Comparison of responses to rapid changes in salinity between Hippocampus kuda and Oryzias melastigma

Comparison of responses to rapid changes in salinity between Hippocampus kuda and Oryzias melastigma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Comparison of responses to rapid changes in salinity between Hippocampus kuda and Oryzias melastigma Yongjian Xu, Wenxin Zhang, Penghong Lin, Xia Pan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6537500/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Aug, 2025 Read the published version in Fish Physiology and Biochemistry → Version 1 posted 11 You are reading this latest preprint version Abstract In order to explore the similarities and differences of responses between Hippocampus kuda and Oryzias melastigma, this study analyzed and compared them from the aspects of growth, behavior, physiology, and gene expression. The results showed that, H. kuda had a greater impact on its feeding behavior compared to O. melastigma at the same rates. And the continuous responses of enzymes indicated there was a more persistent stress in H. kuda, with stress-related genes like Sod1 showing a slower response. Additionally, genes related to sugar and lipid metabolism were significant difference in H. kuda compared to O. melastigma. H. kuda exhibited sensitivity to nearly all treatments, while O. melastigma only responded to treatments of direct input. Furthermore, The responses of immune-related genes in H. kuda was also slower than that in O. melastigma. In summary, the osmotic pressure regulation ability of O. melastigma was more efficient than that of H. kuda to deal with the stress caused by rapid changes in salinity. Hippocampus kuda Oryzias melastigma Rapid salinity change Adaptability and growth Precision aquaculture Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1 Introduction Salinity is an important environmental factor that affects physiological processes such as growth, reproduction, and metabolism of aquatic organisms. Salinity can regulate many biological characteristics in the life process of fish, such as survival, growth, reproduction, etc., and is a key environmental driving factor for fish's stress adaptation ability (Montory et al., 2014 ). Obviously, the salinity in the living environment of fish is not steady. and the different living environment, genetic and physiological characteristics of each species results in different osmotic pressure regulation mechanisms (Kultz, 2015 ; Urbana and Glover, 2015). So the impact of salinity changes is complex to aquatic organisms. Previous researches classified fish into wide-salt fish and narrow-salt fish based on their tolerance to salinity changes (He and Cai, 1998 ). This classification mainly reflected its range of tolerance that the fish can adapt for survival, but did not reflect the rates of this salinity changes. Salinity changes are common and rapidly occurring during the aquaculture process. So, the classification cannot accurately explain whether the fish can quickly adapt to rapid salinity changes, and cannot provide good guidance for aquaculture. It is necessary and vital to investigate differences of stress responses in different fish to rapid salinity hanges. This study selected 2 species fish. Hippocampus kuda , its survival within the salinity range of 6–34 ppt (Zou and Xie, 1989 ). Oryzias melatigma , known as marine madaka, its range was 2–36 ppt (Murata et al., 2020 ). Both were the wide-salt fish, but their adaptation to rapid salinity changes was significantly different. In our previous experiments, H. kuda had a 60% probability of developing anorexia and subsequent enteritis at a changing rate of 1ppt/h within its suitable salinity of 20–30 ppt (Pan et al., 2020 ). However, there was no discomfort observed in O. melatigma at a rate of 5 ppt/h (Wang et al., 2019; Zhang et al., 2021 ). H. kuda didnot adapt to the rapid salinity changes, while O. melatigma did. We preliminarily defined the former was a slow-adaption fish and the latter was a fast-adaption fish. Of course, it was necessary to compare the similarities and differences between them from multiple perspectives (growth, behavior, physiology, molecules), evaluate their response mechanisms and regulatory strategies, and then further clarify the classification. Furthermore, to obtain corresponding characteristic parameters would be crucial for improving aquaculture technology and carrying out precision aquaculture in H. kuda . 2 Materials and Methods 2.1 Experimental fish The seahorse of H. kuda (body length 4.96 ± 0.34 cm, body weight 0.276 ± 0.031 g) was provided by Xiangshan Base of Ningbo Yonghe Biotechnology Company, and temporarily raised for more than a week at the pilot base of Meishan campus, Ningbo University. Individuals with clean body and good vitality were selected for the experiment. O. melatigma (body length 3.12 ± 0.46 cm, weight 1.730 ± 0.243 g) was bred in our laboratory in Meishan campus. Both fish had similar ages of about 45 days old. The temporary breeding conditions were: water temperature of 25 ± 0.5 ℃, salinity of 25 ppt, dissolved oxygen (DO) > 5mg/L, light intensity of 1000lx, and photoperiod of 14L:10D. The seawater was prepared with tap water and sea slat (Qingdao HaiZhiYan Technology Co., Ltd.), and used after 24 hours of aeration. During the periods of temporary breeding and experiment, H. kuda was fed frozen Mysis (Tianjin Fengnian Aquaculture Company, China), and O. melatigma was fed with artificial formula feed (Ningbo Tianbang Group, China). Fed once a day, and removed any remained bait and feces after 2 hours of feeding. The seawater was exchanged approximately 50% before feeding. 2.2 Experimental Design The experiment had 3 groups. The 3 experimental groups had an initial salinity of 25 ppt. The salinity of the control group (CK) remained unchanged in the experiment. The other 2 groups increased or decreased by 2 ppt, that was, the amplitude of salinity changes was 2 ppt. And their salinity would be increased (+ 2 ppt) or decreased (-2 ppt) to a salinity of 27 ppt or 23 ppt, respectively. There were 3 ways of salinity changed rates, included direct input (recorded as 0H ± 2), changed 2 ppt within 2 hours (the rate = 1 ppt/h, recorded as 2H ± 2), and within 5 hours (the rate = 0.4 ppt/h, recorded as 5H ± 2). During the experiment, the temperature of each group remained constant at 25 ± 0.5 ℃, with three replicates for each treatment. The method of salinity changes had been determined by pre-experiment. Using a peristaltic pump, 10L of seawater with a salinity of 10 ppt or 40 ppt was injected into a 20L of seawater with a salinity of 25 ppt within a set period, to achieve the decrease or increase of salinity within 2 or 5 hours, with changed rates of 1 ppt/h and 0.4 ppt/h. After completing the salinity changes, the breeding was maintained at the target salinity for 7 days before ending the experiment. 2.3 Experimental methods 2.3.1 Analysis of gene expression The tissue samples were collected separately from H. kuda and O. melatigma at 12 hour, 4 day, and 7 day after the completeness of salinity changes in each treatment. During the sampling, the fish were anesthetized, and their liver tissues from 3 individuals were taken from each replicate (a total of 9 individuals), then merged as one sample. Total RNA was extracted from each sample using the Trizol method, followed by real-time fluorescence quantitative PCR analysis (Pan et al., 2020 ). According to literature reports and our previous researches, 8 genes were selected in H. kuda , and another 8 genes were selected in O. melatigma as candidate genes for the response analysis (Pan et al., 2020 ). Their specific primers were designed with the software of Primer Premier 5, using mRNA sequences from NCBI. Alternatively, based on the reported Unigene sequences in the transcriptome library (Master dissertation, Pan, 2020 ), the primer sequences of all genes were shown in Table 1 . At the same time, b2m and actb were used as an internal reference gene (Szczygie, et al., 2021; Pan et al., 2020 ) for gene expression analysis in H. kuda and O. melatigma , respectively. The relative expression levels of each target gene were calculated using Livak analysis method, and the 2 −ΔΔCt method was used to calculate the relative expression of the target gene (Livak and Schmittgen, 2001 ). Table 1 Their names and primer sequences of 8 genes analyzed in the experiment Seahorse Marine madaka Gene name Primer sequences(5'-3') Primer sequences(5'-3') Sod1 F: TCACATACTTCACGGGTTTCG R: AGGGAAATGTTCAAGGTACTGC F:CAAATGGGTGTACCAGTGCG R:ATCTCATCATCTCCTGCGGTC Hsp70 F: GTCGGTGAAATAACAGGGAACA R: CTCTGGGTCTACAGGTATTAAGGTG F: ATCAGGAGACACCCACCTCG R: GCCCTCTTGTTCTGGCTAATGT Ldha F: TTGCCCGTCATCTTCATCTG R: GACATCCATACCATCCACCCT F:TCGCTGTGGAAAGGCTCTAA R:CTCTTCTGGGCTGAAGTAAACG Mdh1 F: TCTGCGACCACATGAGGGA R: TCTGGACGGGGAAGGAGTAG F:GCCGCTCAGAAGCTATTTGC R:GCCTCCTGTCCTCTAGTAGCA Cpt1 F: TCAGGGCCAGACGATGCTT R: CGACCGTGCTGCTCAAACA F:ACCGACGCCATTCCCATA R:CTGTCCAGAACCTCCACATACC Fasn F: GTCCCATTGTGCTGTTGTGAC R: CGGACTCCTGAATATCCAGCC F:TGCCACTCCTCCATCTTTGA R:ACGGTTGCTGTAGCCGAAC P53 F: CTTCATCTCATTTCCCAGCATCT R: GGCTTCTAAACCCCACCCTCT F:GCCTTGAAAAGTCTCCATCTGC R:TTCTTCCTCCGTTTTGCGGT Casp3 F: GGGACGGATGTTGATGCTG R: TGGTCCTCTTGGGATACACTCA F: TCTTGTGGGGAAACCAAAGC R: ATAGCCTGAAACGGTGGAGTAG b2m / actb F: TACACCCACCAGCCAGGAAA R: GGACTCGACGACATCGAACATC F:CCCAAAGCCAACAGGGAGA R:CAGAGGCATACAGGGACAGCA 2.3.2 Analysis of enzyme activity The visceral tissue (without liver) of both fish was used for enzyme activity analysis. Accurately weighed 1g tissue, added 9 ML 0.1mol/L pH 7.4 phosphate buffer, mechanically homogenized (DIRAD DR-310, Jiangsu, China) under ice bath, centrifuged at 2500 rpm for 10 minutes in a high-speed centrifuge (Eppendorf 5430R, Germany), and extracted the supernatant. The supermatant would be diluted with the phosphate buffer, and for the determination of the following enzymes. Superoxide dismutase (SOD) by the Hydroxylamine method, malondialdehyde (MDA) by the Thiobarbituric acid (TBA) method, α-Amylase (AMS) by the Starch-iodine colorimetric method, lipase (LPS) by the Methyl resorufin substrate method, alkaline phosphatase (AKP) and acid phosphatase (ACP) by the Disodium phenyl phosphate method. The above analysis was carried out using the corresponding reagent kits from Nanjing Jiancheng Biotechnology Institute (Nanjing, China) according to the instructions. The protein content was measure with Coomassie brilliant blue staining (Candiano et al., 2004 ; Yuan etal., 2024 ). 2.3.3 Analysis of the RNA/DNA ratio According to Buckly's (1979) analysis method, the RNA/DNA ratio was anaylzed for showing the growth of both species. Take respectively an appropriate amount of muscle tissue from the 4-day and 7-day samples and mix it with Tris buffer (0.05 mol/L, pH = 7.4) for homogenization (DIRAD DR-310, Jiangsu, China). Suction 1.4 mL of the homogenization solution and mix it with 0.7 mL of 0.6 mol/L HClO 4 . Cool it on ice bath (BKMAM-Lab VB-1, Hunan, China) for 15 minutes, centrifuge (Eppendorf 5430R, Germany) at 4 ℃ (12000 r/min) for 10 minutes, and then remove the supernatant. Wash the precipitate in 1.12 mL of 0.3 mol/L KOH at 37℃ in water bath for 1 hour and then in ice bath for 30 minutes, and centrifuge again. Take out the supernatant and measure its absorbance value at 260 nm (Mettler UV5 nano, Germany), which was the absorbance value of RNA. At the same time, the precipitate was washed with 2.0 mL 0.2 mol/L HClO 4 , after centrifugation, the supernatant was removed. Then add 2.2 mL of 0.6 mol/L HClO 4 to the precipitate and incubate at 85 ℃ for 15 minutes, followed by an ice bath for 15 minutes. Centrifuge again, the precipitate was protein. Suction the supernatant and measure its absorbance value at 260 nm, which was the absorbance value of DNA. Thus, the ratio of RNA/DNA can be calculated. 2.3.4 Analysis of feeding behavior On the 4th and 7th days, 6–8 individuals of fish were randomly selected from each treatment for observing their feeding behavior. A glass aquarium (L15cm×W10cm×H13cm) was used for behavioral photography. Two portable cameras (Panasonic VX1, Japan) were placed directly above and in front of the aquarium for recording the feeding behavior, in order to subsequent repeated observation and analysis. The water temperature, salinity, light intensity and other conditions inside the aquarium were the same as the original experimental environment. The specific steps in the entire feeding process were as follows: first, let an individual adapt to the new environment in the aquarium for 60 minutes, and then fed live Artemia larvae with a density of 1 ind./mL. The cameras started recording 5 minutes before feeding and lasted for 45 minutes. The following 3 parameters of feeding behavior were analyzed in each treatment based on the recorded videos. Feeding response time (second): the period time elapsed from the entry of Artemia into the water to the first larvae was swallowed by fish. Feeding rate (ind./min): The average rate of Artemia consumed by fish during a 10-minute period from the 11th minute to the 20th minute. Food intake (individual): The total number of Artemia consumed by fish throughout the feeding. 2.4 Data processing and statistical analysis Statistical analysis of experimental data was conducted using SPSS 22.0. Two-way ANOVA was used to examine the effects of salinity changed rates on the growth, feeding behavior, gene expression levels, and enzyme activities of the both fish. T-test was used to analyze the effects of different salinity changes and compare the differences in average values within and between 2 species fish. The data were expressed as mean ± standard error, with P < 0.05 indicating significant differences. Use GraphPad Prism 8.0 to plot data and statistical results. 3 Results 3.1 Effect on the RNA/DNA ratio The variations of RNA/DNA ratio in muscles of H. kuda and O. melastigma at different rates of salinity changes were shown in Table 2 . Table 2 Effects of different rates of salinity changes on the RNA/DNA ratio in the experiment Treatment Sampling time CK 5H ± 2 2H ± 2 0H ± 2 (-2ppt) seahorse 4d 2.849 ± 0.250 b 2.774 ± 0.134 b 2.681 ± 0.259 b 2.259 ± 0.284 a 7d 2.626 ± 0.249 b 2.573 ± 0.095 b 2.345 ± 0.177 a 2.163 ± 0.135 a madaka 4d 2.237 ± 0.283 a 2.054 ± 0.226 a 2.215 ± 0.164 a 1.904 ± 0.250 a 7d 2.585 ± 0.231 a 2.521 ± 0.354 a 2.233 ± 0.379 a 2.296 ± 0.145 a (+2ppt) seahorse 4d 2.849 ± 0.250 b 2.712 ± 0.346 ab 2.531 ± 0.193 ab 2.427 ± 0.289 a 7d 2.626 ± 0.329 b 2.483 ± 0.288 ab 2.211 ± 0.165 ac 2.058 ± 0.232 c* madaka 4d 2.372 ± 0.283 a 2.542 ± 0.252 a 2.445 ± 0.276 a 2.219 ± 0.134 a 7d 2.585 ± 0.231 a 2.716 ± 0.350 a 2.503 ± 0.158 a 2.427 ± 0.271 a Note: Different lowercase letters indicated significant differences in the same species among different rate groups (P < 0.05), * indicated there was a significant difference (P < 0.05) between the 4d and 7d of the same species. Under 2ppt amplitude, there were no any effect on the growth of O. melastigma in all treatments. However, the growth changes was obvious in H. kuda , the RNA/DNA ratios gradually decreased with the increasing rates on the 4th day. Among all treatments, the ratios in 0H ± 2 were the lowest. On the 7th day, the effect was further serious, there were 4 treatments of 0H ± 2 and 2H ± 2 had a significant difference with CK (P < 0.05). The difference was more obvious in the treatments with increased salinity than in decreased salinity, eg. the ratio in 0H + 2 was lower than in 0H-2 (P < 0.05) on the 7th day. More than this, there also was a significant decrease (P < 0.05) compared to the 4th day 3.2 Effect on feeding behavior The variations of feeding behavior in both fish under different rates were shown in Fig. 1 . Compared with CK, the feeding response time of H. kuda was prolonged only in 0H-2 treatment on the 4th day (P < 0.05), and returned to normal on the 7th day. There was a significant difference between the two days (P < 0.05). There also was a significant difference between 0H + 2 and CK on the 7th day(P < 0.05). The feeding rate of H. kuda also showed an obvious decrease in 0H + 2 treatment on the 4th day (P < 0.05), and it decreased in all treatments on the 7th day (P < 0.05). Only 2 treatments of 0H ± 2 was a significant difference between the two days (P < 0.05). The food intake decreased obviously (P < 0.05) in all treatments of H. kuda (except 5H-2) on the 4th day, but all (except 0H ± 2) had recovered on the 7th day. Nevertheless, the feeding response time of O. melastigma had little effect during the experiment, slightly increased in 0H + 2 treatment. And only 0H ± 2 treatments showed a decrease in the feeding rate on the 4th day(P 0.05). So, compared to O. melastigma , H. kuda had no effect on feeding behavior only happened in the treatments with low rates of salinity changes. Based on the measurement results, it was preliminarily determined that the critical safe rate was about 1 ppt/h for H. kuda . 3.3 Effects of physiological and biochemical indicators The variations of several enzymes activities (SOD, MDA, AMS, LPS, AKP, and ACP) in H. kuda and O. melastigma were shown in Fig. 2 . Compared with CK, the SOD activity and MDA content, 2 indicators reflected oxidative stress, increased in most treatments of H. kuda on the 4th day, and were even higher on the 7th day (P < 0.05), eg. SOD in 0H ± 2 and MDA in all treatments. AMS and LPS, 2 digestive enzymes, the AMS activity showed a significant increase (P < 0.05) in 0H + 2 on the 4th day and in 0H ± 2 on the 7th day. The most significant variation was observed in 0H-2, with a significant difference between the two days (P < 0.05). The LPS activity varied in different treatments on the 4th and 7th day, with weak trend. AKP and ACP, 2 immune-related enzymes, the AKP activity showed an increase in most treatments on the 4th day, while ACP decreased in most treatments (except 5H-2) at the same time. On the 7th day, AKP in 5H ± 2 and 2H-2 had dropped, but it continued to rise in 0H ± 2 and 2H + 2. While the ACP activity was elevated in most treatments (except 5H-2) on the 7th day. There was a significant difference (P < 0.05) about both AKP and ACP activities between the 4th and 7th days in the same treatment. Compared with CK, the SOD activity showed a significant increase (P < 0.05) in all treatments of O. melastigma on the 4th day, and then rapidly decreased and returned to normal on the 7th day. The DMA content only showed a significant increase in 2H ± 2 and 0H ± 2 treatments on the 4th day, and remained high content on the 7th day. The AMS activity was also high in all treatments on the 4th day (P < 0.05), and basically returned to normal on the 7th day too. The LPS activity showed little change on the 4th day, then had significantly increased on the 7th day (P < 0.05). On the 4th day, AKP showed an increase in the treatments with decreased salinity (P < 0.05), but showed little change in the increased salinity treatments. On the 7th day, only 2H-2 and 0H ± 2 treatments maintained their high AKP activities. The ACP activity in all treatments was higher than the control on the 4th day (P < 0.05), but only 0H ± 2 remained high on the 7th day (Fig. 2 ). Compared to H. kuda , all enzymes in O. melastigma responded quickly and also returned to normal quickly. 3.4 Effects on related gene expression The variations of the relative expression levels of several genes in H. kuda and O. melastigma were shown in Figs. 3 ~ Fig. 5 . 3.4.1 Stress-related genes Compared with CK, 2 genes related to oxidative stress, Sod1 and Hsp70 , showed their various expression levels in different treatments (Fig. 3 ). Sod1 was up-regulated positively only in 2H + 2 and 0H ± 2 treatments of H. kuda at 12h (P < 0.05). Its expression level further increased in 0H ± 2 at 96h, there was a significant difference between them (P < 0.05). The expression level of Hsp70 increased rapidly in most treatments (except 0H-2) at 12h, and then sharply decreased at 96h, wihch was significantly lower than that in CK (P < 0.05). Similarly, the Sod1 expression in O. melastigma also showed a rapid up-regulation at 12h (except 5H-2), but only 2H-2 still showed an increase at 96h, 2H + 2 and 5H + 2 had quickly fallen back to the control level, and other treatments remained similar to 12h. Hsp70 also showed a rapid up-regulation in most treatments at 12h, then rapidly declined at 96h. The expression level was still higher only in 0H + 2 (P < 0.05). Overall, the Sod1 response in H. kuda was slower than it in O. melastigma. Hsp70 had a rapid up-regulation response in both fish, but it fell back faster in H. kuda . 3.4.2 Energy metabolic-related genes Four metabolic-related genes, Mdh1 and Ldha related to glucose metabolism, as well as Fasn and Cpt1 related to lipid metabolism, were analyzed. Compared with CK, Mdh1 was rapidly down-regulated in all treatments of H. kuda at 12h (Fig. 4 ). And then, Mdh1 was up-regulated in all treatments (except 0H + 2) and its experssion level was higher than that in CK at 96h. Conversely, Ldha was rapidly up-regulated at 12h, then was down-regulated in almost treatments at 96h, only maintained a relatively high expression level in 0H-2. In O. melastigma , Mdh1 showed a rapid up-regulation response only in 2H-2 and 5H-2, while Ldha showed a rapid up-regulation only in 0H ± 2 at 12h. At 96h, only 0H ± 2 showed its obvious up-regulation of Mdh1 , with several times higher than CK (P < 0.05). Ldha had a continuous up-regulation epxression only in 0H-2, and its expression levels in other treatments were either lower or similar to it in CK (Fig. 4 ). So, there was a significant difference in their expressions of 2 sugar metabolism-related genes between H. kuda and O. melastigma . Both genes showed almost synchronous up-regulation or inhibition in its all treatments of H. kuda , but they only showed their responses under acute stress in O. melastigma . Compared with CK, Fasn had an up-regulated expression in all treatments with increased salinity, and Cpt1 was also upregulated in all treatments of H. kuda at 12h. Only 3 treatments (2H-2 and 0H ± 2) showed the up-regulation of Fasn , and only the 0H + 2 treatment remained up-regulated in the experssion of Cpt1 At 96h. There was a significant difference (P < 0.05) in their expression levels of Fasn and Cpt1 between 12h and 96h in all treatments (except 5H-2) of H. kuda . In O. melastigma , Fasn was up-regulated in 0H-2 and increased-salinity treatments, and Cpt1 was also up-regulated in all treatments at 12h. At 96h, Fasn still had a high expression level in 0H ± 2, and the high expression level of Cpt1 also appeared in these 2 treatments (Fig. 4 ). By comparison, the lipid metabolism responses of H. kuda and O. melastigma were similar under rapid salinity changes. 3.4.3 Apoptosis and immune-related genes The variations of relative expression levels of 2 genes related to cell apoptosis and immunity, P53 and Casp3 , were shown in Fig. 5 . Compared with CK, almost treatments of H. kuda showed down-regulation of P53 at 12 h. On the contrary, almost treatments showed up-regulation of Casp3 at the same time. The expression level of P53 at 96 h was similar to that at 12 h in 5H ± 2 (P > 0.05), and increased in the other treatments (P < 0.05) at 96h. Casp3 showed upregulations in all treatments at 96 h, and their expression levels were higher than that of CK (P < 0.05). In O. melastigma , the expression levels of P53 only in 0H ± 2 were higher than that in CK at 12 h, while the expression levels of Casp3 in all treatments were higher than that in CK (P < 0.05). At 96 h, the expression levels of P53 in all treatments with salinity increased were higher than that in CK. And all Casp3 returned below or close to the control at 96h (Fig. 5 ). By comparison, the immune response of H. kuda was slower than that of O. melastigma to the stress. 4 Discussion 4.1 Effects on growth Salinity changes can directly disrupt the inside and outside ion balance of aquatic animals, leading to fluctuation in their osmotic pressure. The osmotic pressure balance of fish involved a series of energy consuming processes such as cell differentiation, protein synthesis, and ion transmembrane transport, and so on (Lushchak, 2011 ), which can have a negative impact on the stress response, energy metabolism, immune regulation, and other processes of fish (Lushchak, 2011 ). In the long-term adaptation process to the osmotic stress, fish usually make energy concessions in life processes such as growth, development, and reproduction to resist the stress, thereby changing the normal growth status, physiological, biochemical, and behavioral performance, and causing individual growth stagnation or even death (Lushchak, 2011 ; Kultz et al., 2007 ). For example, Xiong et al., ( 2020 ) reported the rainbow trout ( Oncorhynchus mykiss ) were significantly lower in the RNA/DNA ratio, specific growth rate, and food conversion efficiency under the stresses of rapid salinity changes than those of the control group. In this study, the RNA/DNA ratio of H. kuda on 4d and 7d gradually decreased with increasing rates, indicating that the growth of H. kuda was also negatively affected by rapid salinity changes (Xu and Sun, 2012 ). However, the tolerance of different aquatic organisms was different to salinity changes. The growth of O. melastigma was not significantly affected by salinity changes, and there was also no significant change with prolonged stress time in this study. Based on this, it was speculated that the growth of O. melastigma under the same conditions was more stable, and its adaptability to salinity changes may also be stronger than H. kuda . 4.2 Effects on feeding The feeding behavior of fish can reflect their physiological status, appetite, and energy demand, and was a common indicator used for evaluating fish stress response (Wang et al., 1997 ). For example, the food intake of Heteropneustes fusilis significantly decreased under the stress of low salinity, which had a strong impact on normal physiological functions (Bal et al., 2021 ). In this study, a similar phenomenon was observed in H. kuda , whose feeding response time increased significantly and food intake decreased significantly in the treatments with direct input. Zhang et al. ( 2021 ) also observed that the feeding rate and the food intake of juvenile H. kuda gradually decreased with the increasing salinity amplitude. It was consistent with the results obtained in this study. This indicated that rapid salinity changes could have a significant impact on the feeding behavior of H. kuda , which may reflect an epigenetic signal that its internal environmental homeostasis was being severely affected. However, the effect of salinity stress on the feeding response time, feeding rate, and food intake of O. melastigma was not significant under the same conditions. This further indicated that the adaptability of O. melastigma to salinity rapid changes was stronger. 4.3 Effects on enzyme activities The MDA content can reflect the degree of oxidative stress that organisms were subjected to, while the SOD activity can reflect the ability of organisms to resist stress and maintain normal physiology (Pan et al., 2016 ). For example, the juvenile Epinephelus coioides was subjected to salinity stress, which led to an increase in MDA content in cells. However, the activities of corresponding antioxidant enzymes (SOD, CAT) were also significantly increased, they enhanced the antioxidant defense ability and maintained a low level of oxidative stress, demonstrating strong tolerance to salinity stress (Cheng et al., 2023). In this study, the MDA content in each treatment of H. kuda was significantly increased, and O. melastigma also showed a significant increase in the treatments with direct input, indicating that all rates of salinity changes can force an increase in oxidative stress levels and cell damage in H. kuda , while O. melastigma only had a risk under acute stress. With the prolongation of stress time, the SOD activity and MDA content in O. melastigma returned to similar levels as the control, while they increased further in H. kuda , indicating a deeper degree of oxidative damage in H. kuda . Therefore, its antioxidant defense ability was still in a continuous upward stage (Pan et al., 2016 ). On the contrary, O. melastigma had completed adaptive regulation to the stress. The salinity changes also had a significant impact on AMS and LPS activities of H. kuda and O. melastigma . From the results, it can be seen that both fish coped with excessive energy consumption by increasing the activities of digestive enzymes, thereby increasing the assimilation efficiency of foodborne sugars and lipids (Tan et al., 2016 ). After a prolonged period of stress, energy supplementation became unsustainable from carbohydrates, leading to an increase in lipid consumption and LPS activity (Tan et al., 2016 ). But the performance was different between the 2 fish. H. kuda always maintained a relatively high level of AMS activity, while O. melastigma had a higher level of LPS activity on the 7th day. It indicated the main energy source in O. melastigma had shifted to lipid metabolism, while H. kuda was still dominated by carbohydrate in the later stage of the experiment. Carbohydrates are short-life energy substances that rapidly decompose through the action of AMS. Lipids, on the other hand, are long-life energy substances that decompose through the action of LPS. Obviously, the energy supply of O. melastigma was more secure than that of H. kuda . Phosphatase activity was commonly used to measure the immune status of organisms. For example, The activities of ACP and AKP in juvenile Lateolabrax maculatus (Wang et al., 2016 ) and juvenile Rachycentron canadum (Feng et al., 2007 ) were significantly inhibited in the early stage of acute low salt stress, and then significantly increased with prolonged stress time. However, the rapid changes in salinity did not have a significant impact on the ACP and AKP activities of juvenile Leuronectes yokohama (Cui et al., 2017 ). The occurrence of this phenomenon indicated that there were significant differences in immune regulatory mechanisms and adaptive abilities among different species (Cui et al., 2017 ). In this study, the trend of changes in AKP and ACP activities in H. kuda and O. melastigma was basically consistent, indicating that rapid changes in salinity may have some similarities in the non-specific immune response regulation process involving ACP and AKP in H. kuda and O. melastigma to some extent. 4.4 Effects on the expression of genes The liver is an important site involved in the regulation of metabolism and osmotic pressure in fish, playing an important role in maintaining osmotic pressure balance and normal physiological activity (Legouis et al., 2020 ). The expression of Ldha in the liver of H. kuda gradually increased with the changed rates at the beginning of the experiment, while Mdh1 showed a downward trend, indicating that H. kuda may be in a state of hypoxia at this time, and the aerobic metabolism of liver glycogen was inhibited, because the expressed upregulation of Ldha increased the synthesis level of lactate to compensate for the inhibited aerobic metabolism (Cao et al., 2018 ). With the prolongation of stress time, the expression level of Ldha would be significantly downregulated, and Mdh1 would be significantly upregulated in H. kuda , indicating that the hypoxia situation was alleviated at this time. The hepatic glycogen metabolism strategy was once again adjusted to promote aerobic metabolism (Ruan et al., 2023 ), providing energy for osmotic pressure regulation. Under the same conditions, there was no significant difference in the expression level of Ldha among all treatments, indicating that O. melastigma may not have experienced hypoxia during the adaptation process. The expression level of Mdh1 in O. melastigma was significantly upregulated in the early stage of stress, and then significantly downregulated, indicating an increase in its sugar aerobic metabolism level during the early stage, providing energy for osmotic pressure regulation (Zhu et al., 2021 ). Subsequently, O. melastigma adapted to the stress, and as a result, aerobic metabolism gradually returned to normal. It was speculated that at this time, the sugar metabolism regulation of O. melastigma may have shifted from passive regulation to active adaptation (Takvam et al., 2021 ). Similar studies had reported, the activities and expression levels of anaerobic metabolic enzymes, such as phosphofructose kinase, pyruvate kinase, and lactate dehydrogenase were significantly increased in the liver of hard clams ( Mercenaria mercenaria ) under hypoxic conditions, indicating that anaerobic metabolism under hypoxic conditions may play a key role in the energy regulation of hard clams (Hu et al., 2023 ). Fatty acid synthase (FASN) was the main enzyme in the fatty acid breakdown pathway (Cheng et al., 2017 ). For example, several genes expressed in the liver of Scophthalmus maximus (Liu et al., 2021 ) and Trachinotus carolinus (Bradshaw et al., 2023 ) were significantly enriched in multiple lipid metabolism related pathways under salinity stresses, indicating that the salinity stress may have a significant impact on lipid metabolism in liver of fish. The juvenile rainbow trout, had a weak adaptability to salinity, adapted to sudden increases in environmental salinity by increasing the level of lipid synthesis (Xiong et al., 2020 ), and so on. In this study, the expression level of Fasn gene in H. kuda was significantly up-regulated at 96 h under rapid salinity changes, indicating that the osmotic pressure balance in H. kuda was affected with prolonged stress time. The increase in lipid synthesis levels may be one of the important means for H. kuda to cope with rapid salinity changes and improve its ability to adapt to the stress (Bin, 2017 ). In summary, changes in salinity under the same conditions may have a greater impact on the lipid metabolism in H. kuda than in O. melastigma . Therefore, the energy demand of H. kuda for compensating for osmotic regulation may be higher than that of O. melastigma (Lassoued et al., 2023 ). In addition, changes in environmental salinity can trigger oxidative stress, during this period, the activity of antioxidant enzymes also changed correspondingly in fish's oxidative defense system (Seon et al., 2011 ; Ding et al., 2019 ). So, the expression levels of Sod1 were significantly increased in O. melastigma and H. kuda at 12h and 96h, respectively. It was speculated that there may be a certain difference in the response time of the oxidative defense system between H. kuda and O. melastigma (Madeira et al., 2017 ). Changes in salinity can also promote a significant upregulation of Casp3 expression, leading to oxidative stress and cell damage in liver, and activating the antioxidant system (Lee et al., 2022 ). In this study, the expression of Casp3 in H. kuda was significantly up-regulated with the increase of salinity changed rates at 12 h, indicating a significant increase in the risk of cell apoptosis in the liver of H. kuda (Chu et al., 2023 ). With the prolongation of stress time, the expression level of Casp3 in O. melastigma was no different with CK at 96 h, indicating a significant reduction in the possibility of cell apoptosis in the liver of O. melastigma . At this time, the oxidative stress response induced by salinity stress in O. melastigma was likely to have returned to normal. So, compared to O. melastigma , salinity changes may cause more severe cell damage and higher levels of cell apoptosis in H. kuda . 5 Conclusion Compared with O. melastigma , the same salinity changes had a greater impact on the feeding behavior of H. kuda , consumed more energy to resist the stress, and had a more significant impact on growth. The same salinity changes may also cause more severe cell damage and higher levels of cell apoptosis to H. kuda , resulting in a decrease in non-specific immune ability and a increase in risk of disease. Furthermore, the metabolic regulation mechanism of O. melastigma may be more efficient than that of H. kuda , with the more sufficient and long-lasting energy supply for stress resistance. Based on the biological characteristics of H. kuda, its precise aquaculture technique needs a stricter and more precise control of environmental salinity to prevent rapid and big salinity changes from affecting the growth and survival. Declarations Ethics statement The studies involving animals were reviewed and approved by by the Ethics Committee on Animal Research of Ningbo University. All experimental procedures complied with the Standard Operation Procedures(SOPs) of the Guide for Use of Experimental Animals of Ningbo University. Author Contribution Pan.Lin. and Zhang. wrote the main manuscript text and figures.Xu gave method guidance References Bal A, Pati SG, Panda F, Mohanty L, Paital B. Low salinity induced challenges in the hardy fish Heteropneustes fossilis , future prospective of aquaculture in near coastal zones[J]. Aquaculture, 2021, 543: 737007. Bin WG. Effect of salvianolate therapy on peripheral blood Bcl-2, BAX and Caspase-3 expression in patients with cerebral ischemic stroke and their correlation with neural function[J]. Journal of Hainan Medical University, 2017, 23(9): 1279-1282. Bradshaw DJ, Uribe V, King LE, Carlie SP, Gonzalo I, Elizabeth A, Marisol SI, Marty R, Paul SW, Sahar M. Effects of low salinities on growth, fatty acid composition, and transcriptome in Florida pompano ( Trachinotus carolinus ) at early developmental stages[J]. Aquaculture, 2023, 563: 738964. Buckly LJ. Relationships between RNA/DNA ratio, prey density, and growth rate in Atlantic cod ( Gadus morhus ) larvae[J]. Journal Fish Research Board Canada, 1979, 36: 1497- 1502. Cao R, Liu Y, Wang Q, Yu FF. Seawater acidification reduced the resistance of Crassostrea gigas to Vibrio splendidus challenge: an energy metabolism perspective [J]. Frontiers in Physiology, 2018, 9: 880. Candiano G, Bruschi M, Musante L, Santucci L, Ghiggeri G M, Carnemolla B, et al. Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis, 2004. 25 (9), 1327–1333. Cheng CH, Ye CX, Guo ZX, Wang AL. Immune and physiological responses of pufferfish ( Takifugu obscurus ) under cold stress [J]. Fish & Shellfish Immunol, 2017, 64: 137-145. Cheng YZ. Effects of seawater salinity on growth, physiology and biochemistry of juvenile Epinephelus obliquus [D]. Nanjing Agricultural University, 2023. Chu P, Luo S, Wang H, Zhang C, Wen X, Yin SW, Wang T. Interactive effects of temperature and salinity on the apoptosis, antioxidant enzymes, and MAPK signaling pathway of juvenile pufferfish ( Takifugu fasciatus ) [J]. Aquaculture Reports, 2023, 29: 101483. Cui QJ, Chen B, Qiu LH, Chen L. The effects of low salt stress on Na + /K + -ATPase, liver antioxidant enzymes, and non-specific immune enzymes in the gills of juvenile blunt snouted yellow flounder [J]. Journal of Guangdong Ocean University, 2017, 37 (6): 26-32. Ding L, Li WH, Li N, Liang LY, Zhang XY, Jin HL, Shi HT, Storey KB, Hong ML. Antioxidant responses to salinity stress in an invasive species, the red-eared slider ( Trachemys scripta elegans ) and involvement of a TOR-Nrf2 signaling pathway[J]. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 2019, 219: 59-67. Feng J, Xu LW, Lin HZ, Dong H. The effect of salinity changes on the immune factors and growth of juvenile cobia fish [J]. Journal of Fishery Sciences of China, 2007, 14 (1): 120-125 He DR, Cai HC. Fish Behavior[M]. Xiamen University Press, 1998. Hu Z, Xu L, Song H, Feng J, Zhou C, Yang MJ, Shi P, Li YR, Guo YJ, Li HZ, Zhang T. Effect of heat and hypoxia stress on mitochondrion and energy metabolism in the gill of hard clam[J]. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 2023, 266: 109556. Kultz D, Fiol D, Valkova N, Gomez-Jimenez S, Chan SY, Lee J. Functional genomics and proteomics of the cellular osmotic stress response in 'non-model' organisms [J]. Journal of Experimental Biology, 2007, 210(9): 1593-1601. Kultz D. Physiological mechanisms used by fish to cope with salinity stress[J]. Journal of Experimental Biology, 2015, 218(12): 1907-1914. Lassoued A, Khalloufi N, Saidani W, Khazri A, Ghanem-Boughanmi N, Bouayed J, Ben-Attia M. Effects of increased salinity on oxidative stress status in the freshwater mussel Unio ravoisieri [J]. Chemistry and Ecology, 2023, 39(3): 256-267. Lee DW, Choi YU, Park HS, Park YS, Choi CY. Effect of low pH and salinity conditions on the antioxidant response and hepatocyte damage in juvenile olive flounder Paralichthys olivaceus [J]. Marine Environmental Research, 2022, 175: 105562. Legouis SD, Faivre A, Cippa PE, de Seigneux S. Renal gluconeogenesis: an underestimated role of the kidney in systemic glucose metabolism [J]. Nephrology Dialysis Transplantation, 2020, 37(8): 1417-1425. Liu Z, Ma A, Yuan C, Zhao TT, Chang HW, Zhang JS. Transcriptome analysis of liver lipid metabolism disorders of the turbot Scophthalmus maximus in response to low salinity stress [J]. Aquaculture, 2021, 534: 736273. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔ CT method[J]. Methods, 2001, 25(4): 402-408. Lushchak VI. Environmentally induced oxidative stress in aquatic animals [J]. Aquatic Toxicology, 2011, 101(1): 13-30. Madeira C, Mendonca V, Leal MC, Flores A, Carbral HN, Diniz MS, Vinagre C. Thermal stress, thermal safety margins and acclimation capacity in tropical shallow waters—An experimental approach testing multiple end-points in two common fish [J]. Ecological Indicators, 2017, 81: 146-158. Montory JA, Pechenik JA, Diederich CM, Chaparro OR. Effects of low salinity on adult behavior and larval performance in the intertidal gastropod Crepipatella peruviana (Calyptraeidae) [J]. PLoS ONE, 2014, 9(7): e103820. Murata K, Kinoshita M, Kiyoshi N, Tanaka M, Kamer Y. Madaka: Biology, Management, and Experimental Protocols[M]. Wiley Blackwell Press, USA, 2020. Pan GP, Liu BW, Zhou WY. The effect of low temperature stress on antioxidant and immune indicators of young grouper[J]. Journal of Shanghai Ocean University, 2016, 25 (1): 78-85. Pan X, Sheng X, Zhang WX, Xu YJ. Effects of short-term temperature changes on the physiology, biochemistry and feeding behaviour of the juvenile yellow seahorse[J]. Aquaculture Research, 2022, 53:1084-1097. Pan X, Xu YJ, Ning Y, Zhang WX. Effects of temperature stress on genes’ transcription and expression in juvenile Hippocampus kuda Bleeker[J]. Journal of Nuclear Agricultural Sciences, 2020, 34(7): 1421-1431. Pan X. Study on the effects of temperature and salinity on the feeding transition period of juvenile seahorse, Hippocampus kuda [D]. Ningbo University, 2020. Ruan S, Lu Z, Huang W, Zhang Y, Shan XJ, Song W, Ji CL. Renal metabolomic profiling of large yellow croaker Larimichthys crocea acclimated in low salinity waters [J]. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 2023, 46: 101083. Seon PM, Suk SH, Young CC, Choi CY, Kim NN, Lee J. Effect of hypoosmotic and thermal stress on gene expression and the activity of antioxidant enzymes in the cinnamon clownfish, Amphiprion melanopus [J]. Animal Cells and Systems, 2011, 15(3): 219-225. Szczygieł J, Kaminska-Gibas T, Petit J, Jurecka P, Wiegertjes G, Irnazarow I. Re-evaluation of common carp ( Cyprinus carpio L.) housekeeping genes for gene expression studies–considering duplicated genes[J]. Fish and Shellfish Immunology, 2021, 115: 58-69. Takvam M, Wood CM, Kryvi H, Nilson TO. Ion transporters and osmoregulation in the kidney of teleost fishes as a function of salinity [J]. Frontiers in Physiology, 2021, 20: 1-25. Tan E, Kinoshita S, Suzuki Y, Ineno T, Tamaki K, Kera A, Muto K, Yada T, Kitamura S, Asakawa S. Different gene expression profiles between normal and thermally selected strains of rainbow trout, Oncorhynchus mykiss , as revealed by comprehensive transcriptome analysis[J]. Gene, 2016, 576(2): 637-643. Urbina MA, Glover CN. Effect of salinity on osmoregulation, metabolism and nitrogen excretion in the amphidromous fish, inanga ( Galaxias maculatus ) [J]. Journal of Experimental Marine Biology and Ecology, 2015, 473: 7-15. Wang HL, Wen HS, Zhang XY. The effect of salinity stress on the intestinal antioxidant and non-specific immune abilities of juvenile sea bass [J]. Modern Agricultural Technology, 2016, (4): 261-269. Wang JQ, Lui H, Po H, Zhang YP. Influence of salinity on food consumption, growth and energy conversion efficiency of common carp ( Cyprinus carpio ) fingerlings [J]. Aquaculture, 1997, 148(2): 115-124. Wang RP, Dai LL, Chen YF, Xu YJ. Effects of short-term temperature or salinity stress on feeding behavior and antioxidant of marine medaka ( Oryzias melastigma )[J]. Oceanologia et Limnologia Sinica, 50(2): 378-388. Xiong Y, Dong SL, Huang M, Li Y, Wang X, Wang F, Ma SS, Zhou YG. Growth, osmoregulatory response, adenine nucleotide contents, and liver transcriptome analysis of steelhead trout ( Oncorhynchus mykiss ) under different salinity acclimation methods [J]. Aquaculture, 2020, 520: 734937. Xu YJ, Sun B. The effects of salinity stress on the growth, composition, and enzyme activity of Hippocampus kuda juveniles [J]. Oceanologia Et Limnologia Sinica, 2012, 43 (6): 1279-1285. Yuan Q, Wu CC, Yang H, Lv WW, Huang WW, Zhang Q, Zhou WZ. Effects of four types of natural bait on water quality, feeding, growth, and antioxidant enzyme activity of Monopterus albus in a recirculating aquaculture system. Frontiers in Physiology, 2024, 15, e1403391 Zhang WX, Pan X, Shen XQ, Xu YJ. The effect of salinity stress on the transcriptional expression of genes in juvenile Hippocampus kuda [J]. Acta Hydrobiologica Sinica , 2021, 45 (5): 995-1004 Zhu JH, Wang XD, Bu XY, Wang CL, Pan JY, Li EC, Shi QC, Zhang ML, Qin J, Chen LQ. Relationship between myo-inositol synthesis and carbohydrate metabolism changes in Mozambique tilapia ( Oreochromis mossambicus ) under acute hypersaline stress[J]. Aquaculture, 2021, 532: 736005. Zou GF, Xie Y. A study on the survival rate of seahorse seedlings [J]. Chinese herbal medicine, 1989, 12 (3): 15-16. Additional Declarations No competing interests reported. Supplementary Files Table1.docx Cite Share Download PDF Status: Published Journal Publication published 07 Aug, 2025 Read the published version in Fish Physiology and Biochemistry → Version 1 posted Editorial decision: Revision requested 27 Jun, 2025 Reviews received at journal 27 Jun, 2025 Reviews received at journal 22 Jun, 2025 Reviewers agreed at journal 20 Jun, 2025 Reviewers agreed at journal 17 Jun, 2025 Reviewers agreed at journal 17 Jun, 2025 Reviewers agreed at journal 16 Jun, 2025 Reviewers invited by journal 15 Jun, 2025 Editor assigned by journal 14 Jun, 2025 Submission checks completed at journal 28 May, 2025 First submitted to journal 26 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6537500","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":471734511,"identity":"590ac580-1000-4976-97b4-5503aeab6d60","order_by":0,"name":"Yongjian Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYPACNh4GBuYDzGD2AeK1sCWQpAUEeAyI02JwI8fwccEvPhn+2T3fHhe2Mcjx3Uhg/FyAR4vkjBxj45l9bDwSd85uN57ZxmAseSOBWXoGHi38Ejlm0rw9QL/cyN0mzdvGkLjhRgIbMw8eLWwwLfI3cp6BtNQT1AK2hecHGw/QU2wgLQkGhLRI9jwrNuZtYOMxvJFmJj3jnIThzDMPm6XxaTE4nrzxMc+fY/ZyN5KfSReU2cjzHU8++BmfFgYGDgMGxrZjMJ4EEDM24NXAwMD+gIHhTw0BRaNgFIyCUTCiAQCLN0RF2C3NfgAAAABJRU5ErkJggg==","orcid":"","institution":"Ningbo University","correspondingAuthor":true,"prefix":"","firstName":"Yongjian","middleName":"","lastName":"Xu","suffix":""},{"id":471734512,"identity":"8d7dd5f6-22d7-4c50-aed8-0d09aedeca34","order_by":1,"name":"Wenxin Zhang","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Wenxin","middleName":"","lastName":"Zhang","suffix":""},{"id":471734516,"identity":"e18e2401-528b-4923-b924-c47e81547b29","order_by":2,"name":"Penghong Lin","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Penghong","middleName":"","lastName":"Lin","suffix":""},{"id":471734517,"identity":"76836c15-8bcd-49c8-8e3e-c4f4ce4a4ef5","order_by":3,"name":"Xia Pan","email":"","orcid":"","institution":"Ningbo University","correspondingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Pan","suffix":""}],"badges":[],"createdAt":"2025-04-27 02:38:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6537500/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6537500/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10695-025-01548-1","type":"published","date":"2025-08-07T15:57:53+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84813833,"identity":"7e30801b-d014-4d91-8709-41711358b9c1","added_by":"auto","created_at":"2025-06-17 15:14:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":130683,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different salinity changed rates on feeding behavior parameters in \u003cem\u003eHippocampus kuda\u003c/em\u003e(left column) and \u003cem\u003eOryzias melastigma\u003c/em\u003e(right column)\u003c/p\u003e\n\u003cp\u003eNote: Different lowercase and uppercase letters indicated significant differences in the same species between different treatments at 4d and 7d, respectively (P\u0026lt;0.05), * incidated there was a significant difference (P\u0026lt;0.05) between 4d and 7d of the same species in the same treatment.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/68075dcc52f3ed120b74cb5e.png"},{"id":84812844,"identity":"32407831-5f29-4aaf-83a0-67a3948bc010","added_by":"auto","created_at":"2025-06-17 15:06:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":166662,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different salinity changed rates on several \u003cstrong\u003eenzyme activitie\u003c/strong\u003es in \u003cem\u003eHippocampus kuda\u003c/em\u003e (left column) and \u003cem\u003eOryzias melastigma\u003c/em\u003e (right column)\u003c/p\u003e\n\u003cp\u003eNote: Different lowercase and uppercase letters indicated significant differences in the same species between different treatments at 4d and 7d, respectively (P\u0026lt;0.05), * incidated there was a significant difference (P\u0026lt;0.05) between 4d and 7d of the same species in the same treatment.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/cdec120678ea51e97492df02.png"},{"id":84812842,"identity":"9cf12636-346d-476c-93c7-cf51d9337d6c","added_by":"auto","created_at":"2025-06-17 15:06:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":101893,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different salinity changed rates on expression of several stress-related \u003cstrong\u003egenes\u003c/strong\u003e in \u003cem\u003eHippocampus kuda\u003c/em\u003e (left column) and \u003cem\u003eOryzias melastigma\u003c/em\u003e (right column)\u003c/p\u003e\n\u003cp\u003eNote: Different lowercase and uppercase letters indicated significant differences in the same species between different treatments at 4d and 7d, respectively (P\u0026lt;0.05), * incidated there was a significant difference (P\u0026lt;0.05) between 4d and 7d of the same species in the same treatment.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/37ca15bbdf99316528d40331.png"},{"id":84813834,"identity":"a7e3757d-9fd8-47e5-ae49-688d54b10908","added_by":"auto","created_at":"2025-06-17 15:14:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":135309,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different salinity changed rates on expression of several energy-related \u003cstrong\u003egenes\u003c/strong\u003e in \u003cem\u003eHippocampus kuda\u003c/em\u003e (left column) and \u003cem\u003eOryzias melastigma\u003c/em\u003e (right column)\u003c/p\u003e\n\u003cp\u003eNote: Different lowercase and uppercase letters indicated significant differences in the same species between different treatments at 4d and 7d, respectively (P\u0026lt;0.05), * incidated there was a significant difference (P\u0026lt;0.05) between 4d and 7d of the same species in the same treatment.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/0ef1934f2955d5ff9b25c2ae.png"},{"id":84812846,"identity":"9e95884b-c325-45fe-ab14-5c8670c88567","added_by":"auto","created_at":"2025-06-17 15:06:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":87648,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different salinity changed rates on expression of several immune-related \u003cstrong\u003egenes\u003c/strong\u003e in \u003cem\u003eHippocampus kuda\u003c/em\u003e (left column) and \u003cem\u003eOryzias melastigma\u003c/em\u003e (right column)\u003c/p\u003e\n\u003cp\u003eNote: Different lowercase and uppercase letters indicated significant differences in the same species between different treatments at 4d and 7d, respectively (P\u0026lt;0.05), * incidated there was a significant difference (P\u0026lt;0.05) between 4d and 7d of the same species in the same treatment.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/496f5b29cd39b3c740aa5f87.png"},{"id":88814253,"identity":"2f93772e-4b86-477f-b426-0fc0e487cb0f","added_by":"auto","created_at":"2025-08-11 16:09:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1482688,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/8ced7770-9d32-482f-bdd3-87c59c080d3d.pdf"},{"id":84813835,"identity":"17034ca9-c253-4157-b6f7-6b7e00df7622","added_by":"auto","created_at":"2025-06-17 15:14:47","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":17419,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-6537500/v1/350990b01f1c5c986198a1db.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Comparison of responses to rapid changes in salinity between Hippocampus kuda and Oryzias melastigma","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eSalinity is an important environmental factor that affects physiological processes such as growth, reproduction, and metabolism of aquatic organisms. Salinity can regulate many biological characteristics in the life process of fish, such as survival, growth, reproduction, etc., and is a key environmental driving factor for fish's stress adaptation ability (Montory et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Obviously, the salinity in the living environment of fish is not steady. and the different living environment, genetic and physiological characteristics of each species results in different osmotic pressure regulation mechanisms (Kultz, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Urbana and Glover, 2015). So the impact of salinity changes is complex to aquatic organisms. Previous researches classified fish into wide-salt fish and narrow-salt fish based on their tolerance to salinity changes (He and Cai, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). This classification mainly reflected its range of tolerance that the fish can adapt for survival, but did not reflect the rates of this salinity changes. Salinity changes are common and rapidly occurring during the aquaculture process. So, the classification cannot accurately explain whether the fish can quickly adapt to rapid salinity changes, and cannot provide good guidance for aquaculture. It is necessary and vital to investigate differences of stress responses in different fish to rapid salinity hanges.\u003c/p\u003e \u003cp\u003eThis study selected 2 species fish. \u003cem\u003eHippocampus kuda\u003c/em\u003e, its survival within the salinity range of 6\u0026ndash;34 ppt (Zou and Xie, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). \u003cem\u003eOryzias melatigma\u003c/em\u003e, known as marine madaka, its range was 2\u0026ndash;36 ppt (Murata et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Both were the wide-salt fish, but their adaptation to rapid salinity changes was significantly different. In our previous experiments, \u003cem\u003eH. kuda\u003c/em\u003e had a 60% probability of developing anorexia and subsequent enteritis at a changing rate of 1ppt/h within its suitable salinity of 20\u0026ndash;30 ppt (Pan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, there was no discomfort observed in \u003cem\u003eO. melatigma\u003c/em\u003e at a rate of 5 ppt/h (Wang et al., 2019; Zhang et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \u003cem\u003eH. kuda\u003c/em\u003e didnot adapt to the rapid salinity changes, while \u003cem\u003eO. melatigma\u003c/em\u003e did. We preliminarily defined the former was a slow-adaption fish and the latter was a fast-adaption fish. Of course, it was necessary to compare the similarities and differences between them from multiple perspectives (growth, behavior, physiology, molecules), evaluate their response mechanisms and regulatory strategies, and then further clarify the classification. Furthermore, to obtain corresponding characteristic parameters would be crucial for improving aquaculture technology and carrying out precision aquaculture in \u003cem\u003eH. kuda\u003c/em\u003e.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Experimental fish\u003c/h2\u003e \u003cp\u003eThe seahorse of \u003cem\u003eH. kuda\u003c/em\u003e (body length 4.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34 cm, body weight 0.276\u0026thinsp;\u0026plusmn;\u0026thinsp;0.031 g) was provided by Xiangshan Base of Ningbo Yonghe Biotechnology Company, and temporarily raised for more than a week at the pilot base of Meishan campus, Ningbo University. Individuals with clean body and good vitality were selected for the experiment. \u003cem\u003eO. melatigma\u003c/em\u003e (body length 3.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46 cm, weight 1.730\u0026thinsp;\u0026plusmn;\u0026thinsp;0.243 g) was bred in our laboratory in Meishan campus. Both fish had similar ages of about 45 days old.\u003c/p\u003e \u003cp\u003eThe temporary breeding conditions were: water temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 ℃, salinity of 25 ppt, dissolved oxygen (DO)\u0026thinsp;\u0026gt;\u0026thinsp;5mg/L, light intensity of 1000lx, and photoperiod of 14L:10D. The seawater was prepared with tap water and sea slat (Qingdao HaiZhiYan Technology Co., Ltd.), and used after 24 hours of aeration. During the periods of temporary breeding and experiment, \u003cem\u003eH. kuda\u003c/em\u003e was fed frozen \u003cem\u003eMysis\u003c/em\u003e (Tianjin Fengnian Aquaculture Company, China), and \u003cem\u003eO. melatigma\u003c/em\u003e was fed with artificial formula feed (Ningbo Tianbang Group, China). Fed once a day, and removed any remained bait and feces after 2 hours of feeding. The seawater was exchanged approximately 50% before feeding.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental Design\u003c/h2\u003e \u003cp\u003eThe experiment had 3 groups. The 3 experimental groups had an initial salinity of 25 ppt. The salinity of the control group (CK) remained unchanged in the experiment. The other 2 groups increased or decreased by 2 ppt, that was, the amplitude of salinity changes was 2 ppt. And their salinity would be increased (+\u0026thinsp;2 ppt) or decreased (-2 ppt) to a salinity of 27 ppt or 23 ppt, respectively. There were 3 ways of salinity changed rates, included direct input (recorded as 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2), changed 2 ppt within 2 hours (the rate\u0026thinsp;=\u0026thinsp;1 ppt/h, recorded as 2H\u0026thinsp;\u0026plusmn;\u0026thinsp;2), and within 5 hours (the rate\u0026thinsp;=\u0026thinsp;0.4 ppt/h, recorded as 5H\u0026thinsp;\u0026plusmn;\u0026thinsp;2). During the experiment, the temperature of each group remained constant at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 ℃, with three replicates for each treatment.\u003c/p\u003e \u003cp\u003eThe method of salinity changes had been determined by pre-experiment. Using a peristaltic pump, 10L of seawater with a salinity of 10 ppt or 40 ppt was injected into a 20L of seawater with a salinity of 25 ppt within a set period, to achieve the decrease or increase of salinity within 2 or 5 hours, with changed rates of 1 ppt/h and 0.4 ppt/h. After completing the salinity changes, the breeding was maintained at the target salinity for 7 days before ending the experiment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Experimental methods\u003c/h2\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1 Analysis of gene expression\u003c/h2\u003e \u003cp\u003eThe tissue samples were collected separately from \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melatigma\u003c/em\u003e at 12 hour, 4 day, and 7 day after the completeness of salinity changes in each treatment. During the sampling, the fish were anesthetized, and their liver tissues from 3 individuals were taken from each replicate (a total of 9 individuals), then merged as one sample. Total RNA was extracted from each sample using the Trizol method, followed by real-time fluorescence quantitative PCR analysis (Pan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAccording to literature reports and our previous researches, 8 genes were selected in \u003cem\u003eH. kuda\u003c/em\u003e, and another 8 genes were selected in \u003cem\u003eO. melatigma\u003c/em\u003e as candidate genes for the response analysis (Pan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Their specific primers were designed with the software of Primer Premier 5, using mRNA sequences from NCBI. Alternatively, based on the reported Unigene sequences in the transcriptome library (Master dissertation, Pan, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), the primer sequences of all genes were shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. At the same time, \u003cem\u003eb2m\u003c/em\u003e and \u003cem\u003eactb\u003c/em\u003e were used as an internal reference gene (Szczygie, et al., 2021; Pan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) for gene expression analysis in \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melatigma\u003c/em\u003e, respectively. The relative expression levels of each target gene were calculated using Livak analysis method, and the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method was used to calculate the relative expression of the target gene (Livak and Schmittgen, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTheir names and primer sequences of 8 genes analyzed in the experiment\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSeahorse\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMarine madaka\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences(5'-3')\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequences(5'-3')\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSod1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCACATACTTCACGGGTTTCG\u003c/p\u003e \u003cp\u003eR: AGGGAAATGTTCAAGGTACTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:CAAATGGGTGTACCAGTGCG\u003c/p\u003e \u003cp\u003eR:ATCTCATCATCTCCTGCGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHsp70\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTCGGTGAAATAACAGGGAACA\u003c/p\u003e \u003cp\u003eR: CTCTGGGTCTACAGGTATTAAGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ATCAGGAGACACCCACCTCG\u003c/p\u003e \u003cp\u003eR: GCCCTCTTGTTCTGGCTAATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLdha\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTGCCCGTCATCTTCATCTG\u003c/p\u003e \u003cp\u003eR: GACATCCATACCATCCACCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:TCGCTGTGGAAAGGCTCTAA\u003c/p\u003e \u003cp\u003eR:CTCTTCTGGGCTGAAGTAAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMdh1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCTGCGACCACATGAGGGA\u003c/p\u003e \u003cp\u003eR: TCTGGACGGGGAAGGAGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:GCCGCTCAGAAGCTATTTGC\u003c/p\u003e \u003cp\u003eR:GCCTCCTGTCCTCTAGTAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCpt1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCAGGGCCAGACGATGCTT\u003c/p\u003e \u003cp\u003eR: CGACCGTGCTGCTCAAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:ACCGACGCCATTCCCATA\u003c/p\u003e \u003cp\u003eR:CTGTCCAGAACCTCCACATACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFasn\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTCCCATTGTGCTGTTGTGAC\u003c/p\u003e \u003cp\u003eR: CGGACTCCTGAATATCCAGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:TGCCACTCCTCCATCTTTGA\u003c/p\u003e \u003cp\u003eR:ACGGTTGCTGTAGCCGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eP53\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTTCATCTCATTTCCCAGCATCT\u003c/p\u003e \u003cp\u003eR: GGCTTCTAAACCCCACCCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:GCCTTGAAAAGTCTCCATCTGC\u003c/p\u003e \u003cp\u003eR:TTCTTCCTCCGTTTTGCGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCasp3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGGACGGATGTTGATGCTG\u003c/p\u003e \u003cp\u003eR: TGGTCCTCTTGGGATACACTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TCTTGTGGGGAAACCAAAGC\u003c/p\u003e \u003cp\u003eR: ATAGCCTGAAACGGTGGAGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eb2m / actb\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TACACCCACCAGCCAGGAAA\u003c/p\u003e \u003cp\u003eR: GGACTCGACGACATCGAACATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:CCCAAAGCCAACAGGGAGA\u003c/p\u003e \u003cp\u003eR:CAGAGGCATACAGGGACAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.3.2 Analysis of enzyme activity\u003c/h2\u003e \u003cp\u003eThe visceral tissue (without liver) of both fish was used for enzyme activity analysis. Accurately weighed 1g tissue, added 9 ML 0.1mol/L pH 7.4 phosphate buffer, mechanically homogenized (DIRAD DR-310, Jiangsu, China) under ice bath, centrifuged at 2500 rpm for 10 minutes in a high-speed centrifuge (Eppendorf 5430R, Germany), and extracted the supernatant. The supermatant would be diluted with the phosphate buffer, and for the determination of the following enzymes. Superoxide dismutase (SOD) by the Hydroxylamine method, malondialdehyde (MDA) by the Thiobarbituric acid (TBA) method, α-Amylase (AMS) by the Starch-iodine colorimetric method, lipase (LPS) by the Methyl resorufin substrate method, alkaline phosphatase (AKP) and acid phosphatase (ACP) by the Disodium phenyl phosphate method. The above analysis was carried out using the corresponding reagent kits from Nanjing Jiancheng Biotechnology Institute (Nanjing, China) according to the instructions. The protein content was measure with Coomassie brilliant blue staining (Candiano et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Yuan etal., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.3.3 Analysis of the RNA/DNA ratio\u003c/h2\u003e \u003cp\u003eAccording to Buckly's (1979) analysis method, the RNA/DNA ratio was anaylzed for showing the growth of both species. Take respectively an appropriate amount of muscle tissue from the 4-day and 7-day samples and mix it with Tris buffer (0.05 mol/L, pH\u0026thinsp;=\u0026thinsp;7.4) for homogenization (DIRAD DR-310, Jiangsu, China). Suction 1.4 mL of the homogenization solution and mix it with 0.7 mL of 0.6 mol/L HClO\u003csub\u003e4\u003c/sub\u003e. Cool it on ice bath (BKMAM-Lab VB-1, Hunan, China) for 15 minutes, centrifuge (Eppendorf 5430R, Germany) at 4 ℃ (12000 r/min) for 10 minutes, and then remove the supernatant. Wash the precipitate in 1.12 mL of 0.3 mol/L KOH at 37℃ in water bath for 1 hour and then in ice bath for 30 minutes, and centrifuge again. Take out the supernatant and measure its absorbance value at 260 nm (Mettler UV5 nano, Germany), which was the absorbance value of RNA. At the same time, the precipitate was washed with 2.0 mL 0.2 mol/L HClO\u003csub\u003e4\u003c/sub\u003e, after centrifugation, the supernatant was removed. Then add 2.2 mL of 0.6 mol/L HClO\u003csub\u003e4\u003c/sub\u003e to the precipitate and incubate at 85 ℃ for 15 minutes, followed by an ice bath for 15 minutes. Centrifuge again, the precipitate was protein. Suction the supernatant and measure its absorbance value at 260 nm, which was the absorbance value of DNA. Thus, the ratio of RNA/DNA can be calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.3.4 Analysis of feeding behavior\u003c/h2\u003e \u003cp\u003eOn the 4th and 7th days, 6\u0026ndash;8 individuals of fish were randomly selected from each treatment for observing their feeding behavior. A glass aquarium (L15cm\u0026times;W10cm\u0026times;H13cm) was used for behavioral photography. Two portable cameras (Panasonic VX1, Japan) were placed directly above and in front of the aquarium for recording the feeding behavior, in order to subsequent repeated observation and analysis. The water temperature, salinity, light intensity and other conditions inside the aquarium were the same as the original experimental environment. The specific steps in the entire feeding process were as follows: first, let an individual adapt to the new environment in the aquarium for 60 minutes, and then fed live \u003cem\u003eArtemia\u003c/em\u003e larvae with a density of 1 ind./mL. The cameras started recording 5 minutes before feeding and lasted for 45 minutes. The following 3 parameters of feeding behavior were analyzed in each treatment based on the recorded videos.\u003c/p\u003e \u003cp\u003eFeeding response time (second): the period time elapsed from the entry of \u003cem\u003eArtemia\u003c/em\u003e into the water to the first larvae was swallowed by fish.\u003c/p\u003e \u003cp\u003eFeeding rate (ind./min): The average rate of \u003cem\u003eArtemia\u003c/em\u003e consumed by fish during a 10-minute period from the 11th minute to the 20th minute.\u003c/p\u003e \u003cp\u003eFood intake (individual): The total number of \u003cem\u003eArtemia\u003c/em\u003e consumed by fish throughout the feeding.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Data processing and statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis of experimental data was conducted using SPSS 22.0. Two-way ANOVA was used to examine the effects of salinity changed rates on the growth, feeding behavior, gene expression levels, and enzyme activities of the both fish. T-test was used to analyze the effects of different salinity changes and compare the differences in average values within and between 2 species fish. The data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error, with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicating significant differences. Use GraphPad Prism 8.0 to plot data and statistical results.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Effect on the RNA/DNA ratio\u003c/h2\u003e\n \u003cp\u003eThe variations of RNA/DNA ratio in muscles of \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e at different rates of salinity changes were shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffects of different rates of salinity changes on the RNA/DNA ratio in the experiment\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"6\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTreatment\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSampling time\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCK\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e5H\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e2H\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e(-2ppt)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eseahorse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.849\u0026thinsp;\u0026plusmn;\u0026thinsp;0.250\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.774\u0026thinsp;\u0026plusmn;\u0026thinsp;0.134\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.681\u0026thinsp;\u0026plusmn;\u0026thinsp;0.259\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.259\u0026thinsp;\u0026plusmn;\u0026thinsp;0.284\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.626\u0026thinsp;\u0026plusmn;\u0026thinsp;0.249\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.573\u0026thinsp;\u0026plusmn;\u0026thinsp;0.095\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.345\u0026thinsp;\u0026plusmn;\u0026thinsp;0.177\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.163\u0026thinsp;\u0026plusmn;\u0026thinsp;0.135\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003emadaka\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.237\u0026thinsp;\u0026plusmn;\u0026thinsp;0.283\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.054\u0026thinsp;\u0026plusmn;\u0026thinsp;0.226\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.215\u0026thinsp;\u0026plusmn;\u0026thinsp;0.164\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.904\u0026thinsp;\u0026plusmn;\u0026thinsp;0.250\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.585\u0026thinsp;\u0026plusmn;\u0026thinsp;0.231\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.521\u0026thinsp;\u0026plusmn;\u0026thinsp;0.354\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.233\u0026thinsp;\u0026plusmn;\u0026thinsp;0.379\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.296\u0026thinsp;\u0026plusmn;\u0026thinsp;0.145\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e(+2ppt)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eseahorse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.849\u0026thinsp;\u0026plusmn;\u0026thinsp;0.250\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.712\u0026thinsp;\u0026plusmn;\u0026thinsp;0.346\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.531\u0026thinsp;\u0026plusmn;\u0026thinsp;0.193\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.427\u0026thinsp;\u0026plusmn;\u0026thinsp;0.289\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.626\u0026thinsp;\u0026plusmn;\u0026thinsp;0.329\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.483\u0026thinsp;\u0026plusmn;\u0026thinsp;0.288\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.211\u0026thinsp;\u0026plusmn;\u0026thinsp;0.165\u003csup\u003eac\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.058\u0026thinsp;\u0026plusmn;\u0026thinsp;0.232\u003csup\u003ec*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003emadaka\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.372\u0026thinsp;\u0026plusmn;\u0026thinsp;0.283\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.542\u0026thinsp;\u0026plusmn;\u0026thinsp;0.252\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.445\u0026thinsp;\u0026plusmn;\u0026thinsp;0.276\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.219\u0026thinsp;\u0026plusmn;\u0026thinsp;0.134\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7d\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.585\u0026thinsp;\u0026plusmn;\u0026thinsp;0.231\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.716\u0026thinsp;\u0026plusmn;\u0026thinsp;0.350\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.503\u0026thinsp;\u0026plusmn;\u0026thinsp;0.158\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.427\u0026thinsp;\u0026plusmn;\u0026thinsp;0.271\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\"\u003eNote: Different lowercase letters indicated significant differences in the same species among different rate groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), * indicated there was a significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between the 4d and 7d of the same species.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eUnder 2ppt amplitude, there were no any effect on the growth of \u003cem\u003eO. melastigma\u003c/em\u003e in all treatments. However, the growth changes was obvious in \u003cem\u003eH. kuda\u003c/em\u003e, the RNA/DNA ratios gradually decreased with the increasing rates on the 4th day. Among all treatments, the ratios in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 were the lowest. On the 7th day, the effect was further serious, there were 4 treatments of 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 and 2H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 had a significant difference with CK (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The difference was more obvious in the treatments with increased salinity than in decreased salinity, eg. the ratio in 0H\u0026thinsp;+\u0026thinsp;2 was lower than in 0H-2 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) on the 7th day. More than this, there also was a significant decrease (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to the 4th day\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Effect on feeding behavior\u003c/h2\u003e\n \u003cp\u003eThe variations of feeding behavior in both fish under different rates were shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003eCompared with CK, the feeding response time of \u003cem\u003eH. kuda\u003c/em\u003e was prolonged only in 0H-2 treatment on the 4th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and returned to normal on the 7th day. There was a significant difference between the two days (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). There also was a significant difference between 0H\u0026thinsp;+\u0026thinsp;2 and CK on the 7th day(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The feeding rate of \u003cem\u003eH. kuda\u003c/em\u003e also showed an obvious decrease in 0H\u0026thinsp;+\u0026thinsp;2 treatment on the 4th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and it decreased in all treatments on the 7th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Only 2 treatments of 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 was a significant difference between the two days (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The food intake decreased obviously (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in all treatments of \u003cem\u003eH. kuda\u003c/em\u003e (except 5H-2) on the 4th day, but all (except 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2) had recovered on the 7th day. Nevertheless, the feeding response time of \u003cem\u003eO. melastigma\u003c/em\u003e had little effect during the experiment, slightly increased in 0H\u0026thinsp;+\u0026thinsp;2 treatment. And only 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 treatments showed a decrease in the feeding rate on the 4th day(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and returned to normal on the 7th day. All treatments of \u003cem\u003eO. melastigma\u003c/em\u003e were not affected their food intake with the salinity changes (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). So, compared to \u003cem\u003eO. melastigma\u003c/em\u003e, \u003cem\u003eH. kuda\u003c/em\u003e had no effect on feeding behavior only happened in the treatments with low rates of salinity changes. Based on the measurement results, it was preliminarily determined that the critical safe rate was about 1 ppt/h for \u003cem\u003eH. kuda\u003c/em\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 Effects of physiological and biochemical indicators\u003c/h2\u003e\n \u003cp\u003eThe variations of several enzymes activities (SOD, MDA, AMS, LPS, AKP, and ACP) in \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e were shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003eCompared with CK, the SOD activity and MDA content, 2 indicators reflected oxidative stress, increased in most treatments of \u003cem\u003eH. kuda\u003c/em\u003e on the 4th day, and were even higher on the 7th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), eg. SOD in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 and MDA in all treatments. AMS and LPS, 2 digestive enzymes, the AMS activity showed a significant increase (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in 0H\u0026thinsp;+\u0026thinsp;2 on the 4th day and in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 on the 7th day. The most significant variation was observed in 0H-2, with a significant difference between the two days (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The LPS activity varied in different treatments on the 4th and 7th day, with weak trend. AKP and ACP, 2 immune-related enzymes, the AKP activity showed an increase in most treatments on the 4th day, while ACP decreased in most treatments (except 5H-2) at the same time. On the 7th day, AKP in 5H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 and 2H-2 had dropped, but it continued to rise in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 and 2H\u0026thinsp;+\u0026thinsp;2. While the ACP activity was elevated in most treatments (except 5H-2) on the 7th day. There was a significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) about both AKP and ACP activities between the 4th and 7th days in the same treatment.\u003c/p\u003e\n \u003cp\u003eCompared with CK, the SOD activity showed a significant increase (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in all treatments of \u003cem\u003eO. melastigma\u003c/em\u003e on the 4th day, and then rapidly decreased and returned to normal on the 7th day. The DMA content only showed a significant increase in 2H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 and 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 treatments on the 4th day, and remained high content on the 7th day. The AMS activity was also high in all treatments on the 4th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and basically returned to normal on the 7th day too. The LPS activity showed little change on the 4th day, then had significantly increased on the 7th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). On the 4th day, AKP showed an increase in the treatments with decreased salinity (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but showed little change in the increased salinity treatments. On the 7th day, only 2H-2 and 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 treatments maintained their high AKP activities. The ACP activity in all treatments was higher than the control on the 4th day (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but only 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 remained high on the 7th day (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Compared to \u003cem\u003eH. kuda\u003c/em\u003e, all enzymes in \u003cem\u003eO. melastigma\u003c/em\u003e responded quickly and also returned to normal quickly.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 Effects on related gene expression\u003c/h2\u003e\n \u003cp\u003eThe variations of the relative expression levels of several genes in \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e were shown in Figs. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026thinsp;~\u0026thinsp;Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.1 Stress-related genes\u003c/h2\u003e\n \u003cp\u003eCompared with CK, 2 genes related to oxidative stress, \u003cem\u003eSod1\u003c/em\u003e and \u003cem\u003eHsp70\u003c/em\u003e, showed their various expression levels in different treatments (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). \u003cem\u003eSod1\u003c/em\u003e was up-regulated positively only in 2H\u0026thinsp;+\u0026thinsp;2 and 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 treatments of \u003cem\u003eH. kuda\u003c/em\u003e at 12h (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Its expression level further increased in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 at 96h, there was a significant difference between them (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The expression level of \u003cem\u003eHsp70\u003c/em\u003e increased rapidly in most treatments (except 0H-2) at 12h, and then sharply decreased at 96h, wihch was significantly lower than that in CK (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Similarly, the \u003cem\u003eSod1\u003c/em\u003e expression in \u003cem\u003eO. melastigma\u003c/em\u003e also showed a rapid up-regulation at 12h (except 5H-2), but only 2H-2 still showed an increase at 96h, 2H\u0026thinsp;+\u0026thinsp;2 and 5H\u0026thinsp;+\u0026thinsp;2 had quickly fallen back to the control level, and other treatments remained similar to 12h. \u003cem\u003eHsp70\u003c/em\u003e also showed a rapid up-regulation in most treatments at 12h, then rapidly declined at 96h. The expression level was still higher only in 0H\u0026thinsp;+\u0026thinsp;2 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Overall, the \u003cem\u003eSod1\u003c/em\u003e response in \u003cem\u003eH. kuda\u003c/em\u003e was slower than it in \u003cem\u003eO. melastigma. Hsp70\u003c/em\u003e had a rapid up-regulation response in both fish, but it fell back faster in \u003cem\u003eH. kuda\u003c/em\u003e.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.2 Energy metabolic-related genes\u003c/h2\u003e\n \u003cp\u003eFour metabolic-related genes, \u003cem\u003eMdh1\u003c/em\u003e and \u003cem\u003eLdha\u003c/em\u003e related to glucose metabolism, as well as \u003cem\u003eFasn\u003c/em\u003e and \u003cem\u003eCpt1\u003c/em\u003e related to lipid metabolism, were analyzed.\u003c/p\u003e\n \u003cp\u003eCompared with CK, \u003cem\u003eMdh1\u003c/em\u003e was rapidly down-regulated in all treatments of \u003cem\u003eH. kuda\u003c/em\u003e at 12h (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). And then, \u003cem\u003eMdh1\u003c/em\u003e was up-regulated in all treatments (except 0H\u0026thinsp;+\u0026thinsp;2) and its experssion level was higher than that in CK at 96h. Conversely, \u003cem\u003eLdha\u003c/em\u003e was rapidly up-regulated at 12h, then was down-regulated in almost treatments at 96h, only maintained a relatively high expression level in 0H-2. In \u003cem\u003eO. melastigma\u003c/em\u003e, \u003cem\u003eMdh1\u003c/em\u003e showed a rapid up-regulation response only in 2H-2 and 5H-2, while \u003cem\u003eLdha\u003c/em\u003e showed a rapid up-regulation only in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 at 12h. At 96h, only 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 showed its obvious up-regulation of \u003cem\u003eMdh1\u003c/em\u003e, with several times higher than CK (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). \u003cem\u003eLdha\u003c/em\u003e had a continuous up-regulation epxression only in 0H-2, and its expression levels in other treatments were either lower or similar to it in CK (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). So, there was a significant difference in their expressions of 2 sugar metabolism-related genes between \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e. Both genes showed almost synchronous up-regulation or inhibition in its all treatments of \u003cem\u003eH. kuda\u003c/em\u003e, but they only showed their responses under acute stress in \u003cem\u003eO. melastigma\u003c/em\u003e.\u003c/p\u003e\n \u003cp\u003eCompared with CK, \u003cem\u003eFasn\u003c/em\u003e had an up-regulated expression in all treatments with increased salinity, and \u003cem\u003eCpt1\u003c/em\u003e was also upregulated in all treatments of \u003cem\u003eH. kuda\u003c/em\u003e at 12h. Only 3 treatments (2H-2 and 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2) showed the up-regulation of \u003cem\u003eFasn\u003c/em\u003e, and only the 0H\u0026thinsp;+\u0026thinsp;2 treatment remained up-regulated in the experssion of \u003cem\u003eCpt1\u003c/em\u003e At 96h. There was a significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in their expression levels of \u003cem\u003eFasn\u003c/em\u003e and \u003cem\u003eCpt1\u003c/em\u003e between 12h and 96h in all treatments (except 5H-2) of \u003cem\u003eH. kuda\u003c/em\u003e. In \u003cem\u003eO. melastigma\u003c/em\u003e, \u003cem\u003eFasn\u003c/em\u003e was up-regulated in 0H-2 and increased-salinity treatments, and \u003cem\u003eCpt1\u003c/em\u003e was also up-regulated in all treatments at 12h. At 96h, \u003cem\u003eFasn\u003c/em\u003e still had a high expression level in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2, and the high expression level of \u003cem\u003eCpt1\u003c/em\u003e also appeared in these 2 treatments (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). By comparison, the lipid metabolism responses of \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e were similar under rapid salinity changes.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec18\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.3 Apoptosis and immune-related genes\u003c/h2\u003e\n \u003cp\u003eThe variations of relative expression levels of 2 genes related to cell apoptosis and immunity, \u003cem\u003eP53\u003c/em\u003e and \u003cem\u003eCasp3\u003c/em\u003e, were shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. Compared with CK, almost treatments of \u003cem\u003eH. kuda\u003c/em\u003e showed down-regulation of \u003cem\u003eP53\u003c/em\u003e at 12 h. On the contrary, almost treatments showed up-regulation of \u003cem\u003eCasp3\u003c/em\u003e at the same time. The expression level of \u003cem\u003eP53\u003c/em\u003e at 96 h was similar to that at 12 h in 5H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and increased in the other treatments (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) at 96h. \u003cem\u003eCasp3\u003c/em\u003e showed upregulations in all treatments at 96 h, and their expression levels were higher than that of CK (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In \u003cem\u003eO. melastigma\u003c/em\u003e, the expression levels of \u003cem\u003eP53\u003c/em\u003e only in 0H\u0026thinsp;\u0026plusmn;\u0026thinsp;2 were higher than that in CK at 12 h, while the expression levels of \u003cem\u003eCasp3\u003c/em\u003e in all treatments were higher than that in CK (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). At 96 h, the expression levels of \u003cem\u003eP53\u003c/em\u003e in all treatments with salinity increased were higher than that in CK. And all \u003cem\u003eCasp3\u003c/em\u003e returned below or close to the control at 96h (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). By comparison, the immune response of \u003cem\u003eH. kuda\u003c/em\u003e was slower than that of \u003cem\u003eO. melastigma\u003c/em\u003e to the stress.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e4.1 Effects on growth\u003c/h2\u003e \u003cp\u003eSalinity changes can directly disrupt the inside and outside ion balance of aquatic animals, leading to fluctuation in their osmotic pressure. The osmotic pressure balance of fish involved a series of energy consuming processes such as cell differentiation, protein synthesis, and ion transmembrane transport, and so on (Lushchak, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), which can have a negative impact on the stress response, energy metabolism, immune regulation, and other processes of fish (Lushchak, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). In the long-term adaptation process to the osmotic stress, fish usually make energy concessions in life processes such as growth, development, and reproduction to resist the stress, thereby changing the normal growth status, physiological, biochemical, and behavioral performance, and causing individual growth stagnation or even death (Lushchak, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Kultz et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). For example, Xiong et al., (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported the rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) were significantly lower in the RNA/DNA ratio, specific growth rate, and food conversion efficiency under the stresses of rapid salinity changes than those of the control group. In this study, the RNA/DNA ratio of \u003cem\u003eH. kuda\u003c/em\u003e on 4d and 7d gradually decreased with increasing rates, indicating that the growth of \u003cem\u003eH. kuda\u003c/em\u003e was also negatively affected by rapid salinity changes (Xu and Sun, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). However, the tolerance of different aquatic organisms was different to salinity changes. The growth of \u003cem\u003eO. melastigma\u003c/em\u003e was not significantly affected by salinity changes, and there was also no significant change with prolonged stress time in this study. Based on this, it was speculated that the growth of \u003cem\u003eO. melastigma\u003c/em\u003e under the same conditions was more stable, and its adaptability to salinity changes may also be stronger than \u003cem\u003eH. kuda\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e4.2 Effects on feeding\u003c/h2\u003e \u003cp\u003eThe feeding behavior of fish can reflect their physiological status, appetite, and energy demand, and was a common indicator used for evaluating fish stress response (Wang et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). For example, the food intake of \u003cem\u003eHeteropneustes fusilis\u003c/em\u003e significantly decreased under the stress of low salinity, which had a strong impact on normal physiological functions (Bal et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this study, a similar phenomenon was observed in \u003cem\u003eH. kuda\u003c/em\u003e, whose feeding response time increased significantly and food intake decreased significantly in the treatments with direct input. Zhang et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) also observed that the feeding rate and the food intake of juvenile \u003cem\u003eH. kuda\u003c/em\u003e gradually decreased with the increasing salinity amplitude. It was consistent with the results obtained in this study. This indicated that rapid salinity changes could have a significant impact on the feeding behavior of \u003cem\u003eH. kuda\u003c/em\u003e, which may reflect an epigenetic signal that its internal environmental homeostasis was being severely affected. However, the effect of salinity stress on the feeding response time, feeding rate, and food intake of \u003cem\u003eO. melastigma\u003c/em\u003e was not significant under the same conditions. This further indicated that the adaptability of \u003cem\u003eO. melastigma\u003c/em\u003e to salinity rapid changes was stronger.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e4.3 Effects on enzyme activities\u003c/h2\u003e \u003cp\u003eThe MDA content can reflect the degree of oxidative stress that organisms were subjected to, while the SOD activity can reflect the ability of organisms to resist stress and maintain normal physiology (Pan et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). For example, the juvenile \u003cem\u003eEpinephelus coioides\u003c/em\u003e was subjected to salinity stress, which led to an increase in MDA content in cells. However, the activities of corresponding antioxidant enzymes (SOD, CAT) were also significantly increased, they enhanced the antioxidant defense ability and maintained a low level of oxidative stress, demonstrating strong tolerance to salinity stress (Cheng et al., 2023). In this study, the MDA content in each treatment of \u003cem\u003eH. kuda\u003c/em\u003e was significantly increased, and \u003cem\u003eO. melastigma\u003c/em\u003e also showed a significant increase in the treatments with direct input, indicating that all rates of salinity changes can force an increase in oxidative stress levels and cell damage in \u003cem\u003eH. kuda\u003c/em\u003e, while \u003cem\u003eO. melastigma\u003c/em\u003e only had a risk under acute stress. With the prolongation of stress time, the SOD activity and MDA content in \u003cem\u003eO. melastigma\u003c/em\u003e returned to similar levels as the control, while they increased further in \u003cem\u003eH. kuda\u003c/em\u003e, indicating a deeper degree of oxidative damage in \u003cem\u003eH. kuda\u003c/em\u003e. Therefore, its antioxidant defense ability was still in a continuous upward stage (Pan et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). On the contrary, \u003cem\u003eO. melastigma\u003c/em\u003e had completed adaptive regulation to the stress.\u003c/p\u003e \u003cp\u003eThe salinity changes also had a significant impact on AMS and LPS activities of \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e. From the results, it can be seen that both fish coped with excessive energy consumption by increasing the activities of digestive enzymes, thereby increasing the assimilation efficiency of foodborne sugars and lipids (Tan et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). After a prolonged period of stress, energy supplementation became unsustainable from carbohydrates, leading to an increase in lipid consumption and LPS activity (Tan et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). But the performance was different between the 2 fish. \u003cem\u003eH. kuda\u003c/em\u003e always maintained a relatively high level of AMS activity, while \u003cem\u003eO. melastigma\u003c/em\u003e had a higher level of LPS activity on the 7th day. It indicated the main energy source in \u003cem\u003eO. melastigma\u003c/em\u003e had shifted to lipid metabolism, while \u003cem\u003eH. kuda\u003c/em\u003e was still dominated by carbohydrate in the later stage of the experiment. Carbohydrates are short-life energy substances that rapidly decompose through the action of AMS. Lipids, on the other hand, are long-life energy substances that decompose through the action of LPS. Obviously, the energy supply of \u003cem\u003eO. melastigma\u003c/em\u003e was more secure than that of \u003cem\u003eH. kuda\u003c/em\u003e.\u003c/p\u003e \u003cp\u003ePhosphatase activity was commonly used to measure the immune status of organisms. For example, The activities of ACP and AKP in juvenile \u003cem\u003eLateolabrax maculatus\u003c/em\u003e (Wang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and juvenile \u003cem\u003eRachycentron canadum\u003c/em\u003e (Feng et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) were significantly inhibited in the early stage of acute low salt stress, and then significantly increased with prolonged stress time. However, the rapid changes in salinity did not have a significant impact on the ACP and AKP activities of juvenile \u003cem\u003eLeuronectes yokohama\u003c/em\u003e (Cui et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The occurrence of this phenomenon indicated that there were significant differences in immune regulatory mechanisms and adaptive abilities among different species (Cui et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In this study, the trend of changes in AKP and ACP activities in \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e was basically consistent, indicating that rapid changes in salinity may have some similarities in the non-specific immune response regulation process involving ACP and AKP in \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e to some extent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e4.4 Effects on the expression of genes\u003c/h2\u003e \u003cp\u003eThe liver is an important site involved in the regulation of metabolism and osmotic pressure in fish, playing an important role in maintaining osmotic pressure balance and normal physiological activity (Legouis et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The expression of \u003cem\u003eLdha\u003c/em\u003e in the liver of \u003cem\u003eH. kuda\u003c/em\u003e gradually increased with the changed rates at the beginning of the experiment, while \u003cem\u003eMdh1\u003c/em\u003e showed a downward trend, indicating that \u003cem\u003eH. kuda\u003c/em\u003e may be in a state of hypoxia at this time, and the aerobic metabolism of liver glycogen was inhibited, because the expressed upregulation of \u003cem\u003eLdha\u003c/em\u003e increased the synthesis level of lactate to compensate for the inhibited aerobic metabolism (Cao et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). With the prolongation of stress time, the expression level of \u003cem\u003eLdha\u003c/em\u003e would be significantly downregulated, and \u003cem\u003eMdh1\u003c/em\u003e would be significantly upregulated in \u003cem\u003eH. kuda\u003c/em\u003e, indicating that the hypoxia situation was alleviated at this time. The hepatic glycogen metabolism strategy was once again adjusted to promote aerobic metabolism (Ruan et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), providing energy for osmotic pressure regulation. Under the same conditions, there was no significant difference in the expression level of \u003cem\u003eLdha\u003c/em\u003e among all treatments, indicating that \u003cem\u003eO. melastigma\u003c/em\u003e may not have experienced hypoxia during the adaptation process. The expression level of \u003cem\u003eMdh1\u003c/em\u003e in \u003cem\u003eO. melastigma\u003c/em\u003e was significantly upregulated in the early stage of stress, and then significantly downregulated, indicating an increase in its sugar aerobic metabolism level during the early stage, providing energy for osmotic pressure regulation (Zhu et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Subsequently, \u003cem\u003eO. melastigma\u003c/em\u003e adapted to the stress, and as a result, aerobic metabolism gradually returned to normal. It was speculated that at this time, the sugar metabolism regulation of \u003cem\u003eO. melastigma\u003c/em\u003e may have shifted from passive regulation to active adaptation (Takvam et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Similar studies had reported, the activities and expression levels of anaerobic metabolic enzymes, such as phosphofructose kinase, pyruvate kinase, and lactate dehydrogenase were significantly increased in the liver of hard clams (\u003cem\u003eMercenaria mercenaria\u003c/em\u003e) under hypoxic conditions, indicating that anaerobic metabolism under hypoxic conditions may play a key role in the energy regulation of hard clams (Hu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFatty acid synthase (FASN) was the main enzyme in the fatty acid breakdown pathway (Cheng et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). For example, several genes expressed in the liver of \u003cem\u003eScophthalmus maximus\u003c/em\u003e (Liu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and \u003cem\u003eTrachinotus carolinus\u003c/em\u003e (Bradshaw et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) were significantly enriched in multiple lipid metabolism related pathways under salinity stresses, indicating that the salinity stress may have a significant impact on lipid metabolism in liver of fish. The juvenile rainbow trout, had a weak adaptability to salinity, adapted to sudden increases in environmental salinity by increasing the level of lipid synthesis (Xiong et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and so on. In this study, the expression level of \u003cem\u003eFasn\u003c/em\u003e gene in \u003cem\u003eH. kuda\u003c/em\u003e was significantly up-regulated at 96 h under rapid salinity changes, indicating that the osmotic pressure balance in \u003cem\u003eH. kuda\u003c/em\u003e was affected with prolonged stress time. The increase in lipid synthesis levels may be one of the important means for \u003cem\u003eH. kuda\u003c/em\u003e to cope with rapid salinity changes and improve its ability to adapt to the stress (Bin, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In summary, changes in salinity under the same conditions may have a greater impact on the lipid metabolism in \u003cem\u003eH. kuda\u003c/em\u003e than in \u003cem\u003eO. melastigma\u003c/em\u003e. Therefore, the energy demand of \u003cem\u003eH. kuda\u003c/em\u003e for compensating for osmotic regulation may be higher than that of \u003cem\u003eO. melastigma\u003c/em\u003e (Lassoued et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In addition, changes in environmental salinity can trigger oxidative stress, during this period, the activity of antioxidant enzymes also changed correspondingly in fish's oxidative defense system (Seon et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Ding et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). So, the expression levels of \u003cem\u003eSod1\u003c/em\u003e were significantly increased in \u003cem\u003eO. melastigma\u003c/em\u003e and \u003cem\u003eH. kuda\u003c/em\u003e at 12h and 96h, respectively. It was speculated that there may be a certain difference in the response time of the oxidative defense system between \u003cem\u003eH. kuda\u003c/em\u003e and \u003cem\u003eO. melastigma\u003c/em\u003e (Madeira et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChanges in salinity can also promote a significant upregulation of \u003cem\u003eCasp3\u003c/em\u003e expression, leading to oxidative stress and cell damage in liver, and activating the antioxidant system (Lee et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this study, the expression of \u003cem\u003eCasp3\u003c/em\u003e in \u003cem\u003eH. kuda\u003c/em\u003e was significantly up-regulated with the increase of salinity changed rates at 12 h, indicating a significant increase in the risk of cell apoptosis in the liver of \u003cem\u003eH. kuda\u003c/em\u003e (Chu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). With the prolongation of stress time, the expression level of \u003cem\u003eCasp3\u003c/em\u003e in \u003cem\u003eO. melastigma\u003c/em\u003e was no different with CK at 96 h, indicating a significant reduction in the possibility of cell apoptosis in the liver of \u003cem\u003eO. melastigma\u003c/em\u003e. At this time, the oxidative stress response induced by salinity stress in \u003cem\u003eO. melastigma\u003c/em\u003e was likely to have returned to normal. So, compared to \u003cem\u003eO. melastigma\u003c/em\u003e, salinity changes may cause more severe cell damage and higher levels of cell apoptosis in \u003cem\u003eH. kuda\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eCompared with \u003cem\u003eO. melastigma\u003c/em\u003e, the same salinity changes had a greater impact on the feeding behavior of \u003cem\u003eH. kuda\u003c/em\u003e, consumed more energy to resist the stress, and had a more significant impact on growth. The same salinity changes may also cause more severe cell damage and higher levels of cell apoptosis to \u003cem\u003eH. kuda\u003c/em\u003e, resulting in a decrease in non-specific immune ability and a increase in risk of disease. Furthermore, the metabolic regulation mechanism of \u003cem\u003eO. melastigma\u003c/em\u003e may be more efficient than that of \u003cem\u003eH. kuda\u003c/em\u003e, with the more sufficient and long-lasting energy supply for stress resistance.\u003c/p\u003e\n\u003cp\u003eBased on the biological characteristics of \u003cem\u003eH. kuda,\u0026nbsp;\u003c/em\u003eits precise aquaculture technique needs a stricter and more precise control of environmental salinity to prevent rapid and big salinity changes from affecting the growth and survival.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe studies involving animals were reviewed and approved by by the Ethics Committee on Animal Research of Ningbo University. All experimental procedures complied with the Standard Operation Procedures(SOPs) of the Guide for Use of Experimental Animals of Ningbo University.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003ePan.Lin. and Zhang. wrote the main manuscript text and figures.Xu gave method guidance\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBal A, Pati SG, Panda F, Mohanty L, Paital B. Low salinity induced challenges in the hardy fish \u003cem\u003eHeteropneustes fossilis\u003c/em\u003e, future prospective of aquaculture in near coastal zones[J]. Aquaculture, 2021, 543: 737007.\u003c/li\u003e\n\u003cli\u003eBin WG. Effect of salvianolate therapy on peripheral blood Bcl-2, BAX and Caspase-3 expression in patients with cerebral ischemic stroke and their correlation with neural function[J]. Journal of Hainan Medical University, 2017, 23(9): 1279-1282.\u003c/li\u003e\n\u003cli\u003eBradshaw DJ, Uribe V, King LE, Carlie SP, Gonzalo I, Elizabeth A, Marisol SI, Marty R, Paul SW, Sahar M. Effects of low salinities on growth, fatty acid composition, and transcriptome in Florida pompano (\u003cem\u003eTrachinotus carolinus\u003c/em\u003e) at early developmental stages[J]. Aquaculture, 2023, 563: 738964.\u003c/li\u003e\n\u003cli\u003eBuckly LJ. Relationships between RNA/DNA ratio, prey density, and growth rate in Atlantic cod (\u003cem\u003eGadus morhus\u003c/em\u003e) larvae[J]. Journal Fish Research Board Canada, 1979, 36: 1497- 1502.\u003c/li\u003e\n\u003cli\u003eCao R, Liu Y, Wang Q, Yu FF. Seawater acidification reduced the resistance of \u003cem\u003eCrassostrea gigas \u003c/em\u003eto \u003cem\u003eVibrio splendidus\u003c/em\u003e challenge: an energy metabolism perspective [J]. Frontiers in Physiology, 2018, 9: 880.\u003c/li\u003e\n\u003cli\u003eCandiano G, Bruschi M, Musante L, Santucci L, Ghiggeri G M, Carnemolla B, et al. Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis, 2004. 25 (9), 1327\u0026ndash;1333.\u003c/li\u003e\n\u003cli\u003eCheng CH, Ye CX, Guo ZX, Wang AL. Immune and physiological responses of pufferfish (\u003cem\u003eTakifugu obscurus\u003c/em\u003e) under cold stress [J]. Fish \u0026amp; Shellfish Immunol, 2017, 64: 137-145.\u003c/li\u003e\n\u003cli\u003eCheng YZ. Effects of seawater salinity on growth, physiology and biochemistry of juvenile \u003cem\u003eEpinephelus obliquus\u003c/em\u003e [D]. Nanjing Agricultural University, 2023.\u003c/li\u003e\n\u003cli\u003eChu P, Luo S, Wang H, Zhang C, Wen X, Yin SW, Wang T. Interactive effects of temperature and salinity on the apoptosis, antioxidant enzymes, and MAPK signaling pathway of juvenile pufferfish (\u003cem\u003eTakifugu fasciatus\u003c/em\u003e) [J]. Aquaculture Reports, 2023, 29: 101483.\u003c/li\u003e\n\u003cli\u003eCui QJ, Chen B, Qiu LH, Chen L. The effects of low salt stress on Na\u003csup\u003e+\u003c/sup\u003e/K\u003csup\u003e+\u003c/sup\u003e-ATPase, liver antioxidant enzymes, and non-specific immune enzymes in the gills of juvenile blunt snouted yellow flounder [J]. Journal of Guangdong Ocean University, 2017, 37 (6): 26-32.\u003c/li\u003e\n\u003cli\u003eDing L, Li WH, Li N, Liang LY, Zhang XY, Jin HL, Shi HT, Storey KB, Hong ML. Antioxidant responses to salinity stress in an invasive species, the red-eared slider (\u003cem\u003eTrachemys scripta elegans\u003c/em\u003e) and involvement of a TOR-Nrf2 signaling pathway[J]. Comparative Biochemistry and Physiology Part C: Toxicology \u0026amp; Pharmacology, 2019, 219: 59-67.\u003c/li\u003e\n\u003cli\u003eFeng J, Xu LW, Lin HZ, Dong H. The effect of salinity changes on the immune factors and growth of juvenile cobia fish [J]. Journal of Fishery Sciences of China, 2007, 14 (1): 120-125\u003c/li\u003e\n\u003cli\u003eHe DR, Cai HC. Fish Behavior[M]. Xiamen University Press, 1998.\u003c/li\u003e\n\u003cli\u003eHu Z, Xu L, Song H, Feng J, Zhou C, Yang MJ, Shi P, Li YR, Guo YJ, Li HZ, Zhang T. Effect of heat and hypoxia stress on mitochondrion and energy metabolism in the gill of hard clam[J]. Comparative Biochemistry and Physiology Part C: Toxicology \u0026amp; Pharmacology, 2023, 266: 109556.\u003c/li\u003e\n\u003cli\u003eKultz D, Fiol D, Valkova N, Gomez-Jimenez S, Chan SY, Lee J. Functional genomics and proteomics of the cellular osmotic stress response in \u0026apos;non-model\u0026apos; organisms [J]. Journal of Experimental Biology, 2007, 210(9): 1593-1601.\u003c/li\u003e\n\u003cli\u003eKultz D. Physiological mechanisms used by fish to cope with salinity stress[J]. Journal of Experimental Biology, 2015, 218(12): 1907-1914.\u003c/li\u003e\n\u003cli\u003eLassoued A, Khalloufi N, Saidani W, Khazri A, Ghanem-Boughanmi N, Bouayed J, Ben-Attia M. Effects of increased salinity on oxidative stress status in the freshwater mussel \u003cem\u003eUnio ravoisieri\u003c/em\u003e [J]. Chemistry and Ecology, 2023, 39(3): 256-267.\u003c/li\u003e\n\u003cli\u003eLee DW, Choi YU, Park HS, Park YS, Choi CY. Effect of low pH and salinity conditions on the antioxidant response and hepatocyte damage in juvenile olive flounder \u003cem\u003eParalichthys olivaceus\u003c/em\u003e[J]. Marine Environmental Research, 2022, 175: 105562.\u003c/li\u003e\n\u003cli\u003eLegouis SD, Faivre A, Cippa PE, de Seigneux S. Renal gluconeogenesis: an underestimated role of the kidney in systemic glucose metabolism [J]. Nephrology Dialysis Transplantation, 2020, 37(8): 1417-1425.\u003c/li\u003e\n\u003cli\u003eLiu Z, Ma A, Yuan C, Zhao TT, Chang HW, Zhang JS. Transcriptome analysis of liver lipid metabolism disorders of the turbot \u003cem\u003eScophthalmus maximus\u003c/em\u003e in response to low salinity stress [J]. Aquaculture, 2021, 534: 736273.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;\u003c/sup\u003eCT method[J]. Methods, 2001, 25(4): 402-408.\u003c/li\u003e\n\u003cli\u003eLushchak VI. Environmentally induced oxidative stress in aquatic animals [J]. Aquatic Toxicology, 2011, 101(1): 13-30.\u003c/li\u003e\n\u003cli\u003eMadeira C, Mendonca V, Leal MC, Flores A, Carbral HN, Diniz MS, Vinagre C. Thermal stress, thermal safety margins and acclimation capacity in tropical shallow waters\u0026mdash;An experimental approach testing multiple end-points in two common fish [J]. Ecological Indicators, 2017, 81: 146-158.\u003c/li\u003e\n\u003cli\u003eMontory JA, Pechenik JA, Diederich CM, Chaparro OR. Effects of low salinity on adult behavior and larval performance in the intertidal gastropod \u003cem\u003eCrepipatella peruviana\u003c/em\u003e (Calyptraeidae) [J]. PLoS ONE, 2014, 9(7): e103820.\u003c/li\u003e\n\u003cli\u003eMurata K, Kinoshita M, Kiyoshi N, Tanaka M, Kamer Y. Madaka: Biology, Management, and Experimental Protocols[M]. Wiley Blackwell Press, USA, 2020.\u003c/li\u003e\n\u003cli\u003ePan GP, Liu BW, Zhou WY. The effect of low temperature stress on antioxidant and immune indicators of young grouper[J]. Journal of Shanghai Ocean University, 2016, 25 (1): 78-85.\u003c/li\u003e\n\u003cli\u003ePan X, Sheng X, Zhang WX, Xu YJ. Effects of short-term temperature changes on the physiology, biochemistry and feeding behaviour of the juvenile yellow seahorse[J]. Aquaculture Research, 2022, 53:1084-1097.\u003c/li\u003e\n\u003cli\u003ePan X, Xu YJ, Ning Y, Zhang WX. Effects of temperature stress on genes\u0026rsquo; transcription and expression in juvenile \u003cem\u003eHippocampus kuda\u003c/em\u003e Bleeker[J]. Journal of Nuclear Agricultural Sciences, 2020, 34(7): 1421-1431.\u003c/li\u003e\n\u003cli\u003ePan X. Study on the effects of temperature and salinity on the feeding transition period of juvenile seahorse, \u003cem\u003eHippocampus kuda\u003c/em\u003e[D]. Ningbo University, 2020. \u003c/li\u003e\n\u003cli\u003eRuan S, Lu Z, Huang W, Zhang Y, Shan XJ, Song W, Ji CL. Renal metabolomic profiling of large yellow croaker \u003cem\u003eLarimichthys crocea\u003c/em\u003e acclimated in low salinity waters [J]. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 2023, 46: 101083.\u003c/li\u003e\n\u003cli\u003eSeon PM, Suk SH, Young CC, Choi CY, Kim NN, Lee J. Effect of hypoosmotic and thermal stress on gene expression and the activity of antioxidant enzymes in the cinnamon clownfish, \u003cem\u003eAmphiprion melanopus\u003c/em\u003e [J]. Animal Cells and Systems, 2011, 15(3): 219-225.\u003c/li\u003e\n\u003cli\u003eSzczygieł J, Kaminska-Gibas T, Petit J, Jurecka P, Wiegertjes G, Irnazarow I. Re-evaluation of common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e L.) housekeeping genes for gene expression studies\u0026ndash;considering duplicated genes[J]. Fish and Shellfish Immunology, 2021, 115: 58-69.\u003c/li\u003e\n\u003cli\u003eTakvam M, Wood CM, Kryvi H, Nilson TO. Ion transporters and osmoregulation in the kidney of teleost fishes as a function of salinity [J]. Frontiers in Physiology, 2021, 20: 1-25.\u003c/li\u003e\n\u003cli\u003eTan E, Kinoshita S, Suzuki Y, Ineno T, Tamaki K, Kera A, Muto K, Yada T, Kitamura S, Asakawa S. Different gene expression profiles between normal and thermally selected strains of rainbow trout, \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e, as revealed by comprehensive transcriptome analysis[J]. Gene, 2016, 576(2): 637-643.\u003c/li\u003e\n\u003cli\u003eUrbina MA, Glover CN. Effect of salinity on osmoregulation, metabolism and nitrogen excretion in the amphidromous fish, inanga (\u003cem\u003eGalaxias maculatus\u003c/em\u003e) [J]. Journal of Experimental Marine Biology and Ecology, 2015, 473: 7-15.\u003c/li\u003e\n\u003cli\u003eWang HL, Wen HS, Zhang XY. The effect of salinity stress on the intestinal antioxidant and non-specific immune abilities of juvenile sea bass [J]. Modern Agricultural Technology, 2016, (4): 261-269.\u003c/li\u003e\n\u003cli\u003eWang JQ, Lui H, Po H, Zhang YP. Influence of salinity on food consumption, growth and energy conversion efficiency of common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) fingerlings [J]. Aquaculture, 1997, 148(2): 115-124.\u003c/li\u003e\n\u003cli\u003eWang RP, Dai LL, Chen YF, Xu YJ. Effects of short-term temperature or salinity stress on feeding behavior and antioxidant of marine medaka (\u003cem\u003eOryzias melastigma\u003c/em\u003e)[J]. Oceanologia et Limnologia Sinica, 50(2): 378-388.\u003c/li\u003e\n\u003cli\u003eXiong Y, Dong SL, Huang M, Li Y, Wang X, Wang F, Ma SS, Zhou YG. Growth, osmoregulatory response, adenine nucleotide contents, and liver transcriptome analysis of steelhead trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) under different salinity acclimation methods [J]. Aquaculture, 2020, 520: 734937.\u003c/li\u003e\n\u003cli\u003eXu YJ, Sun B. The effects of salinity stress on the growth, composition, and enzyme activity of \u003cem\u003eHippocampus kuda\u003c/em\u003e juveniles [J]. Oceanologia Et Limnologia Sinica, 2012, 43 (6): 1279-1285.\u003c/li\u003e\n\u003cli\u003eYuan Q, Wu CC, Yang H, Lv WW, Huang WW, Zhang Q, Zhou WZ. Effects of four types of natural bait on water quality, feeding, growth, and antioxidant enzyme activity of Monopterus albus in a recirculating aquaculture system. Frontiers in\u0026ensp;Physiology, 2024, 15, e1403391\u003c/li\u003e\n\u003cli\u003eZhang WX, Pan X, Shen XQ, Xu YJ. The effect of salinity stress on the transcriptional expression of genes in juvenile \u003cem\u003eHippocampus kuda\u003c/em\u003e [J]. Acta Hydrobiologica Sinica , 2021, 45 (5): 995-1004\u003c/li\u003e\n\u003cli\u003eZhu JH, Wang XD, Bu XY, Wang CL, Pan JY, Li EC, Shi QC, Zhang ML, Qin J, Chen LQ. Relationship between myo-inositol synthesis and carbohydrate metabolism changes in Mozambique tilapia (\u003cem\u003eOreochromis mossambicus\u003c/em\u003e) under acute hypersaline stress[J]. Aquaculture, 2021, 532: 736005.\u003c/li\u003e\n\u003cli\u003eZou GF, Xie Y. A study on the survival rate of seahorse seedlings [J]. Chinese herbal medicine, 1989, 12 (3): 15-16.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Hippocampus kuda, Oryzias melastigma, Rapid salinity change, Adaptability and growth, Precision aquaculture","lastPublishedDoi":"10.21203/rs.3.rs-6537500/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6537500/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn order to explore the similarities and differences of responses between Hippocampus kuda and Oryzias melastigma, this study analyzed and compared them from the aspects of growth, behavior, physiology, and gene expression. The results showed that, H. kuda had a greater impact on its feeding behavior compared to O. melastigma at the same rates. And the continuous responses of enzymes indicated there was a more persistent stress in H. kuda, with stress-related genes like Sod1 showing a slower response. Additionally, genes related to sugar and lipid metabolism were significant difference in H. kuda compared to O. melastigma. H. kuda exhibited sensitivity to nearly all treatments, while O. melastigma only responded to treatments of direct input. Furthermore, The responses of immune-related genes in H. kuda was also slower than that in O. melastigma. In summary, the osmotic pressure regulation ability of O. melastigma was more efficient than that of H. kuda to deal with the stress caused by rapid changes in salinity.\u003c/p\u003e","manuscriptTitle":"Comparison of responses to rapid changes in salinity between Hippocampus kuda and Oryzias melastigma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-17 15:06:43","doi":"10.21203/rs.3.rs-6537500/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-27T17:10:41+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-27T16:11:12+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-23T03:01:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"264677338099308399904123284032533363633","date":"2025-06-20T19:10:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"490428557366113221680000679744818713","date":"2025-06-18T00:25:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"92485605322423133621450256203010204450","date":"2025-06-17T04:18:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"209349850381381784732942268327640753207","date":"2025-06-16T06:18:12+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-15T19:05:21+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-14T20:32:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-29T03:11:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Fish Physiology and Biochemistry","date":"2025-04-27T02:28:01+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"84218b2b-3e90-48f1-a151-262f0d58067b","owner":[],"postedDate":"June 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-11T16:06:16+00:00","versionOfRecord":{"articleIdentity":"rs-6537500","link":"https://doi.org/10.1007/s10695-025-01548-1","journal":{"identity":"fish-physiology-and-biochemistry","isVorOnly":false,"title":"Fish Physiology and Biochemistry"},"publishedOn":"2025-08-07 15:57:53","publishedOnDateReadable":"August 7th, 2025"},"versionCreatedAt":"2025-06-17 15:06:43","video":"","vorDoi":"10.1007/s10695-025-01548-1","vorDoiUrl":"https://doi.org/10.1007/s10695-025-01548-1","workflowStages":[]},"version":"v1","identity":"rs-6537500","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6537500","identity":"rs-6537500","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}