Histones present on the surface of late apoptotic cells induce RAGE-mediated phagocytosis

Histones present on the surface of late apoptotic cells induce RAGE-mediated phagocytosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Histones present on the surface of late apoptotic cells induce RAGE-mediated phagocytosis Yuqing Li, Xiaoman Zhou, Yan Yang, Congcong Du, Yi-shi Liu, Zijie Li, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6795867/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Nov, 2025 Read the published version in Cell Communication and Signaling → Version 1 posted 8 You are reading this latest preprint version Abstract The receptor for advanced glycation end products (RAGE) is a multiligand receptor that can induce phagocytosis in both professional and nonprofessional phagocytes. We found that histones are another ligand for RAGE. Binding between histones and RAGE is increased when DNA is attached to histones. While histones are chromosomal proteins in healthy cells, they are exposed to the cell surface as a complex with DNA when cells undergo apoptosis. The phagocytosis of apoptotic cells by either professional or nonprofessional phagocytes is enhanced when histones are present on the surface of apoptotic cells. Thus, histones serve as eat-me signals. In RAGE knockout cells, the phagocytosis of apoptotic cells was not influenced by the removal of histones, indicating that RAGE is required for the removal of histones from histone-presenting cells. In RAGE knockout mice, wound healing and removal of apoptotic cells from wound sites are delayed, suggesting that RAGE-mediated phagocytosis functions under physiological conditions. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Phagocytosis is an endocytic process by which relatively large particles (greater than 0.5 µm in size) are internalized by cells via a receptor-mediated mechanism. Phagocytosis is mediated primarily by professional phagocytes, including macrophages, dendritic cells, and neutrophils [ 1 ]. Because professional phagocytes present various phagocytic receptors, including those for antibodies and complements, they can internalize a variety of particles and macromolecules [ 2 ]. In addition to professional phagocytes, many other types of cells, including epithelial cells and fibroblasts, can perform phagocytosis; these cells are termed nonprofessional phagocytes [ 3 ]. Compared with those of professional phagocytes, the number of phagocytic receptors present in nonprofessional phagocytes is limited. However, they can internalize certain particles, such as apoptotic cells [ 3 – 5 ]. Apoptotic cells are rapidly phagocytosed so that they are removed before the release of proinflammatory cellular components [ 6 ]. Apoptotic cells present unique phagocytic ligands, called “eat-me” signals, that can activate phagocytic receptors [ 7 ]. For example, phosphatidylserine (PS) exposed to the outer leaflet of the plasma membrane in apoptotic cells is known to serve as an “eat-me” signal [ 8 , 9 ]. PS is recognized by multiple phagocytic receptors either directly or indirectly [ 10 ]. Direct PS-recognizing receptors include T-cell immunoglobulin and mucin domain (TIM) family receptors [ 11 ], brain angiogenesis inhibitor 1 (BAI1) [ 12 ], stabilin-1 [ 13 ], stabilin-2 [ 14 ], and receptor for advanced glycation end products (RAGE) [ 15 ]. Apart from apoptotic cells, the efficient clearance of necrotic cells is required for the maintenance of homeostasis in multicellular organisms [ 16 ]. Like apoptotic cells, recognition of necrotic cells by phagocytes is mediated by “eat-me” signals, although much less is known about the signaling molecules and corresponding receptors involved in the removal of necrotic cells compared to those involved in the process of apoptotic cell removal [ 16 ]. RAGE is a member of the immunoglobulin superfamily proteins and was originally identified as an advanced glycation end products (AGE)-recognizing receptor that induces proinflammatory signaling [ 17 , 18 ]. This receptor is known to bind multiple ligands, including high mobility group box 1 (HMGB1), polynucleotides, and S100 proteins, PS, and AGE. Prolonged activation of RAGE causes chronic inflammation [ 19 ], which is involved in the progression of various disorders [ 20 – 22 ]. In addition to its ability to induce proinflammatory signals, RAGE can induce phagocytosis in both professional and nonprofessional phagocytes [ 15 ]. In professional phagocytes, RAGE has been shown to induce the clearance of apoptotic cells by binding to PS [ 15 , 23 ]. In a previous study, we reported that particles bound to histones are targeted for RAGE-mediated phagocytosis [ 23 ], suggesting that histones are another ligand for RAGE. Histones are components of chromatin, but they can be released from cells by cell lysis or by the formation of neutrophil extracellular traps (NETs) [ 24 ]. Extracellular histones exhibit harmful effects: they can damage the plasma membrane by direct binding as well as serve as damage-associated molecular patterns (DAMPs) that activate proinflammatory signaling pathways [ 25 ]. TLR2, TLR4, and TLR9 are receptors that have been reported to recognize extracellular histones [ 26 , 27 ]. Intriguingly, several reports have shown that histones are also present on the surface of late apoptotic cells [ 28 , 29 ]. A previous study reported that cell surface histones are targeted by the opsonin ApoJ, which is known to induce phagocytosis by binding to LDL receptor-related protein (LRP) [ 30 , 31 ]. In the present study, we demonstrated that cell surface histones are direct targets for RAGE-mediated phagocytosis. Histone-induced and RAGE-mediated phagocytosis is involved in the clearance of dead cells under physiological conditions, such as during the wound repair process. Materials and methods Cells HEK293, HEK293T and Jurkat cells were obtained from American Type Culture Collection (ATCC). RAGE −/− HEK293T cells were generated as described before [ 23 ]. HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Biological Industries) containing 10% (v/v) fetal calf serum (FCS) (Biological Industries). FCS was inactivated by incubation at 56°C for 45 min before addition to media. Jurkat cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 (Biological Industries) containing 10% (v/v) FCS. Jurkat cells stably expressing Green fluorescent protein (GFP) were cultured in RPMI 1640 containing 10% (v/v) FCS and 5 µg/ml blasticidin (InvivoGen). Mouse thymocytes were cultured in RPMI1640 medium containing 10% (v/v) FCS and 1% (v/v) penicillin-streptomycin solution (Beyotime). Primary lung epithelial cells were cultured in DMEM/F-12 medium containing 10% (v/v) FCS and 1% (v/v) penicillin-streptomycin solution, peritoneal macrophages were cultured in RPMI 1640 containing 10% (v/v) FCS and 1% (v/v) penicillin-streptomycin solution. All cells were maintained at 37°C in a humidified atmosphere with 5% CO 2 . Mice Ager +/− C57BL/6 mice purchased from Saiye Biology were bred at 6 to 10 weeks of age. The mice were housed in the specific pathogen free facility at the Experimental Animal Center of Jiangnan University. The housing conditions are as follows: the light time is 8:00–20:00, the temperature is 18–22°C and the relative humidity is 40–70%. Animal care and handling procedures comply with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and are approved by the Ethics Committee of the Laboratory Animal Center of Jiangnan University. Mouse genotypes were determined by PCR using primers Ager-F1, Ager-R1, and Ager-R2 (Supplementary Table 1). Plasmids All the oligo DNAs and plasmids used in this study are listed in Supplementary Tables 1 and 2, respectively. For the CRISPR-Cas9 system used to knockout target genes, guide RNA sequences were designed using the E-CRISP website (RRID:SCR‒019088), and the corresponding DNA fragments were ligated into the Bpi I-digested vector pX330EGFP-hU6-gRNA-hSpCas9 [ 32 ]. The RAGE DNA fragments were amplified from cDNA derived from HEK293T cells and cloned into pME-Hyg-3FLAG [ 33 ]. pLIB2-mEGFP-BSD was used to make Jurkat cells stably expressing GFP. The GFP (mEGFP) was digested out of pME-mEGFP [ 23 ]. Transfection For transient transfection, cells were grown to 60% confluence in 6 cm plates and transfected with plasmid DNA (5 µg/well) using Lipofectamine 8000 (Beyotime) according to the manufacturer’s instructions. Retrovirus-based transfection was performed as described previously [ 34 ] to construct Jurkat cells stably expressing GFP. HEK293T cells (10 6 ) were transfected with 1 µg pGP, 1 µg pLC-VSVG, and 2 µg pLIB2-mEGFP-BSD using Lipofectamine 8000. After 36 h of incubation, the medium was filtered with a 0.22 µm filter and mixed with the same amount of DMEM supplemented with 16 µg/ml hexadimethrine bromide (Sigma‒Aldrich). The medium containing retrovirus was incubated with Jurkat cells overnight. After 5 days of culture, the cells expressing GFP were sorted using a cell sorter S3e (Bio‒Rad). Assays for RAGE and histones or DNA–histone binding HEK293 cells were grown to approximately 70% confluence in 6 cm plates. The plasmids pME-RAGE 124–341 -His-FLAG or pME-RAGE 23–341 -His-FLAG were transfected into HEK293 cells. After two to three days of incubation, the medium was centrifuged at 3000 × g for 3 min at 4°C. The supernatant was loaded onto Ni NTA beads (Smart Life Sciences). His- and FLAG-tagged proteins were eluted with 400 mM imidazole. Subsequently, the anti-FLAG M2 affinity agarose gel (Sigma‒Aldrich) was added to the eluate and incubated for 3 h at 4°C with rotation. The agarose gel was washed with PBS (Sangon Biotech) three times and suspended in PBS. Two hundred microlitres of the agarose gel suspension was mixed with 1 mg/ml purified histone complex (Sangon Biotech) or 10 µg/µl recombinant histone H3C1 (Sangon Biotech). The final concentration of histones in the mixture was 20, 50, or 100 µg/µl, and the final concentration of recombinant H3C1 in the mixture was 1 µg/µl. The mixture was incubated at 4°C for 0.5 h. After washing three times with PBS, the agarose gel was suspended in 40 µl of PBS, 10 µl of 5 × SDS‒PAGE loading buffer (250 mM Tris-HCl pH 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, and 5% ß-mercaptoethanol) was added, and the mixture was subjected to western blotting. To prepare the DNA-histone complex and DNA-histone H3.1, 1 nmol of a single-stranded 22-nt DNA (GTGCCAGATCGGGGTTCAATTC) fragment was incubated in 100 µl of 100 µg/µl histone or 100 µl of 1 µg/µl recombinant histone H3C1. Induction of apoptosis in Jurkat cells and thymocytes Jurkat cells expressing GFP were resuspended in RPMI 1640 containing 10% FCS at a density of 10 6 /ml. The cells were treated with 1 µM staurosporine (Beyotime) for 4 h or 12 h to induce apoptosis. 1 µl PI solution (Beyotime) was added to 99 µl Jurkat cells and incubated for 5 min. Labelling of Jurkat cells with PKH67 was performed with the PKH67 Green Fluorescent cytomembrane Linker Kit (Solarbio) according to the manufacturer’s instructions. Thymus were harvested from 3 to 4 week-old wild-type C57BL/6 mice and chopped to produce a single-cell suspension. PKH67 Green Fluorescent cytomembrane Linker Kit was used to label thymocytes. To induce apoptosis, mouse thymocytes were re-suspended in RPMI1640 medium containing 10% FCS, 1% (v/v) penicillin-streptomycin solution supplemented with different concentrations of dexamethasone at 10 6 cells/ml at 37°C for 12 h, and their viability was measured by Cell Counting Kit-8 (Sigma‒Aldrich) and the IC50 was calculated as described before [ 35 ]. Detection of apoptotic cells was performed with Apoptosis Detection Kit (Dojindo). Western blot analysis Cells cultured in 6 cm plates were suspended in 500 µl RIPA buffer (Beyotime) supplemented with 5 µl of EDTA-Free proteinase inhibitor cocktails (MCE) and incubated at 4°C for 30 min. Protein concentrations in the supernatants were determined using BCA kit (Beyotime). 10 µg of each supernatant was mixed with 5 × SDS-PAGE loading buffer. After incubation at 100°C for 5 minutes, samples were subjected to 12% SDS-PAGE and transferred to PVDF membranes (Bio‒Rad). The membranes were blocked in 5% milk (Sangon Biotech) in TBST buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.05% (v/v) Tween-20). The following primary antibodies were used: rabbit anti-Caspase-3 (CST, 1:1000); rabbit anti-Cleaved caspase-3 (CST, 1:1000); mouse anti-actin (TransGen Biotech, 1:3000); mouse anti-Flag (TransGen Biotech, 1:5000) and rabbit anti-histone H3 (Abcam, 1: 1000). The membranes were incubated with the appropriate antibodies diluted in primary antibody dilution buffer (Beyotime) overnight at 4°C. After washing with TBST three times, the membranes were incubated with HRP-conjugated secondary antibodies diluted in 5% milk in TBST buffer at room temperature for 1 h and washed three times in TBST buffer. Primary antibodies were detected using the secondary anti-mouse IgG HRP-linked (TransGen Biotech, 1:5000), or anti-rabbit IgG HRP-linked (TransGen Biotech, 1:5000). Signals were detected with ECL Substrate (Bio‒Rad). Images were captured using a Tanon 5200 Automatic Chemiluminescence Image Analysis System. Immunofluorescence Apoptotic Jurakt cells expressing GFP were washed with PBS twice and blocked with 1% bovine serum albumin in PBS for 30 min. The cells were incubated with anti-histone H3 antibody (1: 400) at 4°C for 1 h. Cells were washed with PBS three times, and were incubated with Alexa Fluor 555 donkey anti-rabbit IgG (InvivoGen, 1:1000) at 4°C for 30 min. After wash with PBS twice, the cells were observed under the microscope. Isolation and extraction of primary lung epithelial cells For the purification and culture of primary lung epithelial cells, the lungs were perfused with buffered saline through the right ventricle and carefully resected. Two millilitres of dispase (Beyotime) were dripped into the lungs, followed by the addition of 1% low-melting agarose (Beyotime) and incubated at 37°C for 1 h. After incubation, the lungs were minced and mechanically disrupted by passage through 100 and 70 µm nylon strainers. Single-cell suspensions were washed with PBS containing 1% FBS and 100 units of DNase I (Beyotime) and treated with red blood lysis buffer (Solarbio) at 4°C for 15 min. Then, the cell suspensions were centrifuged at 1000 × g for 5 min, washed twice with PBS, and treated with an APC-conjugated anti-mouse CD45 antibody (BioLegend, 1:200) and an APC/Cy7-conjugated anti-mouse EPCAM antibody (BioLegend, 1:200). CD45-negative and EPCAM-positive cells were collected via BD FACS Aria III, and the collected cells were resuspended in DMEM/F-12 medium supplemented with 10% (v/v) FCS and 1% (v/v) penicillin‒streptomycin solution. A total of 2 × 10 5 cells were cultured in 24-well plates at 37°C. Isolation and preparation of mouse peritoneal macrophages The cells were collected from mice peritoneal lavage after 8 to 10 weeks of age as described previously [ 36 ]. Macrophages (2.5 × 10 5 ) were cultured in 24-well plate in RPMI 1640 medium supplemented with 10% (v/v) FCS and 1% (v/v) penicillin‒streptomycin solution. Cells were cultured in 24-well plates at 37°C, and after 1 h, the cells were washed with the medium to remove non-adherent cells. Treatments of apoptotic cells with enzymes, histones, or antibodies To treat the apoptotic cells with DNase I or proteinase, 2 × 10 7 apoptotic cells were incubated with 3 U of DNase I or 2 U of proteinase (Sigma-Aldrich) in PBS at 37°C for 30 min. Apoptotic cells were washed twice with PBS. Histone (final concentration, 5 µg/µl) or recombinant histone H3C1(final concentration, 5 µg/µl) were added to apoptotic cells and incubated at 4°C for 30 min to perform competitive inhibition assays. For treatment with antibodies, 2 × 10 7 apoptotic cells were incubated with rabbit anti-histone H3 antibody (1: 200) or rabbit IgG monoclonal antibody-isotype control (Abcam, 1: 200) in PBS at 4°C for 30 min and washed twice with PBS. Phagocytosis assays Phagocytosis assays were performed as described previously [ 23 ]. For the microscopy-based phagocytosis assay, round glass cover slips were placed on the bottom of 24-well plates. The cells (1.5 × 10 5 /well) were seeded in the plate and allowed to grow to a density of 2–3 × 10 5 cells/well in 500 µl of media supplemented with 0.025 µl of LysoTracker (Beyotime). Apoptotic Jurkat cells were added to 10 6 apoptotic cells/4–6 × 10 5 HEK293T cells/ml media. The cells were incubated at 37°C for 0.5 or 1 h. Then, the cells were placed on ice and washed twice with PBS, and the intracellular cells were analyzed under a fluorescence microscope. Cells observed in LysoTracker-positive compartments were defined as internalized particles. At least a total of 300 cultured cells were analyzed. A flow cytometry-based phagocytosis assay was performed as described before [ 36 ]. HEK293T cells were seeded in 12-well plates and allowed to grow to a density of 2–6 × 10 5 cells /well. The cells were incubated with 1–3 × 10 6 apoptotic Jurkat cells expressing GFP in a CO 2 incubator at 37°C for 0.5 or 1 h. Then, cells were washed with PBS twice and fixed by 4% paraformaldehyde (PFA) fix solution (Beyotime) for 10 min. For RAGE rescue experiments, wild-type cells were transfected with the pME-His empty plasmid, and RAGE −/− HEK293T cells were transfected with the pME-His empty plasmid or the pME-RAGE-His plasmid. Primary lung epithelial cells and macrophages were cultured in 24-well plates. A total of 10 6 apoptotic thymocytes were added to each well and incubated at 37°C for 0.5 h. The cells were washed with cold PBS to remove uninternalized cells. The cells were treated with trypsin and washed twice with PBS. Then, cells were fixed by 4% PFA fix solution for 10 min. Finally, the samples were washed with PBS and analyzed by Accurf C6 (BD). The data were analyzed using FlowJo V10. To omit apoptotic cells that are present outside of phagocytic cells as a background in the flow cytometry-based phagocytosis assay, anti-CD3 antibody was used to stain apoptotic Jurkat cells. To assay only phagocytes that internalize apoptotic cells. Apoptotic Jurkat cells labeled with GFP or PKH-67 were incubated with phagocytes for 0.5 h. These cells were washed and treated with trypsin as described above. The samples were resuspended in PBS containing 1% albumin and PE-conjugated anti-CD3 antibody. Then, cells were fixed by 4% PFA fix solution and subjected to flow cytometry. The phagocytic index was calculated as the ratio of FITC-positive/PE-negative cells to all cells gated. The samples were analyzed via Accurf C6 (BD). The data were analyzed via FlowJo V10. Microscopy Microscopy images were obtained using a Nikon C2 Eclipse Ti-E inverted microscope with a DS-Ri camera equipped with NIS-Element AR software, and quantification of fluorescence intensity was performed using ImageJ software. Flow cytometry Lung epithelial cells were sort by BD FACS Aria III. Mice skin wound samples were analyzed by Beckman CytoFLEX S. The other samples were analyzed by Accurf C6 (BD). The data was analyzed using FlowJo V10. Generation of skin wounds in mice and analysis of wound tissues Full-thickness punch wounds were made on the backs of the mice as described previously [ 37 ]. The mice were given analgesia and general anaesthesia, the back skin was shaved, the skin was lifted, and a mouse punch with a 3 mm aperture was used to generate wounds on the backs of the mice. Back skin samples of the same size were collected from the mice three days after wounding and incubated overnight with DMEM containing 1% (v/v) penicillin‒streptomycin solution and 200 µg/ml dispase II at 4°C. Small patches of skin were further digested with 1.5 mg/ml IV collagenase (Solarbio) and 10 U DNase I in RPMI 1640 medium supplemented with 2% FCS (v/v) and 1% (v/v) penicillin‒streptomycin solution. The suspension was subsequently resuspended in fresh digestion buffer and incubated at 37°C for 90 min. After incubation, the cell suspension was filtered with 70 µm nylon strainers to remove debris and clots. Neutrophils were sorted via PerCP-conjugated anti-mouse CD45 antibody, FITC-conjugated anti-mouse CD11b antibody (BioLegend, 1: 200), and APC-conjugated anti-mouse Ly-6G antibody (BioLegend, 1: 200). An annexin V-PE/7-AAD Apoptosis Detection Kit (Vazyme Biotech) was used to detect whole apoptotic cells, and an anti-histone H3 antibody was used to analyze cell surface histones. Statistical analysis Each experiment was performed with at least three independent samples. The quantitative data were presented as mean ± standard error (SEM). Differences between the analyzed samples were considered significant at P < 0.05. Statistical significance was determined with two-tailed unpaired Student’s t test calculated with GraphPad Prism 8.4.3 software. Results Histones are ligands of RAGE To verify that histones are ligands of RAGE, binding between the purified histone complex and RAGE was assayed in vitro. For this experiment, the extracellular region of RAGE, termed RAGE 23–341 (Fig. 1 A), was produced by HEK293 cells. The core histone complex purified from bovines was coprecipitated with RAGE 23–341 (Fig. 1 B). RAGE 124–341 is an extracellular region of RAGE lacking the V domain (Fig. 1 A). Compared with RAGE 23–341 , the amount of histone complexes bound to RAGE 124–341 was decreased by 57.8% (Fig. 1 B). These results demonstrate that the histone complex directly binds to RAGE via the V domain. A previous study showed that histone-induced phagocytosis was enhanced when DNA was bound to histones [ 23 ]. Thus, we examined whether the binding between RAGE and the histone complex was improved when DNA was bound to histones. The DNA-bound histone complex, hereafter referred to as the DNA-histone complex, was prepared by the incubation of a single-strand DNA (22 nucleotides) [ 23 ] molecule with the histone complex. As shown in Fig. 1 C, the amount of the histone complex that precipitated with RAGE 23–341 increased when the DNA was bound. We also examined the binding between RAGE 23–341 and recombinant human histone H3.1. Like the purified histone complex, recombinant histone H3.1 was coprecipitated with RAGE 23–342 , and the binding of these proteins decreased when the V domain was removed (Fig. S1 A). The binding of histone H3.1 to RAGE 23–341 was improved when DNA was bound to histone H3.1 (Fig. S1 B). Histones are attached to the late apoptotic cell surface via DNA Previous studies have shown that nucleosomes are exposed on the surface of apoptotic cells [ 29 ]. Thus, Jurkat cells were treated with staurosporine to induce apoptosis, and the histones present on the cell surface were analyzed. Apoptotic Jurkat cells were prepared via staurosporine treatment for 4 h or 12 h, and the induction of apoptosis was verified via the detection of annexin V and caspase-3 (Fig. S2). Histones were detected by immunofluorescence microscopy in unpermeabilized Jurkat cells treated with staurosporine for 12 h (Fig. S3) Flow cytometry analysis revealed that the degree of histone staining was increased by the induction of apoptosis; when the cells were treated with staurosporine for 4 h or 12 h, 6.57% or 32.7% of the cells were positive for staining with an anti-histone H3 antibody (Fig. 2 A). Notably, when Jurkat cells were treated with staurosporine for 4 h, 3.98% of the cells were annexin V-positive/propidium iodide (PI)-positive; however, after 12 h of incubation with staurosporine, the percentage of annexin V-positive/PI-positive cells was increased to 33% (Fig S2B). Thus, the presentation of histones occurs in late apoptotic cells. Alternatively, histones may be exposed to the cell surface because of secondary necrosis. Histone staining in apoptotic cells after 12 h of staurosporine treatment was decreased by proteinase treatment (Fig. 2 B). Furthermore, histones were released by DNase treatment (Fig. 2 C and D). The purified histone complex could bind to proteinase-treated apoptotic cells (Fig. 2 B), presumably because proteinase-treated apoptotic cells retain cell surface DNA, which can accommodate the histone complex. Histones accordingly did not bind to apoptotic cells treated with DNase (Fig. 2 E). Recombinant histone H3 also bound to proteinase-treated apoptotic cells (Fig. 2 F). Levels of PI-positive cells were not elevated by DNase or proteinase treatment (Fig. S4), indicating that these treatments did not influence the progression of the apoptotic (or necrotic) process. Histones serve as ligands to induce RAGE-mediated phagocytosis Given that histones are ligands for RAGE, we hypothesized that histone molecules present on the surface of late apoptotic cells could serve as “eat-me” signals to induce RAGE-mediated phagocytosis. This hypothesis was first assessed in an epithelial cell line, HEK293T, because RAGE serves as a primary receptor to mediate phagocytosis in this cell line [ 23 ]. A phagocytosis assay was performed via a flow cytometry-based method; phagocytic cells were sorted to determine whether they harboured GFP-expressing Jurkat cells. As reported previously [ 23 ], HEK293T cells internalized apoptotic Jurkat cells (Fig. S5). The fraction of HEK293T cells that internalized apoptotic Jurkat cells was decreased by 71% in RAGE -knockout ( RAGE −/− ) cells (Fig. 3 A). Phagocytosis deficiency in RAGE −/− HEK293T cells was reversed by the transfection of RAGE (Fig. 3 A). To examine whether phagocytosis was competitively inhibited by soluble histone molecules, a phagocytosis assay was performed with HEK293T cells that had been preincubated with the histone complex. As shown in Fig. 3 B, the percentage of internalized Jurkat cells was decreased by 53% following pretreatment with the histone complex. The removal of cell surface histones by proteinase or DNase treatment caused a decrease in the levels of apoptotic cell internalization by HEK293T cells (Fig. 3 C, D). Importantly, the phagocytosis levels of proteinase-treated apoptotic cells were improved when the apoptotic cells were preincubated with the histone complex so that the histones were attached to the surface of the apoptotic cells (Fig. 3 C). However, the internalization of apoptotic cells treated with proteinase and DNase was not improved by preincubation with the histone complex (Fig. 3 E), most likely because apoptotic cells treated with these enzymes lack the ability to accommodate histones (Fig. 2 E). To further assess whether cell surface histones can induce phagocytosis, we used an anti-histone H3 antibody to block the interaction between histones and receptors. As shown in Fig. 3 F, the internalization of apoptotic Jurkat cells by HEK293T cells was inhibited when the apoptotic cells were preincubated with an anti-histone H3 antibody. Notably, RAGE −/− cells retained the ability to phagocytose apoptotic cells, as the percentage of RAGE −/− cells that internalized apoptotic cells decreased by 35% when the apoptotic cells were treated with proteinase (Fig. 3 C). However, in RAGE −/− cells, the internalization levels of proteinase-treated apoptotic cells were not increased by the binding of histones (Fig. 3 C). In addition, the level of phagocytosis in RAGE −/− cells was not altered by anti-histone H3 antibody treatment (Fig. 3 F). These results support the notion that histone-induced phagocytosis is mediated by RAGE in HEK293T cells. In these flow cytometry assays, HEK293T cells with apoptotic cells attached to their surface could be incorrectly counted as those harboring apoptotic cells. Thus, an anti-CD3 antibody was used to detect Jurkat cells that are present outside of HEK293T cells (Fig. S6). In this assay, Jurkat cells were stained with PKH67. Apoptotic Jurkat cells were incubated with HEK293T cells, and PKH67-positive/CD3-negative cells were sorted as phagocytes harboring apoptotic cells. Since CD3 can be digested by proteinase treatment, proteinase-treated apoptotic cells were not analyzed by this assay. As shown in Fig. S7, the results are similar to those shown in Fig. 3 , indicating that Jurkat cells that are present outside of HEK293T cells did not compromise the flow cytometry-based phagocytosis assay. To further confirm the results of these flow cytometry-based phagocytosis assays, the internalization of apoptotic cells was also quantified via microscopy, in which the number of HEK293T cells containing Jurkat cell-derived fragments (GFP fluorescence) in endocytic compartments was counted via fluorescence microscopy. Both FACS and microscopy assays revealed similar results for the internalization of apoptotic cells by wild-type and RAGE −/− HEK293T cells (Fig. S8). For the above-described phagocytosis assays, HEK293T and apoptotic cells were incubated for 0.5 h. However, we found that the effects of DNase or proteinase were dependent on the incubation time of apoptotic cells and HEK293T cells. As shown in Fig. S9A, the effects of DNase became negligible when the assay was performed with a 1 h incubation. The effect of proteinase treatment was also decreased when the cells were incubated for 1 h than when they were incubated for 0.5 h (Fig. S9B). These results suggest that apoptotic cells treated with hydrolytic enzymes can be internalized via a histone-independent phagocytosis process. Thus, histone-induced and RAGE-mediated phagocytosis is likely involved in the rapid elimination of dead cells. Histones induce RAGE-mediated phagocytosis in primary cells To assess whether histone-induced phagocytosis occurs in vivo, a phagocytosis assay was performed with primary cells. Since RAGE is highly expressed in lung tissues [ 38 , 39 ], pulmonary epithelial cells were used for these experiments. Apoptotic cells were prepared from primary thymocytes; thymocytes were labelled with PKH67, and apoptosis was induced by dexamethasone (Fig. S10). The assay was performed with an incubation time of 0.5 h. In the epithelial cells, fractions that internalized apoptotic cells were decreased by proteinase, DNase, or anti-histone H3 antibody treatments (Fig. 4 A, B, and C). The levels of internalized apoptotic cells were decreased by proteinase treatment, and were then recovered by the addition of histones (Fig. 4 A). In pulmonary epithelial cells derived from Rage −/− mice (Fig. S11), the fraction of internalized apoptotic cells was decreased compared to that of wild-type cells (Fig. 4 A). In the knockout cells, the levels of internalization of apoptotic cells were not altered by anti-histone H3 antibody treatment (Fig. 4 C). Furthermore, the internalization of proteinase-treated apoptotic cells was not improved by the binding of histones (Fig. 4 A). We also performed a phagocytosis assay with primary macrophages obtained from peritoneal fluid. Phagocytosis was decreased in macrophages when histones were removed from apoptotic cells by proteinase (Fig. 4 D) or DNase (Fig. 4 E) treatment. In Rage −/− macrophages, the level of phagocytosis was not decreased by these treatments (Fig. 4 D and E). The internalization of proteinase-treated apoptotic cells by wild-type but not Rage −/− macrophages was improved by the binding of histones (Fig. 4 D). These results suggest that histone-induced and RAGE-mediated phagocytosis occurs in macrophages. To verify that these phagocytosis assays were not compromised by apoptotic cells that are present outside of pulmonary epithelial cells, PKH67-positive/CD3-negative cells were quantified as described above. As shown in Fig. S12, the results were similar to those described in Fig. 4 . RAGE is required to remove histone-bound cells during wound healing During the wound-healing process, the majority of neutrophils recruited to the wound site undergo apoptosis and are removed via phagocytosis [ 40 ]. To assess whether RAGE-mediated phagocytosis functions under physiological conditions, apoptotic cells present in wound sites were analyzed in wild-type and Rage −/− mice. For this purpose, wounds were generated on the backs of the mice. Wound healing in Rage −/− mice was slower than that in wild-type mice (Fig. 5 A), which is consistent with a previous report [ 41 ]. Three days after wounding, the wound tissues were harvested, and the apoptotic cell fraction was analyzed via flow cytometry. The number of apoptotic cell fractions (labelled with annexin V-PE) was greater in Rage −/− mice than in wild-type mice (Fig. 5 B). Neutrophils were sorted via anti-CD45, -CD11b and -Ly-6G antibodies, and the results revealed that the number of apoptotic neutrophils was greater in Rage −/− mice than in wild-type mice (Fig. 5 C). Furthermore, the fractions of histone-presenting cells were greater in Rage −/− mice than in wild-type mice (Fig. 5 D). These results indicate that RAGE-mediated phagocytosis is required for the removal of apoptotic cells from wound sites. Discussion Previous studies reported that the induction of apoptosis caused the presentation of histones on the cell surface, although its mechanism remains elusive [ 29 , 30 ]. Accordingly, we observed histones on the surface of late apoptotic cells. However, because apoptosis is a form of death that does not induce inflammation, the presentation of histones may not be a programmed process to label apoptotic cells. Rather, histones may be exposed to the cell surface when apoptotic cells undergo secondary necrosis. Nevertheless, we and others have shown that histones serve as signals to induce phagocytosis in late apoptotic or necrotic cells [ 30 ]. Histones are recognized by phagocytic receptors either directly or indirectly. In the indirect pathway, ApoJ reportedly functions as a histone-binding opsonin, and phagocytosis is presumably mediated by LRP [ 30 , 31 ]. In the present study, we report that RAGE serves as a phagocytic receptor that directly binds to histones. Histone-induced and RAGE-mediated phagocytosis occurs in both professional and nonprofessional phagocytes. Since RAGE can recognize multiple molecules, other RAGE ligands, such as HMGB1 [ 42 ], may also serve as eat-me signals. Compared with professional phagocytes, phagocytic receptors present on nonprofessional phagocytes are limited. Thus, nonprofessional phagocytes, including HEK293T cells, are convenient for analyzing RAGE-mediated phagocytosis. Intriguingly, the phagocytosis of late apoptotic cells by HEK293T cells was not inhibited by the removal of histones when the assay was performed with longer incubation times. This result could be explained by the presence of another phagocytic receptor in HEK293T cells that recognizes dead cells. However, levels to phagocytose late apoptotic cells by HEK293T cells were deceased significantly by knocking out RAGE , even when the phagocytosis assay was performed with longer incubation times. Thus, in the absence of cell surface histones, late apoptotic cells could be phagocytosed via the RAGE-mediated pathway by binding to another ligand, PS [ 15 ]. Given that PS is present in the plasma membrane, cell surface histones may be more readily recognized by RAGE than PS is. For this reason, dead cells could be more rapidly internalized via the histone-induced and RAGE-mediated phagocytosis pathway than via the PS-induced pathway. Cell surface histones are presumably present as a form of nucleosome on late apoptotic cells. In a previous study, we reported that the activation of RAGE by histone molecules was increased when DNA was bound to histones [ 23 ]. In accordance with this synergetic effect between histones and DNA, the histone‒DNA complex bound to RAGE with higher affinity than when it was bound to histones alone. Our results suggest that histones bind to the V domain. Various ligands, including nucleotides, are known to bind to the V domain [ 43 – 45 ]. Given that DNA can enhance the binding between histones and RAGE, the histone binding site in the V domain is distinct from the previously reported DNA-binding site, although further structural analyses are needed to clarify the mechanism by which RAGE can recognize multiple ligands. Wound repair is slower in Rage −/− mice than in wild-type mice. During the wound healing process, neutrophils are removed from the wound site primarily via phagocytosis [ 40 ]. Clearance of these cells is required for the resolution of inflammation; prolonged residence of the inflammatory cells in the wound site leads to the persistence of inflammation [ 46 ]. Thus, the delay in wound healing in Rage −/− mice may be attributable to the lack of RAGE-mediated phagocytosis. In addition, a previous report revealed that the activation of RAGE and the induction of proinflammatory signaling pathways can induce the proliferation and migration of cells [ 47 , 48 ]. Thus, RAGE may be involved in wound repair in multiple ways. Notably, the numbers of apoptotic neutrophils and histone-presenting neutrophils are increased at the wound site in Rage −/− mice, suggesting that RAGE-mediated phagocytosis, including histone-induced processes, is required for the removal of apoptotic cells from the wound site. Conclusion Histones induce RAGE-mediated phagocytosis of late apoptotic and/or necrotic cells in both professional and nonprofessional phagocytes. Thus, histones serve as “eat-me” signals to remove dead cells. RAGE-mediated and histone-induced phagocytosis is required for the maintenance of healthy states in vertebrates. In addition to apoptotic cells, RAGE-mediated phagocytosis may be required for the removal of histone-containing macromolecules, such as NETs. The generation of histone-presenting cells is not limited to the wound healing process. Thus, histone-induced, RAGE-mediated phagocytosis would be involved in various processes under physiological conditions. Abbreviations RAGE: receptor for advanced glycation end products PS: phosphatidylserine TIM: T-cell immunoglobulin and mucin domain BAI1: brain angiogenesis inhibitor 1 HMGB1: high mobility group box 1 NETs: neutrophil extracellular traps DAMPs: damage-associated molecular patterns LRP: LDL receptor-related protein FCS: fetal calf serum GFP: Green fluorescent protein PFA: paraformaldehyde Declarations Availability of data and materials The data supporting the findings of this study are available within the Article and its Supplementary Information. Further relevant data are available from corresponding authors upon reasonable request. Acknowledgements Not applicable. Funding This work was supported by National Natural Science Foundation of China grants to H.N. (32071467), Z.L. (32171475) and X.Z. (32101031), and Open Foundation of Key Laboratory of Carbohydrate Chemistry and Biotechnology from Ministry of Education, China (KLCCB-KF202303). Author information Authors and Affiliations Laboratory of Cell Glycobiology, School of Biotechnology and Key Laboratory of Carbohydrate Chemistry and Biotechnology of Ministry of Education, Jiangnan University, Wuxi 214122, China Yuqing Li, Xiaoman Zhou, Yan Yang, Congcong Du, Yi-shi Liu, Zijie Li, Linpei Zhang and Hideki Nakanishi State Key Laboratory of Systems Medicine for Cancer, Ren Ji Hospital, School of Medicine, Shanghai Cancer Institute, Shanghai Jiao Tong University, Shanghai, 200240, China Yan Yang Authors' contributions Conceptualization, H.N. and Y.L.; methodology, Y.L., X.Z., Y.Y., Y-S.L., and H.N.; validation, Y.L., Y.Y., C.D., Y-S.L., and H.N.; formal analysis, Y.L., X.Z., Y-S.L., and H.N.; investigation, Y.L., Y.Y., C.D., P.Z., and Y-S.L.; writing—original draft preparation, Y.Y., X.Z. and H.N.; writing—review and editing, H.N., Y-S.L., and Z.L.; supervision, X.Z. and H.N.; funding acquisition, X.Z., Z.L. and H.N. All authors have read and agreed to the published version of the manuscript. Corresponding authors Correspondence to Hideki Nakanishi. Ethics statement Animal care and handling procedures comply with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. The study was approved by the Ethics Committee of the Laboratory Animal Center of Jiangnan University. Consent for publication Not applicable. Conflict of interest Statement All authors have no competing interests to declare that are relevant to the content of this article. Additional information Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References Flannagan RS, Jaumouillé V, Grinstein S. The Cell Biology of Phagocytosis. Annu Rev Pathol. 2012;7(1):61–98. Freeman SA, Grinstein S. Phagocytosis: receptors, signal integration, and the cytoskeleton. Immunol Rev. 2014;262(1):193–215. Rabinovitch M. Professional and non-professional phagocytes: an introduction. Trends Cell Biol. 1995;5(3):85–7. Lacy-Hulbert A. Comparative Characterization of Non-professional and Professional Phagocyte Responses to Apoptotic Cells. Phagocytosis of Dying Cells: From Molecular Mechanisms to Human Diseases. Springer Netherlands: Dordrecht; 2009. pp. 189–215. D.V. Krysko and P. Vandenabeele, Editors. Wood W, et al. Mesenchymal cells engulf and clear apoptotic footplate cells in macrophageless PU.1 null mouse embryos. Development. 2000;127(24):5245–52. Ren Y, Savill J. Apoptosis: the importance of being eaten. Cell Death Differ. 1998;5(7):563–8. Grimsley C, Ravichandran KS. Cues for apoptotic cell engulfment: eat-me, don't eat-me and come-get-me signals. Trends Cell Biol. 2003;13(12):648–56. Fadok VA, et al. The role of phosphatidylserine in recognition of apoptotic cells by phagocytes. Cell Death Differ. 1998;5(7):551–62. Fadok VA, et al. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol. 1992;148(7):2207–16. Naeini MB, et al. The role of phosphatidylserine recognition receptors in multiple biological functions. Cell Mol Biol Lett. 2020;25(1):23. Miyanishi M, et al. Identification of Tim4 as a phosphatidylserine receptor. Nature. 2007;450(7168):435–9. Park D, et al. BAI1 is an engulfment receptor for apoptotic cells upstream of the ELMO/Dock180/Rac module. Nature. 2007;450(7168):430–4. Park SY, et al. Stabilin-1 mediates phosphatidylserine-dependent clearance of cell corpses in alternatively activated macrophages. J Cell Sci. 2009;122(Pt 18):3365–73. Park SY, et al. Rapid cell corpse clearance by stabilin-2, a membrane phosphatidylserine receptor. Cell Death Differ. 2008;15(1):192–201. He M, et al. Receptor for advanced glycation end products binds to phosphatidylserine and assists in the clearance of apoptotic cells. EMBO Rep. 2011;12(4):358–64. Westman J, Grinstein S, Marques PE. Phagocytosis of Necrotic Debris at Sites of Injury and Inflammation. Frontiers in Immunology; 2020. p. 10. Schmidt AM, et al. Isolation and characterization of two binding proteins for advanced glycosylation end products from bovine lung which are present on the endothelial cell surface. J Biol Chem. 1992;267(21):14987–97. Neeper M, et al. Cloning and expression of a cell surface receptor for advanced glycosylation end products of proteins. J Biol Chem. 1992;267(21):14998–5004. Hudson BI, Lippman ME. Targeting RAGE Signaling in Inflammatory Disease. Annu Rev Med. 2018;69(1):349–64. van Zoelen MAD, Achouiti A, van der Poll T. The role of receptor for advanced glycation endproducts (RAGE) in infection. Critical care (London, England), 2011. 15(2): pp. 208–208. Ramasamy R, Yan SF, Schmidt AM. Receptor for AGE (RAGE): signaling mechanisms in the pathogenesis of diabetes and its complications. Ann N Y Acad Sci. 2011;1243:88–102. Oczypok EA, Perkins TN, Oury TD. All the RAGE in lung disease: The receptor for advanced glycation endproducts (RAGE) is a major mediator of pulmonary inflammatory responses. Paediatr Respir Rev. 2017;23:40–9. Yang Y, et al. Receptor for advanced glycation end-products (RAGE) mediates phagocytosis in nonprofessional phagocytes. Commun Biology. 2022;5(1):824. Brinkmann V, et al. Neutrophil extracellular traps kill bacteria. Science. 2004;303(5663):1532–5. Marsman G, Zeerleder S, Luken BM. Extracellular histones, cell-free DNA, or nucleosomes: differences in immunostimulation. Cell Death Dis. 2016;7(12):e2518. Xu J, et al. Extracellular Histones Are Mediators of Death through TLR2 and TLR4 in Mouse Fatal Liver Injury. J Immunol. 2011;187(5):2626. Huang H, et al. Histones activate the NLRP3 inflammasome in Kupffer cells during sterile inflammatory liver injury. J Immunol. 2013;191(5):2665–79. Klein B, Lütz-Meindl U, Kerschbaum HH. From the nucleus to the plasma membrane: translocation of the nuclear proteins histone H3 and lamin B1 in apoptotic microglia. Apoptosis. 2014;19(5):759–75. Radic M, Marion T, Monestier M. Nucleosomes are exposed at the cell surface in apoptosis. J Immunol. 2004;172(11):6692–700. Cunin P, et al. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses. Cell Death Dis. 2016;7(5):e2215. Bartl MM, et al. Multiple Receptors Mediate apoJ-Dependent Clearance of Cellular Debris into Nonprofessional Phagocytes. Exp Cell Res. 2001;271(1):130–41. Hirata T, et al. Post-Golgi anterograde transport requires GARP-dependent endosome-to-TGN retrograde transport. Mol Biol Cell. 2015;26(17):3071–84. Zhao SB, et al. MON2 Guides Wntless Transport to the Golgi through Recycling Endosomes. Cell Struct Funct. 2020;45(1):77–92. Liu SS, et al. A knockout cell library of GPI biosynthetic genes for functional studies of GPI-anchored proteins. Commun Biol. 2021;4(1):777. Friggeri A, et al. Participation of the receptor for advanced glycation end products in efferocytosis. J Immunol. 2011;186(11):6191–8. Juncadella IJ, et al. Apoptotic cell clearance by bronchial epithelial cells critically influences airway inflammation. Nature. 2013;493(7433):547–51. Maschalidi S, et al. Author Correction: Targeting SLC7A11 improves efferocytosis by dendritic cells and wound healing in diabetes. Nature. 2022;608(7923):E29. Brett J, et al. Survey of the distribution of a newly characterized receptor for advanced glycation end products in tissues. Am J Pathol. 1993;143(6):1699–712. Katsuoka F, et al. Type II alveolar epithelial cells in lung express receptor for advanced glycation end products (RAGE) gene. Biochem Biophys Res Commun. 1997;238(2):512–6. Bratton DL, Henson PM. Neutrophil clearance: when the party is over, clean-up begins. Trends Immunol. 2011;32(8):350–7. Nass N, et al. The receptor for advanced glycation end products RAGE is involved in corneal healing. Annals Anat - Anatomischer Anzeiger. 2017;211:13–20. Hori O, et al. The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoterin. Mediation of neurite outgrowth and co-expression of rage and amphoterin in the developing nervous system. J Biol Chem. 1995;270(43):25752–61. Koch M, et al. Structural basis for ligand recognition and activation of RAGE. Structure. 2010;18(10):1342–52. Allmen EU, et al. V domain of RAGE interacts with AGEs on prostate carcinoma cells. Prostate. 2008;68(7):748–58. Sirois CM, et al. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA. J Exp Med. 2013;210(11):2447–63. Rodrigues M, et al. Wound Healing: A Cellular Perspective. Physiol Rev. 2019;99(1):665–706. Ranzato E, et al. Hmgb1 Promotes Wound Healing of 3T3 Mouse Fibroblasts via Rage-Dependent ERK1/2 Activation. Cell Biochem Biophys. 2010;57(1):9–17. Tancharoen S et al. HMGB1 Promotes Intraoral Palatal Wound Healing through RAGE-Dependent Mechanisms. International Journal of Molecular Sciences, 2016. 17(11): p. 1961. Additional Declarations No competing interests reported. Supplementary Files GelsandBlotsimages.pdf SupplementaryInformation.docx Cite Share Download PDF Status: Published Journal Publication published 11 Nov, 2025 Read the published version in Cell Communication and Signaling → Version 1 posted Editorial decision: Revision requested 24 Jul, 2025 Reviews received at journal 20 Jun, 2025 Reviewers agreed at journal 14 Jun, 2025 Reviewers agreed at journal 07 Jun, 2025 Reviewers invited by journal 05 Jun, 2025 Editor assigned by journal 05 Jun, 2025 Submission checks completed at journal 05 Jun, 2025 First submitted to journal 01 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6795867","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":468115716,"identity":"4c59cd76-faea-467d-af39-3b4b5eb5d067","order_by":0,"name":"Yuqing Li","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Yuqing","middleName":"","lastName":"Li","suffix":""},{"id":468115717,"identity":"55fa6009-9a19-4ab7-9e1c-f5e636f26d08","order_by":1,"name":"Xiaoman Zhou","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoman","middleName":"","lastName":"Zhou","suffix":""},{"id":468115718,"identity":"a0364473-d8ea-420b-bfb5-4aae5b474ded","order_by":2,"name":"Yan Yang","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Yang","suffix":""},{"id":468115719,"identity":"5748a548-515e-46f5-afdd-ee09cc646f84","order_by":3,"name":"Congcong Du","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Congcong","middleName":"","lastName":"Du","suffix":""},{"id":468115720,"identity":"05e96c4a-b8ce-4b07-b2f5-862533173340","order_by":4,"name":"Yi-shi Liu","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Yi-shi","middleName":"","lastName":"Liu","suffix":""},{"id":468115721,"identity":"62adf373-9dcc-4408-ab53-f6d78bf2dd50","order_by":5,"name":"Zijie Li","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Zijie","middleName":"","lastName":"Li","suffix":""},{"id":468115722,"identity":"2e22005a-8b57-4424-8ba5-5b0358a3ef65","order_by":6,"name":"Linpei Zhang","email":"","orcid":"","institution":"Jiangnan University","correspondingAuthor":false,"prefix":"","firstName":"Linpei","middleName":"","lastName":"Zhang","suffix":""},{"id":468115723,"identity":"15a7ea3d-7393-4e48-8a56-3191e00bee6e","order_by":7,"name":"Hideki Nakanishi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYBACA2YGA8YGAxtmNoRYAlFa0kjRwgDSwnAYWYyAFnN25o0PZxScZ+djP3v4dUHNHQZ+9hwDhp87cGuxbGYrNtxgcJuZjScvzXrGsWcMkj1vDBh7z+Bx2GEeM8kHIC0MOWbGPGyHGQxu5BgwM7bh1WL+84HBOWY2/jdALf8OM9gTocWMcYPBAWY2iRzjx7xtQFskCGphK5acYZAM1PLGjJm37zCPxJlnBQd78Wk5f3jjx54/dsny/TnGn3m+HZbjb0/e+OAnHi0wkAzEbBJAggfEO0BYAwODHRAzfyBG5SgYBaNgFIw8AADINUsx69mtWgAAAABJRU5ErkJggg==","orcid":"","institution":"Jiangnan University","correspondingAuthor":true,"prefix":"","firstName":"Hideki","middleName":"","lastName":"Nakanishi","suffix":""}],"badges":[],"createdAt":"2025-06-01 13:23:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6795867/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6795867/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12964-025-02483-7","type":"published","date":"2025-11-11T15:57:01+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84209112,"identity":"7f84b845-f2b7-4e27-98b5-51e63c76e3c3","added_by":"auto","created_at":"2025-06-09 09:43:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":53408,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistones bind to RAGE. \u003c/strong\u003e(A) Schematic diagrams of wild-type and truncated RAGE proteins. SP, signal peptide; V, V domain; TM, transmembrane domain; CT, cytosolic tail. (B) The histone complex was precipitated with RAGE\u003csup\u003e23-341\u003c/sup\u003e-FLAG or RAGE\u003csup\u003e124-341\u003c/sup\u003e-FLAG attached to agarose beads. Left panels: Inputs and precipitated proteins were detected with an anti-FLAG antibody. Right panel: Quantification of histones precipitated with truncated RAGEs. Histones precipitated with RAGE\u003csup\u003e124-341\u003c/sup\u003e-FLAG were defined as 1, and the relative intensity of histones precipitated with RAGE\u003csup\u003e23-341\u003c/sup\u003e-FLAG is shown. (C) Left panels: RAGE\u003csup\u003e23-341\u003c/sup\u003e-FLAG was incubated with histones or DNA-histones at the indicated concentrations. Inputs and precipitated proteins were detected with an anti-FLAG antibody. Right panel: Relative intensities of histones precipitated with RAGE\u003csup\u003e23-341\u003c/sup\u003e-FLAG. The intensity of the precipitated histones when the assay was performed at a histone concentration of 20 μg/μl was defined as 1. Data are presented as mean ± SEM. n = 3. \u003cem\u003eP\u003c/em\u003e values were derived from an unpaired two-tailed Student’s t-test. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/a23c84df8923d379b74008ef.png"},{"id":84209910,"identity":"76e95094-7de6-47a3-8a1a-4d4595b17a5f","added_by":"auto","created_at":"2025-06-09 09:51:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":81212,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDNA-histones on the surface of apoptotic cells. \u003c/strong\u003e(A) Cell surface histones were labelled with an anti-histone H3 antibody in healthy and apoptotic Jurkat cells. These cells were analyzed by flow cytometry. The percentagesof histone-positive cells are shown in the bottom panel. (B) Apoptotic Jurkat cells were treated with or without proteinase. Proteinase-treated cells were incubated with or without the purified histone complex. Cell surface histones were analyzed by flow cytometry. The mean fluorescence intensity values are shown in the bottom panel. (C) Cell surface histones present on apoptotic cells treated with or without DNase were analyzed by flow cytometry. The mean fluorescence intensity values are shown in the bottom panel. (D) Apoptotic Jurkat cells were treated with or without DNase, and histones released into the supernatant were detected by western blotting. Quantification of released histones is shown in the bottom. The intensity of histone released from apoptotic Jurkat cells without DNase treatment was defined as 1. (E) Apoptotic cells were treated with or without proteinase and DNase. The cells treated with proteinase and DNase were incubated with or without the purified histone complex. The surface histones present on these cells were analyzed via flow cytometry. The mean fluorescence intensity values are shown in the bottom panel. (F) Apoptotic cells were treated with or without proteinase. Proteinase-treated cells were incubated with or without recombinant histone H3.1. The surface histones present on these cells were analyzed via flow cytometry. The mean fluorescence intensity values are shown in the bottom panel. Data are presented as mean ± SEM. n= 3 (A, B and D to F); n = 4 (C). \u003cem\u003eP \u003c/em\u003evalues were derived from an unpaired two-tailed Student’s t-test. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ns not significant (\u003cem\u003eP\u003c/em\u003e ≥ 0.05).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/8cee80b9bcde9ef0680954ed.png"},{"id":84209114,"identity":"d9406da0-15e4-4b8c-a745-1ecdcb4ec33e","added_by":"auto","created_at":"2025-06-09 09:43:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":90047,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCell surface histones on apoptotic cells induce RAGE-mediated phagocytosis in HEK293T cells. \u003c/strong\u003e(A) Apoptotic Jurkat cells expressing GFP were incubated with wild-type HEK293T cells, \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells, or \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells transfected with \u003cem\u003eRAGE\u003c/em\u003e. HEK293T cells that internalized Jurkat cells were analyzed via flow cytometry. The percentages of HEK293T cells harboring Jurkat cells are shown in the right panel. (B) Wild-type HEK293T cells, \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells, or \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells transfected with \u003cem\u003eRAGE\u003c/em\u003e were preincubated with or without histones. These cells were subsequently incubated with apoptotic Jurkat cells, and the percentages of HEK293T cells harboring Jurkat cells were measured via flow cytometry. (C) Apoptotic Jurkat cells were treated with or without proteinase. Proteinase-treated cells were incubated with or without the purified histone complex. These cells were incubated with HEK293T, and a phagocytosis assay was performed via flow cytometry. (D) Apoptotic cells were treated with or without DNase. These cells were incubated with wild-type HEK293T cells, \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells, or \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells transfected with \u003cem\u003eRAGE\u003c/em\u003e, and the percentages of HEK293T cells harboring Jurkat cells were measured via flow cytometry. (E) Apoptotic cells were treated with proteinase or proteinase and DNase. Then, the samples were incubated with or without histones. These cells were incubated with wild-type HEK293T cells, and the percentages of HEK293T cells harboring Jurkat cells were measured via flow cytometry. (F) Apoptotic cells were pretreated with an anti-histone H3 antibody or a nonspecific control IgG. The cells were incubated with wild-type HEK293T cells, \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells or \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells transfected with \u003cem\u003eRAGE\u003c/em\u003e. The percentages of HEK293T cells harboring Jurkat cells were measured via flow cytometry.\u003cstrong\u003e \u003c/strong\u003eData are presented as mean ± SEM. n = 3. \u003cem\u003eP\u003c/em\u003e values were derived from an unpaired two-tailed Student’s t-test. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ns not significant (\u003cem\u003eP\u003c/em\u003e ≥ 0.05).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/502cd32e265c2c35435fa530.png"},{"id":84210650,"identity":"c0578414-cd8c-4e01-bed5-b0520a45a023","added_by":"auto","created_at":"2025-06-09 09:59:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":84700,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistone-induced and RAGE-mediated efferocytosis occurs in mouse primary cells. \u003c/strong\u003e(A) Apoptotic thymocytes labelled with PKH67 were treated with or without proteinase. Proteinase-treated cells were incubated with or without the purified histone complex. These cells were incubated with primary lung epithelial cells, and a phagocytosis assay was performed via flow cytometry. The percentages of lung epithelial cells harboring thymocytes are shown in the bottom panel. (B) Apoptotic thymocytes were treated with or without DNase. The internalization of these cells in lung epithelial cells was analyzed via flow cytometry. (C) Apoptotic thymocytes were pretreated with an anti-histone H3 antibody or a nonspecific control IgG. The internalization of these cells in lung epithelial cells was analyzed via flow cytometry. (D) Apoptotic thymocytes were treated with or without proteinase. Proteinase-treated cells were incubated with or without the purified histone complex. The internalization of these cells in peritoneal macrophages was analyzed via flow cytometry. (E) Apoptotic thymocytes were treated with or without DNase. The internalization of these cells in peritoneal macrophages was analyzed via flow cytometry. Data are presented as mean ± SEM. n = 3. \u003cem\u003eP\u003c/em\u003e values were derived from an unpaired two-tailed Student’s t-test. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; ns not significant (\u003cem\u003eP\u003c/em\u003e ≥ 0.05).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/a661b414891c9701f4fa4084.png"},{"id":84209914,"identity":"d3d8e31a-7512-475a-8d07-6c537e1a5689","added_by":"auto","created_at":"2025-06-09 09:51:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":209872,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRAGE is involved in wound healing.\u003c/strong\u003e Wounds were generated on the backs of the mice with a 3-mm punch. (A) Left panels: Representative images of wounds in wild-type and \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mice. Right panel: Time course of the changes in the longest point spanning the length of the wound. In box plots, the center line denotes median, box edges encompass 25\u003csup\u003eth\u003c/sup\u003e to 75\u003csup\u003eth\u003c/sup\u003e percentiles, and whiskers span minimum to maximum values. n = 4. (B) Three days after wounding, wound tissues were collected, and cell suspensions were labelled with annexin V-PE to detect apoptotic cells. The cells were analyzed by flow cytometry. The percentages of apoptotic cells are shown in the right panel. (C) Neutrophils were sorted using CD45, CD11b and Ly-6G antibodies. Cell suspensions were labelled with annexin V-PE to detect apoptotic neutrophils. The cells were analyzed by flow cytometry. The percentages of apoptotic neutrophils are shown in the right panel. (D) Wound tissues were collected, and cell suspensions were labelled with an anti-histone H3 antibody. The cells were subsequently analyzed via flow cytometry. The percentages of labelled cells are shown in the right panel. Data are presented as mean ± SEM and n = 6 (B to D). *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; ns not significant (\u003cem\u003eP\u003c/em\u003e ≥ 0.05).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/31083b94d07418358eb1b3a7.png"},{"id":96105166,"identity":"c6994166-2beb-41e6-bcef-c87ad1018653","added_by":"auto","created_at":"2025-11-17 16:09:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1552578,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/85dd964a-4752-4248-8089-5850a962a3cb.pdf"},{"id":84211166,"identity":"b794aee7-e461-4e76-aff4-daac5cbfd2ac","added_by":"auto","created_at":"2025-06-09 10:07:16","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":385491,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/d9d4d39228e23c52586b026b.pdf"},{"id":84209911,"identity":"22a8ad22-432b-405a-a8cb-e18b4f8aac99","added_by":"auto","created_at":"2025-06-09 09:51:16","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4355058,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-6795867/v1/026db84c8df5f4b3eb882ae5.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Histones present on the surface of late apoptotic cells induce RAGE-mediated phagocytosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePhagocytosis is an endocytic process by which relatively large particles (greater than 0.5 \u0026micro;m in size) are internalized by cells via a receptor-mediated mechanism. Phagocytosis is mediated primarily by professional phagocytes, including macrophages, dendritic cells, and neutrophils [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Because professional phagocytes present various phagocytic receptors, including those for antibodies and complements, they can internalize a variety of particles and macromolecules [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In addition to professional phagocytes, many other types of cells, including epithelial cells and fibroblasts, can perform phagocytosis; these cells are termed nonprofessional phagocytes [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Compared with those of professional phagocytes, the number of phagocytic receptors present in nonprofessional phagocytes is limited. However, they can internalize certain particles, such as apoptotic cells [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eApoptotic cells are rapidly phagocytosed so that they are removed before the release of proinflammatory cellular components [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Apoptotic cells present unique phagocytic ligands, called \u0026ldquo;eat-me\u0026rdquo; signals, that can activate phagocytic receptors [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. For example, phosphatidylserine (PS) exposed to the outer leaflet of the plasma membrane in apoptotic cells is known to serve as an \u0026ldquo;eat-me\u0026rdquo; signal [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. PS is recognized by multiple phagocytic receptors either directly or indirectly [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Direct PS-recognizing receptors include T-cell immunoglobulin and mucin domain (TIM) family receptors [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], brain angiogenesis inhibitor 1 (BAI1) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], stabilin-1 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], stabilin-2 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and receptor for advanced glycation end products (RAGE) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Apart from apoptotic cells, the efficient clearance of necrotic cells is required for the maintenance of homeostasis in multicellular organisms [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Like apoptotic cells, recognition of necrotic cells by phagocytes is mediated by \u0026ldquo;eat-me\u0026rdquo; signals, although much less is known about the signaling molecules and corresponding receptors involved in the removal of necrotic cells compared to those involved in the process of apoptotic cell removal [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRAGE is a member of the immunoglobulin superfamily proteins and was originally identified as an advanced glycation end products (AGE)-recognizing receptor that induces proinflammatory signaling [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. This receptor is known to bind multiple ligands, including high mobility group box 1 (HMGB1), polynucleotides, and S100 proteins, PS, and AGE. Prolonged activation of RAGE causes chronic inflammation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], which is involved in the progression of various disorders [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In addition to its ability to induce proinflammatory signals, RAGE can induce phagocytosis in both professional and nonprofessional phagocytes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In professional phagocytes, RAGE has been shown to induce the clearance of apoptotic cells by binding to PS [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn a previous study, we reported that particles bound to histones are targeted for RAGE-mediated phagocytosis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], suggesting that histones are another ligand for RAGE. Histones are components of chromatin, but they can be released from cells by cell lysis or by the formation of neutrophil extracellular traps (NETs) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Extracellular histones exhibit harmful effects: they can damage the plasma membrane by direct binding as well as serve as damage-associated molecular patterns (DAMPs) that activate proinflammatory signaling pathways [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. TLR2, TLR4, and TLR9 are receptors that have been reported to recognize extracellular histones [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Intriguingly, several reports have shown that histones are also present on the surface of late apoptotic cells [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. A previous study reported that cell surface histones are targeted by the opsonin ApoJ, which is known to induce phagocytosis by binding to LDL receptor-related protein (LRP) [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In the present study, we demonstrated that cell surface histones are direct targets for RAGE-mediated phagocytosis. Histone-induced and RAGE-mediated phagocytosis is involved in the clearance of dead cells under physiological conditions, such as during the wound repair process.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCells\u003c/h2\u003e \u003cp\u003eHEK293, HEK293T and Jurkat cells were obtained from American Type Culture Collection (ATCC). \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e HEK293T cells were generated as described before [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. HEK293T cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM, Biological Industries) containing 10% (v/v) fetal calf serum (FCS) (Biological Industries). FCS was inactivated by incubation at 56\u0026deg;C for 45 min before addition to media. Jurkat cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 (Biological Industries) containing 10% (v/v) FCS. Jurkat cells stably expressing Green fluorescent protein (GFP) were cultured in RPMI 1640 containing 10% (v/v) FCS and 5 \u0026micro;g/ml blasticidin (InvivoGen). Mouse thymocytes were cultured in RPMI1640 medium containing 10% (v/v) FCS and 1% (v/v) penicillin-streptomycin solution (Beyotime). Primary lung epithelial cells were cultured in DMEM/F-12 medium containing 10% (v/v) FCS and 1% (v/v) penicillin-streptomycin solution, peritoneal macrophages were cultured in RPMI 1640 containing 10% (v/v) FCS and 1% (v/v) penicillin-streptomycin solution. All cells were maintained at 37\u0026deg;C in a humidified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMice\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eAger\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e C57BL/6 mice purchased from Saiye Biology were bred at 6 to 10 weeks of age. The mice were housed in the specific pathogen free facility at the Experimental Animal Center of Jiangnan University. The housing conditions are as follows: the light time is 8:00\u0026ndash;20:00, the temperature is 18\u0026ndash;22\u0026deg;C and the relative humidity is 40\u0026ndash;70%. Animal care and handling procedures comply with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and are approved by the Ethics Committee of the Laboratory Animal Center of Jiangnan University. Mouse genotypes were determined by PCR using primers Ager-F1, Ager-R1, and Ager-R2 (Supplementary Table\u0026nbsp;1).\u003c/p\u003e\n\u003ch3\u003ePlasmids\u003c/h3\u003e\n\u003cp\u003eAll the oligo DNAs and plasmids used in this study are listed in Supplementary Tables\u0026nbsp;1 and 2, respectively. For the CRISPR-Cas9 system used to knockout target genes, guide RNA sequences were designed using the E-CRISP website (RRID:SCR‒019088), and the corresponding DNA fragments were ligated into the \u003cem\u003eBpi\u003c/em\u003eI-digested vector pX330EGFP-hU6-gRNA-hSpCas9 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The RAGE DNA fragments were amplified from cDNA derived from HEK293T cells and cloned into pME-Hyg-3FLAG [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. pLIB2-mEGFP-BSD was used to make Jurkat cells stably expressing GFP. The GFP (mEGFP) was digested out of pME-mEGFP [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eTransfection\u003c/h3\u003e\n\u003cp\u003eFor transient transfection, cells were grown to 60% confluence in 6 cm plates and transfected with plasmid DNA (5 \u0026micro;g/well) using Lipofectamine 8000 (Beyotime) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eRetrovirus-based transfection was performed as described previously [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] to construct Jurkat cells stably expressing GFP. HEK293T cells (10\u003csup\u003e6\u003c/sup\u003e) were transfected with 1 \u0026micro;g pGP, 1 \u0026micro;g pLC-VSVG, and 2 \u0026micro;g pLIB2-mEGFP-BSD using Lipofectamine 8000. After 36 h of incubation, the medium was filtered with a 0.22 \u0026micro;m filter and mixed with the same amount of DMEM supplemented with 16 \u0026micro;g/ml hexadimethrine bromide (Sigma‒Aldrich). The medium containing retrovirus was incubated with Jurkat cells overnight. After 5 days of culture, the cells expressing GFP were sorted using a cell sorter S3e (Bio‒Rad).\u003c/p\u003e\n\u003ch3\u003eAssays for RAGE and histones or DNA–histone binding\u003c/h3\u003e\n\u003cp\u003eHEK293 cells were grown to approximately 70% confluence in 6 cm plates. The plasmids pME-RAGE\u003csup\u003e124\u0026ndash;341\u003c/sup\u003e-His-FLAG or pME-RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e-His-FLAG were transfected into HEK293 cells. After two to three days of incubation, the medium was centrifuged at 3000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 3 min at 4\u0026deg;C. The supernatant was loaded onto Ni NTA beads (Smart Life Sciences). His- and FLAG-tagged proteins were eluted with 400 mM imidazole. Subsequently, the anti-FLAG M2 affinity agarose gel (Sigma‒Aldrich) was added to the eluate and incubated for 3 h at 4\u0026deg;C with rotation. The agarose gel was washed with PBS (Sangon Biotech) three times and suspended in PBS. Two hundred microlitres of the agarose gel suspension was mixed with 1 mg/ml purified histone complex (Sangon Biotech) or 10 \u0026micro;g/\u0026micro;l recombinant histone H3C1 (Sangon Biotech). The final concentration of histones in the mixture was 20, 50, or 100 \u0026micro;g/\u0026micro;l, and the final concentration of recombinant H3C1 in the mixture was 1 \u0026micro;g/\u0026micro;l. The mixture was incubated at 4\u0026deg;C for 0.5 h. After washing three times with PBS, the agarose gel was suspended in 40 \u0026micro;l of PBS, 10 \u0026micro;l of 5 \u0026times; SDS‒PAGE loading buffer (250 mM Tris-HCl pH 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, and 5% \u0026szlig;-mercaptoethanol) was added, and the mixture was subjected to western blotting. To prepare the DNA-histone complex and DNA-histone H3.1, 1 nmol of a single-stranded 22-nt DNA (GTGCCAGATCGGGGTTCAATTC) fragment was incubated in 100 \u0026micro;l of 100 \u0026micro;g/\u0026micro;l histone or 100 \u0026micro;l of 1 \u0026micro;g/\u0026micro;l recombinant histone H3C1.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eInduction of apoptosis in Jurkat cells and thymocytes\u003c/h2\u003e \u003cp\u003eJurkat cells expressing GFP were resuspended in RPMI 1640 containing 10% FCS at a density of 10\u003csup\u003e6\u003c/sup\u003e/ml. The cells were treated with 1 \u0026micro;M staurosporine (Beyotime) for 4 h or 12 h to induce apoptosis. 1 \u0026micro;l PI solution (Beyotime) was added to 99 \u0026micro;l Jurkat cells and incubated for 5 min. Labelling of Jurkat cells with PKH67 was performed with the PKH67 Green Fluorescent cytomembrane Linker Kit (Solarbio) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eThymus were harvested from 3 to 4 week-old wild-type C57BL/6 mice and chopped to produce a single-cell suspension. PKH67 Green Fluorescent cytomembrane Linker Kit was used to label thymocytes. To induce apoptosis, mouse thymocytes were re-suspended in RPMI1640 medium containing 10% FCS, 1% (v/v) penicillin-streptomycin solution supplemented with different concentrations of dexamethasone at 10\u003csup\u003e6\u003c/sup\u003e cells/ml at 37\u0026deg;C for 12 h, and their viability was measured by Cell Counting Kit-8 (Sigma‒Aldrich) and the IC50 was calculated as described before [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Detection of apoptotic cells was performed with Apoptosis Detection Kit (Dojindo).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eWestern blot analysis\u003c/h3\u003e\n\u003cp\u003eCells cultured in 6 cm plates were suspended in 500 \u0026micro;l RIPA buffer (Beyotime) supplemented with 5 \u0026micro;l of EDTA-Free proteinase inhibitor cocktails (MCE) and incubated at 4\u0026deg;C for 30 min. Protein concentrations in the supernatants were determined using BCA kit (Beyotime). 10 \u0026micro;g of each supernatant was mixed with 5 \u0026times; SDS-PAGE loading buffer. After incubation at 100\u0026deg;C for 5 minutes, samples were subjected to 12% SDS-PAGE and transferred to PVDF membranes (Bio‒Rad). The membranes were blocked in 5% milk (Sangon Biotech) in TBST buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.05% (v/v) Tween-20). The following primary antibodies were used: rabbit anti-Caspase-3 (CST, 1:1000); rabbit anti-Cleaved caspase-3 (CST, 1:1000); mouse anti-actin (TransGen Biotech, 1:3000); mouse anti-Flag (TransGen Biotech, 1:5000) and rabbit anti-histone H3 (Abcam, 1: 1000). The membranes were incubated with the appropriate antibodies diluted in primary antibody dilution buffer (Beyotime) overnight at 4\u0026deg;C. After washing with TBST three times, the membranes were incubated with HRP-conjugated secondary antibodies diluted in 5% milk in TBST buffer at room temperature for 1 h and washed three times in TBST buffer. Primary antibodies were detected using the secondary anti-mouse IgG HRP-linked (TransGen Biotech, 1:5000), or anti-rabbit IgG HRP-linked (TransGen Biotech, 1:5000). Signals were detected with ECL Substrate (Bio‒Rad). Images were captured using a Tanon 5200 Automatic Chemiluminescence Image Analysis System.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003eApoptotic Jurakt cells expressing GFP were washed with PBS twice and blocked with 1% bovine serum albumin in PBS for 30 min. The cells were incubated with anti-histone H3 antibody (1: 400) at 4\u0026deg;C for 1 h. Cells were washed with PBS three times, and were incubated with Alexa Fluor 555 donkey anti-rabbit IgG (InvivoGen, 1:1000) at 4\u0026deg;C for 30 min. After wash with PBS twice, the cells were observed under the microscope.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and extraction of primary lung epithelial cells\u003c/h2\u003e \u003cp\u003eFor the purification and culture of primary lung epithelial cells, the lungs were perfused with buffered saline through the right ventricle and carefully resected. Two millilitres of dispase (Beyotime) were dripped into the lungs, followed by the addition of 1% low-melting agarose (Beyotime) and incubated at 37\u0026deg;C for 1 h. After incubation, the lungs were minced and mechanically disrupted by passage through 100 and 70 \u0026micro;m nylon strainers. Single-cell suspensions were washed with PBS containing 1% FBS and 100 units of DNase I (Beyotime) and treated with red blood lysis buffer (Solarbio) at 4\u0026deg;C for 15 min. Then, the cell suspensions were centrifuged at 1000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 5 min, washed twice with PBS, and treated with an APC-conjugated anti-mouse CD45 antibody (BioLegend, 1:200) and an APC/Cy7-conjugated anti-mouse EPCAM antibody (BioLegend, 1:200). CD45-negative and EPCAM-positive cells were collected via BD FACS Aria III, and the collected cells were resuspended in DMEM/F-12 medium supplemented with 10% (v/v) FCS and 1% (v/v) penicillin‒streptomycin solution. A total of 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells were cultured in 24-well plates at 37\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and preparation of mouse peritoneal macrophages\u003c/h2\u003e \u003cp\u003eThe cells were collected from mice peritoneal lavage after 8 to 10 weeks of age as described previously [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Macrophages (2.5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e) were cultured in 24-well plate in RPMI 1640 medium supplemented with 10% (v/v) FCS and 1% (v/v) penicillin‒streptomycin solution. Cells were cultured in 24-well plates at 37\u0026deg;C, and after 1 h, the cells were washed with the medium to remove non-adherent cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTreatments of apoptotic cells with enzymes, histones, or antibodies\u003c/h2\u003e \u003cp\u003eTo treat the apoptotic cells with DNase I or proteinase, 2 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e apoptotic cells were incubated with 3 U of DNase I or 2 U of proteinase (Sigma-Aldrich) in PBS at 37\u0026deg;C for 30 min. Apoptotic cells were washed twice with PBS. Histone (final concentration, 5 \u0026micro;g/\u0026micro;l) or recombinant histone H3C1(final concentration, 5 \u0026micro;g/\u0026micro;l) were added to apoptotic cells and incubated at 4\u0026deg;C for 30 min to perform competitive inhibition assays. For treatment with antibodies, 2 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e apoptotic cells were incubated with rabbit anti-histone H3 antibody (1: 200) or rabbit IgG monoclonal antibody-isotype control (Abcam, 1: 200) in PBS at 4\u0026deg;C for 30 min and washed twice with PBS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePhagocytosis assays\u003c/h2\u003e \u003cp\u003ePhagocytosis assays were performed as described previously [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For the microscopy-based phagocytosis assay, round glass cover slips were placed on the bottom of 24-well plates. The cells (1.5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e/well) were seeded in the plate and allowed to grow to a density of 2\u0026ndash;3 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well in 500 \u0026micro;l of media supplemented with 0.025 \u0026micro;l of LysoTracker (Beyotime). Apoptotic Jurkat cells were added to 10\u003csup\u003e6\u003c/sup\u003e apoptotic cells/4\u0026ndash;6 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e HEK293T cells/ml media. The cells were incubated at 37\u0026deg;C for 0.5 or 1 h. Then, the cells were placed on ice and washed twice with PBS, and the intracellular cells were analyzed under a fluorescence microscope. Cells observed in LysoTracker-positive compartments were defined as internalized particles. At least a total of 300 cultured cells were analyzed.\u003c/p\u003e \u003cp\u003eA flow cytometry-based phagocytosis assay was performed as described before [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. HEK293T cells were seeded in 12-well plates and allowed to grow to a density of 2\u0026ndash;6 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells /well. The cells were incubated with 1\u0026ndash;3 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e apoptotic Jurkat cells expressing GFP in a CO\u003csub\u003e2\u003c/sub\u003e incubator at 37\u0026deg;C for 0.5 or 1 h. Then, cells were washed with PBS twice and fixed by 4% paraformaldehyde (PFA) fix solution (Beyotime) for 10 min. For RAGE rescue experiments, wild-type cells were transfected with the pME-His empty plasmid, and \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e HEK293T cells were transfected with the pME-His empty plasmid or the pME-RAGE-His plasmid. Primary lung epithelial cells and macrophages were cultured in 24-well plates. A total of 10\u003csup\u003e6\u003c/sup\u003e apoptotic thymocytes were added to each well and incubated at 37\u0026deg;C for 0.5 h. The cells were washed with cold PBS to remove uninternalized cells. The cells were treated with trypsin and washed twice with PBS. Then, cells were fixed by 4% PFA fix solution for 10 min. Finally, the samples were washed with PBS and analyzed by Accurf C6 (BD). The data were analyzed using FlowJo V10.\u003c/p\u003e \u003cp\u003eTo omit apoptotic cells that are present outside of phagocytic cells as a background in the flow cytometry-based phagocytosis assay, anti-CD3 antibody was used to stain apoptotic Jurkat cells. To assay only phagocytes that internalize apoptotic cells. Apoptotic Jurkat cells labeled with GFP or PKH-67 were incubated with phagocytes for 0.5 h. These cells were washed and treated with trypsin as described above. The samples were resuspended in PBS containing 1% albumin and PE-conjugated anti-CD3 antibody. Then, cells were fixed by 4% PFA fix solution and subjected to flow cytometry. The phagocytic index was calculated as the ratio of FITC-positive/PE-negative cells to all cells gated. The samples were analyzed via Accurf C6 (BD). The data were analyzed via FlowJo V10.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMicroscopy\u003c/h2\u003e \u003cp\u003eMicroscopy images were obtained using a Nikon C2 Eclipse Ti-E inverted microscope with a DS-Ri camera equipped with NIS-Element AR software, and quantification of fluorescence intensity was performed using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eLung epithelial cells were sort by BD FACS Aria III. Mice skin wound samples were analyzed by Beckman CytoFLEX S. The other samples were analyzed by Accurf C6 (BD). The data was analyzed using FlowJo V10.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of skin wounds in mice and analysis of wound tissues\u003c/h2\u003e \u003cp\u003eFull-thickness punch wounds were made on the backs of the mice as described previously [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The mice were given analgesia and general anaesthesia, the back skin was shaved, the skin was lifted, and a mouse punch with a 3 mm aperture was used to generate wounds on the backs of the mice. Back skin samples of the same size were collected from the mice three days after wounding and incubated overnight with DMEM containing 1% (v/v) penicillin‒streptomycin solution and 200 \u0026micro;g/ml dispase II at 4\u0026deg;C. Small patches of skin were further digested with 1.5 mg/ml IV collagenase (Solarbio) and 10 U DNase I in RPMI 1640 medium supplemented with 2% FCS (v/v) and 1% (v/v) penicillin‒streptomycin solution. The suspension was subsequently resuspended in fresh digestion buffer and incubated at 37\u0026deg;C for 90 min. After incubation, the cell suspension was filtered with 70 \u0026micro;m nylon strainers to remove debris and clots. Neutrophils were sorted via PerCP-conjugated anti-mouse CD45 antibody, FITC-conjugated anti-mouse CD11b antibody (BioLegend, 1: 200), and APC-conjugated anti-mouse Ly-6G antibody (BioLegend, 1: 200). An annexin V-PE/7-AAD Apoptosis Detection Kit (Vazyme Biotech) was used to detect whole apoptotic cells, and an anti-histone H3 antibody was used to analyze cell surface histones.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eEach experiment was performed with at least three independent samples. The quantitative data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SEM). Differences between the analyzed samples were considered significant at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Statistical significance was determined with two-tailed unpaired Student\u0026rsquo;s t test calculated with GraphPad Prism 8.4.3 software.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eHistones are ligands of RAGE\u003c/h2\u003e \u003cp\u003eTo verify that histones are ligands of RAGE, binding between the purified histone complex and RAGE was assayed in vitro. For this experiment, the extracellular region of RAGE, termed RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), was produced by HEK293 cells. The core histone complex purified from bovines was coprecipitated with RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). RAGE\u003csup\u003e124\u0026ndash;341\u003c/sup\u003e is an extracellular region of RAGE lacking the V domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Compared with RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e, the amount of histone complexes bound to RAGE\u003csup\u003e124\u0026ndash;341\u003c/sup\u003e was decreased by 57.8% (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). These results demonstrate that the histone complex directly binds to RAGE via the V domain. A previous study showed that histone-induced phagocytosis was enhanced when DNA was bound to histones [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Thus, we examined whether the binding between RAGE and the histone complex was improved when DNA was bound to histones. The DNA-bound histone complex, hereafter referred to as the DNA-histone complex, was prepared by the incubation of a single-strand DNA (22 nucleotides) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] molecule with the histone complex. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, the amount of the histone complex that precipitated with RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e increased when the DNA was bound. We also examined the binding between RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e and recombinant human histone H3.1. Like the purified histone complex, recombinant histone H3.1 was coprecipitated with RAGE\u003csup\u003e23\u0026ndash;342\u003c/sup\u003e, and the binding of these proteins decreased when the V domain was removed (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). The binding of histone H3.1 to RAGE\u003csup\u003e23\u0026ndash;341\u003c/sup\u003e was improved when DNA was bound to histone H3.1 (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eHistones are attached to the late apoptotic cell surface via DNA\u003c/h2\u003e \u003cp\u003ePrevious studies have shown that nucleosomes are exposed on the surface of apoptotic cells [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Thus, Jurkat cells were treated with staurosporine to induce apoptosis, and the histones present on the cell surface were analyzed. Apoptotic Jurkat cells were prepared via staurosporine treatment for 4 h or 12 h, and the induction of apoptosis was verified via the detection of annexin V and caspase-3 (Fig. S2). Histones were detected by immunofluorescence microscopy in unpermeabilized Jurkat cells treated with staurosporine for 12 h (Fig. S3) Flow cytometry analysis revealed that the degree of histone staining was increased by the induction of apoptosis; when the cells were treated with staurosporine for 4 h or 12 h, 6.57% or 32.7% of the cells were positive for staining with an anti-histone H3 antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Notably, when Jurkat cells were treated with staurosporine for 4 h, 3.98% of the cells were annexin V-positive/propidium iodide (PI)-positive; however, after 12 h of incubation with staurosporine, the percentage of annexin V-positive/PI-positive cells was increased to 33% (Fig S2B). Thus, the presentation of histones occurs in late apoptotic cells. Alternatively, histones may be exposed to the cell surface because of secondary necrosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistone staining in apoptotic cells after 12 h of staurosporine treatment was decreased by proteinase treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Furthermore, histones were released by DNase treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and D). The purified histone complex could bind to proteinase-treated apoptotic cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), presumably because proteinase-treated apoptotic cells retain cell surface DNA, which can accommodate the histone complex. Histones accordingly did not bind to apoptotic cells treated with DNase (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Recombinant histone H3 also bound to proteinase-treated apoptotic cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Levels of PI-positive cells were not elevated by DNase or proteinase treatment (Fig. S4), indicating that these treatments did not influence the progression of the apoptotic (or necrotic) process.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eHistones serve as ligands to induce RAGE-mediated phagocytosis\u003c/h2\u003e \u003cp\u003eGiven that histones are ligands for RAGE, we hypothesized that histone molecules present on the surface of late apoptotic cells could serve as \u0026ldquo;eat-me\u0026rdquo; signals to induce RAGE-mediated phagocytosis. This hypothesis was first assessed in an epithelial cell line, HEK293T, because RAGE serves as a primary receptor to mediate phagocytosis in this cell line [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A phagocytosis assay was performed via a flow cytometry-based method; phagocytic cells were sorted to determine whether they harboured GFP-expressing Jurkat cells. As reported previously [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], HEK293T cells internalized apoptotic Jurkat cells (Fig. S5). The fraction of HEK293T cells that internalized apoptotic Jurkat cells was decreased by 71% in \u003cem\u003eRAGE\u003c/em\u003e-knockout (\u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Phagocytosis deficiency in \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e HEK293T cells was reversed by the transfection of \u003cem\u003eRAGE\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To examine whether phagocytosis was competitively inhibited by soluble histone molecules, a phagocytosis assay was performed with HEK293T cells that had been preincubated with the histone complex. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, the percentage of internalized Jurkat cells was decreased by 53% following pretreatment with the histone complex. The removal of cell surface histones by proteinase or DNase treatment caused a decrease in the levels of apoptotic cell internalization by HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D). Importantly, the phagocytosis levels of proteinase-treated apoptotic cells were improved when the apoptotic cells were preincubated with the histone complex so that the histones were attached to the surface of the apoptotic cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). However, the internalization of apoptotic cells treated with proteinase and DNase was not improved by preincubation with the histone complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), most likely because apoptotic cells treated with these enzymes lack the ability to accommodate histones (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). To further assess whether cell surface histones can induce phagocytosis, we used an anti-histone H3 antibody to block the interaction between histones and receptors. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, the internalization of apoptotic Jurkat cells by HEK293T cells was inhibited when the apoptotic cells were preincubated with an anti-histone H3 antibody. Notably, \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells retained the ability to phagocytose apoptotic cells, as the percentage of \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells that internalized apoptotic cells decreased by 35% when the apoptotic cells were treated with proteinase (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). However, in \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells, the internalization levels of proteinase-treated apoptotic cells were not increased by the binding of histones (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In addition, the level of phagocytosis in \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells was not altered by anti-histone H3 antibody treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). These results support the notion that histone-induced phagocytosis is mediated by RAGE in HEK293T cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn these flow cytometry assays, HEK293T cells with apoptotic cells attached to their surface could be incorrectly counted as those harboring apoptotic cells. Thus, an anti-CD3 antibody was used to detect Jurkat cells that are present outside of HEK293T cells (Fig. S6). In this assay, Jurkat cells were stained with PKH67. Apoptotic Jurkat cells were incubated with HEK293T cells, and PKH67-positive/CD3-negative cells were sorted as phagocytes harboring apoptotic cells. Since CD3 can be digested by proteinase treatment, proteinase-treated apoptotic cells were not analyzed by this assay. As shown in Fig. S7, the results are similar to those shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, indicating that Jurkat cells that are present outside of HEK293T cells did not compromise the flow cytometry-based phagocytosis assay. To further confirm the results of these flow cytometry-based phagocytosis assays, the internalization of apoptotic cells was also quantified via microscopy, in which the number of HEK293T cells containing Jurkat cell-derived fragments (GFP fluorescence) in endocytic compartments was counted via fluorescence microscopy. Both FACS and microscopy assays revealed similar results for the internalization of apoptotic cells by wild-type and \u003cem\u003eRAGE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e HEK293T cells (Fig. S8).\u003c/p\u003e \u003cp\u003eFor the above-described phagocytosis assays, HEK293T and apoptotic cells were incubated for 0.5 h. However, we found that the effects of DNase or proteinase were dependent on the incubation time of apoptotic cells and HEK293T cells. As shown in Fig. S9A, the effects of DNase became negligible when the assay was performed with a 1 h incubation. The effect of proteinase treatment was also decreased when the cells were incubated for 1 h than when they were incubated for 0.5 h (Fig. S9B). These results suggest that apoptotic cells treated with hydrolytic enzymes can be internalized via a histone-independent phagocytosis process. Thus, histone-induced and RAGE-mediated phagocytosis is likely involved in the rapid elimination of dead cells.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eHistones induce RAGE-mediated phagocytosis in primary cells\u003c/h2\u003e \u003cp\u003eTo assess whether histone-induced phagocytosis occurs in vivo, a phagocytosis assay was performed with primary cells. Since RAGE is highly expressed in lung tissues [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], pulmonary epithelial cells were used for these experiments. Apoptotic cells were prepared from primary thymocytes; thymocytes were labelled with PKH67, and apoptosis was induced by dexamethasone (Fig. S10). The assay was performed with an incubation time of 0.5 h. In the epithelial cells, fractions that internalized apoptotic cells were decreased by proteinase, DNase, or anti-histone H3 antibody treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, and C). The levels of internalized apoptotic cells were decreased by proteinase treatment, and were then recovered by the addition of histones (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In pulmonary epithelial cells derived from \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig. S11), the fraction of internalized apoptotic cells was decreased compared to that of wild-type cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In the knockout cells, the levels of internalization of apoptotic cells were not altered by anti-histone H3 antibody treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Furthermore, the internalization of proteinase-treated apoptotic cells was not improved by the binding of histones (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). We also performed a phagocytosis assay with primary macrophages obtained from peritoneal fluid. Phagocytosis was decreased in macrophages when histones were removed from apoptotic cells by proteinase (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD) or DNase (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) treatment. In \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e macrophages, the level of phagocytosis was not decreased by these treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD and E). The internalization of proteinase-treated apoptotic cells by wild-type but not \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e macrophages was improved by the binding of histones (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These results suggest that histone-induced and RAGE-mediated phagocytosis occurs in macrophages. To verify that these phagocytosis assays were not compromised by apoptotic cells that are present outside of pulmonary epithelial cells, PKH67-positive/CD3-negative cells were quantified as described above. As shown in Fig. S12, the results were similar to those described in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eRAGE is required to remove histone-bound cells during wound healing\u003c/h2\u003e \u003cp\u003eDuring the wound-healing process, the majority of neutrophils recruited to the wound site undergo apoptosis and are removed via phagocytosis [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. To assess whether RAGE-mediated phagocytosis functions under physiological conditions, apoptotic cells present in wound sites were analyzed in wild-type and \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. For this purpose, wounds were generated on the backs of the mice. Wound healing in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice was slower than that in wild-type mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), which is consistent with a previous report [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Three days after wounding, the wound tissues were harvested, and the apoptotic cell fraction was analyzed via flow cytometry. The number of apoptotic cell fractions (labelled with annexin V-PE) was greater in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice than in wild-type mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Neutrophils were sorted via anti-CD45, -CD11b and -Ly-6G antibodies, and the results revealed that the number of apoptotic neutrophils was greater in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice than in wild-type mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Furthermore, the fractions of histone-presenting cells were greater in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice than in wild-type mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). These results indicate that RAGE-mediated phagocytosis is required for the removal of apoptotic cells from wound sites.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePrevious studies reported that the induction of apoptosis caused the presentation of histones on the cell surface, although its mechanism remains elusive [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Accordingly, we observed histones on the surface of late apoptotic cells. However, because apoptosis is a form of death that does not induce inflammation, the presentation of histones may not be a programmed process to label apoptotic cells. Rather, histones may be exposed to the cell surface when apoptotic cells undergo secondary necrosis. Nevertheless, we and others have shown that histones serve as signals to induce phagocytosis in late apoptotic or necrotic cells [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Histones are recognized by phagocytic receptors either directly or indirectly. In the indirect pathway, ApoJ reportedly functions as a histone-binding opsonin, and phagocytosis is presumably mediated by LRP [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In the present study, we report that RAGE serves as a phagocytic receptor that directly binds to histones. Histone-induced and RAGE-mediated phagocytosis occurs in both professional and nonprofessional phagocytes. Since RAGE can recognize multiple molecules, other RAGE ligands, such as HMGB1 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], may also serve as eat-me signals.\u003c/p\u003e \u003cp\u003eCompared with professional phagocytes, phagocytic receptors present on nonprofessional phagocytes are limited. Thus, nonprofessional phagocytes, including HEK293T cells, are convenient for analyzing RAGE-mediated phagocytosis. Intriguingly, the phagocytosis of late apoptotic cells by HEK293T cells was not inhibited by the removal of histones when the assay was performed with longer incubation times. This result could be explained by the presence of another phagocytic receptor in HEK293T cells that recognizes dead cells. However, levels to phagocytose late apoptotic cells by HEK293T cells were deceased significantly by knocking out \u003cem\u003eRAGE\u003c/em\u003e, even when the phagocytosis assay was performed with longer incubation times. Thus, in the absence of cell surface histones, late apoptotic cells could be phagocytosed via the RAGE-mediated pathway by binding to another ligand, PS [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Given that PS is present in the plasma membrane, cell surface histones may be more readily recognized by RAGE than PS is. For this reason, dead cells could be more rapidly internalized via the histone-induced and RAGE-mediated phagocytosis pathway than via the PS-induced pathway.\u003c/p\u003e \u003cp\u003eCell surface histones are presumably present as a form of nucleosome on late apoptotic cells. In a previous study, we reported that the activation of RAGE by histone molecules was increased when DNA was bound to histones [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In accordance with this synergetic effect between histones and DNA, the histone‒DNA complex bound to RAGE with higher affinity than when it was bound to histones alone. Our results suggest that histones bind to the V domain. Various ligands, including nucleotides, are known to bind to the V domain [\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Given that DNA can enhance the binding between histones and RAGE, the histone binding site in the V domain is distinct from the previously reported DNA-binding site, although further structural analyses are needed to clarify the mechanism by which RAGE can recognize multiple ligands.\u003c/p\u003e \u003cp\u003eWound repair is slower in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice than in wild-type mice. During the wound healing process, neutrophils are removed from the wound site primarily via phagocytosis [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Clearance of these cells is required for the resolution of inflammation; prolonged residence of the inflammatory cells in the wound site leads to the persistence of inflammation [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Thus, the delay in wound healing in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice may be attributable to the lack of RAGE-mediated phagocytosis. In addition, a previous report revealed that the activation of RAGE and the induction of proinflammatory signaling pathways can induce the proliferation and migration of cells [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Thus, RAGE may be involved in wound repair in multiple ways. Notably, the numbers of apoptotic neutrophils and histone-presenting neutrophils are increased at the wound site in \u003cem\u003eRage\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, suggesting that RAGE-mediated phagocytosis, including histone-induced processes, is required for the removal of apoptotic cells from the wound site.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eHistones induce RAGE-mediated phagocytosis of late apoptotic and/or necrotic cells in both professional and nonprofessional phagocytes. Thus, histones serve as \u0026ldquo;eat-me\u0026rdquo; signals to remove dead cells. RAGE-mediated and histone-induced phagocytosis is required for the maintenance of healthy states in vertebrates. In addition to apoptotic cells, RAGE-mediated phagocytosis may be required for the removal of histone-containing macromolecules, such as NETs. The generation of histone-presenting cells is not limited to the wound healing process. Thus, histone-induced, RAGE-mediated phagocytosis would be involved in various processes under physiological conditions.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eRAGE:\u003c/em\u003e\u003c/strong\u003ereceptor for advanced glycation end products\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePS:\u003c/em\u003e\u003c/strong\u003e phosphatidylserine\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTIM:\u003c/em\u003e\u003c/strong\u003e T-cell immunoglobulin and mucin domain\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eBAI1:\u003c/em\u003e\u003c/strong\u003ebrain angiogenesis inhibitor 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eHMGB1:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003ehigh mobility group box 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eNETs:\u003c/em\u003e\u003c/strong\u003e neutrophil extracellular traps\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eDAMPs:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003edamage-associated molecular patterns\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eLRP:\u003c/em\u003e\u003c/strong\u003e LDL receptor-related protein\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFCS:\u003c/em\u003e\u003c/strong\u003efetal calf serum\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eGFP:\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eGreen fluorescent protein\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePFA:\u003c/em\u003e\u003c/strong\u003e paraformaldehyde\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data supporting the findings of this study are available within the Article and its Supplementary Information. Further relevant data are available from corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by\u0026nbsp;National Natural Science Foundation of China grants to H.N. (32071467), Z.L. (32171475) and X.Z. (32101031), and Open Foundation of Key Laboratory of Carbohydrate Chemistry and Biotechnology from Ministry of Education, China (KLCCB-KF202303).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLaboratory of Cell Glycobiology, School of Biotechnology and Key Laboratory of Carbohydrate Chemistry and Biotechnology of Ministry of Education, Jiangnan University, Wuxi 214122, China\u003c/p\u003e\n\u003cp\u003eYuqing Li, Xiaoman Zhou, Yan Yang, Congcong Du, Yi-shi Liu, Zijie Li, Linpei Zhang and Hideki Nakanishi\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eState Key Laboratory of Systems Medicine for Cancer, Ren Ji Hospital, School of Medicine, Shanghai Cancer Institute, Shanghai Jiao Tong University, Shanghai, 200240, China\u003c/p\u003e\n\u003cp\u003eYan Yang\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, H.N. and Y.L.; methodology, Y.L., X.Z., Y.Y., Y-S.L., and H.N.; validation, Y.L., Y.Y., C.D., Y-S.L., and H.N.; formal analysis, Y.L., X.Z., Y-S.L., and H.N.; investigation, Y.L., Y.Y., C.D., P.Z., and Y-S.L.; writing—original draft preparation, Y.Y., X.Z. and H.N.; writing—review and editing, H.N., Y-S.L., and Z.L.; supervision, X.Z. and H.N.; funding acquisition,\u0026nbsp;X.Z., Z.L. and H.N. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding authors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Hideki Nakanishi.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimal care and handling procedures comply with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. The study was approved by the Ethics Committee of the Laboratory Animal Center of Jiangnan University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have no competing interests to declare that are relevant to the content of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePublisher's Note\u003c/p\u003e\n\u003cp\u003eSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFlannagan RS, Jaumouill\u0026eacute; V, Grinstein S. The Cell Biology of Phagocytosis. Annu Rev Pathol. 2012;7(1):61\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreeman SA, Grinstein S. Phagocytosis: receptors, signal integration, and the cytoskeleton. Immunol Rev. 2014;262(1):193\u0026ndash;215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRabinovitch M. Professional and non-professional phagocytes: an introduction. Trends Cell Biol. 1995;5(3):85\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLacy-Hulbert A. Comparative Characterization of Non-professional and Professional Phagocyte Responses to Apoptotic Cells. Phagocytosis of Dying Cells: From Molecular Mechanisms to Human Diseases. Springer Netherlands: Dordrecht; 2009. pp. 189\u0026ndash;215. D.V. Krysko and P. Vandenabeele, Editors.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWood W, et al. Mesenchymal cells engulf and clear apoptotic footplate cells in macrophageless PU.1 null mouse embryos. Development. 2000;127(24):5245\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen Y, Savill J. Apoptosis: the importance of being eaten. Cell Death Differ. 1998;5(7):563\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrimsley C, Ravichandran KS. Cues for apoptotic cell engulfment: eat-me, don't eat-me and come-get-me signals. Trends Cell Biol. 2003;13(12):648\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFadok VA, et al. The role of phosphatidylserine in recognition of apoptotic cells by phagocytes. Cell Death Differ. 1998;5(7):551\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFadok VA, et al. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J Immunol. 1992;148(7):2207\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaeini MB, et al. The role of phosphatidylserine recognition receptors in multiple biological functions. Cell Mol Biol Lett. 2020;25(1):23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyanishi M, et al. Identification of Tim4 as a phosphatidylserine receptor. Nature. 2007;450(7168):435\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark D, et al. BAI1 is an engulfment receptor for apoptotic cells upstream of the ELMO/Dock180/Rac module. Nature. 2007;450(7168):430\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark SY, et al. Stabilin-1 mediates phosphatidylserine-dependent clearance of cell corpses in alternatively activated macrophages. J Cell Sci. 2009;122(Pt 18):3365\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark SY, et al. Rapid cell corpse clearance by stabilin-2, a membrane phosphatidylserine receptor. Cell Death Differ. 2008;15(1):192\u0026ndash;201.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe M, et al. Receptor for advanced glycation end products binds to phosphatidylserine and assists in the clearance of apoptotic cells. EMBO Rep. 2011;12(4):358\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWestman J, Grinstein S, Marques PE. Phagocytosis of Necrotic Debris at Sites of Injury and Inflammation. Frontiers in Immunology; 2020. p. 10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt AM, et al. Isolation and characterization of two binding proteins for advanced glycosylation end products from bovine lung which are present on the endothelial cell surface. J Biol Chem. 1992;267(21):14987\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeeper M, et al. Cloning and expression of a cell surface receptor for advanced glycosylation end products of proteins. J Biol Chem. 1992;267(21):14998\u0026ndash;5004.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHudson BI, Lippman ME. Targeting RAGE Signaling in Inflammatory Disease. Annu Rev Med. 2018;69(1):349\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Zoelen MAD, Achouiti A, van der Poll T. \u003cem\u003eThe role of receptor for advanced glycation endproducts (RAGE) in infection.\u003c/em\u003e Critical care (London, England), 2011. 15(2): pp. 208\u0026ndash;208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamasamy R, Yan SF, Schmidt AM. Receptor for AGE (RAGE): signaling mechanisms in the pathogenesis of diabetes and its complications. Ann N Y Acad Sci. 2011;1243:88\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOczypok EA, Perkins TN, Oury TD. All the RAGE in lung disease: The receptor for advanced glycation endproducts (RAGE) is a major mediator of pulmonary inflammatory responses. Paediatr Respir Rev. 2017;23:40\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, et al. Receptor for advanced glycation end-products (RAGE) mediates phagocytosis in nonprofessional phagocytes. Commun Biology. 2022;5(1):824.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrinkmann V, et al. Neutrophil extracellular traps kill bacteria. Science. 2004;303(5663):1532\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarsman G, Zeerleder S, Luken BM. Extracellular histones, cell-free DNA, or nucleosomes: differences in immunostimulation. Cell Death Dis. 2016;7(12):e2518.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu J, et al. Extracellular Histones Are Mediators of Death through TLR2 and TLR4 in Mouse Fatal Liver Injury. J Immunol. 2011;187(5):2626.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang H, et al. Histones activate the NLRP3 inflammasome in Kupffer cells during sterile inflammatory liver injury. J Immunol. 2013;191(5):2665\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlein B, L\u0026uuml;tz-Meindl U, Kerschbaum HH. From the nucleus to the plasma membrane: translocation of the nuclear proteins histone H3 and lamin B1 in apoptotic microglia. Apoptosis. 2014;19(5):759\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadic M, Marion T, Monestier M. Nucleosomes are exposed at the cell surface in apoptosis. J Immunol. 2004;172(11):6692\u0026ndash;700.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCunin P, et al. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses. Cell Death Dis. 2016;7(5):e2215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBartl MM, et al. Multiple Receptors Mediate apoJ-Dependent Clearance of Cellular Debris into Nonprofessional Phagocytes. Exp Cell Res. 2001;271(1):130\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirata T, et al. Post-Golgi anterograde transport requires GARP-dependent endosome-to-TGN retrograde transport. Mol Biol Cell. 2015;26(17):3071\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao SB, et al. MON2 Guides Wntless Transport to the Golgi through Recycling Endosomes. Cell Struct Funct. 2020;45(1):77\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu SS, et al. A knockout cell library of GPI biosynthetic genes for functional studies of GPI-anchored proteins. Commun Biol. 2021;4(1):777.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriggeri A, et al. Participation of the receptor for advanced glycation end products in efferocytosis. J Immunol. 2011;186(11):6191\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuncadella IJ, et al. Apoptotic cell clearance by bronchial epithelial cells critically influences airway inflammation. Nature. 2013;493(7433):547\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaschalidi S, et al. Author Correction: Targeting SLC7A11 improves efferocytosis by dendritic cells and wound healing in diabetes. Nature. 2022;608(7923):E29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrett J, et al. Survey of the distribution of a newly characterized receptor for advanced glycation end products in tissues. Am J Pathol. 1993;143(6):1699\u0026ndash;712.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatsuoka F, et al. Type II alveolar epithelial cells in lung express receptor for advanced glycation end products (RAGE) gene. Biochem Biophys Res Commun. 1997;238(2):512\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBratton DL, Henson PM. Neutrophil clearance: when the party is over, clean-up begins. Trends Immunol. 2011;32(8):350\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNass N, et al. The receptor for advanced glycation end products RAGE is involved in corneal healing. Annals Anat - Anatomischer Anzeiger. 2017;211:13\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHori O, et al. The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoterin. Mediation of neurite outgrowth and co-expression of rage and amphoterin in the developing nervous system. J Biol Chem. 1995;270(43):25752\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoch M, et al. Structural basis for ligand recognition and activation of RAGE. Structure. 2010;18(10):1342\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllmen EU, et al. V domain of RAGE interacts with AGEs on prostate carcinoma cells. Prostate. 2008;68(7):748\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSirois CM, et al. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA. J Exp Med. 2013;210(11):2447\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodrigues M, et al. Wound Healing: A Cellular Perspective. Physiol Rev. 2019;99(1):665\u0026ndash;706.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRanzato E, et al. Hmgb1 Promotes Wound Healing of 3T3 Mouse Fibroblasts via Rage-Dependent ERK1/2 Activation. Cell Biochem Biophys. 2010;57(1):9\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTancharoen S et al. \u003cem\u003eHMGB1 Promotes Intraoral Palatal Wound Healing through RAGE-Dependent Mechanisms.\u003c/em\u003e International Journal of Molecular Sciences, 2016. 17(11): p. 1961.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-communication-and-signaling","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccas","sideBox":"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)","snPcode":"12964","submissionUrl":"https://submission.nature.com/new-submission/12964/3","title":"Cell Communication and Signaling","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6795867/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6795867/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe receptor for advanced glycation end products (RAGE) is a multiligand receptor that can induce phagocytosis in both professional and nonprofessional phagocytes. We found that histones are another ligand for RAGE. Binding between histones and RAGE is increased when DNA is attached to histones. While histones are chromosomal proteins in healthy cells, they are exposed to the cell surface as a complex with DNA when cells undergo apoptosis. The phagocytosis of apoptotic cells by either professional or nonprofessional phagocytes is enhanced when histones are present on the surface of apoptotic cells. Thus, histones serve as eat-me signals. In \u003cem\u003eRAGE\u003c/em\u003eknockout cells, the phagocytosis of apoptotic cells was not influenced by the removal of histones, indicating that RAGE is required for the removal of histones from histone-presenting cells. In RAGE knockout mice, wound healing and removal of apoptotic cells from wound sites are delayed, suggesting that RAGE-mediated phagocytosis functions under physiological conditions.\u003c/p\u003e","manuscriptTitle":"Histones present on the surface of late apoptotic cells induce RAGE-mediated phagocytosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-09 09:43:11","doi":"10.21203/rs.3.rs-6795867/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-07-24T19:56:25+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-20T13:03:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"263112332937850813655101880033871682046","date":"2025-06-14T08:34:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"204419186375773331703896234496383408333","date":"2025-06-07T09:00:10+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-05T14:42:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-05T13:41:07+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-05T13:37:02+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Communication and Signaling","date":"2025-06-01T13:10:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-communication-and-signaling","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccas","sideBox":"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)","snPcode":"12964","submissionUrl":"https://submission.nature.com/new-submission/12964/3","title":"Cell Communication and Signaling","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"39543456-3e5e-4292-a5fc-7d93d27b7e18","owner":[],"postedDate":"June 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-17T16:04:17+00:00","versionOfRecord":{"articleIdentity":"rs-6795867","link":"https://doi.org/10.1186/s12964-025-02483-7","journal":{"identity":"cell-communication-and-signaling","isVorOnly":false,"title":"Cell Communication and Signaling"},"publishedOn":"2025-11-11 15:57:01","publishedOnDateReadable":"November 11th, 2025"},"versionCreatedAt":"2025-06-09 09:43:11","video":"","vorDoi":"10.1186/s12964-025-02483-7","vorDoiUrl":"https://doi.org/10.1186/s12964-025-02483-7","workflowStages":[]},"version":"v1","identity":"rs-6795867","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6795867","identity":"rs-6795867","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}