M ru360 (Sigma-Aldrich) was included to respectively inhibit the opening of the mPTP or the mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e uniporter. Fluorescence intensity was monitored using the Biotech Synergy H1 plate reader (Agilent Technologies, Santa Clara, CA, USA), while automated injectors delivered 6x 1 mM and 8x 1.2 mM CaCl\u003csub\u003e2\u003c/sub\u003e. mPTP opening was defined as the rise in fluorescence intensity during the decay phase of the curve, indicative of mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e release.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eRNA isolation, reverse transcription, and quantitative PCR.\u003c/em\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFrozen left ventricular (LV) samples underwent pulverization at -60\u0026deg;C and subsequent homogenization utilizing a Tissuelyser LT (Qiagen N.V., Hilden, Germany) in 1 mL of TRI Reagent solution (Thermo Fischer Scientific). mRNA extraction followed standard protocols, with quantification performed using a NanoDrop spectrophotometer (Thermo Fischer Scientific). Synthesis of cDNA was achieved employing the QuantiTect RT kit (Qiagen) according to the manufacturer\u0026rsquo;s instructions. Atpif-1 (Forward: 5\u0026rsquo; GGAGCCTTCGGAAAACGAGA 3\u0026rsquo;; Reverse: 5\u0026rsquo; ATGGTGTTTCCTCAGGGCAG 3\u0026rsquo;) and Nppa (Forward: 5\u0026rsquo; GCTTCCAGGCCATATTGGAG 3\u0026rsquo;; Reverse: 5\u0026rsquo; GGTGGTCTAGCAGGTTCTTG 3\u0026rsquo;) were designed utilizing Primer-Blast software (NCBI, Bethesda, MD, USA) and internally validated. Quantitative PCR (qPCR) was conducted employing the SYBR\u0026reg; Green Master Mix (Bio-Rad, Hercules, CA, USA) in the CFX384 Touch Real-Time PCR Detection System (Bio-Rad).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis.\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAll results were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE derived from a minimum of three independent assays. For data with normal distribution and equal variances, a two-sided t-test or one-way ANOVA followed by the Tukey post-hoc test or mixed-effects analysis were employed for multiple comparisons. Conversely, non-normally distributed data were analyzed using the U Mann-Whitney test or the Kruskal\u0026ndash;Wallis test, followed by the Dunn post-hoc test for multiple comparisons. Statistical significance was established at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Data analysis and visualization were performed using GraphPad Prism 9 software (GraphPad Software Inc., San Diego, CA, United States).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cem\u003eATPIF-1 KO increases mitochondrial Ca\u003c/em\u003e \u003csup\u003e \u003cem\u003e2+\u003c/em\u003e \u003c/sup\u003e \u003cem\u003eretention capacity.\u003c/em\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eATPIF-1 has recently been linked with decreased mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e handling (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Given that mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e overload is a crucial step in mitochondrial swelling and mPTP formation during I/R injury, it is plausible that ATPIF-1 may promote mPTP formation and subsequent myocardial damage during reperfusion. To investigate this hypothesis, cardiac mitochondria were isolated from ATPIF-1 KO mice ((\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), see Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) or their WT littermates and subjected to a Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity assay. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and C, ATPIF-1 KO mitochondria display greater resilience to Ca\u003csup\u003e2+\u003c/sup\u003e overload, as evidenced by their increased capacity for Ca\u003csup\u003e2+\u003c/sup\u003e uptake (measured as fluorescence decay after CaCl\u003csub\u003e2\u003c/sub\u003e injection) without mPTP opening (measured as fluorescence increase after CaCl\u003csub\u003e2\u003c/sub\u003e injection). Notably, treatment with the mPTP inhibitor cyclosporine A (CsA) eliminated the differences between genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), indicating that the differences observed are dependent on mPTP opening. Furthermore, we confirmed mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e uptake by blocking the mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e uniporter (MCU) with ru360 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on these results and the observation that \u003cem\u003ein vitro\u003c/em\u003e ATPIF-1 upregulation promotes mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e overload and subsequent mPTP formation, argues against a beneficial role for ATPIF-1 during I/R (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). We therefore investigated the in vivo impact of ATPIF-1 KO on I/R injury, as well as on chronic remodeling following myocardial infarction (MI), as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eCardiac function following I/R injury.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe findings from experiment 1 revealed a reduction in anterior wall (AW) motion 24 hours post-reperfusion, resulting in a notable decrease in fractional shortening observed in both genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). However, parameters such as left ventricular internal diastolic dimension (LVIDD) and cardiac output exhibited no significant differences between the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Furthermore, there were no disparities noted in left ventricular fractional shortening or other conventional echocardiographic parameters between genotypes, suggesting that ATPIF-1 KO does not impact myocardial function following I/R injury (summarized in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAssessment of myocardial deformation via strain analysis offers a more sensitive measure of myocardial contractility. I/R injury led to a notable reduction in global longitudinal strain (GLS) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Nevertheless, GLS values were equally impaired in ATPIF-1 KO and WT mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eATPIF-1 KO does not mitigate cardiac damage in response to I/R injury.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eConsistent with the echocardiographic results, myocardial infarcted area (IA), expressed as a percentage of the area at risk (AAR), was comparable between WT and KO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Additionally, the myocardial AAR and remote area (RA) showed no significant differences between the groups. These findings suggest that, despite its role in reducing mPTP formation, the absence of ATPIF-1 does not alleviate acute myocardial damage caused by I/R injury.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eEffect of ATPIF-1 KO on chronic post-MI remodeling.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eNext, we explored whether ATPIF-1 KO influenced chronic post-MI remodeling by subjecting mice to PL of the left coronary artery (LCA) and monitoring them for 5 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Cardiac function assessed via M-mode echocardiography at the 5-week mark revealed no discernible differences in fractional shortening, LVIDD, or cardiac output between the genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMoreover, ATPIF-1 KO did not affect cardiac hypertrophy, as indicated by comparable cardiac mass and cardiomyocyte cross-sectional area between genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and B). However, cardiac sections from ATPIF-1 KO animals displayed 3.29% of interstitial fibrosis in the LV myocardium remote from the infarct, which corresponds to 57,3% increase in comparison to WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eATPIF-1 has been primarily recognized for its role in preventing ATP hydrolysis and averting energetic crisis during severe mitochondrial depolarization, commonly observed in acute cardiac ischemia (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). However, recent \u003cem\u003ein vitro\u003c/em\u003e evidence shows that ATPIF-1 overexpression promotes pathological cardiomyocyte hypertrophy, mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e mishandling, and the premature mPTP formation (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). While our study showed that mitochondria of ATPIF-1 KO are more tolerant to Ca\u003csup\u003e2+\u003c/sup\u003e induced mPTP formation, ATPIF-1 KO mice were surprisingly not protected from myocardial I/R injury. Furthermore, ATPIF-1 KO also did not influence cardiac remodeling after permanent LCA ligation. Instead, ATPIF-1 KO resulted in higher levels of interstitial fibrosis upon chronic MI. These findings challenge conventional views on the function of ATPIF-1 and suggest that ATPIF-1 inhibition does not offer a nodal point for the mitigation of myocardial I/R injury.\u003c/p\u003e \u003cp\u003eDuring an ischemic event, ATPIF-1 act as a unidirectional inhibitor of ATP hydrolysis, preventing cellular ATP wasting and targeting dysfunctional mitochondria for mitophagy (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). While historically considered an adaptive response against ischemic damage, recent evidence implicates ATPIF-1 upregulation in maladaptive cardiac metabolic rewiring in various cardiac diseases (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). Our research, along with others', has demonstrated that increased ATPIF-1 expression diminishes mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e handling and ATP synthesis, leading to heightened ROS emission and a shift towards glycolysis (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Consequently, inhibiting ATPIF-1 has been suggested as a viable approach to postpone or prevent detrimental metabolic changes following a cardiac injury (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e concentrations exhibit a homeostatic range that enables mitochondria to enhance NADH generation and ATP synthesis (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Nevertheless, Ca\u003csup\u003e2+\u003c/sup\u003e concentrations exceeding the physiological range initially trigger a reversible and transient low-conductance mPTP opening, which prevents the accumulation of Ca\u003csup\u003e2+\u003c/sup\u003e and ROS. Further Ca\u003csup\u003e2+\u003c/sup\u003e accumulation in mitochondria stimulates permanent high-conductance mPTP opening, leading to irreversible damage to mitochondrial structure and the release of apoptotic factors, such as cytochrome C (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). In our study, we induced massive and irreversible mPTP opening with increasing Ca\u003csup\u003e2+\u003c/sup\u003e concentrations and observed that mitochondria lacking ATPIF-1 exhibited a significantly higher threshold for mPTP opening, suggesting potential positive implications during reperfusion. While we did not delve into the biological mechanism underlying the increased mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity, \u003cem\u003ein vitro\u003c/em\u003e studies have shown a negative correlation between ATPIF-1 protein expression and mitochondrial capacity for Ca\u003csup\u003e2+\u003c/sup\u003e uptake and storage. Overexpression of ATPIF-1 in neonatal rat ventricular myocytes leads to severe mitochondrial dysfunction, characterized by mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e mishandling and higher sensitivity to open the mPTP (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In contrast, knockdown of ATPIF-1 in HeLa cells induces the opposite effect, significantly increasing MCU-mediated mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e uptake (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Further biochemical analysis is required to confirm the role MCU complex or changes in mPTP regulatory proteins in the ATPIF-1 KO \u003cem\u003ein vivo\u003c/em\u003e model.\u003c/p\u003e \u003cp\u003eDespite the positive effects on mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity, our study demonstrated that ATPIF-1 KO did not confer additional protection against contractile dysfunction and necrosis following acute I/R injury. This contrasts with the effects of other mPTP inhibitors such as CsA, Sanglifehrin A, or NIM811, which also improve mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity by specifically inhibiting cyclophilin-D, showing positive effects on reducing infarct size and myocardial contractile dysfunction after in vivo and in vitro experimental I/R damage (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). This may be explained by the fact that ATPIF-1 not only regulates ATP hydrolysis and mPTP formation. There is extensive evidence that ATPIF-1 also intervenes in mitochondrial cristae remodeling, mitophagy, ROS signaling, and the adaptive metabolic rewiring (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Therefore, we cannot discard other effects on mitochondrial function and structure besides the higher mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e tolerance, which could influence cardiomyocyte function after an I/R injury. Supporting this idea, a recent report performed in mouse embryonic fibroblasts showed that both overexpression and silencing of ATPIF-1 induced cell proliferation during hypoxia, with a completely opposite metabolic signature (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). These results suggest that ATPIF-1 controls other cellular processes beyond mitochondrial function that are relevant in both normal normoxia and hypoxia.\u003c/p\u003e \u003cp\u003eBased on the above, we propose that ATPIF-1 KO may exert contrasting effects on mitochondrial function during both ischemic and reperfusion phases, potentially triggering a complex compensatory mechanism that neutralizes its impact on cardiomyocytes. Supporting this notion, in the PL model, where the reperfusion phase and potential benefits of ATPIF-1 KO are absent, the lack of ATPIF-1 exacerbated interstitial fibrosis. These findings hold significant clinical implications, suggesting that inhibiting ATPIF-1 may not effectively prevent functional or structural alterations following I/R injury. Instead, it could exacerbate maladaptive cardiac remodeling after chronic MI, rendering it a potentially detrimental therapeutic strategy. In contrast to our results, Zhou et al. showed that cardiac-specific ATPIF-1 KO significantly reduced cardiac dysfunction and hypertrophy after MI induced by permanent ligation of the LCA (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). However, they did not assess cardiac fibrosis, and like our study, they found no differences in infarct size. Of note, the myocardial infarct size in their mean infarct size was 40%, twice as high as the infarct size in our study (~\u0026thinsp;20%, data not shown). The consequences of ATPIF-1 KO might have been different if we would have employed a more severe form of myocardial injury.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eA primary limitation of our study is the use of whole-body, non-inducible ATPIF-1 KO mice. Cardiac ischemia involves multiple organ systems, and ATPIF-1 KO in other organs may influence the cardiac response to ischemia. We did not investigate potential regulatory mechanisms underlying improvements in Ca\u003csup\u003e2+\u003c/sup\u003e retention capacity and the efficacy of reducing cell death during reperfusion. Further experiments are required to elucidate the role of the MCU complex or mitochondrial ROS, as ROS are upregulated in ATPIF-1 overexpression models and have been shown to decrease the mPTP opening threshold and increase MCU open probability (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Finally, it is important to note that the extent of MI induced in the PL model was relatively small, making comparisons with other studies challenging (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eMartin Dokter, Silke Oberdorf, Susanne Feringa, and Sietske Zijlstra for expert technical assistance and advice.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGBD Results Seattle, WA: IHME, University of Washington: Institute for Health Metrics and Evaluation (IHME); 2020 [Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://vizhub.healthdata.org/gbd-results/\u003c/span\u003e\u003cspan address=\"https://vizhub.healthdata.org/gbd-results/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeusch G. Myocardial ischaemia-reperfusion injury and cardioprotection in perspective. Nat Rev Cardiol. 2020;17(12):773\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaryzhnaya NV, Maslov LN, Oeltgen PR. Pharmacology of mitochondrial permeability transition pore inhibitors. Drug Dev Res. 2019;80(8):1013\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHausenloy DJ, Yellon DM. Myocardial ischemia-reperfusion injury: a neglected therapeutic target. J Clin Invest. 2013;123(1):92\u0026ndash;100.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChinopoulos C, Adam-Vizi V. Mitochondria as ATP consumers in cellular pathology. Biochim Biophys Acta. 2010;1802(1):221\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEndlicher R, Drahota Z, Stefkova K, Cervinkova Z, Kucera O. The Mitochondrial Permeability Transition Pore-Current Knowledge of Its Structure, Function, and Regulation, and Optimized Methods for Evaluating Its Functional State. Cells. 2023;12(9).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarroll J, Watt IN, Wright CJ, Ding S, Fearnley IM, Walker JE. The inhibitor protein IF(1) from mammalian mitochondria inhibits ATP hydrolysis but not ATP synthesis by the ATP synthase complex. J Biol Chem. 2024;300(3):105690.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg AC, Baird SD, Screaton RA. High-content functional genomic screening to identify novel regulators of the PINK1-Parkin pathway. Methods Enzymol. 2014;547:1\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu JW, Hu H, Hua JS, Ma LK. ATPase inhibitory factor 1 protects the heart from acute myocardial ischemia/reperfusion injury through activating AMPK signaling pathway. Int J Biol Sci. 2022;18(2):731\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePavez-Giani MG, Sanchez-Aguilera PI, Bomer N, Miyamoto S, Booij HG, Giraldo P, et al. ATPase Inhibitory Factor-1 Disrupts Mitochondrial Ca(2+) Handling and Promotes Pathological Cardiac Hypertrophy through CaMKIIdelta. Int J Mol Sci. 2021;22(9).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo L. Mitochondrial ATP synthase inhibitory factor 1 interacts with the p53-cyclophilin D complex and promotes opening of the permeability transition pore. J Biol Chem. 2022;298(5):101858.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou B, Caudal A, Tang X, Chavez JD, McMillen TS, Keller A, et al. Upregulation of mitochondrial ATPase inhibitory factor 1 (ATPIF1) mediates increased glycolysis in mouse hearts. J Clin Invest. 2022;132(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura J, Fujikawa M, Yoshida M. IF1, a natural inhibitor of mitochondrial ATP synthase, is not essential for the normal growth and breeding of mice. Biosci Rep. 2013;33(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBooij HG, Yu H, De Boer RA, van de Kolk CW, van de Sluis B, Van Deursen JM, et al. Overexpression of A kinase interacting protein 1 attenuates myocardial ischaemia/reperfusion injury but does not influence heart failure development. Cardiovasc Res. 2016;111(3):217\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEijgenraam TR, Boogerd CJ, Stege NM, Oliveira Nunes Teixeira V, Dokter MM, Schmidt LE, et al. Protein Aggregation Is an Early Manifestation of Phospholamban p.(Arg14del)-Related Cardiomyopathy: Development of PLN-R14del-Related Cardiomyopathy. Circ Heart Fail. 2021;14(11):e008532.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohl S, Medway DJ, Schulz-Menger J, Schneider JE, Neubauer S, Lygate CA. Refined approach for quantification of in vivo ischemia-reperfusion injury in the mouse heart. Am J Physiol Heart Circ Physiol. 2009;297(6):H2054-8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNijholt KT, Sanchez-Aguilera PI, Mahmoud B, Gerding A, Wolters JC, Wolters AHG, et al. A Kinase Interacting Protein 1 regulates mitochondrial protein levels in energy metabolism and promotes mitochondrial turnover after exercise. Sci Rep. 2023;13(1):18822.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaxwell JT, Tsai C-H, Mohiuddin TA, Kwong JQ. Analyses of Mitochondrial Calcium Influx in Isolated Mitochondria and Cultured Cells. J Vis Exp. 2018(134).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaccenda D, Gorini G, Jones A, Thornton C, Baracca A, Solaini G, et al. The ATPase Inhibitory Factor 1 (IF(1)) regulates the expression of the mitochondrial Ca(2+) uniporter (MCU) via the AMPK/CREB pathway. Biochim Biophys Acta Mol Cell Res. 2021;1868(1):118860.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGore E, Duparc T, Genoux A, Perret B, Najib S, Martinez LO. The Multifaceted ATPase Inhibitory Factor 1 (IF1) in Energy Metabolism Reprogramming and Mitochondrial Dysfunction: A New Player in Age-Associated Disorders? Antioxid Redox Signal. 2022;37(4\u0026ndash;6):370\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYlitalo K, Ala-Rami A, Vuorinen K, Peuhkurinen K, Lepojarvi M, Kaukoranta P, et al. Reversible ischemic inhibition of F(1)F(0)-ATPase in rat and human myocardium. Biochim Biophys Acta. 2001;1504(2\u0026ndash;3):329\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujikawa M, Imamura H, Nakamura J, Yoshida M. Assessing actual contribution of IF1, inhibitor of mitochondrial FoF1, to ATP homeostasis, cell growth, mitochondrial morphology, and cell viability. J Biol Chem. 2012;287(22):18781\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanchez-Aguilera P, Lopez-Crisosto C, Norambuena-Soto I, Penannen C, Zhu J, Bomer N, et al. IGF-1 boosts mitochondrial function by a Ca(2+) uptake-dependent mechanism in cultured human and rat cardiomyocytes. Front Physiol. 2023;14:1106662.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaccenda D, Tan CH, Seraphim A, Duchen MR, Campanella M. IF1 limits the apoptotic-signalling cascade by preventing mitochondrial remodelling. Cell Death Differ. 2013;20(5):686\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLefebvre V, Du Q, Baird S, Ng AC, Nascimento M, Campanella M, et al. Genome-wide RNAi screen identifies ATPase inhibitory factor 1 (ATPIF1) as essential for PARK2 recruitment and mitophagy. Autophagy. 2013;9(11):1770\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRomero-Carraminana I, Esparza-Molto PB, Dominguez-Zorita S, Nuevo-Tapioles C, Cuezva JM. IF1 promotes oligomeric assemblies of sluggish ATP synthase and outlines the heterogeneity of the mitochondrial membrane potential. Commun Biol. 2023;6(1):836.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLauterboeck L, Kang SW, White D, 3rd, Bao R, Mobasheran P, Yang Q. IF1 Promotes Cellular Proliferation and Inhibits Oxidative Phosphorylation in Mouse Embryonic Fibroblasts under Normoxia and Hypoxia. Cells. 2024;13(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Z, Shanmughapriya S, Tomar D, Siddiqui N, Lynch S, Nemani N, et al. Mitochondrial Ca(2+) Uniporter Is a Mitochondrial Luminal Redox Sensor that Augments MCU Channel Activity. Mol Cell. 2017;65(6):1014\u0026ndash;28 e7.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4602126/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4602126/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Ischemic conditions can flip the action of mitochondrial ATP-synthase from an ATP producing to an ATP consuming enzyme. The mitochondrial protein ATPase inhibitory factor 1 (ATPIF-1) prevents ATP-synthase reversal, thereby preserving ATP during ischemia. Recent evidence suggests that ATPIF-1 may also have detrimental effects on mitochondrial calcium (Ca2+) handling and mitochondrial permeability transition pore (mPTP) opening under ischemic conditions, challenging conventional views on the function of ATPIF-1. \r\nTo determine the role of ATPIF-1 during myocardial ischemia we studied Ca2+ retention capacity, cardiac injury and cardiac remodeling after myocardial infarction (MI) in ATPIF-1 knockout (ATPIF-1 KO) mice and wild-type (WT) littermates. Mitochondrial Ca2+ retention capacity of isolated cardiac mitochondria of ATPIF-1 KO of ATPIF1-KO mice displayed a 1.3-fold higher threshold for mPTP opening compared to WT mice. However, when subjected 45 minutes left coronary artery (LCA) ligation followed by 48 hours of reperfusion, myocardial infarct size, left ventricular function and remodeling were all comparable between genotypes. Moreover, when subjected to permanent LCA ligation loss of ATPIF-1 KO also did not influence cardiac function or cardiac remodeling. Instead, ATPIF-1 KO mice displayed a 57.3% increase in interstitial fibrosis compared to WT mice. In conclusion, ATPIF-1 KO attenuates mPTP formation, however it does not mitigate myocardial I/R injury or post-MI remodeling. These findings challenge the concept that ATPIF-1 is critical for the response to I/R injury.","manuscriptTitle":"ATPIF-1 knockout attenuates mitochondrial mPTP opening but does not diminish cardiac ischemic/reperfusion injury.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-29 13:18:31","doi":"10.21203/rs.3.rs-4602126/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"18e9b763-e40b-477e-a27c-e5cb3a7f2c04","owner":[],"postedDate":"July 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":34117722,"name":"Health sciences/Diseases/Cardiovascular diseases/Acute coronary syndromes/Myocardial infarction"},{"id":34117723,"name":"Biological sciences/Physiology/Metabolism/Mitochondria"}],"tags":[],"updatedAt":"2024-12-04T12:02:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-29 13:18:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4602126","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4602126","identity":"rs-4602126","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}