A mechanistic study revealing that SLCO1B3 promotes gastric cancer development and metastasis through MAP1S expression downregulation

A mechanistic study revealing that SLCO1B3 promotes gastric cancer development and metastasis through MAP1S expression downregulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A mechanistic study revealing that SLCO1B3 promotes gastric cancer development and metastasis through MAP1S expression downregulation Shihao Liang, Yangyuan Huang, Liping Li, Qingyu Zeng, Wemjie Liao, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7967187/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Mar, 2026 Read the published version in BMC Cancer → Version 1 posted 10 You are reading this latest preprint version Abstract Background: Gastric cancer (GC) remains a significant cause of mortality worldwide. Exploring the pathogenesis of GC is crucial for developing new therapeutic strategies. Methods: Clinical sample sequencing and immunohistochemical analyses were employed to investigate the expression patterns of solute carrier organic anion transporter B3 (SLCO1B3) in GC and surrounding normal tissues, as well as its effect on GC prognosis. In vitro GC studies were performed to confirm the effects of SLCO1B3 overexpression and knockdown on GC cell proliferation, migration, and invasion, as well as the influence of SLCO1B3 overexpression on carcinogenesis in vivo. Additionally, RNA sequencing of GC cells overexpressing SLCO1B3 identified microtubule-associated protein 1S (MAP1S) as a downstream target, revealing that SLCO1B3 promotes GC progression by downregulating MAP1S expression. Conclusion: SLCO1B3 expression is elevated in GC versus adjacent tissues and correlates with diminished patient survival rates. SLCO1B3 overexpression promotes GC occurrence and metastasis by downregulating MAP1S expression. gastric cancer SLCO1B3 tumorigenesis metastasis MAP1S Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Gastric cancer (GC) remains one of the most common malignant tumors worldwide and is a major cause of death 1 . Gastrointestinal tumors account for 23.9% of all new cancer cases and 33.2% of cancer-related deaths globally 2 . In China, the incidence and mortality rates of gastrointestinal tumors remain high 3 . Traditionally, the primary treatment for GC has been surgery, with molecular targeted therapy as an adjunct. Recently, significant progress has been made in the treatment of GC through molecular targeted therapy and immunotherapy. Therefore, in-depth explorations of the mechanisms underlying GC development and the identification of new therapeutic targets hold important clinical and social significance for GC treatment. Solute carrier is a major family of transport proteins involved in drug uptake, playing a crucial role in determining chemotherapy efficacy (sensitivity and resistance) and/or toxicity 4 . The solute carrier organic anion transporter family members 1B3 (SLCO1B3) and 1B1 (SLCO1B1) are predominantly expressed in hepatocytes and represent the most well-investigated solute carriers. SLCO1B3, referred to as organic anion transport polypeptide (OATP) 1B3, LST-2, and OATP8 5 , is integral to the cellular transfer of numerous clinically significant pharmaceuticals and natural substances. SLCO1B3 is typically expressed in the basolateral region of hepatocytes 6 . Its expression is very low in the gastrointestinal tract, unlike that in normal liver tissue and cancerous tissue 4 . Recent findings have indicated that a shortened variant of SLCO1B3 is expressed in human tumors and certain cancer cell lines 7 – 9 . This variant of SLCO1B3 is primarily located in the cytoplasm and is considered a potential prognostic biomarker for colorectal 10 and pancreatic cancers 11 . However, the role of SLCO1B3 in cancer exhibits polymorphism. In breast cancer, SLCO1B3 inhibits cancer cell proliferation, migration, and invasion and is associated with the HER2 signaling pathway 12 , whereas the opposite effects are observed in non-small cell lung cancer 13 and prostate cancer 14 – 16 . Microtubule-associated protein 1S (MAP1S) is the most widely expressed member of the MAP1 family, essential for accurate cell division, and serves as a link between mitochondria and microtubules for transport 17 , 18 . MAP1S also plays a bridging role in autophagy between microtubules and mitochondria, influencing the biogenesis and degradation of autophagosomes 19 . The early accumulation of genomic instability prior to the emergence of tumorigenic signs indicates that genomic instability drives tumorigenesis. Following tumorigenesis, tumor development subsequently triggers the activation of autophagy, thereby reducing genomic instability in the tumor foci 19 , 20 . Meanwhile, in studies on various inflammatory diseases, including pneumonia 21 and autoimmune thyroiditis 22 , MAP1S has been shown to promote inflammatory progression when suppressed or inhibit inflammatory progression via autophagy pathway activation. SLCO1B3 in GC is strongly associated with prognosis. Clinical data analyses revealed that SLCO1B3 expression in GC tissues is markedly elevated compared with that in neighboring normal tissues. Furthermore, elevated SLCO1B3 expression is correlated with diminished patient survival rates. The diagnostic and prognostic significance of SLCO1B3 and its functional role in human GC remain to be investigated. This study was conducted to investigate the correlation between SLCO1B3 and the clinicopathological features and prognosis of GC patients. We examined the functional effects of SLCO1B3 in human GC cell proliferation, migration, and invasion in vitro. Furthermore, we investigated SLCO1B3 involvement in GC development in vivo and analyzed the molecular processes associated with SLCO1B3 and MAP1S in GC onset and progression. 2. Method Bioinformatics prediction Use the Cancer Genome Atlas (TCGA) database to analyse the differences in SLCO1B3 expression levels in cancer and cancer-adjacent tissues. Utilise the Kaplan-Meier plotter(KM) ( https://kmplot.com/analysis/ ) to examine gastric cancer-related data and assess the influence of varying SLCO1B3 expression levels on gastric cancer survival prognosis. Research subjects and materials This study obtained the clinical data of 18 gastric cancer patients from the First Affiliated Hospital of Guilin Medical University. Tissue samples were obtained from patients with gastric cancer (GC) who had not undergone radiotherapy or chemotherapy at the time of collection. Clinical and pathological data were gathered for all patients, and the American Joint Committee on Cancer (AJCC) criteria were employed to stage and classify tumours. The study was approved by the Ethics Committee of the First Affiliated Hospital of Guilin Medical University (Ethics Approval Number: 2024YJSLL-113). RNA extraction and RT-qPCR Extract RNA from the sample using TRIzol (Invitrogen) according to the provided instructions. Then prepare cDNA using the TOLOBIO kit. Target sequence information from the NCBI database was used to design primers using the primer design tool (NCBI, USA).The ultimate reaction volume was 10 µL, and all qRT-PCR assays were conducted utilising the CFX96 Touch real-time fluorescence quantitative PCR detection system (Bio-Rad). All primers were synthesised by Sangon Biotech Co., Ltd., located in Shanghai, China. Data were analysed with the 2-ΔΔCt technique, employing GAPDH as the normalisation control for these assessments.All analyses were performed in triplicate.The primers used were:SLCO1B3-Forward:TTGGAAGGGTCTACTTGGGCTTATC,SLCO1B3-Reverse:TTTCTTTCATTGTCCGATGCCTTGG;MAP1S-Forward:CGCCTTCTTCGCGTCAATG,MAP1S-Reverse:TGCCGCACCAGCTTCCAG;G3BP2-Forward:GAGGACCAAGACCAGGCAGAG,G3BP2-Reverse:TGGATAGCGAATTATTCTACGGTTGTC;MEX3C-Forward:CTTATCGTGTGGTAGGATTAGTGGTTG,MEX3C-Reverse:ATCTCTGCTCGGAGTTACTATGTAGG;YTHDF3-Forward:TCTGTTGTGGACTATAATGCGTATGC,YTHDF3-Reverse:GCGAATATGCCGTAATTGGTTATTGG;GAPDH-Forward:CAGGAGGCATTGCTGATGAT,GAPDH-Reverse:GAAGGCTGGGGCTCATTT. Immunohistochemistry (IHC) Perform immunohistochemical (IHC) staining using an anti-SLCO1B3 antibody (Proteintech, dilution 1:400). Analyse the correlation between SLCO1B3 expression quantity in gastric cancer tissues and adjacent non-cancerous tissues (n = 18) using IHC scoring. Following staining, two pathologists independently evaluated the samples according to staining intensity and the proportion of positively stained cells, assigning intensity ratings as follows: 0 (no staining), 1 (yellow), 2 (yellow-brown), and 3 (brown). The proportion of positive cells was quantified as follows: 0 (less than 5%), 1 (5–25%), 2 (26–50%), 3 (51–75%), and 4 (76% or greater). The two scores are subsequently multiplied to determine the relative expression index. A final score of less than 4 indicates low expression and a score of 4 or more indicates high expression. Immunohistochemistry (IHC) of mouse xenograft tumour tissues was performed using a microscopic imaging system to acquire images of the sections. Each section was first observed at low magnification to examine the entire tissue. Then, 400× microscopic images were acquired, with a total of three images collected. The Halo data analysis system was used to calculate the percentage of positive area (% DAB-positive tissue) in each image. Independent samples t-tests were performed using SPSS 21.0 statistical analysis software, and data were presented as the mean ± standard deviation ( ± SD). Cell culture In 2023, the Guangxi Key Laboratory of Molecular Medicine for Liver Injury and Repair provided the AGS and HGC-27 cell lines. These cell lines have been confirmed to be free of mycoplasma contamination and can be used for up to six months. All cells can be passaged up to 25 times. AGS cells are cultivated in Ham's F-12K medium (Gibco, New York, USA), whereas HGC-27 cells are cultured in 1640 medium (Gibco). The culture media for both cell lines comprises 10% foetal bovine serum (Gibco) and 1% penicillin-streptomycin (Solarbio, China). The cells are maintained in a 37°C, 5% CO₂ incubator and the medium is changed three times weekly. The cells are passaged at 80% confluence using a 1:1 or 1:2 ratio. Gene transfection was performed using PolyJet M transfection reagent and puromycin (Solarbio, China) was used for selection to obtain stably transfected cell lines. The plasmids human SLCO1B3-pcDNA3.1-EGFP-PURO,SLCO1B3 sh1 pLVX-shRNA2-PURO and MAP1S-pcDNA3.1-T2A-TagRFP were purchased from Changsha Zheqiong Biotechnology Co., Ltd. (Youbao Biotechnology), and the yeast was provided by Tiangen Biotechnology Co., Ltd. (Beijing, China). Escherichia coli (E. coli) was also provided by Tiangen Biotechnology Co., Ltd. (Beijing, China). The commercial antibodies used were SLCO1B3 (mouse, Proteintech, Wuhan Sanying), SLCO1B3 (rabbit, Proteintech, Wuhan Sanying), MAP1S (rabbit, Proteintech, Wuhan Sanying) and GAPDH (rabbit, Abcam). Cell transfection Perform transfection when the cell density in the 6-well plate reaches 70–80%. Follow the PolyJet transfection reagent instructions for transfection. Replace the culture medium four hours after transfection. Observe the transfection fluorescence under a microscope 24–48 hours later; extract cellular RNA after 48 hours and cellular protein after 72 hours for validation. Western blotting Cell lysis was performed utilising RIPA buffer (Beyotime, China) supplemented with protease inhibitors. Centrifugation of the lysate is required to achieve the separation of cell debris. Subsequent to this, the protein samples must be separated by 8% SDS-PAGE and transferred to PVDF membranes. The membranes were sequentially blocked with defatted milk at 37°C for 1 hour, after which they were incubated overnight with specific antibodies.Protein levels were detected using an enhanced chemiluminescence detection kit (Biosharp), and quantitative analysis was performed using ImageJ software. It is important to note that all experiments were repeated on three separate occasions. The primary antibodies included: SLCO1B3 (rabbit, Proteintech, Wuhan Sanying), MAP1S (rabbit, Proteintech, Wuhan Sanying) and GAPDH (rabbit, Abcam). CCK-8 test HGC-27 and AGS cells need to be inoculated into a 96-well plate at a density of 8,000 cells per well, with five replicate wells for each group. After the cells have fully adhered to the walls (0 h), add 10µL of CCK-8 working solution to each well of the plate. The plate should then be incubated at 37°C and protected from light.After a culture period of 2 hours, the OD values at 450 nm should be measured and proliferation curves plotted at 24, 48, and 72 hours. The CCK-8 assay was performed on three separate occasions in independent experiments. The analysis of the data was conducted utilising GraphPad 10 software. Colony formation experiment Forty-eight hours post-transfection, 1000 HGC-27 and AGS cells were seeded into a 6-well plate containing 2 mL of culture medium and cultured for a period of 7 to 14 days until visible clones formed.Subsequent to the elimination of the medium, the clones were air-dried, fixed with 4% para-formaldehyde at ambient temperature for 30 minutes, and dyed with a 0.1% crystal violet solution for 15 minutes.The cells were washed with Phosphate Buffered Saline (PBS) buffer, and images were collected. The clone counts were then analysed using ImageJ software. Transwell migration assay Following a 48-hour transfection period, 50,000 HGC-27 and AGS cells were seeded into the upper chamber, which contained 200 µL of serum-free 1640 medium and Ham's F-12k medium, respectively.The lower chambers were then filled with 600 µL of 20% FBS-containing 1640 medium and Ham's F-12k medium, respectively. Following a 48-hour incubation period at 37°C, the cells were fixed and stained with a 0.1% crystal violet solution. The residual cells in the upper chamber were subsequently eliminated, and photographs of the labelled cells were captured and processed using Image J software for quantification. Wound healing experiment Subsequent to a 48-hour period of transfection, a sterile 1 ml pipette tip should be utilised to create linear abrasions ('wounds') in the monolayer. The samples should subsequently be rinsed with Phosphate Buffered Saline (PBS), followed by the addition of serum-free media to eliminate any cellular debris. It is imperative that photographs are taken at 0 hours using an inverted microscope. Subsequent to a 48-hour period, photographic documentation of the same location should be conducted, with a subsequent comparison of the observations being made to assess cell migration. In order to enhance the clarity of the images, it is recommended that ImageJ software be employed for the purpose of analysis. RNA-Seq Following the extraction of total RNA from the samples, the removal of ribosomal RNA is undertaken in order to maximise the retention of all coding RNA and non-coding RNA (ncRNA). The resulting RNA is then subjected to random fragmentation, resulting in short fragments. These fragments are then used as a template to synthesise the first strand of cDNA using six-base random primers (random hexamers).Thereafter, a buffer, dNTPs (with dUTP substituting dTTP), RNase H, and DNA polymerase I are introduced to facilitate the synthesis of the second strand of cDNA. The cDNA is purified with a QiaQuick PCR kit, eluted using EB buffer, and then undergoes end repair, A-addition, and ligation of sequencing adapters. This is followed by the degradation of the second strand using UNG (Uracil-N-Glycosylase) enzyme.Subsequently, agarose gel electrophoresis is performed to select fragment sizes, followed by PCR amplification. The final sequencing library is prepared and sequenced using the Illumina NovaSeq 4000 (Illumina, USA) for RNA sequencing (RNA-seq). The identification of differentially expressed genes relies on the criterion of a P-value 1.5 or < 0.5. GC heterologous transplantation mouse model Male BALB/c nude mice (3 weeks old) were procured from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China).The mouse model was established in accordance with a previously published protocol 23 . Mice were randomly assigned to two groups (n = 5 per group) and subcutaneously injected with either SLCO1B3 stably overexpressed HGC-27 cells or an equivalent quantity of negative control HGC-27 cells. The objective of this study was to evaluate the impact of SLCO1B3 overexpression on the proliferation of GC xenograft tumours.Tumour dimensions were measured at two-day intervals using an external caliper. The tumour volume was determined using the subsequent formula: Tumour volume was computed using the formula: (length × width)² / 2. Mice were euthanized 21 days post-injection, and tumours were excised, photographed, and weighed. Subcutaneous tumour tissue was collected for IHC analysis. All animal tests were performed in compliance with international standards, namely the 3R principles, and received approval from the Animal Ethics Committee of the First Affiliated Hospital of Guilin Medical University. 3. Results Abnormal SLCO1B3 expression in GC We collected GC and adjacent normal tissue samples from three patients at the First Affiliated Hospital of Guilin Medical University. Gene sequencing revealed that SLCO1B3 was highly overexpressed in GC tissues(Fig. 1 A-D). Furthermore, confirmation through the The Cancer Genome Atlas database demonstrated that SLCO1B3 expression was markedly elevated in GC tissues when compared with its expression in surrounding normal tissues ( p < 0.001)(Fig. 1 E). Furthermore, in an analysis of the Kaplan–Meier online database, GC patients with high SLCO1B3 expression demonstrated significantly poorer survival outcomes than those with low SLCO1B3 expression(Fig. 1 F). Immunohistochemical staining revealed that SLCO1B3 is primarily expressed in the cytoplasm in cancer cells(Fig. 1 G,H), with markedly elevated expression in GC tissues versus surrounding non-cancerous tissues ( p < 0.0001)(Table 1 ). Thus, SLCO1B3 may act as a tumor-promoting factor in GC. Table 1 Correlation analysis between SLCO1B3 and clinical parameters in 17 patients with GC Variables Number of patients SLCO1B3 χ 2 P Low High Gender 2.471 0.162 Male 10 1 (5.9%) 9 (52.9%) Female 7 3 (17.6%) 4 (23.5%) Age (years) 0.018 0.665 ≤ 65 8 2 (50.0%) 6 (46.2%) >65 9 2 (50.0%) 7 (53.8%) Organ typology 9.590 Low polarisation 6 0 (0.0%) 6 (46.2%) Low-to-moderate differentiation 3 2 (50.0%) 1 (7.7%) middle-class differentiation 4 0 (0.0%) 4 (30.8%) High-low differentiation 1 1 (25.0%) 0 (0.0%) Highly differentiated 3 1 (25.0%) 2 (15.4%) Vascular Invasion 0.049 0.67 Positive 12 3 (75.0%) 9 (69.2%) Negative 5 1 (25.0%) 4 (30.8%) Nerve Invasion 1.121 0.421 Positive 14 4 (100.0%) 10 (76.9%) Negative 3 0 (0.0%) 3 (23.1%) Positive Lymphatic Node 0.195 0.579 = 0 3 1 (25.0%) 2 (15.4%) >0 14 3 (75.0%) 11 (84.6%) Distant Metastasis 0.195 0.579 Positive 3 1 (25.0%) 2(15.4%) Negative 14 3 (75.0%) 11 (84.6%) CK20 1.121 0.421 Positive 14 4 (100.0%) 10 (76.9%) Negative 3 0 (0.0%) 3 (23.1%) Muc5Ac 0.243 0.555 Positive 11 3 (75.0%) 8 (61.5%) Negative 6 1 (25.0%) 5 (38.5%) CK31 0.006 0.700 Positive 13 3 (75.0%) 10 (76.9%) Negative 4 1 (25.0%) 3 (23.1%) P53 0.679 0.574 Positive 15 4 (100.0%) 11 (84.6%) Negative 2 0 (0.0%) 2 (15.4%) Ki67 9.590 0.006 Positive 11 0 (66.7%) 11 (84.6%) Negative 6 4 (100.0%) 2 (15.4%) SLCO1B3 promotes the proliferative capacity of GC cells Next, SLCO1B3 was either overexpressed or knocked down in AGS and HGC-27 GC cells by transfecting the respective NC, OE-SLCO1B3, control, and sh-SLCO1B3-1 plasmids. The transfection effectiveness was validated through qRT-PCR and Western blotting(Fig. 2 A-F). Functional assays were then conducted, including Cell Counting Kit-8 (CCK-8), colony formation, wound healing, and Transwell assays. The defining feature of cancer cells is their ability to proliferate without restriction. Thus, we investigated the effects of SLCO1B3 on AGS and HGC-27 cell proliferation using CCK-8 and colony formation assays. For the colony formation assay, 1,000 cells were seeded into each well of a six-well plate, fixed, and stained. The results showed that, at the same time point and under the same conditions, the number of colonies in cells with SLCO1B3 overexpression was significantly higher than that in the control group (NC). The opposite phenotype was observed when SLCO1B3 was knocked down(Fig. 2 G-L). Cell viability was evaluated via the CCK-8 assay. GC cells from the NC, OE-SLCO1B3, and sh-SLCO1B3-1 groups were transfected with the respective plasmids and placed in a 96-well plate at a density of 5,000 cells per well. Cell optical density (OD) was assessed at 24, 48, and 72 hours. At 72 hours, cells transfected with OE-SLCO1B3 exhibited significantly higher OD values than the control group (NC). Cells transfected with sh-SLCO1B3-1 exhibited lower OD values than the control group at the same time point. These results suggest that SLCO1B3 promotes the proliferative capacity of GC cells(Fig. 2 M-P). SLCO1B3 promotes the migration ability of GC cells One of the defining characteristics of tumor cells is their ability to migrate, which can lead to tumor invasion and metastasis. To determine the effect of SLCO1B3 on GC cell migration, wound healing and Transwell experiments were conducted. AGS and HGC-27 cells were transfected with SLCO1B3 overexpression or knockdown plasmids. When the cell density reached 100%, the cells were scratched and subsequently cultured in serum-free medium. Images (4× magnification) were captured at 0 and 48 hours. The wound healing assay results indicated that the migratory capacity of the SLCO1B3-overexpressing group was markedly superior to that of the NC group, whereas the migratory capacity of the SLCO1B3-knockdown group was significantly inferior to that of the control group(Fig. 3 A,B). In the Transwell experiment, GC cells from the NC and OE-SLCO1B3 groups, as well as the control and sh-SLCO1B3-1 groups, were digested with trypsin. Each migration chamber was co-cultured with 50,000 cells, which were then fixed and stained after 48 hours. The results showed that overexpressing SLCO1B3 in AGS and HGC-27 cells increased the number of migrating cells compared with that observed in the control group. Furthermore, the cells' invasive ability was increased. The knockdown of SLCO1B3 in AGS and HGC-27 cells reduced the number of migratory cells relative to the empty vector group. These data indicate that SLCO1B3 enhances the migratory capacity of GC cells(Fig. 3 C-F). SLCO1B3 influences the transcription and protein expression of the MAP1S gene, and SLCO1B3 exerts its effects by regulating MAP1S protein expression. Next, we investigated the regulatory mechanism of SLCO1B3 in GC cell proliferation and migration via RNA-Seq in HGC-27 cells overexpressing the SLCO1B3 gene. Many genes demonstrated altered expression in HGC-27 cells overexpressing SLCO1B3(Fig. 4 A,B). Several genes with the most obvious trends were screened, and qRT-PCR analysis was performed(Fig. 4 C,D). Only MAP1S demonstrated expression consistent with the sequencing results. Thus, we applied qRT-PCR and Western blotting to further investigate the expression pattern of MAP1S. Changes in SLCO1B3 influenced the overall level of MAP1S mRNA(Fig. 5 A,B). Western blotting revealed a negative correlation between MAP1S and SLCO1B3 in AGS and HGC-27 cells. Significantly reduced MAP1S levels were observed in SLCO1B3-overexpressing cells, whereas significantly increased levels were observed in SLCO1B3-knockdown cells(Fig. 5 C-H). These findings suggest that SLCO1B3 regulates the occurrence and progression of GC through MAP1S. SLCO1B3 promotes GC proliferation and migration by regulating MAP1S protein translation To further validate the role of SLCO1B3 in promoting GC proliferation by regulating MAP1S protein translation, we transfected the MAP1S empty vector plasmid (Vector) and the MAP1S overexpression plasmid (OE-MAP1S) into AGS and HGC-27 cells. Transfection efficiency was confirmed by qRT-PCR and Western blotting(Fig. 6 A,B). The NC and SLCO1B3-overexpressing cell lines were then co-transfected with the MAP1S empty vector plasmid and the SLCO1B3-overexpressing plasmid, yielding the following: Vector + NC (control), OE-SLCO1B3, and OE-SLCO1B3 + OE-MAP1S. Functional experiments were then performed using these cells. In the colony formation assay, we cultured 500 gastric cancer cells, which had been treated as described above, in each well of a six-well plate. After 14 days, staining and observation revealed that promoting MAP1S had effectively reversed the pro-proliferative effect of SLCO1B3 overexpression on GC cells(Fig. 6 C,D). The viability of GC cells was assessed using the CCK-8 assay. Five thousand cells were cultured in each well of a 96-well plate. Cell optical density (OD) values were measured at 24, 48, and 72 hours. The results indicated that promoting MAP1S effectively reversed the pro-proliferative effect of SLCO1B3 overexpression in GC cells(Fig. 6 E,F). Subsequently, we examined the function of SLCO1B3 in modulating MAP1S translation in GC cell migration using wound healing and Transwell assays. In the wound healing assay, cells at 100% density were scratched and cultured in serum-free medium. Images were captured at 0 and 48 hours(Fig. 6 G,H). In the Transwell migration experiment, 50,000 cells were cultured in each migration chamber and subsequently fixed and stained after 24 hours(Fig. 6 I,J). The results showed that promoting MAP1S effectively inhibited the GC cell migration promoted by SLCO1B3 overexpression. Effect of SLCO1B3 overexpression on GC formation in vivo Next, we investigated the role of SLCO1B3 in GC development in a mouse xenograft model. HGC-27 cells were stably transfected with OE-SLCO1B3 or NC and selected using puromycin. Western blotting confirmed SLCO1B3 gene overexpression(Fig. 7 A,B). Stabilized, overexpressed HGC-27 cells (OE-SLCO1B3) or an equivalent number of NC cells were subcutaneously injected into the axillary region of male BALB/cA-nu nude mice (n = 5 per group). The xenograft tumors that formed from HGC-27 cells overexpressing SLCO1B3 developed noticeably faster than those derived from control cells. The mice were euthanized 21 days after injection. After 3 weeks of growth, the tumors were larger and heavier(Fig. 7 C,D). Given the previous immunohistochemical results, we performed IHC experiments on the excised tumors. The SLCO1B3 (p < 0.01) and Ki-67 (p < 0.001) positivity rates in xenograft tumors derived from HGC-27 cells overexpressing SLCO1B3 were significantly higher than those in tumors derived from control cells(Fig. 7 G,H). 4. Discussion In this study, we investigated the association between SLCO1B3 and the prognosis and clinical pathological features of GC patients. Our clinical sample evaluation revealed that the malignant tissues of GC patients demonstrated marked SLCO1B3 overexpression. Additionally, the TGCA and KM database analyses revealed that SLCO1B3 is a hub gene linked to overall survival in GC patients. Therefore, we hypothesize that SLCO1B3 could serve as a novel therapeutic target in GC. Molecular targeted therapy is an essential method for treating GC and other cancers. According to earlier research, SLCO1B3 is overexpressed in endometrial cancer, serous ovarian cancer, and cutaneous squamous cell carcinoma and is linked to prognosis 24 – 26 . GC studies have also shown that SLCO1B3 is a prognostic indicator 27 . In this study, we found that clinical factors such as lymph node metastasis and the rate of Ki-67 positivity in GC patients were positively correlated with high SLCO1B3 expression. Colorectal cancer studies have shown that SLCO1B3 plays a key role in the initiation and metastasis and that knocking down SLCO1B3 can inhibit these processes 10 . Given the positive correlation between SLCO1B3 and the Ki-67 positivity rate, we propose that SLCO1B3 may also promote the development and metastasis of GC, which is supported by our in vitro findings. According to previous studies, SLCO1B3, which is associated with cancer and differs from the liver-type SLCO1B3 expressed on the membranes of normal liver cells, has been shown to promote the development of various cancer types 28 . Non-small cell lung cancer studies have shown that SLCO1B3 promotes tumor growth, migration, and in vivo tumor formation by regulating EMT-related genes, such as E-cadherin. Knocking down Ct-SLCO1B3 RNA significantly inhibits tumor phenotypes, suggesting its potential as a therapeutic target for non-small cell lung cancer 13 . SLCO1B3 has been found to exhibit similar characteristics in colorectal cancer studies 10 . Similarly, our results indicate that SLCO1B3 overexpression promotes GC cell proliferation and metastasis. In mouse xenograft experiments, we observed that SLCO1B3 overexpression led to Ki-67 overexpression, accelerating the growth and size of xenograft tumors. Therefore, this study provides strong evidence supporting SLCO1B3's role in promoting GC cell development. Our RNA-seq pathway analysis revealed that SLCO1B3 overexpression is linked to MAP1S expression downregulation. MAP1S belongs to the MAP1 protein family, which includes MAP1A, MAP1B, and MAP1S. However, its evolutionary conservation is lower than that of MAP1B 29 . MAP1S participates in the regulation of cytoskeletal dynamics by modulating microtubule stability 18 . In non-small cell lung cancer studies, researchers have found that MAP1S inhibits the Keap1–Nrf2 pathway, significantly reducing the survival rate of A549/DDP drug-resistant cells and increasing autophagy levels 20 . Related studies have consistently associated MAP1S with pathways related to autophagy initiation, cellular DNA damage, and immune regulation 20 , 30 – 32 . Although no studies have yet explored the co-expression of SLCO1B3 and MAP1S in cancer, related cancer studies have shown that SLCO1B3 expression is always opposite to that of MAP1S. We speculate that the upregulation of SLCO1B3 expression in GC may lead to the downregulation of MAP1S expression and the occurrence of GC cells. This assertion is supported by our in vitro reversal experiment findings. A substantial body of literature suggests that SLCO1B3 expression levels and functions vary across different cancer types. In this study, we first sequenced clinical samples, subsequently obtaining results from pathological tissue section analysis, in vitro cell experiments, and animal experiments. We propose that SLCO1B3 promotes the occurrence and development of GC cells. Furthermore, we identified MAP1S as a downstream mediator of the tumorigenic effects of SLCO1B3. However, this study has some limitations. The primers designed for this study cannot identify CT-SLCO1B3 and LT-SLCO1B3 specifically, and we did not investigate the pathways through which SLCO1B3 exerts its effects. Thus, the bidirectional role of SLCO1B3 in different tumor types remains unclear. Future studies on this gene should investigate the specific pathways through which it exerts its effects to validate the conclusions of this study. 5. Conclusion SLCO1B3 expression is substantially higher in GC tissue than in nearby normal tissue, indicating that it could be used as a prognostic and diagnostic marker for GC. SLCO1B3 expression is positively correlated with Ki-67 expression, promoting the occurrence and development of GC cells. Furthermore, SLCO1B3 promotes GC growth by regulating MAP1S expression. Declarations Authors' contributions Shihao Liang: Research design (lead), methodology (lead), initial draft writing (lead). Yangyuan Huang: Data validation (co-author), review and editing (co-author). Liping Li: Software development (co-author), data validation (co-author). Qingyu Zeng: Data validation (co-author). Wenjie Liao: Software development (co-author). Weiyan Li: Review and editing (co-author). Leiyu Qin: Survey research (co-author). Bin Li: Conceptual design (lead), Funding acquisition (lead), Survey research (co-author), Methodology (supporting), Project management (lead). All authors read and approved the final manuscript. Funding This research was funded by Guangxi Medical and health key discipline construction project; the Department of Science and Technology of Guangxi Zhuang Autonomous Region, Guangxi Science and Technology Program Project under grant, Guangxi Clinical Medical Research Center for Early Diagnosis and Treatment of Gastric Cancer (No. AD23026091); General Program of National Natural Science Foundation of China (No. 82173075);Innovation Project of Guangxi Graduate Education (No. YCBZ2024182) and Graduate Research Program of Guilin Medical University (No. GYYK2025005). Acknowledgments We thank LetPub (www. letpub. com) for its linguistic assistance during the preparation of this manuscript. Competing interests The authors declare no conflict of interest related to this article. Availability of data and materials The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethics approval and consent to participate This study has been approved by the Ethics Committee of the First Affiliated Hospital of Guilin Medical University, and all experimental procedures comply with the principles of the Declaration of Helsinki. Consent for publication Not applicable. References F B, M L, H S, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin . 2024;74(3):229-263. doi:10.3322/caac.21834 Li M, Cao S, Xu RH. Global trends and epidemiological shifts in gastrointestinal cancers: insights from the past four decades. Cancer Commun (Lond) . 2025;n/a(n/a). doi:10.1002/cac2.70017 Diao X, Guo C, Jin Y, et al. Cancer situation in China: an analysis based on the global epidemiological data released in 2024. Cancer Commun (Lond) . 2024;45(2):178-197. doi:10.1002/cac2.12627 Oswald S. Organic Anion Transporting Polypeptide (OATP) transporter expression, localization and function in the human intestine. Pharmacology & Therapeutics . 2019;195:39-53. doi:10.1016/j.pharmthera.2018.10.007 B H, B S, Kp L. Organic anion transporting polypeptides: pharmacology, toxicology, structure, and transport mechanisms. Pharmacological reviews . 2025;77(2). doi:10.1016/j.pharmr.2024.100023 X Z, Y C, T L, C L. Transcriptome analysis of healthy and fatty liver revealed that inhibition of SLCO1B3 induces abnormal liver metabolism and lipid synthesis. Poult Sci . 2023;102(11). doi:10.1016/j.psj.2023.103023 M N, T F, S M, et al. Identification of a new organic anion transporting polypeptide 1B3 mRNA isoform primarily expressed in human cancerous tissues and cells. Biochem Biophys Res Commun . 2012;418(4):818-823. doi:10.1016/j.bbrc.2012.01.115 N T, K K, Er J, et al. A cancer-specific variant of the SLCO1B3 gene encodes a novel human organic anion transporting polypeptide 1B3 (OATP1B3) localized mainly in the cytoplasm of colon and pancreatic cancer cells. Mol Pharmaceutics . 2013;10(1):406-416. doi:10.1021/mp3005353 T F, Y S, K C. Cancer-type organic anion transporting polypeptide 1B3: current knowledge of the gene structure, expression profile, functional implications and future perspectives. Curr Drug Metab . 2015;16(6):474-485. doi:10.2174/1389200216666150812142715 L Z, L Z, X Z, et al. SLCO1B3 promotes colorectal cancer tumorigenesis and metastasis through STAT3. Aging (Milano) . 2021;13(18). doi:10.18632/aging.203502 Y S, M H, O S, et al. Cancer-type OATP1B3 mRNA has the potential to become a detection and prognostic biomarker for human colorectal cancer. Biomarkers Med . 2017;11(8). doi:10.2217/bmm-2017-0098 Tang T, Wang G, Liu S, et al. Highly expressed SLCO1B3 inhibits the occurrence and development of breast cancer and can be used as a clinical indicator of prognosis. Sci Rep . 2021;11(1):631. doi:10.1038/s41598-020-80152-0 Hase H, Aoki M, Matsumoto K, et al. Cancer type‑SLCO1B3 promotes epithelial‑mesenchymal transition resulting in the tumour progression of non‑small cell lung cancer. Oncol Rep . 2021;45(1):309-316. doi:10.3892/or.2020.7839 Barbier RH, McCrea EM, Lee KY, et al. Abiraterone induces SLCO1B3 expression in prostate cancer via microRNA-579-3p. Sci Rep . 2021;11(1):10765. doi:10.1038/s41598-021-90143-4 Rajanala SH, Plym A, Vaselkiv JB, et al. SLCO1B3 and SLCO2B1 genotypes, androgen deprivation therapy, and prostate cancer outcomes: a prospective cohort study and meta-analysis. Carcinogenesis . 2024;45(1-2):35-44. doi:10.1093/carcin/bgad075 Deng F, Laasik M, Salminen L, et al. Toxicity and therapy outcome associations in LIG3, SLCO1B3, ABCB1, OPRM1 and GSTP1 in high-grade serous ovarian cancer. Basic Clin Pharmacol Toxicol . 2023;132(6):521-531. doi:10.1111/bcpt.13866 Fischer I. Perspective: examining MAP1B structure with an evolutionary perspective. Cytoskelet (hob NJ) . Published online July 10, 2025. doi:10.1002/cm.70000 MacTaggart B, Wang J, Tang HY, Kashina A. Arginylation of ⍺-tubulin at E77 regulates microtubule dynamics via MAP1S. J Cell Biol . 2025;224(4):e202406099. doi:10.1083/jcb.202406099 Li W, Dai Y, Shi B, et al. LRPPRC sustains yap-P27-mediated cell ploidy and P62-HDAC6-mediated autophagy maturation and suppresses genome instability and hepatocellular carcinomas. Oncogene . 2020;39(19):3879-3892. doi:10.1038/s41388-020-1257-9 Wang J, Zhang X, Yang F, et al. RASSF1A enhances chemosensitivity of NSCLC cells through activating autophagy by regulating MAP1S to inactivate Keap1-Nrf2 pathway. Drug Des Dev Ther . 2021;15:21-35. doi:10.2147/DDDT.S269277 Gallob F, Brcic L, Eidenhammer S, Rumpp F, Nerlich A, Popper H. Senescence and autophagy in usual interstitial pneumonia of different etiology. Virchows Arch: Int J Pathol . 2021;478(3):497-506. doi:10.1007/s00428-020-02917-2 Jia X, Zhai T, Zhang JA. Circulating exosome involves in the pathogenesis of autoimmune thyroid diseases through immunomodulatory proteins. Front Immunol . 2021;12:730089. doi:10.3389/fimmu.2021.730089 Numata Y, Fujii T, Toda C, et al. Digoxin promotes anoikis of circulating cancer cells by targeting Na+/K+-ATPase α3-isoform. Cell Death Dis . 2025;16(1):373. doi:10.1038/s41419-025-07703-z It L, Ch S, Fc T, Cb C, Ks M. Cancer-derived extracellular vesicles as biomarkers for cutaneous squamous cell carcinoma: a systematic review. Cancers . 2022;14(20). doi:10.3390/cancers14205098 R P, S V, M A, et al. Altered profile of E1-S transporters in endometrial cancer: lower protein levels of ABCG2 and OSTβ and up-regulation of SLCO1B3 expression. Int J Mol Sci . 2021;22(8). doi:10.3390/ijms22083819 J X, R S, S W, L Z. Construction of a prognostic signature for serous ovarian cancer based on lactate metabolism-related genes. Front Oncol . 2022;12. doi:10.3389/fonc.2022.967342 X Z, X C, J L, et al. A novel metabolism-related prognostic gene development and validation in gastric cancer. Clin Transl Oncol : Off Publ Fed Span Oncol Soc Natl Cancer Inst Mex . 2023;25(2):447-459. doi:10.1007/s12094-022-02958-w B H, D L, L M, Mf F, J K. Transcriptional regulation of liver-type OATP1B3 (lt-OATP1B3) and cancer-type OATP1B3 (ct-OATP1B3) studied in hepatocyte-derived and colon cancer-derived cell lines. Pharmaceutics . 2023;15(3). doi:10.3390/pharmaceutics15030738 I F. Perspective: examining MAP1B structure with an evolutionary perspective. Cytoskelet (hob NJ) . Published online October 7, 2025. doi:10.1002/cm.70000 Granados-López AJ, Manzanares-Acuña E, López-Hernández Y, et al. UVB inhibits proliferation, cell cycle and induces apoptosis via p53, E2F1 and microtubules system in cervical cancer cell lines. Int J Mol Sci . 2021;22(10):5197. doi:10.3390/ijms22105197 M P, Md S, V J, H S. The novel anti-cancer feature of brazzein through activating of hTLR5 by integration of biological evaluation: molecular docking and molecular dynamics simulation. Sci Rep . 2022;12(1). doi:10.1038/s41598-022-26487-2 Y G, J L, B S, et al. HBx-induced upregulation of MAP1S drives hepatocellular carcinoma proliferation and migration via MAP1S/smad/TGF-β1 loop. Int J Biol Macromol . 2024;281(Pt 3). doi:10.1016/j.ijbiomac.2024.136327 Additional Declarations No competing interests reported. Supplementary Files RawDataforWesternBlotExperiment.pdf Cite Share Download PDF Status: Published Journal Publication published 29 Mar, 2026 Read the published version in BMC Cancer → Version 1 posted Editorial decision: Revision requested 06 Jan, 2026 Reviews received at journal 26 Dec, 2025 Reviewers agreed at journal 22 Dec, 2025 Reviews received at journal 19 Dec, 2025 Reviewers agreed at journal 19 Dec, 2025 Reviewers invited by journal 15 Dec, 2025 Editor assigned by journal 08 Dec, 2025 Editor invited by journal 13 Nov, 2025 Submission checks completed at journal 12 Nov, 2025 First submitted to journal 12 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7967187","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":561836749,"identity":"4b4b2a2e-599e-45c0-a649-fbdf2d463062","order_by":0,"name":"Shihao Liang","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shihao","middleName":"","lastName":"Liang","suffix":""},{"id":561836750,"identity":"229bde86-3fe2-426c-bf10-2080ada53b0d","order_by":1,"name":"Yangyuan Huang","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yangyuan","middleName":"","lastName":"Huang","suffix":""},{"id":561836751,"identity":"8a1f8e3e-6055-4614-810c-e98d7f62b07e","order_by":2,"name":"Liping Li","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Liping","middleName":"","lastName":"Li","suffix":""},{"id":561836752,"identity":"4d878b77-b31b-47a3-9857-ababdc121afc","order_by":3,"name":"Qingyu Zeng","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qingyu","middleName":"","lastName":"Zeng","suffix":""},{"id":561836753,"identity":"999a54c7-8aef-4fe4-ae96-62ebbff26a71","order_by":4,"name":"Wemjie Liao","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wemjie","middleName":"","lastName":"Liao","suffix":""},{"id":561836754,"identity":"bf157478-480b-4295-b77d-fe2bf3db2c9b","order_by":5,"name":"Weiyan Li","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weiyan","middleName":"","lastName":"Li","suffix":""},{"id":561836755,"identity":"d2564a28-04df-423a-8fef-130353f1d82b","order_by":6,"name":"Leiyu Qin","email":"","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Leiyu","middleName":"","lastName":"Qin","suffix":""},{"id":561836756,"identity":"229b1c6c-2a04-4d5d-b2b9-41f863909f9d","order_by":7,"name":"Bin Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtElEQVRIiWNgGAWjYBACPgYGNoYEBgY5Nvb2A8RpYYNqMebjOZNAghYgSJwn4WBApBb25mMPHlTcSW+TAFr2o2IbEVp4jqUbJJx5ltsm3XiAsefMbSK0SOSYSSS2Hc5tkzmQwMzYRowW+fffJBL/HU5nk0gwIFKLBA+bRGLD4QQStPCkmRskHDts2AYM5INE+YWf/fCzhz9qDsvLt7cffPCjgggtKOAAiepHwSgYBaNgFOACANC3OQXwt245AAAAAElFTkSuQmCC","orcid":"","institution":"Affliated Hospital of Guilin Medical University","correspondingAuthor":true,"prefix":"","firstName":"Bin","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-10-28 16:32:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7967187/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7967187/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12885-026-15917-3","type":"published","date":"2026-03-29T16:13:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":98778548,"identity":"4c2908d1-d31a-420e-864b-30e0fc40846a","added_by":"auto","created_at":"2025-12-22 12:29:26","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6677053,"visible":true,"origin":"","legend":"","description":"","filename":"AmechanisticstudyrevealingthatSLCO1B3promotesgastriccancerdevelopmentandmetastasisthroughMAP1Sexpressiondownregulationwithfig.docx","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/5e8545a49e3e1c3bbee2c5f4.docx"},{"id":98756197,"identity":"94d83102-2f8e-4e48-8aab-83d934276c5f","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8689,"visible":true,"origin":"","legend":"","description":"","filename":"dde23bdef8ab411e9de2c48ab7891de0.json","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/6be55e9571fcf419160b3f5f.json"},{"id":98780140,"identity":"e7682a9a-6254-4e73-bbf7-d7ee077be205","added_by":"auto","created_at":"2025-12-22 12:31:06","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9955218,"visible":true,"origin":"","legend":"","description":"","filename":"RawDataforWesternBlotExperimentd1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/ab349927040d2930ee052872.pdf"},{"id":98779042,"identity":"7c1d6813-4cb6-4a5f-8dc9-14cf5e9498fa","added_by":"auto","created_at":"2025-12-22 12:29:53","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":117656,"visible":true,"origin":"","legend":"","description":"","filename":"dde23bdef8ab411e9de2c48ab7891de01enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/e4973bb1f6e0bbe3b2dbf8fb.xml"},{"id":98756210,"identity":"f0668d44-5e1a-4788-b45a-7d1f5751b206","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10573550,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/b88e27ed0efa74eb6c2acc63.jpeg"},{"id":98778014,"identity":"fb21cca8-9ddd-4326-be9e-b3ef1aaa871a","added_by":"auto","created_at":"2025-12-22 12:28:48","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9190706,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/f0f8672d038dbaf6a6fac092.jpeg"},{"id":98756204,"identity":"446544c3-cd99-4c72-b3b3-1c6fa5a9c2ec","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8374106,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/af5b8236124ea210110a9a7b.jpeg"},{"id":98780350,"identity":"84e62591-edd2-4c8e-93de-cb71a98ef2a7","added_by":"auto","created_at":"2025-12-22 12:31:14","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9817226,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/530f069494db046d2372c71f.jpeg"},{"id":98756203,"identity":"bf0aef20-74d3-42bb-80e7-995887674584","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6796422,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/9aa728e1391850cecb56f0d2.jpeg"},{"id":98780310,"identity":"768f38d3-5a0d-4e5e-9ed3-8fdf2aaca93e","added_by":"auto","created_at":"2025-12-22 12:31:12","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10484762,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/0c2c3a953b560ef4d0a804ce.jpeg"},{"id":98777920,"identity":"03afe4c1-0b46-4a41-b25d-c98bc8db21a9","added_by":"auto","created_at":"2025-12-22 12:28:40","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7198002,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/d31e20f7f085780a9efb4541.jpeg"},{"id":98778809,"identity":"a049624c-39c8-4e81-856f-bbfb194c6bd8","added_by":"auto","created_at":"2025-12-22 12:29:40","extension":"wmf","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":380,"visible":true,"origin":"","legend":"","description":"","filename":"image1.wmf","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/9c092f1dc2812ae315426942.wmf"},{"id":98777998,"identity":"5d628ded-ccf9-4323-852b-15eb405a9c78","added_by":"auto","created_at":"2025-12-22 12:28:47","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136981,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/d3108ba186cd1c7fb3ea5694.png"},{"id":98778534,"identity":"0ea42ac9-09ab-4c71-8da5-4e2901ef35ff","added_by":"auto","created_at":"2025-12-22 12:29:25","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":95904,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/71e67c4a97d46971d514a022.png"},{"id":98756194,"identity":"224b122b-c53f-4e49-a08d-3e76a3679197","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":281117,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/8202924cb4876f7a2818a999.png"},{"id":98778560,"identity":"c629cf7e-db76-4a21-9213-99b9e272fcfa","added_by":"auto","created_at":"2025-12-22 12:29:27","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88027,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/002e4f4317fc7b07e765e0ae.png"},{"id":98756216,"identity":"fbd5baf3-7412-42db-82f1-860f0cf5c7ad","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74083,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/a236ac863a0e7b678b80905f.png"},{"id":98756208,"identity":"d36039d2-c1da-47a0-aaf4-db97e287b208","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":173459,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/2d302ec0b8c6575178fbdd65.png"},{"id":98756219,"identity":"5c18a78a-e0a2-49fb-bd78-cb7f7be49646","added_by":"auto","created_at":"2025-12-22 09:31:33","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":199940,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/f4fd07e70f502bc98e4ba838.png"},{"id":98756213,"identity":"d5bfb1c0-315d-4d16-a5b5-c9ad1921f9f2","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":240,"visible":true,"origin":"","legend":"","description":"","filename":"Onlineimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/2c0293dd233bf5126040cb59.png"},{"id":98756205,"identity":"d240edc4-68b0-4ae3-a519-6c77fc92339c","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116472,"visible":true,"origin":"","legend":"","description":"","filename":"dde23bdef8ab411e9de2c48ab7891de01structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/4755471deb319e0f14ed4d5c.xml"},{"id":98756217,"identity":"6f53dcca-f6ef-4147-9376-4904e6b882cf","added_by":"auto","created_at":"2025-12-22 09:31:32","extension":"html","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127735,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/7f67a12fcd08fbfd56263f54.html"},{"id":98778637,"identity":"2fc1be97-5e54-4586-8d77-3d4b7612be1f","added_by":"auto","created_at":"2025-12-22 12:29:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":255621,"visible":true,"origin":"","legend":"\u003cp\u003eSLCO1B3 exhibits a strong association with gastric cancer. (A) Principal Component Analysis (PCA) plot of sample components from clinical sequencing data. (B) Heatmap of differentially expressed genes identified from clinical sequencing. (C, D) Gene Ontology (GO) and KEGG pathway analyses of significantly differentially expressed genes from clinical sequencing. (E) In TCGA data, SLCO1B3 mRNA exhibits high expression in gastric cancer tissues. (F) Analysis using the Kaplan-Meier Plotter database reveals poorer survival prognosis in the SLCO1B3 high-expression group, *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05. (G,H) IHC experimental analysis demonstrates high SLCO1B3 expression in gastric cancer tissues, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.00001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/e0ebb4cea9dd65dbf5d03f0e.png"},{"id":98756196,"identity":"80a01357-b911-4cda-9759-26acdae52173","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":207660,"visible":true,"origin":"","legend":"\u003cp\u003eSLCO1B3 regulates malignant growth in gastric cancer. (A,B) Q-PCR analysis of SLCO1B3 gene transcripts in HGC-27 and AGS cells was performed in overexpression versus control groups and knockdown versus control groups. (C–F) Western blotting detected SLCO1B3 gene expression levels in gastric cancer cell lines, using GAPDH as the reference gene. Bar charts display the mean ± SD of SLCO1B3 overexpression and knockdown across three independent experiments. (G–I) Colony formation assays in HGC-27 cells following SLCO1B3 gene regulation. (J–L) Colony formation assays in AGS cells following SLCO1B3 gene regulation. (M–P) CCK-8 assays in gastric cancer cells from SLCO1B3 overexpression and control groups, and SLCO1B3 knockdown and control groups. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, n = 3, Student's t-test.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/724a34d688e95ed5cd173664.png"},{"id":98778650,"identity":"5ff38c64-2884-4bb1-a4d6-b72cd06ed81c","added_by":"auto","created_at":"2025-12-22 12:29:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":358197,"visible":true,"origin":"","legend":"\u003cp\u003eSLCO1B3 regulates gastric cancer invasion and metastasis. (A,B) Wound healing assays assessed SLCO1B3's impact on cancer cell migration capacity, showing relative migration ability (mean±SD, n = 3, Student's t-test). The right-hand bar chart quantifies wound healing assays at 0 and 48 hours. (C–F) Migration of gastric carcinoma (GC) cells overexpressing SLCO1B3, SLCO1B3-knockdown, and control groups. Scale bar represents 200 μm. The right-hand bar chart quantitatively compares the number of migrating cells per field. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, n = 3, Student's t-test.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/16c3eeff1b9321b4f79d344b.png"},{"id":98756192,"identity":"c8ca1bb9-0b79-4449-ba14-30ad0c58b2ff","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":174226,"visible":true,"origin":"","legend":"\u003cp\u003eSequencing of gastric cancer cells overexpressing SLCO1B3 to identify downstream target genes. (A) Bar chart analysis of differentially expressed genes between SLCO1B3-overexpressing and control gastric cancer cells. (B) Heatmap of differentially expressed genes between SLCO1B3-overexpressing and control gastric cancer cells. (C, D) Gene Ontology (GO) analysis and KEGG pathway analysis of SLCO1B3-overexpressing versus control gastric cancer cells.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/5fc7a979a3a78c6c172b8fb0.png"},{"id":98756198,"identity":"150d3395-0fc9-41b5-991a-bf73b1876b88","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":139765,"visible":true,"origin":"","legend":"\u003cp\u003eSLCO1B3 exerts its effects by regulating MAP1S protein translation. (A,B) RT-qPCR analysis of SLCO1B3-overexpressing and control GC cells. (C–H) Western blotting results demonstrate that SLCO1B3 overexpression downregulates MAP1S expression levels, whereas SLCO1B3 knockdown produces the opposite effect. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, n = 3, Student's t-test.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/13f54621b56c086e2171c803.png"},{"id":98756199,"identity":"2dd3d2cc-057c-4748-bdb4-d4f768ea008c","added_by":"auto","created_at":"2025-12-22 09:31:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":332292,"visible":true,"origin":"","legend":"\u003cp\u003eSLCO1B3 regulates gastric cancer proliferation, invasion and migration by modulating MAP1S. (A) Q-PCR analysis of MAP1S overexpression versus control plasmid expression in gastric cancer cells, ***p\u0026lt;0.0001. (B) Western blotting analysis of MAP1S and control plasmid protein expression in gastric cancer cells. Bar charts display mean ± SD of MAP1S overexpression across three independent experiments, ****p\u0026lt;0.00001. (C,D) Colony formation assays in gastric cancer cells co-transfected with SLCO1B3 and MAP1S overexpression plasmids. (E,F) CCK8 assays performed on gastric cancer cells co-transfected with SLCO1B3 and MAP1S overexpression plasmids. (G,H) Wound healing analysis assessing migration capacity of gastric cancer cells co-transfected with SLCO1B3 and MAP1S overexpression plasmids, showing relative migration ability (mean±SD, n = 3, Student's t-test). The right-hand bar chart quantifies wound healing at 0-h and 48-h time points. (I,J) Evaluation of migration in GC cells co-transfected with SLCO1B3 and MAP1S overexpression plasmids. Scale bar represents 200 μm. The right-hand bar chart quantitatively compares the number of migrating cells per field. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, n = 3, Student's t-test.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/76b232744c14f2742aec988f.png"},{"id":98778408,"identity":"face9a04-7e77-49bf-8fc2-ed90277a6646","added_by":"auto","created_at":"2025-12-22 12:29:14","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":289741,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of SLCO1B3 promotes in vivo proliferation of gastric cancer cells. (A,B) Western blotting analysis of SLCO1B3 protein expression in gastric cancer cells stably overexpressing SLCO1B3. (C,D) Xenograft tumours overexpressing SLCO1B3 exhibited accelerated volume growth. (E,F) Xenografts overexpressing SLCO1B3 demonstrated increased tumour mass. (G,H) Representative tumour tissue immunohistochemical analysis. *p\u0026lt;0.05, **p\u0026lt;0.001, ***p\u0026lt;0.0001, n=3, Student's t-test.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/99a9966bd1907516bc6f00ea.png"},{"id":105755315,"identity":"b0e68f89-6a69-4cf8-b8ba-edebe36d5eeb","added_by":"auto","created_at":"2026-03-30 16:26:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2612228,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/10786bfc-6126-4901-9ef7-ef505c34b372.pdf"},{"id":98778028,"identity":"d9a7725f-08bb-4e3c-8201-dda0c1e62115","added_by":"auto","created_at":"2025-12-22 12:28:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":9955218,"visible":true,"origin":"","legend":"","description":"","filename":"RawDataforWesternBlotExperiment.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7967187/v1/9c268dabf40182848039d8b4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A mechanistic study revealing that SLCO1B3 promotes gastric cancer development and metastasis through MAP1S expression downregulation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eGastric cancer (GC) remains one of the most common malignant tumors worldwide and is a major cause of death\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Gastrointestinal tumors account for 23.9% of all new cancer cases and 33.2% of cancer-related deaths globally\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In China, the incidence and mortality rates of gastrointestinal tumors remain high\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Traditionally, the primary treatment for GC has been surgery, with molecular targeted therapy as an adjunct. Recently, significant progress has been made in the treatment of GC through molecular targeted therapy and immunotherapy. Therefore, in-depth explorations of the mechanisms underlying GC development and the identification of new therapeutic targets hold important clinical and social significance for GC treatment.\u003c/p\u003e \u003cp\u003eSolute carrier is a major family of transport proteins involved in drug uptake, playing a crucial role in determining chemotherapy efficacy (sensitivity and resistance) and/or toxicity\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. The solute carrier organic anion transporter family members 1B3 (SLCO1B3) and 1B1 (SLCO1B1) are predominantly expressed in hepatocytes and represent the most well-investigated solute carriers. SLCO1B3, referred to as organic anion transport polypeptide (OATP) 1B3, LST-2, and OATP8\u003csup\u003e5\u003c/sup\u003e, is integral to the cellular transfer of numerous clinically significant pharmaceuticals and natural substances. SLCO1B3 is typically expressed in the basolateral region of hepatocytes\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Its expression is very low in the gastrointestinal tract, unlike that in normal liver tissue and cancerous tissue\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Recent findings have indicated that a shortened variant of SLCO1B3 is expressed in human tumors and certain cancer cell lines\u003csup\u003e\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. This variant of SLCO1B3 is primarily located in the cytoplasm and is considered a potential prognostic biomarker for colorectal\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e and pancreatic cancers\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. However, the role of SLCO1B3 in cancer exhibits polymorphism. In breast cancer, SLCO1B3 inhibits cancer cell proliferation, migration, and invasion and is associated with the HER2 signaling pathway\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, whereas the opposite effects are observed in non-small cell lung cancer\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e and prostate cancer\u003csup\u003e\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMicrotubule-associated protein 1S (MAP1S) is the most widely expressed member of the MAP1 family, essential for accurate cell division, and serves as a link between mitochondria and microtubules for transport\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. MAP1S also plays a bridging role in autophagy between microtubules and mitochondria, influencing the biogenesis and degradation of autophagosomes\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The early accumulation of genomic instability prior to the emergence of tumorigenic signs indicates that genomic instability drives tumorigenesis. Following tumorigenesis, tumor development subsequently triggers the activation of autophagy, thereby reducing genomic instability in the tumor foci\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Meanwhile, in studies on various inflammatory diseases, including pneumonia\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e and autoimmune thyroiditis\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, MAP1S has been shown to promote inflammatory progression when suppressed or inhibit inflammatory progression via autophagy pathway activation.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eSLCO1B3 in GC is strongly associated with prognosis. Clinical data analyses revealed that SLCO1B3 expression in GC tissues is markedly elevated compared with that in neighboring normal tissues. Furthermore, elevated SLCO1B3 expression is correlated with diminished patient survival rates. The diagnostic and prognostic significance of SLCO1B3 and its functional role in human GC remain to be investigated.\u003c/p\u003e \u003cp\u003eThis study was conducted to investigate the correlation between SLCO1B3 and the clinicopathological features and prognosis of GC patients. We examined the functional effects of SLCO1B3 in human GC cell proliferation, migration, and invasion in vitro. Furthermore, we investigated SLCO1B3 involvement in GC development in vivo and analyzed the molecular processes associated with SLCO1B3 and MAP1S in GC onset and progression.\u003c/p\u003e"},{"header":"2. Method","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eBioinformatics prediction\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUse the Cancer Genome Atlas (TCGA) database to analyse the differences in SLCO1B3 expression levels in cancer and cancer-adjacent tissues. Utilise the Kaplan-Meier plotter(KM) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://kmplot.com/analysis/\u003c/span\u003e\u003cspan address=\"https://kmplot.com/analysis/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to examine gastric cancer-related data and assess the influence of varying SLCO1B3 expression levels on gastric cancer survival prognosis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eResearch subjects and materials\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThis study obtained the clinical data of 18 gastric cancer patients from the First Affiliated Hospital of Guilin Medical University. Tissue samples were obtained from patients with gastric cancer (GC) who had not undergone radiotherapy or chemotherapy at the time of collection. Clinical and pathological data were gathered for all patients, and the American Joint Committee on Cancer (AJCC) criteria were employed to stage and classify tumours. The study was approved by the Ethics Committee of the First Affiliated Hospital of Guilin Medical University (Ethics Approval Number: 2024YJSLL-113).\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA extraction and RT-qPCR\u003c/b\u003e \u003c/p\u003e \u003cp\u003eExtract RNA from the sample using TRIzol (Invitrogen) according to the provided instructions. Then prepare cDNA using the TOLOBIO kit. Target sequence information from the NCBI database was used to design primers using the primer design tool (NCBI, USA).The ultimate reaction volume was 10 \u0026micro;L, and all qRT-PCR assays were conducted utilising the CFX96 Touch real-time fluorescence quantitative PCR detection system (Bio-Rad). All primers were synthesised by Sangon Biotech Co., Ltd., located in Shanghai, China. Data were analysed with the 2-ΔΔCt technique, employing GAPDH as the normalisation control for these assessments.All analyses were performed in triplicate.The primers used were:SLCO1B3-Forward:TTGGAAGGGTCTACTTGGGCTTATC,SLCO1B3-Reverse:TTTCTTTCATTGTCCGATGCCTTGG;MAP1S-Forward:CGCCTTCTTCGCGTCAATG,MAP1S-Reverse:TGCCGCACCAGCTTCCAG;G3BP2-Forward:GAGGACCAAGACCAGGCAGAG,G3BP2-Reverse:TGGATAGCGAATTATTCTACGGTTGTC;MEX3C-Forward:CTTATCGTGTGGTAGGATTAGTGGTTG,MEX3C-Reverse:ATCTCTGCTCGGAGTTACTATGTAGG;YTHDF3-Forward:TCTGTTGTGGACTATAATGCGTATGC,YTHDF3-Reverse:GCGAATATGCCGTAATTGGTTATTGG;GAPDH-Forward:CAGGAGGCATTGCTGATGAT,GAPDH-Reverse:GAAGGCTGGGGCTCATTT.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunohistochemistry (IHC)\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePerform immunohistochemical (IHC) staining using an anti-SLCO1B3 antibody (Proteintech, dilution 1:400). Analyse the correlation between SLCO1B3 expression quantity in gastric cancer tissues and adjacent non-cancerous tissues (n\u0026thinsp;=\u0026thinsp;18) using IHC scoring. Following staining, two pathologists independently evaluated the samples according to staining intensity and the proportion of positively stained cells, assigning intensity ratings as follows: 0 (no staining), 1 (yellow), 2 (yellow-brown), and 3 (brown). The proportion of positive cells was quantified as follows: 0 (less than 5%), 1 (5\u0026ndash;25%), 2 (26\u0026ndash;50%), 3 (51\u0026ndash;75%), and 4 (76% or greater). The two scores are subsequently multiplied to determine the relative expression index. A final score of less than 4 indicates low expression and a score of 4 or more indicates high expression. Immunohistochemistry (IHC) of mouse xenograft tumour tissues was performed using a microscopic imaging system to acquire images of the sections. Each section was first observed at low magnification to examine the entire tissue. Then, 400\u0026times; microscopic images were acquired, with a total of three images collected. The Halo data analysis system was used to calculate the percentage of positive area (% DAB-positive tissue) in each image. Independent samples t-tests were performed using SPSS 21.0 statistical analysis software, and data were presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (\u003cspan class=\"InlineEquation\"\u003e\u003c/span\u003e\u0026plusmn;\u0026thinsp;SD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell culture\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn 2023, the Guangxi Key Laboratory of Molecular Medicine for Liver Injury and Repair provided the AGS and HGC-27 cell lines. These cell lines have been confirmed to be free of mycoplasma contamination and can be used for up to six months. All cells can be passaged up to 25 times. AGS cells are cultivated in Ham's F-12K medium (Gibco, New York, USA), whereas HGC-27 cells are cultured in 1640 medium (Gibco). The culture media for both cell lines comprises 10% foetal bovine serum (Gibco) and 1% penicillin-streptomycin (Solarbio, China). The cells are maintained in a 37\u0026deg;C, 5% CO₂ incubator and the medium is changed three times weekly. The cells are passaged at 80% confluence using a 1:1 or 1:2 ratio. Gene transfection was performed using PolyJet M transfection reagent and puromycin (Solarbio, China) was used for selection to obtain stably transfected cell lines. The plasmids human SLCO1B3-pcDNA3.1-EGFP-PURO,SLCO1B3 sh1 pLVX-shRNA2-PURO and MAP1S-pcDNA3.1-T2A-TagRFP were purchased from Changsha Zheqiong Biotechnology Co., Ltd. (Youbao Biotechnology), and the yeast was provided by Tiangen Biotechnology Co., Ltd. (Beijing, China). Escherichia coli (E. coli) was also provided by Tiangen Biotechnology Co., Ltd. (Beijing, China). The commercial antibodies used were SLCO1B3 (mouse, Proteintech, Wuhan Sanying), SLCO1B3 (rabbit, Proteintech, Wuhan Sanying), MAP1S (rabbit, Proteintech, Wuhan Sanying) and GAPDH (rabbit, Abcam).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell transfection\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePerform transfection when the cell density in the 6-well plate reaches 70\u0026ndash;80%. Follow the PolyJet transfection reagent instructions for transfection. Replace the culture medium four hours after transfection. Observe the transfection fluorescence under a microscope 24\u0026ndash;48 hours later; extract cellular RNA after 48 hours and cellular protein after 72 hours for validation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blotting\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCell lysis was performed utilising RIPA buffer (Beyotime, China) supplemented with protease inhibitors. Centrifugation of the lysate is required to achieve the separation of cell debris. Subsequent to this, the protein samples must be separated by 8% SDS-PAGE and transferred to PVDF membranes. The membranes were sequentially blocked with defatted milk at 37\u0026deg;C for 1 hour, after which they were incubated overnight with specific antibodies.Protein levels were detected using an enhanced chemiluminescence detection kit (Biosharp), and quantitative analysis was performed using ImageJ software. It is important to note that all experiments were repeated on three separate occasions. The primary antibodies included: SLCO1B3 (rabbit, Proteintech, Wuhan Sanying), MAP1S (rabbit, Proteintech, Wuhan Sanying) and GAPDH (rabbit, Abcam).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCCK-8 test\u003c/b\u003e \u003c/p\u003e \u003cp\u003eHGC-27 and AGS cells need to be inoculated into a 96-well plate at a density of 8,000 cells per well, with five replicate wells for each group. After the cells have fully adhered to the walls (0 h), add 10\u0026micro;L of CCK-8 working solution to each well of the plate. The plate should then be incubated at 37\u0026deg;C and protected from light.After a culture period of 2 hours, the OD values at 450 nm should be measured and proliferation curves plotted at 24, 48, and 72 hours. The CCK-8 assay was performed on three separate occasions in independent experiments. The analysis of the data was conducted utilising GraphPad 10 software.\u003c/p\u003e \u003cp\u003e \u003cb\u003eColony formation experiment\u003c/b\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eForty-eight hours post-transfection, 1000 HGC-27 and AGS cells were seeded into a 6-well plate containing 2 mL of culture medium and cultured for a period of 7 to 14 days until visible clones formed.Subsequent to the elimination of the medium, the clones were air-dried, fixed with 4% para-formaldehyde at ambient temperature for 30 minutes, and dyed with a 0.1% crystal violet solution for 15 minutes.The cells were washed with Phosphate Buffered Saline (PBS) buffer, and images were collected. The clone counts were then analysed using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTranswell migration assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFollowing a 48-hour transfection period, 50,000 HGC-27 and AGS cells were seeded into the upper chamber, which contained 200 \u0026micro;L of serum-free 1640 medium and Ham's F-12k medium, respectively.The lower chambers were then filled with 600 \u0026micro;L of 20% FBS-containing 1640 medium and Ham's F-12k medium, respectively. Following a 48-hour incubation period at 37\u0026deg;C, the cells were fixed and stained with a 0.1% crystal violet solution. The residual cells in the upper chamber were subsequently eliminated, and photographs of the labelled cells were captured and processed using Image J software for quantification.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWound healing experiment\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSubsequent to a 48-hour period of transfection, a sterile 1 ml pipette tip should be utilised to create linear abrasions ('wounds') in the monolayer. The samples should subsequently be rinsed with Phosphate Buffered Saline (PBS), followed by the addition of serum-free media to eliminate any cellular debris. It is imperative that photographs are taken at 0 hours using an inverted microscope. Subsequent to a 48-hour period, photographic documentation of the same location should be conducted, with a subsequent comparison of the observations being made to assess cell migration. In order to enhance the clarity of the images, it is recommended that ImageJ software be employed for the purpose of analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA-Seq\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFollowing the extraction of total RNA from the samples, the removal of ribosomal RNA is undertaken in order to maximise the retention of all coding RNA and non-coding RNA (ncRNA). The resulting RNA is then subjected to random fragmentation, resulting in short fragments. These fragments are then used as a template to synthesise the first strand of cDNA using six-base random primers (random hexamers).Thereafter, a buffer, dNTPs (with dUTP substituting dTTP), RNase H, and DNA polymerase I are introduced to facilitate the synthesis of the second strand of cDNA. The cDNA is purified with a QiaQuick PCR kit, eluted using EB buffer, and then undergoes end repair, A-addition, and ligation of sequencing adapters. This is followed by the degradation of the second strand using UNG (Uracil-N-Glycosylase) enzyme.Subsequently, agarose gel electrophoresis is performed to select fragment sizes, followed by PCR amplification. The final sequencing library is prepared and sequenced using the Illumina NovaSeq 4000 (Illumina, USA) for RNA sequencing (RNA-seq). The identification of differentially expressed genes relies on the criterion of a P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and a fold change\u0026thinsp;\u0026gt;\u0026thinsp;1.5 or \u0026lt;\u0026thinsp;0.5.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGC heterologous transplantation mouse model\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMale BALB/c nude mice (3 weeks old) were procured from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China).The mouse model was established in accordance with a previously published protocol\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Mice were randomly assigned to two groups (n\u0026thinsp;=\u0026thinsp;5 per group) and subcutaneously injected with either SLCO1B3 stably overexpressed HGC-27 cells or an equivalent quantity of negative control HGC-27 cells. The objective of this study was to evaluate the impact of SLCO1B3 overexpression on the proliferation of GC xenograft tumours.Tumour dimensions were measured at two-day intervals using an external caliper. The tumour volume was determined using the subsequent formula: Tumour volume was computed using the formula: (length \u0026times; width)\u0026sup2; / 2. Mice were euthanized 21 days post-injection, and tumours were excised, photographed, and weighed. Subcutaneous tumour tissue was collected for IHC analysis. All animal tests were performed in compliance with international standards, namely the 3R principles, and received approval from the Animal Ethics Committee of the First Affiliated Hospital of Guilin Medical University.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e \u003cb\u003eAbnormal SLCO1B3 expression in GC\u003c/b\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWe collected GC and adjacent normal tissue samples from three patients at the First Affiliated Hospital of Guilin Medical University. Gene sequencing revealed that SLCO1B3 was highly overexpressed in GC tissues(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-D). Furthermore, confirmation through the The Cancer Genome Atlas database demonstrated that SLCO1B3 expression was markedly elevated in GC tissues when compared with its expression in surrounding normal tissues (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001)(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Furthermore, in an analysis of the Kaplan\u0026ndash;Meier online database, GC patients with high SLCO1B3 expression demonstrated significantly poorer survival outcomes than those with low SLCO1B3 expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Immunohistochemical staining revealed that SLCO1B3 is primarily expressed in the cytoplasm in cancer cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG,H), with markedly elevated expression in GC tissues versus surrounding non-cancerous tissues (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001)(Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Thus, SLCO1B3 may act as a tumor-promoting factor in GC.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCorrelation analysis between SLCO1B3 and clinical parameters in 17 patients with GC\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eVariables\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNumber of patients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eSLCO1B3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eχ \u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.471\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.162\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (5.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9 (52.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3 (17.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4 (23.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge (years)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.665\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2 (50.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6 (46.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2 (50.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7 (53.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrgan typology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e9.590\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLow polarisation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0 (0.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6 (46.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLow-to-moderate differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2 (50.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1 (7.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiddle-class differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0 (0.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4 (30.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHigh-low differentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0 (0.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHighly differentiated\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2 (15.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVascular Invasion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.049\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.67\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3 (75.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9 (69.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4 (30.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNerve Invasion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.121\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.421\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4 (100.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10 (76.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0 (0.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3 (23.1%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive Lymphatic Node\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.579\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e=\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2 (15.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3 (75.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11 (84.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDistant Metastasis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.579\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2(15.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3 (75.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11 (84.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.121\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.421\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4 (100.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10 (76.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0 (0.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3 (23.1%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMuc5Ac\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.243\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.555\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3 (75.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8 (61.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5 (38.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.700\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3 (75.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10 (76.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1 (25.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3 (23.1%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.679\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.574\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4 (100.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11 (84.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0 (0.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2 (15.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKi67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e9.590\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.006\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0 (66.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11 (84.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4 (100.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2 (15.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSLCO1B3 promotes the proliferative capacity of GC cells\u003c/b\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eNext, SLCO1B3 was either overexpressed or knocked down in AGS and HGC-27 GC cells by transfecting the respective NC, OE-SLCO1B3, control, and sh-SLCO1B3-1 plasmids. The transfection effectiveness was validated through qRT-PCR and Western blotting(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-F). Functional assays were then conducted, including Cell Counting Kit-8 (CCK-8), colony formation, wound healing, and Transwell assays.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe defining feature of cancer cells is their ability to proliferate without restriction. Thus, we investigated the effects of SLCO1B3 on AGS and HGC-27 cell proliferation using CCK-8 and colony formation assays. For the colony formation assay, 1,000 cells were seeded into each well of a six-well plate, fixed, and stained. The results showed that, at the same time point and under the same conditions, the number of colonies in cells with SLCO1B3 overexpression was significantly higher than that in the control group (NC). The opposite phenotype was observed when SLCO1B3 was knocked down(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-L). Cell viability was evaluated via the CCK-8 assay. GC cells from the NC, OE-SLCO1B3, and sh-SLCO1B3-1 groups were transfected with the respective plasmids and placed in a 96-well plate at a density of 5,000 cells per well. Cell optical density (OD) was assessed at 24, 48, and 72 hours. At 72 hours, cells transfected with OE-SLCO1B3 exhibited significantly higher OD values than the control group (NC). Cells transfected with sh-SLCO1B3-1 exhibited lower OD values than the control group at the same time point. These results suggest that SLCO1B3 promotes the proliferative capacity of GC cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eM-P).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSLCO1B3 promotes the migration ability of GC cells\u003c/b\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eOne of the defining characteristics of tumor cells is their ability to migrate, which can lead to tumor invasion and metastasis. To determine the effect of SLCO1B3 on GC cell migration, wound healing and Transwell experiments were conducted. AGS and HGC-27 cells were transfected with SLCO1B3 overexpression or knockdown plasmids. When the cell density reached 100%, the cells were scratched and subsequently cultured in serum-free medium. Images (4\u0026times; magnification) were captured at 0 and 48 hours. The wound healing assay results indicated that the migratory capacity of the SLCO1B3-overexpressing group was markedly superior to that of the NC group, whereas the migratory capacity of the SLCO1B3-knockdown group was significantly inferior to that of the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA,B). In the Transwell experiment, GC cells from the NC and OE-SLCO1B3 groups, as well as the control and sh-SLCO1B3-1 groups, were digested with trypsin. Each migration chamber was co-cultured with 50,000 cells, which were then fixed and stained after 48 hours. The results showed that overexpressing SLCO1B3 in AGS and HGC-27 cells increased the number of migrating cells compared with that observed in the control group. Furthermore, the cells' invasive ability was increased. The knockdown of SLCO1B3 in AGS and HGC-27 cells reduced the number of migratory cells relative to the empty vector group. These data indicate that SLCO1B3 enhances the migratory capacity of GC cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-F).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSLCO1B3 influences the transcription and protein expression of the MAP1S gene, and SLCO1B3 exerts its effects by regulating MAP1S protein expression.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNext, we investigated the regulatory mechanism of SLCO1B3 in GC cell proliferation and migration via RNA-Seq in HGC-27 cells overexpressing the SLCO1B3 gene. Many genes demonstrated altered expression in HGC-27 cells overexpressing SLCO1B3(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA,B). Several genes with the most obvious trends were screened, and qRT-PCR analysis was performed(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC,D). Only MAP1S demonstrated expression consistent with the sequencing results. Thus, we applied qRT-PCR and Western blotting to further investigate the expression pattern of MAP1S. Changes in SLCO1B3 influenced the overall level of MAP1S mRNA(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA,B). Western blotting revealed a negative correlation between MAP1S and SLCO1B3 in AGS and HGC-27 cells. Significantly reduced MAP1S levels were observed in SLCO1B3-overexpressing cells, whereas significantly increased levels were observed in SLCO1B3-knockdown cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-H). These findings suggest that SLCO1B3 regulates the occurrence and progression of GC through MAP1S.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSLCO1B3 promotes GC proliferation and migration by regulating MAP1S protein translation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further validate the role of SLCO1B3 in promoting GC proliferation by regulating MAP1S protein translation, we transfected the MAP1S empty vector plasmid (Vector) and the MAP1S overexpression plasmid (OE-MAP1S) into AGS and HGC-27 cells. Transfection efficiency was confirmed by qRT-PCR and Western blotting(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA,B). The NC and SLCO1B3-overexpressing cell lines were then co-transfected with the MAP1S empty vector plasmid and the SLCO1B3-overexpressing plasmid, yielding the following: Vector\u0026thinsp;+\u0026thinsp;NC (control), OE-SLCO1B3, and OE-SLCO1B3\u0026thinsp;+\u0026thinsp;OE-MAP1S. Functional experiments were then performed using these cells. In the colony formation assay, we cultured 500 gastric cancer cells, which had been treated as described above, in each well of a six-well plate. After 14 days, staining and observation revealed that promoting MAP1S had effectively reversed the pro-proliferative effect of SLCO1B3 overexpression on GC cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC,D). The viability of GC cells was assessed using the CCK-8 assay. Five thousand cells were cultured in each well of a 96-well plate. Cell optical density (OD) values were measured at 24, 48, and 72 hours. The results indicated that promoting MAP1S effectively reversed the pro-proliferative effect of SLCO1B3 overexpression in GC cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE,F). Subsequently, we examined the function of SLCO1B3 in modulating MAP1S translation in GC cell migration using wound healing and Transwell assays. In the wound healing assay, cells at 100% density were scratched and cultured in serum-free medium. Images were captured at 0 and 48 hours(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG,H). In the Transwell migration experiment, 50,000 cells were cultured in each migration chamber and subsequently fixed and stained after 24 hours(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI,J). The results showed that promoting MAP1S effectively inhibited the GC cell migration promoted by SLCO1B3 overexpression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of SLCO1B3 overexpression on GC formation in vivo\u003c/b\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eNext, we investigated the role of SLCO1B3 in GC development in a mouse xenograft model. HGC-27 cells were stably transfected with OE-SLCO1B3 or NC and selected using puromycin. Western blotting confirmed SLCO1B3 gene overexpression(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA,B). Stabilized, overexpressed HGC-27 cells (OE-SLCO1B3) or an equivalent number of NC cells were subcutaneously injected into the axillary region of male BALB/cA-nu nude mice (n\u0026thinsp;=\u0026thinsp;5 per group). The xenograft tumors that formed from HGC-27 cells overexpressing SLCO1B3 developed noticeably faster than those derived from control cells. The mice were euthanized 21 days after injection. After 3 weeks of growth, the tumors were larger and heavier(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC,D). Given the previous immunohistochemical results, we performed IHC experiments on the excised tumors. The SLCO1B3 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and Ki-67 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) positivity rates in xenograft tumors derived from HGC-27 cells overexpressing SLCO1B3 were significantly higher than those in tumors derived from control cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG,H).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn this study, we investigated the association between SLCO1B3 and the prognosis and clinical pathological features of GC patients. Our clinical sample evaluation revealed that the malignant tissues of GC patients demonstrated marked SLCO1B3 overexpression. Additionally, the TGCA and KM database analyses revealed that SLCO1B3 is a hub gene linked to overall survival in GC patients. Therefore, we hypothesize that SLCO1B3 could serve as a novel therapeutic target in GC.\u003c/p\u003e \u003cp\u003eMolecular targeted therapy is an essential method for treating GC and other cancers. According to earlier research, SLCO1B3 is overexpressed in endometrial cancer, serous ovarian cancer, and cutaneous squamous cell carcinoma and is linked to prognosis\u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. GC studies have also shown that SLCO1B3 is a prognostic indicator\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. In this study, we found that clinical factors such as lymph node metastasis and the rate of Ki-67 positivity in GC patients were positively correlated with high SLCO1B3 expression. Colorectal cancer studies have shown that SLCO1B3 plays a key role in the initiation and metastasis and that knocking down SLCO1B3 can inhibit these processes\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Given the positive correlation between SLCO1B3 and the Ki-67 positivity rate, we propose that SLCO1B3 may also promote the development and metastasis of GC, which is supported by our in vitro findings.\u003c/p\u003e \u003cp\u003eAccording to previous studies, SLCO1B3, which is associated with cancer and differs from the liver-type SLCO1B3 expressed on the membranes of normal liver cells, has been shown to promote the development of various cancer types\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Non-small cell lung cancer studies have shown that SLCO1B3 promotes tumor growth, migration, and in vivo tumor formation by regulating EMT-related genes, such as E-cadherin. Knocking down Ct-SLCO1B3 RNA significantly inhibits tumor phenotypes, suggesting its potential as a therapeutic target for non-small cell lung cancer\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. SLCO1B3 has been found to exhibit similar characteristics in colorectal cancer studies\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Similarly, our results indicate that SLCO1B3 overexpression promotes GC cell proliferation and metastasis. In mouse xenograft experiments, we observed that SLCO1B3 overexpression led to Ki-67 overexpression, accelerating the growth and size of xenograft tumors. Therefore, this study provides strong evidence supporting SLCO1B3's role in promoting GC cell development.\u003c/p\u003e \u003cp\u003eOur RNA-seq pathway analysis revealed that SLCO1B3 overexpression is linked to MAP1S expression downregulation. MAP1S belongs to the MAP1 protein family, which includes MAP1A, MAP1B, and MAP1S. However, its evolutionary conservation is lower than that of MAP1B\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. MAP1S participates in the regulation of cytoskeletal dynamics by modulating microtubule stability\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In non-small cell lung cancer studies, researchers have found that MAP1S inhibits the Keap1\u0026ndash;Nrf2 pathway, significantly reducing the survival rate of A549/DDP drug-resistant cells and increasing autophagy levels\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Related studies have consistently associated MAP1S with pathways related to autophagy initiation, cellular DNA damage, and immune regulation \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Although no studies have yet explored the co-expression of SLCO1B3 and MAP1S in cancer, related cancer studies have shown that SLCO1B3 expression is always opposite to that of MAP1S. We speculate that the upregulation of SLCO1B3 expression in GC may lead to the downregulation of MAP1S expression and the occurrence of GC cells. This assertion is supported by our in vitro reversal experiment findings.\u003c/p\u003e \u003cp\u003eA substantial body of literature suggests that SLCO1B3 expression levels and functions vary across different cancer types. In this study, we first sequenced clinical samples, subsequently obtaining results from pathological tissue section analysis, in vitro cell experiments, and animal experiments. We propose that SLCO1B3 promotes the occurrence and development of GC cells. Furthermore, we identified MAP1S as a downstream mediator of the tumorigenic effects of SLCO1B3.\u003c/p\u003e \u003cp\u003eHowever, this study has some limitations. The primers designed for this study cannot identify CT-SLCO1B3 and LT-SLCO1B3 specifically, and we did not investigate the pathways through which SLCO1B3 exerts its effects. Thus, the bidirectional role of SLCO1B3 in different tumor types remains unclear. Future studies on this gene should investigate the specific pathways through which it exerts its effects to validate the conclusions of this study.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eSLCO1B3 expression is substantially higher in GC tissue than in nearby normal tissue, indicating that it could be used as a prognostic and diagnostic marker for GC. SLCO1B3 expression is positively correlated with Ki-67 expression, promoting the occurrence and development of GC cells. Furthermore, SLCO1B3 promotes GC growth by regulating MAP1S expression.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eShihao Liang: Research design (lead), methodology (lead), initial draft writing (lead). Yangyuan Huang: Data validation (co-author), review and editing (co-author). Liping Li: Software development (co-author), data validation (co-author). Qingyu Zeng: Data validation (co-author). Wenjie Liao: Software development (co-author). Weiyan Li: Review and editing (co-author). Leiyu Qin: Survey research (co-author). Bin Li: Conceptual design (lead), Funding acquisition (lead), Survey research (co-author), Methodology (supporting), Project management (lead). All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by\u0026nbsp;Guangxi Medical and health key discipline construction project; the Department of Science and Technology of Guangxi Zhuang Autonomous Region, Guangxi Science and Technology Program Project under grant, Guangxi Clinical Medical Research Center for Early Diagnosis and Treatment of Gastric Cancer (No. AD23026091); General Program of National Natural Science Foundation of China (No. 82173075);Innovation Project of Guangxi Graduate Education (No. YCBZ2024182) and Graduate Research Program of Guilin Medical University (No. GYYK2025005).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank LetPub (www. letpub. com) for its linguistic assistance during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest related to this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has been approved by the Ethics Committee of the First Affiliated Hospital of Guilin Medical University, and all experimental procedures comply with the principles of the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eF B, M L, H S, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e. 2024;74(3):229-263. doi:10.3322/caac.21834\u003c/li\u003e\n\u003cli\u003eLi M, Cao S, Xu RH. Global trends and epidemiological shifts in gastrointestinal cancers: insights from the past four decades. \u003cem\u003eCancer Commun (Lond)\u003c/em\u003e. 2025;n/a(n/a). doi:10.1002/cac2.70017\u003c/li\u003e\n\u003cli\u003eDiao X, Guo C, Jin Y, et al. Cancer situation in China: an analysis based on the global epidemiological data released in 2024. \u003cem\u003eCancer Commun (Lond)\u003c/em\u003e. 2024;45(2):178-197. doi:10.1002/cac2.12627\u003c/li\u003e\n\u003cli\u003eOswald S. Organic Anion Transporting Polypeptide (OATP) transporter expression, localization and function in the human intestine. \u003cem\u003ePharmacology \u0026amp; Therapeutics\u003c/em\u003e. 2019;195:39-53. doi:10.1016/j.pharmthera.2018.10.007\u003c/li\u003e\n\u003cli\u003eB H, B S, Kp L. Organic anion transporting polypeptides: pharmacology, toxicology, structure, and transport mechanisms. \u003cem\u003ePharmacological reviews\u003c/em\u003e. 2025;77(2). doi:10.1016/j.pharmr.2024.100023\u003c/li\u003e\n\u003cli\u003eX Z, Y C, T L, C L. Transcriptome analysis of healthy and fatty liver revealed that inhibition of SLCO1B3 induces abnormal liver metabolism and lipid synthesis. \u003cem\u003ePoult Sci\u003c/em\u003e. 2023;102(11). doi:10.1016/j.psj.2023.103023\u003c/li\u003e\n\u003cli\u003eM N, T F, S M, et al. Identification of a new organic anion transporting polypeptide 1B3 mRNA isoform primarily expressed in human cancerous tissues and cells. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e. 2012;418(4):818-823. doi:10.1016/j.bbrc.2012.01.115\u003c/li\u003e\n\u003cli\u003eN T, K K, Er J, et al. A cancer-specific variant of the SLCO1B3 gene encodes a novel human organic anion transporting polypeptide 1B3 (OATP1B3) localized mainly in the cytoplasm of colon and pancreatic cancer cells. \u003cem\u003eMol Pharmaceutics\u003c/em\u003e. 2013;10(1):406-416. doi:10.1021/mp3005353\u003c/li\u003e\n\u003cli\u003eT F, Y S, K C. Cancer-type organic anion transporting polypeptide 1B3: current knowledge of the gene structure, expression profile, functional implications and future perspectives. \u003cem\u003eCurr Drug Metab\u003c/em\u003e. 2015;16(6):474-485. doi:10.2174/1389200216666150812142715\u003c/li\u003e\n\u003cli\u003eL Z, L Z, X Z, et al. SLCO1B3 promotes colorectal cancer tumorigenesis and metastasis through STAT3. \u003cem\u003eAging (Milano)\u003c/em\u003e. 2021;13(18). doi:10.18632/aging.203502\u003c/li\u003e\n\u003cli\u003eY S, M H, O S, et al. Cancer-type OATP1B3 mRNA has the potential to become a detection and prognostic biomarker for human colorectal cancer. \u003cem\u003eBiomarkers Med\u003c/em\u003e. 2017;11(8). doi:10.2217/bmm-2017-0098\u003c/li\u003e\n\u003cli\u003eTang T, Wang G, Liu S, et al. Highly expressed SLCO1B3 inhibits the occurrence and development of breast cancer and can be used as a clinical indicator of prognosis. \u003cem\u003eSci Rep\u003c/em\u003e. 2021;11(1):631. doi:10.1038/s41598-020-80152-0\u003c/li\u003e\n\u003cli\u003eHase H, Aoki M, Matsumoto K, et al. Cancer type‑SLCO1B3 promotes epithelial‑mesenchymal transition resulting in the tumour progression of non‑small cell lung cancer. \u003cem\u003eOncol Rep\u003c/em\u003e. 2021;45(1):309-316. doi:10.3892/or.2020.7839\u003c/li\u003e\n\u003cli\u003eBarbier RH, McCrea EM, Lee KY, et al. Abiraterone induces SLCO1B3 expression in prostate cancer via microRNA-579-3p. \u003cem\u003eSci Rep\u003c/em\u003e. 2021;11(1):10765. doi:10.1038/s41598-021-90143-4\u003c/li\u003e\n\u003cli\u003eRajanala SH, Plym A, Vaselkiv JB, et al. SLCO1B3 and SLCO2B1 genotypes, androgen deprivation therapy, and prostate cancer outcomes: a prospective cohort study and meta-analysis. \u003cem\u003eCarcinogenesis\u003c/em\u003e. 2024;45(1-2):35-44. doi:10.1093/carcin/bgad075\u003c/li\u003e\n\u003cli\u003eDeng F, Laasik M, Salminen L, et al. Toxicity and therapy outcome associations in LIG3, SLCO1B3, ABCB1, OPRM1 and GSTP1 in high-grade serous ovarian cancer. \u003cem\u003eBasic Clin Pharmacol Toxicol\u003c/em\u003e. 2023;132(6):521-531. doi:10.1111/bcpt.13866\u003c/li\u003e\n\u003cli\u003eFischer I. Perspective: examining MAP1B structure with an evolutionary perspective. \u003cem\u003eCytoskelet (hob NJ)\u003c/em\u003e. Published online July 10, 2025. doi:10.1002/cm.70000\u003c/li\u003e\n\u003cli\u003eMacTaggart B, Wang J, Tang HY, Kashina A. Arginylation of ⍺-tubulin at E77 regulates microtubule dynamics via MAP1S. \u003cem\u003eJ Cell Biol\u003c/em\u003e. 2025;224(4):e202406099. doi:10.1083/jcb.202406099\u003c/li\u003e\n\u003cli\u003eLi W, Dai Y, Shi B, et al. LRPPRC sustains yap-P27-mediated cell ploidy and P62-HDAC6-mediated autophagy maturation and suppresses genome instability and hepatocellular carcinomas. \u003cem\u003eOncogene\u003c/em\u003e. 2020;39(19):3879-3892. doi:10.1038/s41388-020-1257-9\u003c/li\u003e\n\u003cli\u003eWang J, Zhang X, Yang F, et al. RASSF1A enhances chemosensitivity of NSCLC cells through activating autophagy by regulating MAP1S to inactivate Keap1-Nrf2 pathway. \u003cem\u003eDrug Des Dev Ther\u003c/em\u003e. 2021;15:21-35. doi:10.2147/DDDT.S269277\u003c/li\u003e\n\u003cli\u003eGallob F, Brcic L, Eidenhammer S, Rumpp F, Nerlich A, Popper H. Senescence and autophagy in usual interstitial pneumonia of different etiology. \u003cem\u003eVirchows Arch: Int J Pathol\u003c/em\u003e. 2021;478(3):497-506. doi:10.1007/s00428-020-02917-2\u003c/li\u003e\n\u003cli\u003eJia X, Zhai T, Zhang JA. Circulating exosome involves in the pathogenesis of autoimmune thyroid diseases through immunomodulatory proteins. \u003cem\u003eFront Immunol\u003c/em\u003e. 2021;12:730089. doi:10.3389/fimmu.2021.730089\u003c/li\u003e\n\u003cli\u003eNumata Y, Fujii T, Toda C, et al. Digoxin promotes anoikis of circulating cancer cells by targeting Na+/K+-ATPase \u0026alpha;3-isoform. \u003cem\u003eCell Death Dis\u003c/em\u003e. 2025;16(1):373. doi:10.1038/s41419-025-07703-z\u003c/li\u003e\n\u003cli\u003eIt L, Ch S, Fc T, Cb C, Ks M. Cancer-derived extracellular vesicles as biomarkers for cutaneous squamous cell carcinoma: a systematic review. \u003cem\u003eCancers\u003c/em\u003e. 2022;14(20). doi:10.3390/cancers14205098\u003c/li\u003e\n\u003cli\u003eR P, S V, M A, et al. Altered profile of E1-S transporters in endometrial cancer: lower protein levels of ABCG2 and OST\u0026beta; and up-regulation of SLCO1B3 expression. \u003cem\u003eInt J Mol Sci\u003c/em\u003e. 2021;22(8). doi:10.3390/ijms22083819\u003c/li\u003e\n\u003cli\u003eJ X, R S, S W, L Z. Construction of a prognostic signature for serous ovarian cancer based on lactate metabolism-related genes. \u003cem\u003eFront Oncol\u003c/em\u003e. 2022;12. doi:10.3389/fonc.2022.967342\u003c/li\u003e\n\u003cli\u003eX Z, X C, J L, et al. A novel metabolism-related prognostic gene development and validation in gastric cancer. \u003cem\u003eClin Transl Oncol : Off Publ Fed Span Oncol Soc Natl Cancer Inst Mex\u003c/em\u003e. 2023;25(2):447-459. doi:10.1007/s12094-022-02958-w\u003c/li\u003e\n\u003cli\u003eB H, D L, L M, Mf F, J K. Transcriptional regulation of liver-type OATP1B3 (lt-OATP1B3) and cancer-type OATP1B3 (ct-OATP1B3) studied in hepatocyte-derived and colon cancer-derived cell lines. \u003cem\u003ePharmaceutics\u003c/em\u003e. 2023;15(3). doi:10.3390/pharmaceutics15030738\u003c/li\u003e\n\u003cli\u003eI F. Perspective: examining MAP1B structure with an evolutionary perspective. \u003cem\u003eCytoskelet (hob NJ)\u003c/em\u003e. Published online October 7, 2025. doi:10.1002/cm.70000\u003c/li\u003e\n\u003cli\u003eGranados-L\u0026oacute;pez AJ, Manzanares-Acu\u0026ntilde;a E, L\u0026oacute;pez-Hern\u0026aacute;ndez Y, et al. UVB inhibits proliferation, cell cycle and induces apoptosis via p53, E2F1 and microtubules system in cervical cancer cell lines. \u003cem\u003eInt J Mol Sci\u003c/em\u003e. 2021;22(10):5197. doi:10.3390/ijms22105197\u003c/li\u003e\n\u003cli\u003eM P, Md S, V J, H S. The novel anti-cancer feature of brazzein through activating of hTLR5 by integration of biological evaluation: molecular docking and molecular dynamics simulation. \u003cem\u003eSci Rep\u003c/em\u003e. 2022;12(1). doi:10.1038/s41598-022-26487-2\u003c/li\u003e\n\u003cli\u003eY G, J L, B S, et al. HBx-induced upregulation of MAP1S drives hepatocellular carcinoma proliferation and migration via MAP1S/smad/TGF-\u0026beta;1 loop. \u003cem\u003eInt J Biol Macromol\u003c/em\u003e. 2024;281(Pt 3). doi:10.1016/j.ijbiomac.2024.136327\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"gastric cancer, SLCO1B3, tumorigenesis, metastasis, MAP1S","lastPublishedDoi":"10.21203/rs.3.rs-7967187/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7967187/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eGastric cancer (GC) remains a significant cause of mortality worldwide. Exploring the pathogenesis of GC is crucial for developing new therapeutic strategies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eClinical sample sequencing and immunohistochemical analyses were employed to investigate the expression patterns of solute carrier organic anion transporter B3 (SLCO1B3) in GC and surrounding normal tissues, as well as its effect on GC prognosis. In vitro GC studies were performed to confirm the effects of SLCO1B3 overexpression and knockdown on GC cell proliferation, migration, and invasion, as well as the influence of SLCO1B3 overexpression on carcinogenesis in vivo. Additionally, RNA sequencing of GC cells overexpressing SLCO1B3 identified microtubule-associated protein 1S (MAP1S) as a downstream target, revealing that SLCO1B3 promotes GC progression by downregulating MAP1S expression.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e SLCO1B3 expression is elevated in GC versus adjacent tissues and correlates with diminished patient survival rates. SLCO1B3 overexpression promotes GC occurrence and metastasis by downregulating MAP1S expression.\u003c/p\u003e","manuscriptTitle":"A mechanistic study revealing that SLCO1B3 promotes gastric cancer development and metastasis through MAP1S expression downregulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-22 09:31:24","doi":"10.21203/rs.3.rs-7967187/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-06T12:43:03+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-27T01:47:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"317217635157613623924163018391216880295","date":"2025-12-22T12:01:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-19T16:20:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"34857618297452201373204349528287477028","date":"2025-12-19T16:05:50+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-15T14:02:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-08T17:31:45+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-13T15:22:30+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-12T13:32:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Cancer","date":"2025-11-12T13:28:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7d5f719d-a132-4de0-96d0-ebc8c7524045","owner":[],"postedDate":"December 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-30T16:22:32+00:00","versionOfRecord":{"articleIdentity":"rs-7967187","link":"https://doi.org/10.1186/s12885-026-15917-3","journal":{"identity":"bmc-cancer","isVorOnly":false,"title":"BMC Cancer"},"publishedOn":"2026-03-29 16:13:03","publishedOnDateReadable":"March 29th, 2026"},"versionCreatedAt":"2025-12-22 09:31:24","video":"","vorDoi":"10.1186/s12885-026-15917-3","vorDoiUrl":"https://doi.org/10.1186/s12885-026-15917-3","workflowStages":[]},"version":"v1","identity":"rs-7967187","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7967187","identity":"rs-7967187","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}