Analysis of flowering-associated gene expressions and metabolic characteristics in adzuki bean (Vigna angularis L.) with different short-day induction | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Analysis of flowering-associated gene expressions and metabolic characteristics in adzuki bean (Vigna angularis L.) with different short-day induction Weixin Dong, Dongxiao Li, Lei Zhang, Peijun Tao, Yuechen Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3362672/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Adzuki bean is an important miscellaneous grain crop and a kind of typical short-day crop that is used in a variety of foods because of its high nutritional and medicinal value. The flowering time of adzuki beans is affected by multiple environmental factors, particularly the photoperiod. Adzuki bean can meet at flowering period, accelerate breeding process and avoid natural disasters by adjusting the day-length.Therefore, RNA-seq analysis was used to determine the effects of different day-length on the expression and metabolic characteristics of genes related to flowering time in adzuki beans. Results In this study, ‘Tangshan Hongxiaodu’ was used as experimental material. Transcriptome sequencing was performed under SD-5d, SD-10d and SD-15d treatments, respectively. The results showed that a total of 5,939 differentially expressed genes (DEGs) were identified by sequencing, Among these common genes, 38.09% were upregulated and 23.81% were downregulated in three groups. Gene Ontology (GO) enrichment analysis was performed on the target genes to identify common functions related to photosystem I and II. Kyoto Encyclopedia of Genes and Genomes (KEGG) enriched analysis was performed t o predict two pathways involved in antenna proteinand circadian rhythm. And that the flowering of adzuki beans was promoted by downregulating genes in the circadian rhythm pathway through the blue light metabolic pathway, whereas the antenna protein promoted flowering by enhancing the reception of light signals and accelerating electron transport. In these two metabolic pathways, the number of DEGs was the greatest changes in SD-5d vs SD-15d comparison group. Real-time qRT-PCR validation of eight DEGs in these two metabolic pathways was consistent with the transcriptome results, indicating that the sequencing results were accurate and reliable and that these genes may be candidate genes affecting the regulation of short-day induction at the adzuki bean seedling stage. Conclusion The results indicated that short-day induction can downregulate the expression of genes related to adzuki bean flowering in the circadian rhythm and upregulate the expression of some genes in the antenna protein pathway. In addition, the results not only provide a theoretical reference for the molecular mechanism of adzuki bean flowering induced by short days, but also provide multi-level information on the next steps in exploring the functional verification of key genes regulating adzuki bean flowering. Adzuki bean Short-day induction Transcriptome Gene expression Metabolic characteristics qRT-PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Adzuki bean, which originated in China, is an important grain crop. As a homologous medicinal food species, it plays an important role in the human diet with a perennial export volume of approximately 40,500 tons[ 1 ]. However, this species experiences serious shedding of flowers and pods, so the yield of adzuki beans is low and unstable [ 2 ]. Many recent studies [ 3 – 7 ] have found that sunshine duration could be set at the seedling stage to regulate flowering time, which has had a significant impact on improving the bean yield and quality in the later stage. To date, there have been few reports on the molecular mechanisms of short-day induction and regulation of adzuki bean flowering. RNA-Seq technology can comprehensively identify transcripts, conduct transcriptome analyses, and rapidly identify genes with high sensitivity and accuracy. Therefore, using this technology to identify the regulatory pathways and candidate genes involved in plant flowering is important for understanding the molecular mechanisms underlying plant flowering. As an important phenological stage, the flowering phase initiates plant reproduction and involves complex transduction mechanisms of environmental signals, including light and temperature [ 8 – 10 ]. Among these, photoperiod is one of the most important environmental factors affecting flowering time in plants. The molecular mechanisms of Arabidopsis thaliana in response to photoperiod flowering have been extensively studied [ 11 ]. As a typical long-day plant, the flowering of A. thaliana can be triggered rapidly under 16 h of light, but is delayed under 8 h of light. The regulatory mechanism is related to the fact that CO protein levels are high in the long term and the mRNA level of FT is increased. Finally, the FT protein is transported to the meristematic tissue through the vascular bundle, promoting the differentiation of floral primordia into floral tissue [ 12 – 13 ]. Under short-day conditions, the COP1/SPA1 complex is formed to degrade the CO protein, thus, downregulating FT expression and inhibiting Arabidopsis flowering [ 14 – 15 ]. For soybean, flowering genes have been studied extensively, and 10 QTL loci (namely E1–E9 and EJ ) related to flowering time have been identified [ 16 – 17 ]. Among those, E1 - E4 , E7 , and E8 regulate the photoperiod flowering of soybeans, with E1 contributing the most to soybean flowering [ 18 ]. E5 , which does not exist separately, may have been caused by accidental outcrossing with pollen with the E2 allele [ 19 ]. E9 is a leaky allele of FT2a, the abundance of which is directly related to changes in soybean flowering time [ 20 ]. In addition to the E genes, the FT gene also plays an important role in the flowering process of soybeans [ 21 ]. In adzuki beans, three metabolic pathways related to flowering have been identified by transcriptome sequencing, including plant hormones, circadian rhythms, and antenna proteins, by comparing different short-day induction periods with their respective controls. Among them, the homologues of 13 verified genes are all related to flowering, indicating that these genes are key candidates for regulating the flowering of adzuki beans [ 22 ]. Other studies screened eight significantly different genes related to flowering by transcriptome analysis after short-day induction in kidney beans. With the function of these differential genes related to the regulation of the biological clock, TOC1 has been identified to play a key role in controlling the photoperiodic flowering response through clock function. Upregulation or downregulation of TOC1 leads to changes in downstream genes that regulate the flowering time of kidney beans [ 23 ]. With the deepening of transcriptome research on plant flowering, the metabolic pathways and key genes that regulate flowering through the photoperiod have been described in detail in Arabidopsis species, Adzuki bean, and Phaseolus vulgaris . Additionally, transcriptomics has increasingly been used to regulate flowering and flower development in diverse plants, including lute [ 24 ], tobacco [ 25 ], lily [ 26 ], cucumber [ 27 ], and hemp [ 28 ]. However, understanding of the effect of the photoperiod on plant flowering needs to be broadened through transcriptome analysis. In particular, transcript information and gene expression profiles of adzuki bean under different short-day inductions have not yet been determined. Therefore, applying RNA-seq to identify candidate genes related to flowering would help to elucidate the regulatory mechanism of short-day-induced flowering in adzuki beans. In this study, three short-day induction treatments, SD-5d, SD-10d, and SD-15d, were performed to compare the transcriptome of adzuki bean leaves, explore differentially expressed transcripts, and identify candidate transcripts involved in the regulation of flowering. This is of great significance for revealing the molecular mechanisms underlying the regulation of flowering time in adzuki beans. Result Characteristics of growth and flowering The effects of different short-day inducement periods on the growth, rate of apical flower bud differentiation, flowering time, and flowering promoting rate of adzuki beans were very different. The longer the short-day induction period, the greater the inhibitory effect on adzuki bean plants (Additional file 1:Figure S1 ). Leaf area, plant height, and stem diameter decreased with the prolongation of short-day induction, and plant height showed significant differences among the three treatments at the flowering and podding stages. At the seed-filling stage, the plant height of SD-15d significantly decreased by 25.87% and 18.45% compared to that of the SD-5d and SD-10d treatments, respectively. The stem diameter of SD-15d significantly decreased by 10.91% and 13.27% compared to that of SD-5d at the flowering and seed filling stages, respectively, whereas there was no significant difference between the SD-5d and SD-10d treatments. There was a significant difference in the stem diameter among the three treatments during the podding stage. Significant differences in leaf area were observed among the three treatments for all growth periods (Additional file 2:Table S1 ) . The advanced flowering days and flowering promoting rate showed that the flowering date of plants in SD-15d was 12 and 7 days earlier than that in SD-5d and SD-10d (Additional file 1:Figure S1 C), and the flowering promotion rates were 22.03% and 11.83%, respectively (Additional file 1:Figure S1 D). The advanced flowering days of plants in SD-10d were 6 days compared with SD-5d, and the flowering promoting rate was 10.20%. These results indicated that short-day induction promoted the early flowering of adzuki beans by inhibiting the vegetative growth of plants. Short-day induction had a cumulative effect, showing that the longer the short-day inducement, the earlier the flowering time, and the greater the flowering promotion rate. Functional analysis of differentially expressed genes By comparing the data among the three groups, the total number of differentially expressed genes (DEGs) was 5,939, including 3,107 upregulated genes and 2,832 downregulated genes (Fig. 2 ). On comparing SD-10d and SD-5d, 2,044 DEGs were detected, including 961 upregulated and 1,083 downregulated genes. Comparing SD-5d and SD-15d, a total of 3,068 genes were detected, including 1,711 upregulated genes and 1,357 downregulated genes. Comparing SD-10d and SD-15d, a total of 827 genes were detected, including 435 upregulated and 392 downregulated genes (Additional file 3:Figure S2 A). In addition, by comparing the three groups, 105 common genes were detected, of which 40 were upregulated and 25 were downregulated (Additional file 4,5,6:Figure S2 B,C,D). In addition, it was observed that the number of DEGs between SD-5d and SD-15d was the highest, indicating that the longer the interval between the two short-day inducement treatments, the higher the number of DEGs detected. Cluster analysis showed that the three treatments, SD-5d, SD-10d, and SD-15d, had a significant impact on gene expression (Additional file 7:Figure S2 E). Among these, 40 genes were gradually upregulated with an extension of short-day time, whereas 25 genes were gradually downregulated. Another 40 genes did not show obvious expression rules, of which 25 genes showed up-down-up regulation and 15 genes showed down-up-down regulation in all treatments. The above results showed that 40 upregulated and 25 downregulated genes played key roles in the growth and development of adzuki beans, but the other genes had no obvious rules, indicating that the function of different genes varied in response to different short-day induction times. Gene Ontology function enrichment analysis GO terms (DEGs > 2) were screened separately for biological processes, cell components, and molecular functions. GO function enrichment analysis showed that the light-related function of DEGs was found among all three comparison groups, in which two types of cell components involved in DEGs between SD-5d and SD-10d were related to light function, that is, photosystem I (PSI) and II (PSII), both of which included five upregulated genes. In addition, there was a circadian function related to light in biological processes, which contained 14 genes, of which six were upregulated and eight were downregulated (Additional file 8:Figure S3 A). The DEGs in the two comparison groups of SD-5d vs SD-15d and SD-10d vs SD-15d had light-driven functions as PSI and PSII, but the number of genes involved was different. For SD-5d vs SD-15d, PSI and PSII contained nine and twelve genes, respectively; the former nine genes were upregulated, eleven genes of the latter group were upregulated, and the remaining one gene was downregulated. Both SD-10d and SD-15d contained five upregulated genes (Additional file 9,10:Figure S3 B,C). These results suggested that the three comparison groups all contained PSI and PSII functions related to light (Additional file 11:Figure S3 D), and that photosystem genes in leaf cell components could be activated after different short-day induction times. These genes are key regulators of the growth and development of adzuki bean seedlings and are closely related to photoelectron transport under short-day-induced conditions. Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of DEGs KEGG pathway enrichment analysis of DEGs in the three groups was performed to select the top 20 signaling pathways with significant differences in each comparison group. Figure 4 shows that DEGs between SD-5d vs SD-10d and SD10d vs SD-15d were enriched in two light-related pathways, that is, the antenna protein pathway and circadian pathway, respectively, with different numbers of genes involved in these pathways. For the SD-5d vs SD-10d groups, five genes were upregulated in the antenna protein pathway, and of sixteen genes in the circadian pathway, three were upregulated and thirteen were downregulated. For the SD-10d vs SD-15d group, there were seven genes in the circadian pathway, including four upregulated and three downregulated. Four light-related pathways were enriched in the SD-5d vs SD-15d group, including nine, seventeen, forty-five, and fourteen genes, respectively. The expression patterns of genes in different pathways were different, nine genes in the antenna protein pathway were upregulated; of seventeen genes in the circadian pathway, three were upregulated and fourteen were downregulated; forty-five genes in the plant hormone signal transduction pathway consisted of twenty seven upregulated and eighteen downregulated genes; and all fourteen genes in the photosynthesis pathway were upregulated. The above results showed that the three comparison groups all contained two pathways related to light and circadian rhythms, of which SD-5d vs SD-10d and SD-5d vs SD-15d had the most significant enrichment degree in the circadian rhythm pathway. This suggests that different short-day inductions, on the one hand, activate gene expression in the antenna protein pathway and promote photosynthesis, and on the other hand, regulate photosynthesis, stomatal rhythmic opening and closing, leaf rhythmic opening and closing, and other important physiological processes, by regulating the biological clock. This could help plants optimize their energy utilization efficiency to the maximum extent and guarantee the early flowering of adzuki beans. Additionally, the circadian pathway plays a key role in the response to different short-day induction periods (Additional file 12,13,14,15:Figure S4 A,B,C,D). Gene set enrichment analysis in the KEGG pathway It is generally believed that a positive ES value indicates that a certain functional gene set is enriched at the front of the ranked sequence and that the involved pathway is upregulated. A negative ES value indicates that a certain functional gene set is enriched at the rear of the ranked sequence and that the involved pathway is downregulated. The core genes that appeared in the ES map indicate that this functional gene set has biological significance. Here, gene set enrichment analysis revealed that the antenna proteins and circadian pathways in the three comparison groups had the same enrichment scores, as shown in Fig. 5 . The antenna protein pathway was upregulated (Additional file 16:Figure S5 A,B), the circadian pathway was downregulated (Additional file 17,18:Figure S5 C,D,E,F), and the core genes were identified in both pathways. The core genes of the antenna protein pathway were enriched in the front of the sequencing sequence, whereas those of the circadian pathway were enriched in the rear of the sequencing sequence in the three comparison groups, indicating that these core genes play an important role in the response of adzuki beans to short-day induction. Heatmap cluster analysis was performed on the core genes of antenna proteins and circadian metabolic pathways (Fig. 6 ). The antenna protein pathways of the three comparison groups, SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d, contained 13, 15, and 17 core genes, respectively, which were upregulated with an increase in the number of short-day induction days (Additional file 22,23,24:Figure S6 D,E,F). The circadian rhythm pathways in the three comparison groups contained 12, 15, and 14 core genes, which were inversely downregulated as the number of short-day induction days increased (Additional file 19,20,21:Figure S6 A,B,C). These results indicated that adzuki beans responded to different short-day induction periods by upregulating the key genes in the antenna protein pathway or downregulating the key genes in the circadian pathway, thus, promoting early flowering. Analysis of circadian and antenna protein pathway maps The circadian rhythm is a rhythmic change in plants in response to daylight length. Analysis of the circadian metabolic pathway showed that blue light promoted and far-red light inhibited flowering in adzuki beans. After short-day induction, PHYB, a far-red light receptor, interacted with PIF3, a phytochrome interaction factor, to promote the transcription of NDA and the formation of LHY, a circadian clock regulatory protein. The PRR7 protein of the central oscillator-controlled internal clock inhibited the transcription of PIF3 and formation of LHY. In addition, PRR7, a key gene in the photoperiodic flowering pathway, could inhibit the expression of the LHY protein, thus, inhibit the flowering of adzuki beans. After short-day induction, one pathway of flowering regulation was that a complex formed by morphogenesis regulator COP1 and signal sensing protein SPA1 was inhibited by the cryptochrome CRY-blue light receptor protein, and this complex was downregulated and ubiquitinated to inhibit the transcription of HY5, a negative regulator of photomorphogenesis, thus, indirectly, promoting photomorphogenesis.Another pathway of flowering regulation is that of CRY, a blue light receptor protein, which inhibits complex formation by COP1 and ELF3, thus, inhibits GI by ubiquitylation. As a negative regulator, GI downregulates the function of the complex formed by FKF1 and GI, inhibits CDF1 binding to the promoter of CO by ubiquitylation, thus, initiates the transcriptional activation of CO and upregulation of FT. GI can also directly promote DNA transcription into CO, which can promote FT upregulation, and indirectly promote adzuki bean flowering (Fig. 7 A). Figure 7 B shows that the changes in the expression levels of seven protein genes, PIF3, PRR7, SPA1, HY5, ELF3, GI, and FKF1 were different among SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d three comparison groups. Difference genes showed more significant changes in SD-5d vs SD-15d comparison group, indicating that the longer the short-day induction, the greater differential gene change and most genes were downregulated. Chloroplasts in green plants are comprised of PSⅠand PSⅡ. PSⅠcontains five light-trapping pigment protein complexes, named Lhca1, Lhca2, Lhca3, Lhca4, and Lhca5, while PSⅡ contains six, named Lhcb1, Lhcb2, Lhcb3, Lhcb4, Lhcb5, and Lhcb6, of which the first three (Lhcb1-3) play major roles. Different short-day inductions could affect the expression of genes encoding antenna proteins, allowing them to adapt to the growth and development of Adzuki beans. Figure 8 A, B shows that, after a short-day induction period, the genes involved in the Lhca3, Lhcb1, Lhcb2, Lhcb3, Lhcb4, and Lhcb6 proteins were all upregulated, and there was a higher number of upregulated genes in the Lhcb1, Lhcb2, and Lhcb3 proteins than in the other proteins. Figure 8 B shows that the largest differential genes were changed in the comparison group of SD-5d vs SD-15d, indicating that the light signal reception ability in the plants was enhanced with an increase in the number of short-day induction days; that is, the longer short-day induction period, the stronger reception ability. These results indicated that the adzuki beans responded to short-day induction by upregulating PSⅠ and PSⅡ genes. These genes may play key roles in regulating the growth and development of adzuki bean seedlings under short-day induction conditions, the longer the period of induction, the greater the differential genes change. Identification of DEGs by qRT-PCR To verify the reliability and accuracy of the transcriptomic data, new samples from the same treatment group were subjected to qRT-PCR analysis. Eight genes with significant variability were screened from the circadian rhythm and antenna protein pathways, all of which were closely related to light and associated with flowering by homologous sequence alignment (Additional file 25:Table S2 ). qRT-PCR was performed to verify these eight genes in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15dthree comparison groups. The results showed that the LOC108331766 gene was significantly different in the SD-5d vs SD-10d and SD-5d vs SD-15d comparison groups, but was not significantly different in the SD-10d vs SD-15d group. The LOC108322606 gene was significantly different in the SD-5d vs SD-10d and SD-10d vs SD-15d groups, but was not significantly different in the SD-5d vs SD-15d groups. In the antenna protein pathway, LOC108345872 and LOC108344684 gene was significantly different among the three groups. Meanwhile, LOC108335068 gene was significantly different in the SD-5d vs SD-15d and SD-10d vs SD-15d groups, but was not significantly different in the SD-5d vs SD-10d comparison group. LOC108328079, LOC108333950, and LOC108338432 gene was significantly different in the SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d groups, respectively, but not in the other groups. These results suggest that the qRT-PCR results for the eight genes were consistent with the transcriptome sequencing results of RNA-seq (Additional file 26:Figure S9 A1B1,A2B2,A3B3,A4B4). Eight genes were significantly different in circadian rhythm and antenna protein pathways, indicating that the transcriptome sequencing data were accurate and reliable. Discussion The life cycle of higher plants includes vegetative and reproductive growth, and flower initiation marks the transition between plant growth stages, which determines whether a plant can successfully reproduce [ 35 ]. As an important agronomic index, flowering time is a prerequisite for high yield and high harvest index of crops and is greatly affected by the photoperiod [ 36 – 37 ]. In this study, a short-day sensitive variety, ‘Tangshan hong xiao dou’, was used under SD-5d, SD-10d and SD-15d treatments, and it was found that the longer short-day induction period, the earlier flowering was initiated and the greater inhibitory effect on plants. These results indicated that adzuki bean plants promote flowering by inhibiting plant growth after short-day induction, which is consistent with the results of studies on chrysanthemums and soybeans [ 38 – 39 ]. The plant light-dependent signaling response is an extremely complex process involving the regulation of many related genes. To further explore the regulatory mechanism of the short-day induction of adzuki bean flowering and the expression of key genes, a cDNA library of adzuki bean leaves was constructed after different short-day induction periods and transcriptome sequencing was conducted using Illumina sequencing technology. A total of 5,939 differential genes were obtained in three comparison groups, among which the SD-5d vs SD-15d group had the maximum number of differential genes (3,068), which increased with an increasing number of interval days between the two short-day induction groups. GO functional enrichment results showed that PSI and PSII, which have two light-related functions, were both present in the three comparison groups, and the number of DEGs in each comparison group was different. There were nine and twelve genes corresponding to two light-related functions in the SD-5d vs SD-15d comparison group, respectively. All nine genes were upregulated, whereas among the twelve genes, the expression of eleven was upregulated and that of one was downregulated, indicating that the longer interval of short-day induction, the higher number of DEGs identified, and most of these genes were upregulated. PSI and PSII are related to plant light-trapping pigment protein complexes that receive solar energy and assimilate carbon dioxide to form chemical energy [ 40 – 41 ]. There are three main light-trapping pigment protein complexes encoded by Lhcb1, Lhcb2, and Lhcb3 in the peripheral light-trapping antenna of PSII. The main function of this complex is to capture and transfer light energy and balance the excitation energies of PSI and PSII. It also plays an important role in maintaining the membrane structure of thylakoids in response to changes in the external environment and in photoprotection [ 42 – 43 ]. From these results, it can be speculated that the photosynthetic capacity of adzuki bean plants was enhanced by the upregulation of genes in PSI and PSⅡ after short-day stress. In particular, the photocapture capacity of the peripheral photocapture antenna of PSII was enhanced. In addition, the electron transfer rate was accelerated to rapidly respond to changes in the external environment and maintain normal growth and development. The subsequent gene pathway map of antenna protein gene expression also showed that genes in the three comparison groups were upregulated, and the number of DEGs in the SD-5d vs SD-15d comparison group was the highest. Among these, five genes in the Lhcb1 protein were upregulated, suggesting that the Lhcb1 protein plays an important role in light energy absorption after short-day induction in adzuki beans. There is a complex interaction between exogenous photoperiodic signals and the flowering biological clocks of plants when sensing changes in the lengths of day and night, which causes a series of activations or inhibitions of flowering genes, ultimately leading to changes in the flowering rhythm [ 44 ]. Different plant flowering rhythm and photoperiodic pathways are conservative in large part [ 45 ]. In this study, KEGG enrichment analysis showed that two light-related antenna proteins and circadian pathways were present in three comparison groups, and the degree of enrichment of the circadian pathways was most significant in the SD-5d vs SD-15d group. Further analysis of gene set enrichment revealed that adzuki beans can respond to short-day induction by upregulating antenna protein pathway and downregulating key genes in the circadian rhythm pathway, thus, promoting early flowering. This is similar to the findings of previous studies on different species of edible fungi and peaches under short-day induction using transcriptome sequencing [ 46 – 47 ]. Further analysis of the regulatory network showed that the antenna protein enhanced the absorption of light energy through gene upregulation; in the circadian rhythm pathway, early flowering of plants was promoted through the blue light metabolic pathway, while far-red light inhibited the flowering of adzuki beans. Early studies on Arabidopsis species found that the red light receptor PHYB and the blue light receptor CRY2 have antagonistic effects on the regulation of flowering time [ 48 – 49 ]. CRY1, CRY2, and PHYA stabilize CO, whereas PHYB promotes its degradation [ 50 ]. How does blue light regulate the CO protein in adzuki beans? One regulatory pathway is the far-red light signaling pathway; in the circadian rhythm system, PHYB binds to PIF3 to promote the transcription of NDA into LHY, and PRR7 inhibits the transcription of PIF3 into LHY protein, thus, inhibiting flowering. Another pathway is the blue light pathway, in which CRY inhibits the formation of the COP1-SPA1 complex, which is downregulated, and inhibits the transcription of HY5 by ubiquitination, thus, indirectly promoting light morphogenesis. In addition, CRY inhibits the formation of the COP1-ELF3 complex and GI by ubiquitination. As a negative regulator, GI downregulates the formation of the FKF1-GI complex, inhibits CDF1 binding to the CO promoter by ubiquitination, transcriptionally activates CO, and upregulates FT to indirectly promote adzuki bean flowering. GI can also directly promote DNA transcription into CO, which, in turn, promotes FT upregulation, thereby indirectly promoting adzuki bean flowering. Based on this analysis, it was found that light regulates CO activity through at least two processes: the biological clock regulates the expression of CO mRNA and the stability of the CO protein is regulated through the signal transduction of different light receptors. In A . thaliana , CRY2 cannot interact with SPA1 during the dark period, when high CO gene expression occurs under short-day conditions, which leads to the degradation of the CO protein by the COP1–SPA1 complex and flowering [ 51 – 52 ]. Under long-day conditions, GI and FKF1 proteins at high levels form a complex and degrade the CDF1 protein under blue light, which eliminates the inhibitory effect of CDF1 on the CO gene. Subsequently, CO mRNA begins to accumulate, promoting the upregulation of FT genes and flowering [ 53 – 54 ]. It can be seen that the flowering regulation mechanism of adzuki beans is similar to that of A. thaliana . Substantial progress has been made in the study of cryptochrome genes in soybeans [ 55 – 57 ], Arabidopsis species [ 58 – 59 ], and rice [ 60 ]. Cryptochrome acts as a photoreceptor in various angiosperms, regulates the biological clock, and plays an important role in the induction of flowering. However, the number of upregulated or downregulated genes in flowering proteins varies between plants. Eight DEGs selected in circadian rhythms and antenna proteins were verified to be consistent with the RNA-seq results, and the functions of these eight genes were related to light and flowering. This study clarified the regulatory mechanism of the short-day induction of adzuki bean flowering, laying a foundation for further exploration of the functions of key genes that regulate adzuki bean flowering. Conclusion The transcriptional results showed that the number of DEGs in the SD-5d vs SD-15d comparison group was the highest (3,068 genes). The longer short-day induction time, the greater promotion of flowering. This regulatory mechanism is associated with the downregulation of key genes in the circadian rhythm pathway, thus, regulating the blue light metabolism pathway to promote flowering under short-day induction. In addition, the antenna protein pathway accelerates electron transfer through gene upregulation to promote the flowering of adzuki beans. Eight DEGs screened from these two metabolic pathways were mostly upregulated and were re-verified by RNA-seq as candidate genes for regulating adzuki bean flowering. These results further clarify the metabolic pathway of adzuki bean flowering under short-day induction and provide valuable information for future functional studies of flowering-related genes. Methods Experimental material A late maturity variety ‘Tangshan Hongxiaodou’sensitive to short-day was selected as the experimental material, provided by the adzuki Bean Breeding Research Group of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. The experiment had been conducted in the Teaching and experimental base of Hebei Agricultural University, Baoding (longitude: 115°47 ', latitude: 38°87 ') in 2021. As a typical short-day crop, adzuki bean is very sensitive to short-day induction, and thus the flowering time and maturity stage are significantly earlier than previously. Soil Fertility The soil type of this experimental field is loam soil. 400g compound fertilizer (N-P 2 O 5 -K 2 O = 24:4:8) was applied to each plot (length 5m, width 1m) before sown, and the nutrient content of the experimental plot was measured after ploughing. The fertility of the cultivated soil layer (0-20cm) of the experimental plot was shown in Table 3 (Additional file 27:Table S3 ). Table 1 Plant height, stem diameter and leaf area of adzuki bean under different short-day inducement times. Determination index Treatment Flowering Podding Seed-fling Plant height/cm SD-5d 39.51 ± 1.01a 44.03 ± 0.63a 45.61 ± 0.64a SD-10d 35.00 ± 2.29b 39.04 ± 0.55b 41.46 ± 1.42a SD-15d 28.96 ± 3.57c 32.18 ± 0.92c 33.81 ± 1.12b Stem diameter/cm SD-5d 1.65 ± 0.08a 1.84 ± 0.04a 2.11 ± 0.12a SD-10d 1.59 ± 0.04ab 1.72 ± 0.03b 1.99 ± 0.11ab SD-15d 1.47 ± 0.06b 1.48 ± 0.04c 1.83 ± 0.14b Leaf area/cm 2 SD-5d 28.62 ± 0.92a 30.55 ± 0.59a 36.04 ± 1.88a SD-10d 25.77 ± 0.49b 27.85 ± 0.28b 31.99 ± 1.26b SD-15d 22.92 ± 0.69c 22.58 ± 0.77c 26.78 ± 1.01c Values are means ± S.E. The differe n t small letters in the same column indicate statistical significance at 0.05 level by DMRT. Table 2 List of different genes associated with light in circadian rhythm and antenna proteins signaling pathways. Gene ID LOC108331766 LOC108322606 LOC108345872 LOC108328079 LOC108344684 LOC108335068 LOC108333950 LOC108338432 KEGG map Circadian rhythm-plant (KEGG map) Photosynthesis-antenna proteins (KEGG map) Gene symbol F17H15.25 F11C10.3 /F11C10.4 CAB21 F27I1.2 CAB1B CAB3 LHBC1 LHCB2 Regulation Up Down Up Up Up Up Up Up Location Chromosome 4 NC_030640.1 Chromosome Un NW_016115133.1 Chromosome 10 NC_030646.1 Chromosome 3 NC_030639.1 Chromosome 10 NC_030646.1 Chromosome 6 NC_030642.1 Chromosome 5 NC_030641.1 Chromosome 7 NC_030643.1 Description Protein early flowering 3-like Protein suppressor of phya-1051-like Chlorophyll a-b binding protein of LHCII type 1-like Chlorophyll a-b binding protein CP29.3, chloroplastic Chlorophyll a-b binding protein of LHCII type 1-like Chlorophyll a-b binding protein of LHCII type 1-like Chlorophyll a-b binding protein 13, chloroplastic-like Chlorophyll a-b binding protein 215, chloroplastic Differential groups SD-5d VS SD-10d; SD-5d VS SD-15d SD-5d VS SD-10d;SD-10d VS SD-15d SD-5d VS SD-10d;SD-5d VS SD-15d༛SD-10d VS SD-15d SD-5d VS SD-10d SD-5d VS SD-10d;SD-5d VS SD-15d༛SD-10d VS SD-15d SD-5d VS SD-15d;SD-10d VS SD-15d SD-5d VS SD-15d SD-10d VS SD-15d q-value 2.83E-03 6.78E-06 5.84E-33 1.44E-51 3.64E-08 4.27E-39 1.23E-05 8.03E-07 6.62E-14 1.19E-41 3.09E-14 4.91E-18 1.58E-12 2.32E-12 6.97E-15 Functional annotations of orthologs Protein early flowering 3-like WD40 repeat Chlorophyll A-B binding protein Chlorophyll A-B binding protein Chlorophyll A-B binding protein Chlorophyll A-B binding protein Chlorophyll A-B binding protein Chlorophyll A-B binding protein Table 3 Determination of soil nutrients content in experiment field Experimental site Year Determination index Organic matter(%) Total nitrogen(%) Available nitrogen(ppm) Available phosphorus(ppm) Available potassium(ppm) Teaching and experimental base of Hebei Agricultural University 2021 1.61 0.0969 85.88 66.761 189.2 Environmental characteristics in the community after shading The environmental characteristics of the plot after shading treatment are shown in Table 4 (Additional file 28:Table S4 ). Compared with the atmospheric environment, the light intensity in the plot after shading is near zero, and the relative humidity is significantly increased by 21.41%, while the CO2 concentration and temperature are slightly increased, but not reaching a significant level. Table 4 Changes in field microclimate with shading treatment Treatment Illumination intensity (lux) CO 2 concentration (ppm) Relative humidity (%) Temperature (℃) Ambient environment 58865.41 ± 1547.23a 478.46 ± 15.56a 75.35 ± 5.83b 25.88 ± 1.33a Environment of Plots 11.67 ± 4.21b 534.54 ± 18.76a 95.88 ± 6.43a 26.87 ± 1.47a Note: Values are means ± S.E, The different small letters in the same column indicate statistical significance at 0.05 level by DMRT. The same as below. Test Methods Short-day treatment Before sowing, the experimental field plot with 5m long and 1m wide was applied 400g compound fertilizer (N-P 2 O 5 -K 2 O = 24:4:8). Then, ploughing was carried out and sowing was carried out on June 24. All plots were two-rows planting with a row spacing of 15cm×40cm. When the true leaf unfolded, short-day treatments was implemented by extending the night length (10h light/14 h dark) automatically, that realized by putting the stainless-steel shelf covered with opaque cloth on the upper side of the plots. The shading treatment is 10h-light and 14h-dark with shading 5d, 10d and 15d respectively. By adopting the randomized-block arrangement, this experiment was initialed shading treatment with opaque cloth begun at 18:00 every day and finished at 8:00 the next morning. After the shading treatment, all plants were grown to maturity under natural light. 0.4% potassium dihydrogen phosphate was sprayed at the initial flowering stage and pod setting stage, respectively, when one-time irrigating and controlling of insects and diseases were performed. There were three shading treatments with three replicates and nine plots. After 5, 10 and 15 days of shading, the middle leaflet samples of top trifoliate leaves were uniformly taken at 9:00 am with 5–6 plants duplications. All samples were marked as SD-5d-1, SD-5d-2, SD-5d-3; SD-10d-1, SD-10d-2, SD-10d-3; SD-15d-1, SD-15d-2, SD-15d-3, respectively. After sampling, the samples were quick-frozen in liquid nitrogen and placed in a refrigerator at -80 ° C, and RNA extraction and sequencing were performed one week later. Determination of meteorological factors The light intensity was measured by TES1332 illuminometer (provided by College of Plant Protection, Agricultural University of Hebei, TES1332, Taiwan) at 20–30 cm above the canopy of adzuki bean community. CO 2 concentration was measured by Li-6400 portable photosynthetic meter (LI-COR, Lincoln, NE, USA). Temperature and humidity were measured by HOBO Pro V2 series (U23-002, produced in the United States), which counted and recorded data automatically every hour. Determination of growth index plant height, stem diameter and leaf area were measured with three representative plants selected from each plot at flowering, pod setting and grain filling stages, respectively. Plant height was the distance from the true leaf to the growing point of the plant. The diameter of the plant stem at the true leaf was measured with a vernier caliper, and calculated with the formular: circumference = 2*3.14* (diameter/2). Leaf area was measured by YMJ-B leaf area measuring instrument (Hangzhou Huier Instrument Equipment Co, LTD). Investigation and statistics of flowering characteristics At the flowering stage, 3 representative plants were selected from each treatment with 3 replicates. The advanced flowering days was recorded and the flowering promotion rate was calculated. The determination formula is as follows: Advanced flowering days = days from emergence to flowering of plants in control-days from emergence to flowering of plants in different treatments Flowering promoting rate (%) = [(days from emergence to flowering in control - days from emergence to flowering in different treatments) ×100]/days from emergence to flowering in control RNA extraction and cDNA library construction Total RNA was isolated from samples and DNA was digested by DNase. Eukaryotic mRNA was enriched using oligo (dT) coupled to magnetic beads, and the mRNA was broken down into short fragments by the addition of interrupting reagents. The interrupted mRNA was used as the template to synthesize one-strand cDNA with six-base random primers; and then a two-strand synthesis reaction system was prepared to synthesize two-strand cDNA, which was further purified by the kit and carried out end-to-end repair, A-tail addition and sequencing adapter connection, fragment size selection, and finally PCR amplification and library construction. After qualified by Agilent 2100 Bioanalyzer, the constructed libraries were sequenced using Illumina HiSeqTM2500 or Illumina HiSeq X Ten sequencer to produce 125bp or 150bp double-ended reads. Screening of differentially expressed genes FPKM[ 29 ], bowtie2[ 30 ] and express software [ 31 ] were used to analyze the transcript levels. With a reference genome of Vigna angularis ( https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/190/045/ )[ 32 ], the number of transcript (protein - coding) reads for all samples were obtained by express software. Genes with an average number of reads greater than 2 were screened, and related data was standardized by the estimateSizeFactors function of DESeq[ 33 ] R package. The p-value and fold-change values of difference comparison were calculated by nbinomTest function. Differentially expressed genes (DEGs) were screened based on Fold Change ≥ 2 and FDR < 0.05. Functional annotation analysis of differentially expressed genes (DEGs) Gene Ontology (GO) annotations and functional classification of differential genes (p 2) were generated using Blast2 GO and WEGO. Furtherly, BLAST was used to align gene sequences to KEGG (Kyoto Encyclopedia of Genes and Genomes) database for gene annotation of biochemical pathway and identification of the regulatory-metabolic network of organisms. qRT-PCR validation Under the same treatment, other samples of adzuki bean were used to conduct qRT-PCR on 8 selected DEGs to verify the accuracy of sequencing results. RNA was extracted using an RNA extraction kit followed by reverse transcription to produce cDNA (HiScript II Q RT SuperMix for qPCR). Primer 5.0 was used to design the primers, and the primer sequences are shown in Table 5 (Additional file 29:Table S5 ). The quantitative Kit (QuantiFast® SYBR® Green PCR Kit) was used to prepare the qRT-PCR reaction system and the transcripts were detected on the fluorescence quantitative PCR instrument. The qRT-PCR cycling conditions were as follows: 40 cycles of predenaturation at 95°C for 10 min, denaturation at 95°C for 10s, and annealing extension at 60°C for 30s. Gene expression was calculated using the method of 2-∆∆Ct [ 34 ]. Table 5 Primer design for qRT-PCR validation of eight differentially significant genes Order number Gene ID Forward primer sequence (5’→3’) Reverse primer sequence (5’→3’) 1 ACTIN CTAAGGCTAATCGTGAGAA CGTAAATAGGAACCGTGT 2 LOC108331766 AAAAGGGAGGACCAAGAGCAC TGAGTGGCACAACACCTGAAT 3 LOC108322606 AAGCAAACAAGGAAGGGAAAG TGAAACATGGCTGCAAAAGAT 4 LOC108345872 GAGGCTCCTTCTTACCTGACG AGTTCACGGTTTCGAGCAAAT 5 LOC108328079 AAGAAACGCAGAACTTGACCC GCTTGAATGGCAAAGATGAGG 6 LOC108344684 GAGGCTCCTTCTTACCTGACG AGTTCAAGGTTCCGAGCAAAT 7 LOC108335068 GAGGTGACCGACCCAATTTAC CACAATCGCCTGAACAAAGAA 8 LOC108333950 GGGTTCTTTGTTCAAGCCATT ACCCAAGCATTGTTAGCCACT 9 LOC108338432 CAGGTTGTGCTTATGGGGTTT AGCGACCATTCTTGAGTTCCT Declarations Authors’contributions Weixin Dong Yuechen Zhang designed the experiment in advance, Lei Zhang prepared for the test and treatment of test materials. Peijun Tao designed and performed the experiment. Weixin Dong analyzed the data and wrote the manuscript. Dongxiao Li revised the paper and all authors read and agreed to the final manuscript. Funding This work was supported by the Hebei Province Natural Science Foundation for Youth (C2021204405), the China Agriculture Research System of MOF and MARA-Food Legumes (CARS-08-G-22), and the National Key Research and Development Program of China (2021YFD1901004-2). Availability of data and materials The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI-PRJNA817421. Ethics approval and consent to participate The seeds used in this study were licensed, and the collection of materials in field studies have complied with relevant institutional and national legislation. Consent for publication All authors agree for publication, and test data were detailed and accurate, ‘Tangshanhongxiaodou’ was used as material for this experimentis. It was a farmer species resources and used widely in scientific research. Competing interests The authors declare that they have no competing interests. Authors' information 1 State Key Laboratory of North China Crop Improvement and Regulation/Key Laboratory of Crop Growth Regulation of Hebei Province/College of Agronomy, Hebei Agricultural University, Baoding, 071001, China, 2 Hebei Open University, Shijiazhuang, 050080, China. Acknowledgements We are heartfelt thanks to Professor Kai Xiao, Yanhong Tang and Huixing Kang. Adzuki Bean Breeding Research Group of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. References Tian J, Cheng XZ. Plant production technology. Beijing, China: Beijing Education Press; 2015. Sacks FM. A literature review of phascolus angularis-the adzuki bean. Phys Rev A. 1971;3(31):9–15. Dong WX, Yin BZ, Wei Y, et al. Effects of short-day photoperiod inducement after early flowering on morphological, physiological and yield in adzuki bean. J Sichuan Agricultural Univ. 2018;36(1):38–45. Dong WX, Yin BZ, Ren S, et al. Effects of short-day photoperiod treatment after early flowering on yield and grain quality of adzuki bean. J Nanjing Agricultural Univ. 2017;40(3):386–92. Ding XL, Wang X, Li Q, et al. Metabolomics studies on cytoplasmic male sterility during flower bud development in soybean. Int J Mol Sci. 2019;20:2869. Liu M, Zhang MT, Dong WX, et al. Effect of photoperiod treatment on the several physiological and biochemical index of flower organ and yield of adzuki bean. J Anhui Agricultural Univ. 2016;43(4):604–9. Kishor U, Antara D, Harsha S, et al. Identifcation and characterization of PEBP family genes reveal CcFT8 a probable candidate for photoperiod insensitivity in C. cajan. Biotech. 2020;10:194. Zhao W, Gu R, Che G, et al. CsTFL1b may regulate the flflowering time and inflflorescence architecture in cucumber ( Cucumis sativus L.). Biochem. Biophys Res Commun. 2018;499:307–13. Yano M, Kojima S, Takahashi Y, et al. Genetic control of flowering in rice, a short-day plant. Plant Physiol. 2001;127:1425–9. Zhang JZ, Ai XY, Sun LM, et al. Transcriptome profile analysis of flowering molecular processes of early flowering trifoliate orange mutant and the wild type [ Poncirus trifoliata (L.) Raf.] by massively parallel signature sequencing. BMC Genom. 2011;12:63. Izawa T. Daylength measurements by rice plants in photoperi_odic short-day fowering. In: Int Rev Cytol. 2007; pp 191–222. Cheng X, Li G, Tang Y, et al. Dissection of genetic regulation of compound inforescence development in medicago truncatula. Development. 2018;145:158766. Taoka K, Ohki I, Tsuji H, et al. 14-3-3 proteins act as intracellular receptors for rice Hd3a forigen. Nature. 2011;476:332–5. Laubinger S, Marchal V, Gourrierec J, et al. Arabidopsis SPAproteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability. Development. 2006;133(16):3213–22. Saijo Y, Sullivan JA, Wang H, et al. The COP1-SPA1 interaction defines a critical step in phytochrome A-mediated regulation of HY5 activity. Genes and Development. 2003;17(21):2642–7. Cober ER, Molnar SJ, Charette M, et al. A new locus for early maturity soybean. Crop Sci. 2010;50(2):524–7. Cober ER, Voldeng HD. A new soybean maturity and photoperiod sensitivity locus linked to and photoperiod-sensitivity locus linked to E1 and T. Crop Sci. 2001;41(3):698–701. Tsubokura Y, Watanabe S, Xia ZJ, et al. Natural variation in the genes responsible for maturity loci E1, E2, E3 and E4 in soybean. Ann Botany. 2014;113(3):429–41. Dissanayaka A, Rodriguez TO, Di S, et al. Quantitative trait locus mapping of soybean maturity gene E5. Breed Sci. 2016;66(3):407–15. Zhao C, Takeshima R, Zhu JH, et al. A recessive allele for delayed flowering at the soybean maturity locus E9 is a leaky allele of FT2a , a FLOWERING LOCUS T ortholog. BMC Plant Biol. 2016;16:20. Banfield MJ, Barker JJ, Perry AC, et al. Function from structure? The crystal structure of human phosphatidylethanolamine-binding protein suggests a role in membrane signal transduction. Structure. 1998;6(10):1245–54. Dong WX, Li DX, Zhang L, et al. Transcriptome analysis of short-day photoperiod inducement in adzuki bean (Vigna angularis L.) based on RNA-Seq. BMC Plant Biol. 2022;13:893245. Yang XU, Liu DJ, Yan ZS, et al. Regulation of fowering under short photoperiods based on transcriptomic and metabolomic analysis in Phaseolus vulgaris L. Mol Genet Genomics. 2021;296:379–90. An HS, Jiang S, Zhang JY. Comparative transcriptomic analysis of differentially expressed transcripts associated with flowering time of loquat (Eriobotya japonica Lindl). Horticulturae. 2021;7(171):1–15. Guan XX, Sui CL, Chen Y, et al. Transcriptome analysis of response of tobacco seedlings to low light stress. Genomics and Applied Biology. 2021;40(1):315–24. Zhao YQ, Zhang Q, Li JW, et al. High temperature in the root zone repressed flowering in Lilium × formolongi by disturbing the photoperiodic pathway and reconfiguring hormones and primary metabolism. Environ Exp Bot. 2021;192:104644. Cai Y, Bartholomew ES, Dong M, et al. The HD-ZIP IV transcription factor CsGL2-LIKE regulates male flowering time and fertility in cucumber. J Exp Bot. 2020;8:1–13. Li ZQ, Tang MQ, Luo DJ, Kashif MH, Cao S, Zhang WX, et al. Integrated methylome and transcriptome analyses reveal the molecular mechanism by which DNA methylation regulates kenaf flowering. Front Plant Sci. 2021;12:709030. Roberts A, Trapnell C, Donaghey J, et al. Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol. 2011;12(3):R22. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. Roberts A, Pachter L. Streaming fragment assignment for real-time analysis of sequencing experiments. Nat Methods. 2013;10:71–3. Anders S, Huber W. Diferential expression of RNA-Seq data at the gene level-the DESeq package. Eur Mol Biol Lab. 2012; 23–5. Kenneth J, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2–11CT method. Methods. 2001;25:402–8. Kang YJ, Satyawan D, Shim S, et al. Draft genome sequence of adzuki bean, Vigna angularis. Sci Rep. 2015;5:8069. Blümel M, Dally N, Jung C. Flowering time regulation in crops what did we learn from Arabidopsis? Curr Opin Biotechnol. 2015;32:121–9. Wahl V, Ponnu J, Schlereth A, et al. Regulation of flowering by trehalose-6-phosphate signaling in Arabidopsis thaliana . Science. 2013;339(6120):704–7. Atsuko K, René R. Genetic and molecular basis of floral induction in Arabidopsis thaliana . J Exp Bot. 2020;71(9):2490–504. Lu SY, Yang ZQ. Regulation of photoperiod on the growth and flowering of cut chrysanthemum. Chin J Agrometeorology. 2021;42(7):596–605. Yang YH, Lei Y, Bai ZY, et al. Effect of different pre-flowering photoperiod on main agronomic traits of soybean. Southwest China Journal of Agricultural Sciences. 2021;34(2):250–7. De Bianchi S, Betterle N, Kouril R, et al. Arabidopsis mutants deleted in the light-harvesting protein Lhcb4 have a disrupted photosystem â…¡ macrostructure and are defective in photoprotection. Plant Cell. 2011;23(7):2659–79. Marin A, Passarini F, Stokkum IHM, et al. Minor complexes at work: light-harvesting by carotenoids in the ph.otosystem â…¡ antenna complexes CP24 and CP26. Biophys J. 2011;100(11):2829–38. Xia YS, Ning ZS, Bai CH, et al. Allelic variations of a light harvesting chlorophyll A/B binding protein gene (Lhcb1) associated with agronomic traits in barley. PLoS ONE. 2012;7(5):e37573. Xu YH, Liu YR, Yan L, et al. Light-harvesting chlorophyll a/b-binding proteins are required for stomatal response to abscisic acid in Arabidopsis. J Exp Bot. 2012;63(3):1095–106. Song YH, Ito S, Imaizumi T. Similarities in the circadian clock and photoperiodism in plants. Curr Opin Plant Biol. 2010;13(5):594–603. Wang H, Lu Y, Gu AX et al. Expression analysis of key clock genes of lcc - 1 mutant from chinese cabbage under different photoperiods. J Hebei Agricultural Univ 42(4):21–8. Xiao DL, Zhang D, Ma L, et al. Preliminary study on differentially expressed genes of sparassis latifolia under light inducing. Edible Fungi of China. 2017;36(5):60–3. He P, Li LG, Wang HB, et al. Effects of shading fruit with opaque paper bag on transcriptome in peach. Scientia Agricultura Sinica. 2017;50(6):1088–97. Cerdan PD, Chory J. Regulation of flowering time by light quality. Nature. 2003;423:881–5. Blackman BK, Rasmussen DA, Strasburg JL, et al. Contributions of flowering time genes to sunflower domestication and improvement. Genetics. 2010;187(1):271–87. Ishikawa M, Kiba T, Chua NH. The Arabidopsis SPA1 gene is required for circadian clock function and photoperiodic flowering. Plant J. 2006;46(5):736–46. Liu B, Zuo Z, Liu H, et al. Arabidopsis cryptochrome 1 interacts with SPA1 to suppress COP1 activity in response to blue light. Gene and Development. 2011;25(10):1029–34. Zuo Z, Liu H, Liu B, et al. Blue light-dependent interaction of CRY2 with SPA1regulates COP1 activity and floral initiation in Arabidopsis. Curr Biology:CB. 2011;21(10):841–7. Jang S, Marchal V, Panigrahi KC, et al. Arabidopsis COP1 shapes the temporal pattern of CO accumulation conferring a photoperiodic flowering response. The EMBO Jjournal. 2008;27(8):1277–88. Lazaro A, Valverde F, Pineiro M, et al. The Arabidopsis E3ubiquitin ligase HOS1negativelys CONSTANS abundance in the photoperiodic control of flowering. Plant Cell. 2012;24(3):982–9. Xia ZJ, Zhai H, Zhang YF, et al. QNE1 is a key flowering regulator determining the length of the vegetative period in soybean cultivars. Sci China Life Sci. 2022;65(12):2472–90. Liu TM, Li X, Wang Q, et al. Analysis on cloning and expression of promoter of flowering Time Gm FT2a in soybean. J Northeast Agricultural Univ. 2022;29(1):1–8. Lin XY, Liu BH, James LW, et al. Molecular mechanisms for the photoperiodic regulation of flowering in soybean. J Integr Plant Biol. 2021;63(6):981–94. Chen YL, Zhang LP, Zhang HY, et al. ERF1 delays flowering through direct inhibition of FLOWERING LOCUS T expression in Arabidopsis. J Integr Plant Biol. 2021;63(10):1712–23. Yan JD, Li XM, Zeng BJ, et al. FKF1 F-box protein promotes flowering in part by negatively regulating DELLA protein stability under long-day photoperiod in Arabidopsis. J Integr Plant Biol. 2020;62(11):1717–40. Xu X, Meng QL, Geng MF, et al. Divergence in flowering time is a major component contributing to reproductive isolation between two wild rice species(Oryza rufipogon and O. nivara). Sci China (Life Sciences). 2020;63(11):1714–24. Additional Declarations No competing interests reported. Supplementary Files File1figure.1ABCD.xls File2table1.xlsx File3figure.2A.xls File4figure.2B.xlsx File5figure.2C.xlsx File6figure.2D.xlsx File7figure.2E.xls File8figure.3A.xlsx File9figure.3B.xlsx File10figure.3C.xlsx File11figure.3D.xlsx File12figure.4A.xlsx File13figure.4B.xlsx File14figure.4C.xlsx File15figure.4D.xls File16figure.5AB.csv File17figure.5CD.csv File18figure.5EF.csv File19figure.6A.xlsx File20figure.6B.xlsx File21figure.6C.xlsx File22figure.6D.xlsx File23figure.6E.xlsx File24figure.6F.xlsx File25table2.xlsx File26figure.9.xlsx File27table3.xlsx File28table4.xlsx File29table5.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3362672","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":234474331,"identity":"3d37a370-4073-4629-aa30-ba975769d957","order_by":0,"name":"Weixin Dong","email":"","orcid":"","institution":"Hebei Open University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weixin","middleName":"","lastName":"Dong","suffix":""},{"id":234474332,"identity":"1a838b15-183f-423e-a13f-fd3b8bffee9b","order_by":1,"name":"Dongxiao Li","email":"","orcid":"","institution":"Agricultural University of Hebei","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dongxiao","middleName":"","lastName":"Li","suffix":""},{"id":234474333,"identity":"9b94b84b-9f84-4f2b-858d-bb8d42e2c4e3","order_by":2,"name":"Lei Zhang","email":"","orcid":"","institution":"Agricultural University of Hebei","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Zhang","suffix":""},{"id":234474334,"identity":"e0b8e5dc-f4c9-41bc-9c2f-1ef81b2d4bba","order_by":3,"name":"Peijun Tao","email":"","orcid":"","institution":"Agricultural University of Hebei","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Peijun","middleName":"","lastName":"Tao","suffix":""},{"id":234474335,"identity":"4458deef-4ee6-4474-9b4c-96b1dc7daf52","order_by":4,"name":"Yuechen Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYBAC+xkQmoefvSHxQUKFDWEtjFAtMpI9Bx4bPDiTRrwWG4Mbjs8kH7YdIqyFWbr52cOvbXY8BjeY0yoS2A4w8Ld3J+DVwiZzzNxYti2ZR/J2W9qNBJ47DBJnzm7Aq4VHIsFMWrLtAA/fnTNALRLPGAwkcvFrkZBI/wbWwnAj/1tBgsFhwloMJHLMJD8CtQjcSEhjSEggTkuZNMM5oF96DiRLJBxI4yHoF/sZ6dskf5TZ2YOi8uPPfzZy/O29+LWAADMvG4LDQ1A5CDD++EOUulEwCkbBKBipAABuXEyRBgs5/AAAAABJRU5ErkJggg==","orcid":"","institution":"Agricultural University of Hebei","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yuechen","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2023-09-17 07:44:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3362672/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3362672/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":43660104,"identity":"4353ef27-d4f6-4311-a122-d176a33520e3","added_by":"auto","created_at":"2023-09-25 23:17:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":205297,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of short-day induction on growth, apical inflorescence, flowering days and flowering promotion rate in adzuki bean\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Adzuki bean plant pictures of different short-day inducement times. There were three treatments (SD-5d, SD-10d, SD-15d); \u003cstrong\u003eB\u003c/strong\u003e Advanced flowering days of adzuki bean in three different treatment groups; \u003cstrong\u003eCD \u003c/strong\u003eEarly flowering days and flowering promoting rate of adzuki bean in three different treatment groups.\u003c/p\u003e","description":"","filename":"F1.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/e77343294acd4bccf2ee1d4a.png"},{"id":43661857,"identity":"f42b894d-0e64-450c-95f9-042b297207e7","added_by":"auto","created_at":"2023-09-25 23:25:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":166922,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of effect on different genes number under different short-day induction\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eNumbers of the significantly regulated genes under short-day induction treatment different days. The numbers on the horizontal axis reflect different treatment and the vertical axis represents numbers of total, up-and down-regulated genes, respectively. \u003cstrong\u003eBCD \u003c/strong\u003eVenn diagram analysis of significantly regulated genes under short-day induction treatment different days. \u003cstrong\u003eE\u003c/strong\u003e Heatmap clustering of global pattern of the strongly regulated genes conducted using Hierarchical Clustering (HCL) algorithm under short-day induction treatment different days. The color scale represents the values of lg FPKM (FPKM-Fragments Per Kilobase of transcript per Million fragments mapped.\u003c/p\u003e","description":"","filename":"F2.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/f80d9bbefa85abe7f6834f83.png"},{"id":43660108,"identity":"1eff4a72-944a-4780-a9ed-19cdb95c26cd","added_by":"auto","created_at":"2023-09-25 23:17:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":68096,"visible":true,"origin":"","legend":"\u003cp\u003eResults of the GO enrichment in three group comparing SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e SD-5d vs SD-10d GO analysis under short-day induction treatment different days. \u003cstrong\u003eB\u003c/strong\u003e SD-5d vs SD-15d GO analysis under short-day induction treatment different days. \u003cstrong\u003eC\u003c/strong\u003e SD-10d vs SD-15d GO analysis under short-day induction treatment different days.\u003cstrong\u003e D\u003c/strong\u003e The GO enrichment results are common to three comparison groups.\u003c/p\u003e","description":"","filename":"F3.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/717ee34a733eaeb64d23a859.png"},{"id":43660106,"identity":"f16cee32-a883-49fe-8156-8137859fd04c","added_by":"auto","created_at":"2023-09-25 23:17:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":95363,"visible":true,"origin":"","legend":"\u003cp\u003eResults of the KEGG enrichment in three group comparing SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e SD-5d vs SD-10d KEGG analysis under short-day induction treatment different days. \u003cstrong\u003eB\u003c/strong\u003e SD-5d vs SD-15d KEGG analysis under short-day induction treatment different days. \u003cstrong\u003eC \u003c/strong\u003eSD-10d vs SD-15d KEGG analysis under short-day induction treatment different days. \u003cstrong\u003eD \u003c/strong\u003eThe KEGG enrichment results are common to three comparison groups.\u003c/p\u003e","description":"","filename":"F4.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/ebb4f167224152479d0e4a15.png"},{"id":43663603,"identity":"6cd9c8a9-4aed-4db8-8144-773541020b1c","added_by":"auto","created_at":"2023-09-25 23:33:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":99052,"visible":true,"origin":"","legend":"\u003cp\u003eGene set enrichment analysis of antenna proteins and circadian rhythm pathway\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eABC \u003c/strong\u003eGene set enrichment analysis of antenna proteins in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15d three comparison groups.\u003cstrong\u003e DEF \u003c/strong\u003eGene set enrichment analysis of circadian rhythm pathway in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15d three comparison groups.\u003c/p\u003e","description":"","filename":"F5.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/038f82daa7cd0d03a5207b00.png"},{"id":43661863,"identity":"7e644bb9-7b8b-4290-b2d2-3c86cd09613b","added_by":"auto","created_at":"2023-09-25 23:25:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":75869,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap cluster analysis of differential genes in antenna proteins and circadian rhythm metabolic pathways\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eABC\u003c/strong\u003e Enrichment analysis of circadian rhythm pathways in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15d three comparison groups. \u003cstrong\u003eDEF\u003c/strong\u003e Enrichment analysis of antenna proteins pathways in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15d three comparison groups.\u003c/p\u003e","description":"","filename":"F6.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/30a2b5a1fa2da738053a34ab.png"},{"id":43660117,"identity":"3ddeedaf-6128-475b-8ec8-7bde816b295e","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":65770,"visible":true,"origin":"","legend":"\u003cp\u003eCircadian rhythm metabolic pathway and analysis of gene expression in this pathway\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Circadian rhythm metabolic pathway of adzuki bean. \u003cstrong\u003eB\u003c/strong\u003e Analysis of gene expression in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15d three comparison groups of circadian rhythm metabolic pathway.\u003c/p\u003e","description":"","filename":"F7.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/881f47c9d7d32a2f450b8c65.png"},{"id":43660115,"identity":"7ed83778-e251-4da1-86c6-d34e8198690c","added_by":"auto","created_at":"2023-09-25 23:17:10","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":130275,"visible":true,"origin":"","legend":"\u003cp\u003eAntenna proteins metabolic pathway and analysis of gene expression in this pathway\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Antenna proteins metabolic pathway diagram of adzuki bean. \u003cstrong\u003eB \u003c/strong\u003eAnalysis of gene expression in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15d three comparison groups of antenna proteins metabolic pathway.\u003c/p\u003e","description":"","filename":"F8.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/020ffb37b7c9b7bd19dc61bd.png"},{"id":43661859,"identity":"e8a5ec18-3f22-49b6-b301-788c04a0052f","added_by":"auto","created_at":"2023-09-25 23:25:10","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":53156,"visible":true,"origin":"","legend":"\u003cp\u003eThe qRT-PCR validation of 8 differentially related photoperiod expressed genes in circadian rhythm and antenna proteins pathways\u003c/p\u003e\n\u003cp\u003e*Indicates signifificant difference at 0.05 level, ** and *** indicate extremely signifificant difference at 0.01 and 0.001 level.\u003c/p\u003e","description":"","filename":"F9.png","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/8a268ecfa07389dd6d5a35f5.png"},{"id":43708356,"identity":"4f3d799f-8c01-49af-ad5f-2abc15815e47","added_by":"auto","created_at":"2023-09-26 15:03:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1514575,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/829d1d5b-e2bc-4c81-b1bc-953aa968c66e.pdf"},{"id":43663948,"identity":"61e8d2b8-64d2-493f-957f-393d8049c168","added_by":"auto","created_at":"2023-09-25 23:41:10","extension":"xls","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1055744,"visible":true,"origin":"","legend":"","description":"","filename":"File1figure.1ABCD.xls","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/941d07fd7405f8e0aa505a54.xls"},{"id":43663600,"identity":"c2d79e51-e972-43b1-804b-291ca8c46fb8","added_by":"auto","created_at":"2023-09-25 23:33:10","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":14470,"visible":true,"origin":"","legend":"","description":"","filename":"File2table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/ec547f46f80e8591f1d51f06.xlsx"},{"id":43661858,"identity":"9e6e8990-22e9-4f91-bccc-e8c830442781","added_by":"auto","created_at":"2023-09-25 23:25:10","extension":"xls","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":11264,"visible":true,"origin":"","legend":"","description":"","filename":"File3figure.2A.xls","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/e197d03f70185dadc615fada.xls"},{"id":43660112,"identity":"9097dcd0-cdae-46ca-84a2-4551cf91e76d","added_by":"auto","created_at":"2023-09-25 23:17:10","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":71602,"visible":true,"origin":"","legend":"","description":"","filename":"File4figure.2B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/26fad8b34151e2b817b1406f.xlsx"},{"id":43706193,"identity":"28cddb3d-41ac-462f-85dd-9d0a0e378f61","added_by":"auto","created_at":"2023-09-26 14:55:01","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":57019,"visible":true,"origin":"","legend":"","description":"","filename":"File5figure.2C.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/e844cd3525c57043cbf66e32.xlsx"},{"id":43664236,"identity":"2cc58635-24d8-4dc1-91cd-1cdb49fdac37","added_by":"auto","created_at":"2023-09-25 23:49:11","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":54448,"visible":true,"origin":"","legend":"","description":"","filename":"File6figure.2D.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/cd9ff224a1839f7082f5735c.xlsx"},{"id":43663602,"identity":"c4cb961a-ed6c-41dd-8387-0e658dcfd3c2","added_by":"auto","created_at":"2023-09-25 23:33:10","extension":"xls","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":33792,"visible":true,"origin":"","legend":"","description":"","filename":"File7figure.2E.xls","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/40f361e4826f716643127541.xls"},{"id":43661862,"identity":"b92a9695-7b4d-4075-b44b-ba2fb125b56a","added_by":"auto","created_at":"2023-09-25 23:25:10","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":9754,"visible":true,"origin":"","legend":"","description":"","filename":"File8figure.3A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/85b1281c0dfa72c9632c8107.xlsx"},{"id":43661867,"identity":"6bcc6f06-f005-4bed-aa08-7c4e3303cab9","added_by":"auto","created_at":"2023-09-25 23:25:11","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":9730,"visible":true,"origin":"","legend":"","description":"","filename":"File9figure.3B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/c2bc8b7ca1158b316b37d3f6.xlsx"},{"id":43663950,"identity":"183208e5-631e-46b5-83f9-485fe4429ca9","added_by":"auto","created_at":"2023-09-25 23:41:11","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":9755,"visible":true,"origin":"","legend":"","description":"","filename":"File10figure.3C.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/a8ddfbc7b06aaf5679141621.xlsx"},{"id":43663606,"identity":"514305d9-5b0d-4691-9287-8339edd51739","added_by":"auto","created_at":"2023-09-25 23:33:11","extension":"xlsx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":9278,"visible":true,"origin":"","legend":"","description":"","filename":"File11figure.3D.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/82c02818ca869894506792b3.xlsx"},{"id":43660121,"identity":"49fd137c-9af0-486d-98bb-4ecb9442cf82","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xlsx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":12410,"visible":true,"origin":"","legend":"","description":"","filename":"File12figure.4A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/d54037c248243c54702c738c.xlsx"},{"id":43661871,"identity":"4f6dc5f7-da73-49b5-b29d-08a9ee9a90f9","added_by":"auto","created_at":"2023-09-25 23:25:11","extension":"xlsx","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":12698,"visible":true,"origin":"","legend":"","description":"","filename":"File13figure.4B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/ce70f0a4bd29db83ddc34d63.xlsx"},{"id":43663951,"identity":"084b0b07-f1fc-4229-b828-598ab47f9df1","added_by":"auto","created_at":"2023-09-25 23:41:11","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":12332,"visible":true,"origin":"","legend":"","description":"","filename":"File14figure.4C.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/350b59687df9f375d73ca0de.xlsx"},{"id":43660129,"identity":"0cc454b2-5eec-4d46-a963-48d573d4b30c","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xls","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":19456,"visible":true,"origin":"","legend":"","description":"","filename":"File15figure.4D.xls","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/fa1989493e6bb63a681c853d.xls"},{"id":43663608,"identity":"aee661ba-5bc0-481a-9615-f624abe196bb","added_by":"auto","created_at":"2023-09-25 23:33:11","extension":"csv","order_by":16,"title":"","display":"","copyAsset":false,"role":"supplement","size":38692,"visible":true,"origin":"","legend":"","description":"","filename":"File16figure.5AB.csv","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/d1e9c4e57c3f193d8b09e0c0.csv"},{"id":43663954,"identity":"54ee4b8e-ddcf-4431-8177-64b72d4a26c8","added_by":"auto","created_at":"2023-09-25 23:41:11","extension":"csv","order_by":17,"title":"","display":"","copyAsset":false,"role":"supplement","size":37637,"visible":true,"origin":"","legend":"","description":"","filename":"File17figure.5CD.csv","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/183809e5613c915e890140bb.csv"},{"id":43660128,"identity":"fe78dee0-3f37-4ef3-abd3-20bf7973b14f","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"csv","order_by":18,"title":"","display":"","copyAsset":false,"role":"supplement","size":38393,"visible":true,"origin":"","legend":"","description":"","filename":"File18figure.5EF.csv","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/8a31e49e8623ed9249c33890.csv"},{"id":43660133,"identity":"4c7fad62-52e7-47e6-b5e3-68688766485b","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xlsx","order_by":19,"title":"","display":"","copyAsset":false,"role":"supplement","size":9197,"visible":true,"origin":"","legend":"","description":"","filename":"File19figure.6A.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/f73e096395e80118bd60a2fe.xlsx"},{"id":43660135,"identity":"90a1bd01-c4d6-47c3-ade5-52efdf010e30","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xlsx","order_by":20,"title":"","display":"","copyAsset":false,"role":"supplement","size":9357,"visible":true,"origin":"","legend":"","description":"","filename":"File20figure.6B.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/3ca463c441e41033f36462b4.xlsx"},{"id":43663610,"identity":"95db2a4d-90e1-4198-95c1-39968d3e9dbf","added_by":"auto","created_at":"2023-09-25 23:33:11","extension":"xlsx","order_by":21,"title":"","display":"","copyAsset":false,"role":"supplement","size":9349,"visible":true,"origin":"","legend":"","description":"","filename":"File21figure.6C.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/898807fa364672f269d8303e.xlsx"},{"id":43660139,"identity":"7fd18487-c00a-49ed-9988-0dd0673756b1","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xlsx","order_by":22,"title":"","display":"","copyAsset":false,"role":"supplement","size":9252,"visible":true,"origin":"","legend":"","description":"","filename":"File22figure.6D.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/cd5c83366f97b9e013040efb.xlsx"},{"id":43661874,"identity":"d271677b-87fc-4ead-8463-6ba1c5cb6ab0","added_by":"auto","created_at":"2023-09-25 23:25:11","extension":"xlsx","order_by":23,"title":"","display":"","copyAsset":false,"role":"supplement","size":9416,"visible":true,"origin":"","legend":"","description":"","filename":"File23figure.6E.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/41ffd6612f8dd419ba93ffa7.xlsx"},{"id":43661880,"identity":"add90349-b936-4c19-801a-f21523766ec6","added_by":"auto","created_at":"2023-09-25 23:25:11","extension":"xlsx","order_by":24,"title":"","display":"","copyAsset":false,"role":"supplement","size":9478,"visible":true,"origin":"","legend":"","description":"","filename":"File24figure.6F.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/2cd6a443d5a551544d725935.xlsx"},{"id":43663613,"identity":"cb488b5c-dbe2-4d7b-a06b-5b40cca79480","added_by":"auto","created_at":"2023-09-25 23:33:11","extension":"xlsx","order_by":25,"title":"","display":"","copyAsset":false,"role":"supplement","size":12249,"visible":true,"origin":"","legend":"","description":"","filename":"File25table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/211dec5d2eac5ca492b36ef4.xlsx"},{"id":43663953,"identity":"10b21058-4c8a-49d1-96c9-73273c48f3f8","added_by":"auto","created_at":"2023-09-25 23:41:11","extension":"xlsx","order_by":26,"title":"","display":"","copyAsset":false,"role":"supplement","size":55764,"visible":true,"origin":"","legend":"","description":"","filename":"File26figure.9.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/542e735802c70f7b104df97a.xlsx"},{"id":43661876,"identity":"f7f7505d-18ba-46d4-a786-ee22e9eb5cf6","added_by":"auto","created_at":"2023-09-25 23:25:11","extension":"xlsx","order_by":27,"title":"","display":"","copyAsset":false,"role":"supplement","size":10502,"visible":true,"origin":"","legend":"","description":"","filename":"File27table3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/1140da73b3418ebbd2bca0c9.xlsx"},{"id":43660131,"identity":"d96b30ec-b066-4dd5-8d80-a0a1f2f27ccd","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xlsx","order_by":28,"title":"","display":"","copyAsset":false,"role":"supplement","size":10649,"visible":true,"origin":"","legend":"","description":"","filename":"File28table4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/3b96521a2b62922fb6d838ac.xlsx"},{"id":43660134,"identity":"cba70f30-ca9b-4654-9da8-3fab893c1318","added_by":"auto","created_at":"2023-09-25 23:17:11","extension":"xlsx","order_by":29,"title":"","display":"","copyAsset":false,"role":"supplement","size":10770,"visible":true,"origin":"","legend":"","description":"","filename":"File29table5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3362672/v1/fd0150ce9d1f1cd5a784bf81.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Analysis of flowering-associated gene expressions and metabolic characteristics in adzuki bean (Vigna angularis L.) with different short-day induction","fulltext":[{"header":"Background","content":"\u003cp\u003eAdzuki bean, which originated in China, is an important grain crop. As a homologous medicinal food species, it plays an important role in the human diet with a perennial export volume of approximately 40,500 tons[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. However, this species experiences serious shedding of flowers and pods, so the yield of adzuki beans is low and unstable [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Many recent studies [\u003cspan additionalcitationids=\"CR4 CR5 CR6\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] have found that sunshine duration could be set at the seedling stage to regulate flowering time, which has had a significant impact on improving the bean yield and quality in the later stage. To date, there have been few reports on the molecular mechanisms of short-day induction and regulation of adzuki bean flowering. RNA-Seq technology can comprehensively identify transcripts, conduct transcriptome analyses, and rapidly identify genes with high sensitivity and accuracy. Therefore, using this technology to identify the regulatory pathways and candidate genes involved in plant flowering is important for understanding the molecular mechanisms underlying plant flowering.\u003c/p\u003e \u003cp\u003eAs an important phenological stage, the flowering phase initiates plant reproduction and involves complex transduction mechanisms of environmental signals, including light and temperature [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Among these, photoperiod is one of the most important environmental factors affecting flowering time in plants. The molecular mechanisms of \u003cem\u003eArabidopsis thaliana\u003c/em\u003e in response to photoperiod flowering have been extensively studied [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. As a typical long-day plant, the flowering of \u003cem\u003eA. thaliana\u003c/em\u003e can be triggered rapidly under 16 h of light, but is delayed under 8 h of light. The regulatory mechanism is related to the fact that CO protein levels are high in the long term and the mRNA level of FT is increased. Finally, the FT protein is transported to the meristematic tissue through the vascular bundle, promoting the differentiation of floral primordia into floral tissue [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Under short-day conditions, the COP1/SPA1 complex is formed to degrade the CO protein, thus, downregulating FT expression and inhibiting \u003cem\u003eArabidopsis\u003c/em\u003e flowering [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. For soybean, flowering genes have been studied extensively, and 10 QTL loci (namely \u003cem\u003eE1\u0026ndash;E9\u003c/em\u003e and \u003cem\u003eEJ\u003c/em\u003e) related to flowering time have been identified [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Among those, \u003cem\u003eE1\u003c/em\u003e-\u003cem\u003eE4\u003c/em\u003e, \u003cem\u003eE7\u003c/em\u003e, and \u003cem\u003eE8\u003c/em\u003e regulate the photoperiod flowering of soybeans, with \u003cem\u003eE1\u003c/em\u003e contributing the most to soybean flowering [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. \u003cem\u003eE5\u003c/em\u003e, which does not exist separately, may have been caused by accidental outcrossing with pollen with the \u003cem\u003eE2\u003c/em\u003e allele [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. \u003cem\u003eE9\u003c/em\u003e is a leaky allele of FT2a, the abundance of which is directly related to changes in soybean flowering time [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In addition to the E genes, the FT gene also plays an important role in the flowering process of soybeans [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In adzuki beans, three metabolic pathways related to flowering have been identified by transcriptome sequencing, including plant hormones, circadian rhythms, and antenna proteins, by comparing different short-day induction periods with their respective controls. Among them, the homologues of 13 verified genes are all related to flowering, indicating that these genes are key candidates for regulating the flowering of adzuki beans [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Other studies screened eight significantly different genes related to flowering by transcriptome analysis after short-day induction in kidney beans. With the function of these differential genes related to the regulation of the biological clock, TOC1 has been identified to play a key role in controlling the photoperiodic flowering response through clock function. Upregulation or downregulation of TOC1 leads to changes in downstream genes that regulate the flowering time of kidney beans [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWith the deepening of transcriptome research on plant flowering, the metabolic pathways and key genes that regulate flowering through the photoperiod have been described in detail in \u003cem\u003eArabidopsis\u003c/em\u003e species, Adzuki bean, and \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e. Additionally, transcriptomics has increasingly been used to regulate flowering and flower development in diverse plants, including lute [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], tobacco [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], lily [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], cucumber [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and hemp [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, understanding of the effect of the photoperiod on plant flowering needs to be broadened through transcriptome analysis. In particular, transcript information and gene expression profiles of adzuki bean under different short-day inductions have not yet been determined. Therefore, applying RNA-seq to identify candidate genes related to flowering would help to elucidate the regulatory mechanism of short-day-induced flowering in adzuki beans. In this study, three short-day induction treatments, SD-5d, SD-10d, and SD-15d, were performed to compare the transcriptome of adzuki bean leaves, explore differentially expressed transcripts, and identify candidate transcripts involved in the regulation of flowering. This is of great significance for revealing the molecular mechanisms underlying the regulation of flowering time in adzuki beans.\u003c/p\u003e"},{"header":"Result","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of growth and flowering\u003c/h2\u003e \u003cp\u003eThe effects of different short-day inducement periods on the growth, rate of apical flower bud differentiation, flowering time, and flowering promoting rate of adzuki beans were very different. The longer the short-day induction period, the greater the inhibitory effect on adzuki bean plants (Additional file 1:Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Leaf area, plant height, and stem diameter decreased with the prolongation of short-day induction, and plant height showed significant differences among the three treatments at the flowering and podding stages. At the seed-filling stage, the plant height of SD-15d significantly decreased by 25.87% and 18.45% compared to that of the SD-5d and SD-10d treatments, respectively. The stem diameter of SD-15d significantly decreased by 10.91% and 13.27% compared to that of SD-5d at the flowering and seed filling stages, respectively, whereas there was no significant difference between the SD-5d and SD-10d treatments. There was a significant difference in the stem diameter among the three treatments during the podding stage. Significant differences in leaf area were observed among the three treatments for all growth periods (Additional file 2:Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) .\u003c/p\u003e \u003cp\u003eThe advanced flowering days and flowering promoting rate showed that the flowering date of plants in SD-15d was 12 and 7 days earlier than that in SD-5d and SD-10d (Additional file 1:Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), and the flowering promotion rates were 22.03% and 11.83%, respectively (Additional file 1:Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD). The advanced flowering days of plants in SD-10d were 6 days compared with SD-5d, and the flowering promoting rate was 10.20%. These results indicated that short-day induction promoted the early flowering of adzuki beans by inhibiting the vegetative growth of plants. Short-day induction had a cumulative effect, showing that the longer the short-day inducement, the earlier the flowering time, and the greater the flowering promotion rate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eFunctional analysis of differentially expressed genes\u003c/h2\u003e \u003cp\u003eBy comparing the data among the three groups, the total number of differentially expressed genes (DEGs) was 5,939, including 3,107 upregulated genes and 2,832 downregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). On comparing SD-10d and SD-5d, 2,044 DEGs were detected, including 961 upregulated and 1,083 downregulated genes. Comparing SD-5d and SD-15d, a total of 3,068 genes were detected, including 1,711 upregulated genes and 1,357 downregulated genes. Comparing SD-10d and SD-15d, a total of 827 genes were detected, including 435 upregulated and 392 downregulated genes (Additional file 3:Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA). In addition, by comparing the three groups, 105 common genes were detected, of which 40 were upregulated and 25 were downregulated (Additional file 4,5,6:Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB,C,D). In addition, it was observed that the number of DEGs between SD-5d and SD-15d was the highest, indicating that the longer the interval between the two short-day inducement treatments, the higher the number of DEGs detected.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCluster analysis showed that the three treatments, SD-5d, SD-10d, and SD-15d, had a significant impact on gene expression (Additional file 7:Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eE). Among these, 40 genes were gradually upregulated with an extension of short-day time, whereas 25 genes were gradually downregulated. Another 40 genes did not show obvious expression rules, of which 25 genes showed up-down-up regulation and 15 genes showed down-up-down regulation in all treatments. The above results showed that 40 upregulated and 25 downregulated genes played key roles in the growth and development of adzuki beans, but the other genes had no obvious rules, indicating that the function of different genes varied in response to different short-day induction times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGene Ontology function enrichment analysis\u003c/h2\u003e \u003cp\u003eGO terms (DEGs\u0026thinsp;\u0026gt;\u0026thinsp;2) were screened separately for biological processes, cell components, and molecular functions. GO function enrichment analysis showed that the light-related function of DEGs was found among all three comparison groups, in which two types of cell components involved in DEGs between SD-5d and SD-10d were related to light function, that is, photosystem I (PSI) and II (PSII), both of which included five upregulated genes. In addition, there was a circadian function related to light in biological processes, which contained 14 genes, of which six were upregulated and eight were downregulated (Additional file 8:Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eA). The DEGs in the two comparison groups of SD-5d vs SD-15d and SD-10d vs SD-15d had light-driven functions as PSI and PSII, but the number of genes involved was different. For SD-5d vs SD-15d, PSI and PSII contained nine and twelve genes, respectively; the former nine genes were upregulated, eleven genes of the latter group were upregulated, and the remaining one gene was downregulated. Both SD-10d and SD-15d contained five upregulated genes (Additional file 9,10:Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eB,C). These results suggested that the three comparison groups all contained PSI and PSII functions related to light (Additional file 11:Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eD), and that photosystem genes in leaf cell components could be activated after different short-day induction times. These genes are key regulators of the growth and development of adzuki bean seedlings and are closely related to photoelectron transport under short-day-induced conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eKyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of DEGs\u003c/h2\u003e \u003cp\u003eKEGG pathway enrichment analysis of DEGs in the three groups was performed to select the top 20 signaling pathways with significant differences in each comparison group. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows that DEGs between SD-5d vs SD-10d and SD10d vs SD-15d were enriched in two light-related pathways, that is, the antenna protein pathway and circadian pathway, respectively, with different numbers of genes involved in these pathways. For the SD-5d vs SD-10d groups, five genes were upregulated in the antenna protein pathway, and of sixteen genes in the circadian pathway, three were upregulated and thirteen were downregulated. For the SD-10d vs SD-15d group, there were seven genes in the circadian pathway, including four upregulated and three downregulated. Four light-related pathways were enriched in the SD-5d vs SD-15d group, including nine, seventeen, forty-five, and fourteen genes, respectively. The expression patterns of genes in different pathways were different, nine genes in the antenna protein pathway were upregulated; of seventeen genes in the circadian pathway, three were upregulated and fourteen were downregulated; forty-five genes in the plant hormone signal transduction pathway consisted of twenty seven upregulated and eighteen downregulated genes; and all fourteen genes in the photosynthesis pathway were upregulated. The above results showed that the three comparison groups all contained two pathways related to light and circadian rhythms, of which SD-5d vs SD-10d and SD-5d vs SD-15d had the most significant enrichment degree in the circadian rhythm pathway. This suggests that different short-day inductions, on the one hand, activate gene expression in the antenna protein pathway and promote photosynthesis, and on the other hand, regulate photosynthesis, stomatal rhythmic opening and closing, leaf rhythmic opening and closing, and other important physiological processes, by regulating the biological clock. This could help plants optimize their energy utilization efficiency to the maximum extent and guarantee the early flowering of adzuki beans. Additionally, the circadian pathway plays a key role in the response to different short-day induction periods (Additional file 12,13,14,15:Figure \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003eA,B,C,D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGene set enrichment analysis in the KEGG pathway\u003c/h2\u003e \u003cp\u003eIt is generally believed that a positive ES value indicates that a certain functional gene set is enriched at the front of the ranked sequence and that the involved pathway is upregulated. A negative ES value indicates that a certain functional gene set is enriched at the rear of the ranked sequence and that the involved pathway is downregulated. The core genes that appeared in the ES map indicate that this functional gene set has biological significance. Here, gene set enrichment analysis revealed that the antenna proteins and circadian pathways in the three comparison groups had the same enrichment scores, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. The antenna protein pathway was upregulated (Additional file 16:Figure \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003eA,B), the circadian pathway was downregulated (Additional file 17,18:Figure \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003eC,D,E,F), and the core genes were identified in both pathways. The core genes of the antenna protein pathway were enriched in the front of the sequencing sequence, whereas those of the circadian pathway were enriched in the rear of the sequencing sequence in the three comparison groups, indicating that these core genes play an important role in the response of adzuki beans to short-day induction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHeatmap cluster analysis was performed on the core genes of antenna proteins and circadian metabolic pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The antenna protein pathways of the three comparison groups, SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d, contained 13, 15, and 17 core genes, respectively, which were upregulated with an increase in the number of short-day induction days (Additional file 22,23,24:Figure \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003eD,E,F). The circadian rhythm pathways in the three comparison groups contained 12, 15, and 14 core genes, which were inversely downregulated as the number of short-day induction days increased (Additional file 19,20,21:Figure \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003eA,B,C). These results indicated that adzuki beans responded to different short-day induction periods by upregulating the key genes in the antenna protein pathway or downregulating the key genes in the circadian pathway, thus, promoting early flowering.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of circadian and antenna protein pathway maps\u003c/h2\u003e \u003cp\u003eThe circadian rhythm is a rhythmic change in plants in response to daylight length. Analysis of the circadian metabolic pathway showed that blue light promoted and far-red light inhibited flowering in adzuki beans. After short-day induction, PHYB, a far-red light receptor, interacted with PIF3, a phytochrome interaction factor, to promote the transcription of NDA and the formation of LHY, a circadian clock regulatory protein. The PRR7 protein of the central oscillator-controlled internal clock inhibited the transcription of PIF3 and formation of LHY. In addition, PRR7, a key gene in the photoperiodic flowering pathway, could inhibit the expression of the LHY protein, thus, inhibit the flowering of adzuki beans. After short-day induction, one pathway of flowering regulation was that a complex formed by morphogenesis regulator COP1 and signal sensing protein SPA1 was inhibited by the cryptochrome CRY-blue light receptor protein, and this complex was downregulated and ubiquitinated to inhibit the transcription of HY5, a negative regulator of photomorphogenesis, thus, indirectly, promoting photomorphogenesis.Another pathway of flowering regulation is that of CRY, a blue light receptor protein, which inhibits complex formation by COP1 and ELF3, thus, inhibits GI by ubiquitylation. As a negative regulator, GI downregulates the function of the complex formed by FKF1 and GI, inhibits CDF1 binding to the promoter of CO by ubiquitylation, thus, initiates the transcriptional activation of CO and upregulation of FT. GI can also directly promote DNA transcription into CO, which can promote FT upregulation, and indirectly promote adzuki bean flowering (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Figure\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB shows that the changes in the expression levels of seven protein genes, PIF3, PRR7, SPA1, HY5, ELF3, GI, and FKF1 were different among SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d three comparison groups. Difference genes showed more significant changes in SD-5d vs SD-15d comparison group, indicating that the longer the short-day induction, the greater differential gene change and most genes were downregulated.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eChloroplasts in green plants are comprised of PSⅠand PSⅡ. PSⅠcontains five light-trapping pigment protein complexes, named Lhca1, Lhca2, Lhca3, Lhca4, and Lhca5, while PSⅡ contains six, named Lhcb1, Lhcb2, Lhcb3, Lhcb4, Lhcb5, and Lhcb6, of which the first three (Lhcb1-3) play major roles. Different short-day inductions could affect the expression of genes encoding antenna proteins, allowing them to adapt to the growth and development of Adzuki beans. Figure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA, B shows that, after a short-day induction period, the genes involved in the Lhca3, Lhcb1, Lhcb2, Lhcb3, Lhcb4, and Lhcb6 proteins were all upregulated, and there was a higher number of upregulated genes in the Lhcb1, Lhcb2, and Lhcb3 proteins than in the other proteins. Figure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB shows that the largest differential genes were changed in the comparison group of SD-5d vs SD-15d, indicating that the light signal reception ability in the plants was enhanced with an increase in the number of short-day induction days; that is, the longer short-day induction period, the stronger reception ability. These results indicated that the adzuki beans responded to short-day induction by upregulating PSⅠ and PSⅡ genes. These genes may play key roles in regulating the growth and development of adzuki bean seedlings under short-day induction conditions, the longer the period of induction, the greater the differential genes change.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of DEGs by qRT-PCR\u003c/h2\u003e \u003cp\u003eTo verify the reliability and accuracy of the transcriptomic data, new samples from the same treatment group were subjected to qRT-PCR analysis. Eight genes with significant variability were screened from the circadian rhythm and antenna protein pathways, all of which were closely related to light and associated with flowering by homologous sequence alignment (Additional file 25:Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). qRT-PCR was performed to verify these eight genes in SD-5d vs SD-10d, SD-5d vs SD-15d and SD-10d vs SD-15dthree comparison groups.\u003c/p\u003e \u003cp\u003eThe results showed that the LOC108331766 gene was significantly different in the SD-5d vs SD-10d and SD-5d vs SD-15d comparison groups, but was not significantly different in the SD-10d vs SD-15d group. The LOC108322606 gene was significantly different in the SD-5d vs SD-10d and SD-10d vs SD-15d groups, but was not significantly different in the SD-5d vs SD-15d groups. In the antenna protein pathway, LOC108345872 and LOC108344684 gene was significantly different among the three groups. Meanwhile, LOC108335068 gene was significantly different in the SD-5d vs SD-15d and SD-10d vs SD-15d groups, but was not significantly different in the SD-5d vs SD-10d comparison group. LOC108328079, LOC108333950, and LOC108338432 gene was significantly different in the SD-5d vs SD-10d, SD-5d vs SD-15d, and SD-10d vs SD-15d groups, respectively, but not in the other groups. These results suggest that the qRT-PCR results for the eight genes were consistent with the transcriptome sequencing results of RNA-seq (Additional file 26:Figure \u003cspan refid=\"MOESM9\" class=\"InternalRef\"\u003eS9\u003c/span\u003eA1B1,A2B2,A3B3,A4B4). Eight genes were significantly different in circadian rhythm and antenna protein pathways, indicating that the transcriptome sequencing data were accurate and reliable.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe life cycle of higher plants includes vegetative and reproductive growth, and flower initiation marks the transition between plant growth stages, which determines whether a plant can successfully reproduce [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. As an important agronomic index, flowering time is a prerequisite for high yield and high harvest index of crops and is greatly affected by the photoperiod [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In this study, a short-day sensitive variety, \u0026lsquo;Tangshan hong xiao dou\u0026rsquo;, was used under SD-5d, SD-10d and SD-15d treatments, and it was found that the longer short-day induction period, the earlier flowering was initiated and the greater inhibitory effect on plants. These results indicated that adzuki bean plants promote flowering by inhibiting plant growth after short-day induction, which is consistent with the results of studies on chrysanthemums and soybeans [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe plant light-dependent signaling response is an extremely complex process involving the regulation of many related genes. To further explore the regulatory mechanism of the short-day induction of adzuki bean flowering and the expression of key genes, a cDNA library of adzuki bean leaves was constructed after different short-day induction periods and transcriptome sequencing was conducted using Illumina sequencing technology. A total of 5,939 differential genes were obtained in three comparison groups, among which the SD-5d vs SD-15d group had the maximum number of differential genes (3,068), which increased with an increasing number of interval days between the two short-day induction groups. GO functional enrichment results showed that PSI and PSII, which have two light-related functions, were both present in the three comparison groups, and the number of DEGs in each comparison group was different. There were nine and twelve genes corresponding to two light-related functions in the SD-5d vs SD-15d comparison group, respectively. All nine genes were upregulated, whereas among the twelve genes, the expression of eleven was upregulated and that of one was downregulated, indicating that the longer interval of short-day induction, the higher number of DEGs identified, and most of these genes were upregulated. PSI and PSII are related to plant light-trapping pigment protein complexes that receive solar energy and assimilate carbon dioxide to form chemical energy [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThere are three main light-trapping pigment protein complexes encoded by Lhcb1, Lhcb2, and Lhcb3 in the peripheral light-trapping antenna of PSII. The main function of this complex is to capture and transfer light energy and balance the excitation energies of PSI and PSII. It also plays an important role in maintaining the membrane structure of thylakoids in response to changes in the external environment and in photoprotection [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. From these results, it can be speculated that the photosynthetic capacity of adzuki bean plants was enhanced by the upregulation of genes in PSI and PSⅡ after short-day stress. In particular, the photocapture capacity of the peripheral photocapture antenna of PSII was enhanced. In addition, the electron transfer rate was accelerated to rapidly respond to changes in the external environment and maintain normal growth and development. The subsequent gene pathway map of antenna protein gene expression also showed that genes in the three comparison groups were upregulated, and the number of DEGs in the SD-5d vs SD-15d comparison group was the highest. Among these, five genes in the Lhcb1 protein were upregulated, suggesting that the Lhcb1 protein plays an important role in light energy absorption after short-day induction in adzuki beans.\u003c/p\u003e \u003cp\u003eThere is a complex interaction between exogenous photoperiodic signals and the flowering biological clocks of plants when sensing changes in the lengths of day and night, which causes a series of activations or inhibitions of flowering genes, ultimately leading to changes in the flowering rhythm [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Different plant flowering rhythm and photoperiodic pathways are conservative in large part [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In this study, KEGG enrichment analysis showed that two light-related antenna proteins and circadian pathways were present in three comparison groups, and the degree of enrichment of the circadian pathways was most significant in the SD-5d vs SD-15d group. Further analysis of gene set enrichment revealed that adzuki beans can respond to short-day induction by upregulating antenna protein pathway and downregulating key genes in the circadian rhythm pathway, thus, promoting early flowering. This is similar to the findings of previous studies on different species of edible fungi and peaches under short-day induction using transcriptome sequencing [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurther analysis of the regulatory network showed that the antenna protein enhanced the absorption of light energy through gene upregulation; in the circadian rhythm pathway, early flowering of plants was promoted through the blue light metabolic pathway, while far-red light inhibited the flowering of adzuki beans. Early studies on Arabidopsis species found that the red light receptor PHYB and the blue light receptor CRY2 have antagonistic effects on the regulation of flowering time [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. CRY1, CRY2, and PHYA stabilize CO, whereas PHYB promotes its degradation [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHow does blue light regulate the CO protein in adzuki beans? One regulatory pathway is the far-red light signaling pathway; in the circadian rhythm system, PHYB binds to PIF3 to promote the transcription of NDA into LHY, and PRR7 inhibits the transcription of PIF3 into LHY protein, thus, inhibiting flowering. Another pathway is the blue light pathway, in which CRY inhibits the formation of the COP1-SPA1 complex, which is downregulated, and inhibits the transcription of HY5 by ubiquitination, thus, indirectly promoting light morphogenesis. In addition, CRY inhibits the formation of the COP1-ELF3 complex and GI by ubiquitination. As a negative regulator, GI downregulates the formation of the FKF1-GI complex, inhibits CDF1 binding to the CO promoter by ubiquitination, transcriptionally activates CO, and upregulates FT to indirectly promote adzuki bean flowering. GI can also directly promote DNA transcription into CO, which, in turn, promotes FT upregulation, thereby indirectly promoting adzuki bean flowering. Based on this analysis, it was found that light regulates CO activity through at least two processes: the biological clock regulates the expression of CO mRNA and the stability of the CO protein is regulated through the signal transduction of different light receptors.\u003c/p\u003e \u003cp\u003eIn \u003cem\u003eA\u003c/em\u003e. \u003cem\u003ethaliana\u003c/em\u003e, CRY2 cannot interact with SPA1 during the dark period, when high CO gene expression occurs under short-day conditions, which leads to the degradation of the CO protein by the COP1\u0026ndash;SPA1 complex and flowering [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Under long-day conditions, GI and FKF1 proteins at high levels form a complex and degrade the CDF1 protein under blue light, which eliminates the inhibitory effect of CDF1 on the CO gene. Subsequently, CO mRNA begins to accumulate, promoting the upregulation of FT genes and flowering [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. It can be seen that the flowering regulation mechanism of adzuki beans is similar to that of \u003cem\u003eA. thaliana\u003c/em\u003e. Substantial progress has been made in the study of cryptochrome genes in soybeans [\u003cspan additionalcitationids=\"CR56\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], \u003cem\u003eArabidopsis\u003c/em\u003e species [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], and rice [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Cryptochrome acts as a photoreceptor in various angiosperms, regulates the biological clock, and plays an important role in the induction of flowering. However, the number of upregulated or downregulated genes in flowering proteins varies between plants. Eight DEGs selected in circadian rhythms and antenna proteins were verified to be consistent with the RNA-seq results, and the functions of these eight genes were related to light and flowering. This study clarified the regulatory mechanism of the short-day induction of adzuki bean flowering, laying a foundation for further exploration of the functions of key genes that regulate adzuki bean flowering.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe transcriptional results showed that the number of DEGs in the SD-5d vs SD-15d comparison group was the highest (3,068 genes). The longer short-day induction time, the greater promotion of flowering. This regulatory mechanism is associated with the downregulation of key genes in the circadian rhythm pathway, thus, regulating the blue light metabolism pathway to promote flowering under short-day induction. In addition, the antenna protein pathway accelerates electron transfer through gene upregulation to promote the flowering of adzuki beans. Eight DEGs screened from these two metabolic pathways were mostly upregulated and were re-verified by RNA-seq as candidate genes for regulating adzuki bean flowering. These results further clarify the metabolic pathway of adzuki bean flowering under short-day induction and provide valuable information for future functional studies of flowering-related genes.\u003c/p\u003e "},{"header":"Methods","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003eExperimental material\u003c/h2\u003e \u003cp\u003eA late maturity variety \u0026lsquo;Tangshan Hongxiaodou\u0026rsquo;sensitive to short-day was selected as the experimental material, provided by the adzuki Bean Breeding Research Group of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. The experiment had been conducted in the Teaching and experimental base of Hebei Agricultural University, Baoding (longitude: 115\u0026deg;47 ', latitude: 38\u0026deg;87 ') in 2021. As a typical short-day crop, adzuki bean is very sensitive to short-day induction, and thus the flowering time and maturity stage are significantly earlier than previously.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSoil Fertility\u003c/h2\u003e \u003cp\u003eThe soil type of this experimental field is loam soil. 400g compound fertilizer (N-P\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e-K\u003csub\u003e2\u003c/sub\u003eO\u0026thinsp;=\u0026thinsp;24:4:8) was applied to each plot (length 5m, width 1m) before sown, and the nutrient content of the experimental plot was measured after ploughing. The fertility of the cultivated soil layer (0-20cm) of the experimental plot was shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e (Additional file 27:Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePlant height, stem diameter and leaf area of adzuki bean under different short-day inducement times.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDetermination index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFlowering\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePodding\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSeed-fling\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003ePlant height/cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-5d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39.51\u0026thinsp;\u0026plusmn;\u0026thinsp;1.01a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-10d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.29b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e41.46\u0026thinsp;\u0026plusmn;\u0026thinsp;1.42a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.96\u0026thinsp;\u0026plusmn;\u0026thinsp;3.57c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.92c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e33.81\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eStem diameter/cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-5d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-10d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eLeaf area/cm\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-5d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.92a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.59a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e36.04\u0026thinsp;\u0026plusmn;\u0026thinsp;1.88a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-10d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25.77\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e31.99\u0026thinsp;\u0026plusmn;\u0026thinsp;1.26b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.77c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e26.78\u0026thinsp;\u0026plusmn;\u0026thinsp;1.01c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eValues are means\u0026thinsp;\u0026plusmn;\u0026thinsp;S.E. The differe\u003cem\u003en\u003c/em\u003et small letters in the same column indicate statistical significance at 0.05 level by DMRT.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of different genes associated with light in circadian rhythm and antenna proteins signaling pathways.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108331766\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLOC108322606\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLOC108345872\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eLOC108328079\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLOC108344684\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eLOC108335068\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLOC108333950\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e \u003cp\u003eLOC108338432\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKEGG map\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCircadian rhythm-plant\u003c/p\u003e \u003cp\u003e(KEGG map)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c10\" namest=\"c4\"\u003e \u003cp\u003ePhotosynthesis-antenna proteins\u003c/p\u003e \u003cp\u003e(KEGG map)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene symbol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF17H15.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF11C10.3\u003c/p\u003e \u003cp\u003e/F11C10.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAB21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF27I1.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCAB1B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCAB3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eLHBC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eLHCB2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRegulation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLocation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChromosome 4 NC_030640.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChromosome Un\u003c/p\u003e \u003cp\u003eNW_016115133.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eChromosome 10 NC_030646.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChromosome 3 NC_030639.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eChromosome 10 NC_030646.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eChromosome 6\u003c/p\u003e \u003cp\u003eNC_030642.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eChromosome 5\u003c/p\u003e \u003cp\u003eNC_030641.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eChromosome 7\u003c/p\u003e \u003cp\u003eNC_030643.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDescription\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProtein early flowering 3-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProtein suppressor of phya-1051-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eChlorophyll a-b binding protein of LHCII type 1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChlorophyll a-b binding protein CP29.3, chloroplastic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eChlorophyll a-b binding protein of LHCII type 1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eChlorophyll a-b binding protein of LHCII type 1-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eChlorophyll a-b binding protein 13, chloroplastic-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eChlorophyll a-b binding protein 215, chloroplastic\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDifferential groups\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSD-5d VS SD-10d;\u003c/p\u003e \u003cp\u003eSD-5d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSD-5d VS SD-10d;SD-10d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSD-5d VS SD-10d;SD-5d VS SD-15d༛SD-10d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSD-5d VS SD-10d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSD-5d VS SD-10d;SD-5d VS SD-15d༛SD-10d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSD-5d VS SD-15d;SD-10d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eSD-5d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eSD-10d VS SD-15d\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eq-value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.83E-03\u003c/p\u003e \u003cp\u003e6.78E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.84E-33\u003c/p\u003e \u003cp\u003e1.44E-51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.64E-08\u003c/p\u003e \u003cp\u003e4.27E-39\u003c/p\u003e \u003cp\u003e1.23E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.03E-07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.62E-14\u003c/p\u003e \u003cp\u003e1.19E-41\u003c/p\u003e \u003cp\u003e3.09E-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.91E-18\u003c/p\u003e \u003cp\u003e1.58E-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003e2.32E-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e6.97E-15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFunctional\u003c/p\u003e \u003cp\u003eannotations of\u003c/p\u003e \u003cp\u003eorthologs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProtein early flowering 3-like\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWD40 repeat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eChlorophyll A-B binding protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChlorophyll A-B binding protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eChlorophyll A-B binding protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eChlorophyll A-B binding protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eChlorophyll A-B binding protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eChlorophyll A-B binding protein\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetermination of soil nutrients content in experiment field\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eExperimental site\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eYear\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c7\" namest=\"c3\"\u003e \u003cp\u003eDetermination index\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOrganic matter(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTotal nitrogen(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAvailable nitrogen(ppm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAvailable phosphorus(ppm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAvailable potassium(ppm)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTeaching and experimental base of Hebei Agricultural University\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0969\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e66.761\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e189.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEnvironmental characteristics in the community after shading\u003c/h2\u003e \u003cp\u003eThe environmental characteristics of the plot after shading treatment are shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e (Additional file 28:Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). Compared with the atmospheric environment, the light intensity in the plot after shading is near zero, and the relative humidity is significantly increased by 21.41%, while the CO2 concentration and temperature are slightly increased, but not reaching a significant level.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChanges in field microclimate with shading treatment\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIllumination intensity\u003c/p\u003e \u003cp\u003e(lux)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCO\u003csub\u003e2\u003c/sub\u003e concentration\u003c/p\u003e \u003cp\u003e(ppm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRelative humidity\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTemperature\u003c/p\u003e \u003cp\u003e(℃)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmbient environment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e58865.41\u0026thinsp;\u0026plusmn;\u0026thinsp;1547.23a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e478.46\u0026thinsp;\u0026plusmn;\u0026thinsp;15.56a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75.35\u0026thinsp;\u0026plusmn;\u0026thinsp;5.83b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.88\u0026thinsp;\u0026plusmn;\u0026thinsp;1.33a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnvironment of Plots\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.67\u0026thinsp;\u0026plusmn;\u0026thinsp;4.21b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e534.54\u0026thinsp;\u0026plusmn;\u0026thinsp;18.76a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e95.88\u0026thinsp;\u0026plusmn;\u0026thinsp;6.43a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e26.87\u0026thinsp;\u0026plusmn;\u0026thinsp;1.47a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eNote: Values are means\u0026thinsp;\u0026plusmn;\u0026thinsp;S.E, The different small letters in the same column indicate statistical significance at 0.05 level by DMRT. The same as below.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eTest Methods\u003c/h2\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003eShort-day treatment\u003c/h2\u003e \u003cp\u003eBefore sowing, the experimental field plot with 5m long and 1m wide was applied 400g compound fertilizer (N-P\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e-K\u003csub\u003e2\u003c/sub\u003eO\u0026thinsp;=\u0026thinsp;24:4:8). Then, ploughing was carried out and sowing was carried out on June 24. All plots were two-rows planting with a row spacing of 15cm\u0026times;40cm. When the true leaf unfolded, short-day treatments was implemented by extending the night length (10h light/14 h dark) automatically, that realized by putting the stainless-steel shelf covered with opaque cloth on the upper side of the plots. The shading treatment is 10h-light and 14h-dark with shading 5d, 10d and 15d respectively. By adopting the randomized-block arrangement, this experiment was initialed shading treatment with opaque cloth begun at 18:00 every day and finished at 8:00 the next morning. After the shading treatment, all plants were grown to maturity under natural light. 0.4% potassium dihydrogen phosphate was sprayed at the initial flowering stage and pod setting stage, respectively, when one-time irrigating and controlling of insects and diseases were performed. There were three shading treatments with three replicates and nine plots. After 5, 10 and 15 days of shading, the middle leaflet samples of top trifoliate leaves were uniformly taken at 9:00 am with 5\u0026ndash;6 plants duplications. All samples were marked as SD-5d-1, SD-5d-2, SD-5d-3; SD-10d-1, SD-10d-2, SD-10d-3; SD-15d-1, SD-15d-2, SD-15d-3, respectively. After sampling, the samples were quick-frozen in liquid nitrogen and placed in a refrigerator at -80 \u0026deg; C, and RNA extraction and sequencing were performed one week later.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of meteorological factors\u003c/h2\u003e \u003cp\u003eThe light intensity was measured by TES1332 illuminometer (provided by College of Plant Protection, Agricultural University of Hebei, TES1332, Taiwan) at 20\u0026ndash;30 cm above the canopy of adzuki bean community. CO\u003csub\u003e2\u003c/sub\u003e concentration was measured by Li-6400 portable photosynthetic meter (LI-COR, Lincoln, NE, USA). Temperature and humidity were measured by HOBO Pro V2 series (U23-002, produced in the United States), which counted and recorded data automatically every hour.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of growth index\u003c/h2\u003e \u003cp\u003eplant height, stem diameter and leaf area were measured with three representative plants selected from each plot at flowering, pod setting and grain filling stages, respectively. Plant height was the distance from the true leaf to the growing point of the plant. The diameter of the plant stem at the true leaf was measured with a vernier caliper, and calculated with the formular: circumference\u0026thinsp;=\u0026thinsp;2*3.14* (diameter/2). Leaf area was measured by YMJ-B leaf area measuring instrument (Hangzhou Huier Instrument Equipment Co, LTD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eInvestigation and statistics of flowering characteristics\u003c/h2\u003e \u003cp\u003eAt the flowering stage, 3 representative plants were selected from each treatment with 3 replicates. The advanced flowering days was recorded and the flowering promotion rate was calculated. The determination formula is as follows:\u003c/p\u003e \u003cp\u003eAdvanced flowering days\u0026thinsp;=\u0026thinsp;days from emergence to flowering of plants in control-days from emergence to flowering of plants in different treatments\u003c/p\u003e \u003cp\u003eFlowering promoting rate (%) = [(days from emergence to flowering in control - days from emergence to flowering in different treatments) \u0026times;100]/days from emergence to flowering in control\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and cDNA library construction\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from samples and DNA was digested by DNase. Eukaryotic mRNA was enriched using oligo (dT) coupled to magnetic beads, and the mRNA was broken down into short fragments by the addition of interrupting reagents. The interrupted mRNA was used as the template to synthesize one-strand cDNA with six-base random primers; and then a two-strand synthesis reaction system was prepared to synthesize two-strand cDNA, which was further purified by the kit and carried out end-to-end repair, A-tail addition and sequencing adapter connection, fragment size selection, and finally PCR amplification and library construction. After qualified by Agilent 2100 Bioanalyzer, the constructed libraries were sequenced using Illumina HiSeqTM2500 or Illumina HiSeq X Ten sequencer to produce 125bp or 150bp double-ended reads.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eScreening of differentially expressed genes\u003c/h2\u003e \u003cp\u003eFPKM[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], bowtie2[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and express software [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] were used to analyze the transcript levels. With a reference genome of \u003cem\u003eVigna angularis\u003c/em\u003e (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/190/045/\u003c/span\u003e\u003cspan address=\"https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/190/045/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], the number of transcript (protein - coding) reads for all samples were obtained by express software. Genes with an average number of reads greater than 2 were screened, and related data was standardized by the estimateSizeFactors function of DESeq[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] R package. The p-value and fold-change values of difference comparison were calculated by nbinomTest function. Differentially expressed genes (DEGs) were screened based on Fold Change\u0026thinsp;\u0026ge;\u0026thinsp;2 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eFunctional annotation analysis of differentially expressed genes (DEGs)\u003c/h2\u003e \u003cp\u003eGene Ontology (GO) annotations and functional classification of differential genes (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and Fold Change\u0026thinsp;\u0026gt;\u0026thinsp;2) were generated using Blast2 GO and WEGO. Furtherly, BLAST was used to align gene sequences to KEGG (Kyoto Encyclopedia of Genes and Genomes) database for gene annotation of biochemical pathway and identification of the regulatory-metabolic network of organisms.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eqRT-PCR validation\u003c/h2\u003e \u003cp\u003eUnder the same treatment, other samples of adzuki bean were used to conduct qRT-PCR on 8 selected DEGs to verify the accuracy of sequencing results. RNA was extracted using an RNA extraction kit followed by reverse transcription to produce cDNA (HiScript II Q RT SuperMix for qPCR). Primer 5.0 was used to design the primers, and the primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e (Additional file 29:Table \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e). The quantitative Kit (QuantiFast\u0026reg; SYBR\u0026reg; Green PCR Kit) was used to prepare the qRT-PCR reaction system and the transcripts were detected on the fluorescence quantitative PCR instrument. The qRT-PCR cycling conditions were as follows: 40 cycles of predenaturation at 95\u0026deg;C for 10 min, denaturation at 95\u0026deg;C for 10s, and annealing extension at 60\u0026deg;C for 30s. Gene expression was calculated using the method of 2-∆∆Ct [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer design for qRT-PCR validation of eight differentially significant genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrder number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward primer sequence (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse primer sequence (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTIN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTAAGGCTAATCGTGAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGTAAATAGGAACCGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108331766\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAAGGGAGGACCAAGAGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGAGTGGCACAACACCTGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108322606\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGCAAACAAGGAAGGGAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGAAACATGGCTGCAAAAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108345872\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGCTCCTTCTTACCTGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTTCACGGTTTCGAGCAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108328079\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGAAACGCAGAACTTGACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTTGAATGGCAAAGATGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108344684\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGCTCCTTCTTACCTGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTTCAAGGTTCCGAGCAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108335068\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGTGACCGACCCAATTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACAATCGCCTGAACAAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108333950\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGTTCTTTGTTCAAGCCATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACCCAAGCATTGTTAGCCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLOC108338432\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGTTGTGCTTATGGGGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGCGACCATTCTTGAGTTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo;contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWeixin Dong Yuechen Zhang designed the experiment in advance, Lei Zhang prepared for the test and treatment of test materials. Peijun Tao designed and performed the experiment. Weixin Dong analyzed the data and wrote the manuscript. Dongxiao Li revised the paper and all authors read and agreed to the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Hebei Province Natural Science Foundation for Youth (C2021204405), the China Agriculture Research System of MOF and MARA-Food Legumes (CARS-08-G-22), and the National Key Research and Development Program of China (2021YFD1901004-2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI-PRJNA817421.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The seeds used in this study were licensed, and the collection of materials in field studies have complied with relevant institutional and national legislation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agree for publication, and test data were detailed and accurate,\u0026nbsp;\u0026lsquo;Tangshanhongxiaodou\u0026rsquo;\u0026nbsp;was used as material for this experimentis. It was a farmer species resources and used widely in scientific research.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1 State Key Laboratory of North China Crop Improvement and Regulation/Key Laboratory of Crop Growth Regulation of Hebei Province/College of Agronomy, Hebei Agricultural University, Baoding, 071001, China, 2 Hebei Open University, Shijiazhuang, 050080, China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are heartfelt thanks to Professor Kai Xiao, Yanhong Tang and Huixing Kang. Adzuki Bean Breeding Research Group of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTian J, Cheng XZ. Plant production technology. Beijing, China: Beijing Education Press; 2015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSacks FM. A literature review of phascolus angularis-the adzuki bean. Phys Rev A. 1971;3(31):9\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong WX, Yin BZ, Wei Y, et al. Effects of short-day photoperiod inducement after early flowering on morphological, physiological and yield in adzuki bean. J Sichuan Agricultural Univ. 2018;36(1):38\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong WX, Yin BZ, Ren S, et al. Effects of short-day photoperiod treatment after early flowering on yield and grain quality of adzuki bean. J Nanjing Agricultural Univ. 2017;40(3):386\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing XL, Wang X, Li Q, et al. Metabolomics studies on cytoplasmic male sterility during flower bud development in soybean. Int J Mol Sci. 2019;20:2869.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu M, Zhang MT, Dong WX, et al. Effect of photoperiod treatment on the several physiological and biochemical index of flower organ and yield of adzuki bean. J Anhui Agricultural Univ. 2016;43(4):604\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKishor U, Antara D, Harsha S, et al. Identifcation and characterization of PEBP family genes reveal CcFT8 a probable candidate for photoperiod insensitivity in C. cajan. Biotech. 2020;10:194.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao W, Gu R, Che G, et al. \u003cem\u003eCsTFL1b\u003c/em\u003e may regulate the flflowering time and inflflorescence architecture in cucumber (\u003cem\u003eCucumis sativus\u003c/em\u003e L.). Biochem. Biophys Res Commun. 2018;499:307\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYano M, Kojima S, Takahashi Y, et al. Genetic control of flowering in rice, a short-day plant. Plant Physiol. 2001;127:1425\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang JZ, Ai XY, Sun LM, et al. Transcriptome profile analysis of flowering molecular processes of early flowering trifoliate orange mutant and the wild type [\u003cem\u003ePoncirus trifoliata\u003c/em\u003e (L.) Raf.] by massively parallel signature sequencing. BMC Genom. 2011;12:63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIzawa T. Daylength measurements by rice plants in photoperi_odic short-day fowering. In: Int Rev Cytol. 2007; pp 191\u0026ndash;222.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng X, Li G, Tang Y, et al. Dissection of genetic regulation of compound inforescence development in medicago truncatula. Development. 2018;145:158766.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaoka K, Ohki I, Tsuji H, et al. 14-3-3 proteins act as intracellular receptors for rice Hd3a forigen. Nature. 2011;476:332\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaubinger S, Marchal V, Gourrierec J, et al. Arabidopsis SPAproteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability. Development. 2006;133(16):3213\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaijo Y, Sullivan JA, Wang H, et al. The COP1-SPA1 interaction defines a critical step in phytochrome A-mediated regulation of HY5 activity. Genes and Development. 2003;17(21):2642\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCober ER, Molnar SJ, Charette M, et al. A new locus for early maturity soybean. Crop Sci. 2010;50(2):524\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCober ER, Voldeng HD. A new soybean maturity and photoperiod sensitivity locus linked to and photoperiod-sensitivity locus linked to E1 and T. Crop Sci. 2001;41(3):698\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsubokura Y, Watanabe S, Xia ZJ, et al. Natural variation in the genes responsible for maturity loci E1, E2, E3 and E4 in soybean. Ann Botany. 2014;113(3):429\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDissanayaka A, Rodriguez TO, Di S, et al. Quantitative trait locus mapping of soybean maturity gene E5. Breed Sci. 2016;66(3):407\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao C, Takeshima R, Zhu JH, et al. A recessive allele for delayed flowering at the soybean maturity locus \u003cem\u003eE9\u003c/em\u003e is a leaky allele of \u003cem\u003eFT2a\u003c/em\u003e, a FLOWERING LOCUS T ortholog. BMC Plant Biol. 2016;16:20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanfield MJ, Barker JJ, Perry AC, et al. Function from structure? The crystal structure of human phosphatidylethanolamine-binding protein suggests a role in membrane signal transduction. Structure. 1998;6(10):1245\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong WX, Li DX, Zhang L, et al. Transcriptome analysis of short-day photoperiod inducement in adzuki bean (Vigna angularis L.) based on RNA-Seq. BMC Plant Biol. 2022;13:893245.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang XU, Liu DJ, Yan ZS, et al. Regulation of fowering under short photoperiods based on transcriptomic and metabolomic analysis in \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L. Mol Genet Genomics. 2021;296:379\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAn HS, Jiang S, Zhang JY. Comparative transcriptomic analysis of differentially expressed transcripts associated with flowering time of loquat (Eriobotya japonica Lindl). Horticulturae. 2021;7(171):1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuan XX, Sui CL, Chen Y, et al. Transcriptome analysis of response of tobacco seedlings to low light stress. Genomics and Applied Biology. 2021;40(1):315\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao YQ, Zhang Q, Li JW, et al. High temperature in the root zone repressed flowering in Lilium \u0026times; formolongi by disturbing the photoperiodic pathway and reconfiguring hormones and primary metabolism. Environ Exp Bot. 2021;192:104644.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai Y, Bartholomew ES, Dong M, et al. The HD-ZIP IV transcription factor CsGL2-LIKE regulates male flowering time and fertility in cucumber. J Exp Bot. 2020;8:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi ZQ, Tang MQ, Luo DJ, Kashif MH, Cao S, Zhang WX, et al. Integrated methylome and transcriptome analyses reveal the molecular mechanism by which DNA methylation regulates kenaf flowering. Front Plant Sci. 2021;12:709030.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts A, Trapnell C, Donaghey J, et al. Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol. 2011;12(3):R22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts A, Pachter L. Streaming fragment assignment for real-time analysis of sequencing experiments. Nat Methods. 2013;10:71\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnders S, Huber W. Diferential expression of RNA-Seq data at the gene level-the DESeq package. Eur Mol Biol Lab. 2012; 23\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKenneth J, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026ndash;11CT method. Methods. 2001;25:402\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang YJ, Satyawan D, Shim S, et al. Draft genome sequence of adzuki bean, Vigna angularis. Sci Rep. 2015;5:8069.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBl\u0026uuml;mel M, Dally N, Jung C. Flowering time regulation in crops what did we learn from Arabidopsis? Curr Opin Biotechnol. 2015;32:121\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWahl V, Ponnu J, Schlereth A, et al. Regulation of flowering by trehalose-6-phosphate signaling in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Science. 2013;339(6120):704\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtsuko K, Ren\u0026eacute; R. Genetic and molecular basis of floral induction in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. J Exp Bot. 2020;71(9):2490\u0026ndash;504.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu SY, Yang ZQ. Regulation of photoperiod on the growth and flowering of cut chrysanthemum. Chin J Agrometeorology. 2021;42(7):596\u0026ndash;605.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang YH, Lei Y, Bai ZY, et al. Effect of different pre-flowering photoperiod on main agronomic traits of soybean. Southwest China Journal of Agricultural Sciences. 2021;34(2):250\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Bianchi S, Betterle N, Kouril R, et al. Arabidopsis mutants deleted in the light-harvesting protein Lhcb4 have a disrupted photosystem \u0026acirc;\u0026#133;\u0026iexcl; macrostructure and are defective in photoprotection. Plant Cell. 2011;23(7):2659\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarin A, Passarini F, Stokkum IHM, et al. Minor complexes at work: light-harvesting by carotenoids in the ph.otosystem \u0026acirc;\u0026#133;\u0026iexcl; antenna complexes CP24 and CP26. Biophys J. 2011;100(11):2829\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia YS, Ning ZS, Bai CH, et al. Allelic variations of a light harvesting chlorophyll A/B binding protein gene (Lhcb1) associated with agronomic traits in barley. PLoS ONE. 2012;7(5):e37573.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu YH, Liu YR, Yan L, et al. Light-harvesting chlorophyll a/b-binding proteins are required for stomatal response to abscisic acid in Arabidopsis. J Exp Bot. 2012;63(3):1095\u0026ndash;106.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong YH, Ito S, Imaizumi T. Similarities in the circadian clock and photoperiodism in plants. Curr Opin Plant Biol. 2010;13(5):594\u0026ndash;603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Lu Y, Gu AX et al. Expression analysis of key clock genes of \u003cem\u003elcc\u003c/em\u003e-\u003cem\u003e1\u003c/em\u003e mutant from chinese cabbage under different photoperiods. J Hebei Agricultural Univ 42(4):21\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao DL, Zhang D, Ma L, et al. Preliminary study on differentially expressed genes of sparassis latifolia under light inducing. Edible Fungi of China. 2017;36(5):60\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe P, Li LG, Wang HB, et al. Effects of shading fruit with opaque paper bag on transcriptome in peach. Scientia Agricultura Sinica. 2017;50(6):1088\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerdan PD, Chory J. Regulation of flowering time by light quality. Nature. 2003;423:881\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlackman BK, Rasmussen DA, Strasburg JL, et al. Contributions of flowering time genes to sunflower domestication and improvement. Genetics. 2010;187(1):271\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshikawa M, Kiba T, Chua NH. The Arabidopsis SPA1 gene is required for circadian clock function and photoperiodic flowering. Plant J. 2006;46(5):736\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu B, Zuo Z, Liu H, et al. Arabidopsis cryptochrome 1 interacts with SPA1 to suppress COP1 activity in response to blue light. Gene and Development. 2011;25(10):1029\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo Z, Liu H, Liu B, et al. Blue light-dependent interaction of CRY2 with SPA1regulates COP1 activity and floral initiation in Arabidopsis. Curr Biology:CB. 2011;21(10):841\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJang S, Marchal V, Panigrahi KC, et al. Arabidopsis COP1 shapes the temporal pattern of CO accumulation conferring a photoperiodic flowering response. The EMBO Jjournal. 2008;27(8):1277\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLazaro A, Valverde F, Pineiro M, et al. The Arabidopsis E3ubiquitin ligase HOS1negativelys CONSTANS abundance in the photoperiodic control of flowering. Plant Cell. 2012;24(3):982\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia ZJ, Zhai H, Zhang YF, et al. QNE1 is a key flowering regulator determining the length of the vegetative period in soybean cultivars. Sci China Life Sci. 2022;65(12):2472\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu TM, Li X, Wang Q, et al. Analysis on cloning and expression of promoter of flowering Time Gm FT2a in soybean. J Northeast Agricultural Univ. 2022;29(1):1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin XY, Liu BH, James LW, et al. Molecular mechanisms for the photoperiodic regulation of flowering in soybean. J Integr Plant Biol. 2021;63(6):981\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen YL, Zhang LP, Zhang HY, et al. ERF1 delays flowering through direct inhibition of FLOWERING LOCUS T expression in Arabidopsis. J Integr Plant Biol. 2021;63(10):1712\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan JD, Li XM, Zeng BJ, et al. FKF1 F-box protein promotes flowering in part by negatively regulating DELLA protein stability under long-day photoperiod in Arabidopsis. J Integr Plant Biol. 2020;62(11):1717\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Meng QL, Geng MF, et al. Divergence in flowering time is a major component contributing to reproductive isolation between two wild rice species(Oryza rufipogon and O. nivara). Sci China (Life Sciences). 2020;63(11):1714\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Adzuki bean, Short-day induction, Transcriptome, Gene expression, Metabolic characteristics, qRT-PCR","lastPublishedDoi":"10.21203/rs.3.rs-3362672/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3362672/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAdzuki bean is an important miscellaneous grain crop and a kind of typical short-day crop that is used in a variety of foods because of its high nutritional and medicinal value. The flowering time of adzuki beans is affected by multiple environmental factors, particularly the photoperiod. Adzuki bean can meet at flowering period, accelerate breeding process and avoid natural disasters by adjusting the day-length.Therefore, RNA-seq analysis was used to determine the effects of different day-length on the expression and metabolic characteristics of genes related to flowering time in adzuki beans.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, \u0026lsquo;Tangshan Hongxiaodu\u0026rsquo; was used as experimental material. Transcriptome sequencing was performed under SD-5d, SD-10d and SD-15d treatments, respectively. The results showed that a total of 5,939 differentially expressed genes (DEGs) were identified by sequencing, Among these common genes, 38.09% were upregulated and 23.81% were downregulated in three groups. Gene Ontology (GO) enrichment analysis was performed on the target genes to identify common functions related to photosystem I and II. Kyoto Encyclopedia of Genes and Genomes (KEGG) enriched analysis was performed t o predict two pathways involved in antenna proteinand circadian rhythm. And that the flowering of adzuki beans was promoted by downregulating genes in the circadian rhythm pathway through the blue light metabolic pathway, whereas the antenna protein promoted flowering by enhancing the reception of light signals and accelerating electron transport. In these two metabolic pathways, the number of DEGs was the greatest changes in SD-5d vs SD-15d comparison group. Real-time qRT-PCR validation of eight DEGs in these two metabolic pathways was consistent with the transcriptome results, indicating that the sequencing results were accurate and reliable and that these genes may be candidate genes affecting the regulation of short-day induction at the adzuki bean seedling stage.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe results indicated that short-day induction can downregulate the expression of genes related to adzuki bean flowering in the circadian rhythm and upregulate the expression of some genes in the antenna protein pathway. In addition, the results not only provide a theoretical reference for the molecular mechanism of adzuki bean flowering induced by short days, but also provide multi-level information on the next steps in exploring the functional verification of key genes regulating adzuki bean flowering.\u003c/p\u003e","manuscriptTitle":"Analysis of flowering-associated gene expressions and metabolic characteristics in adzuki bean (Vigna angularis L.) with different short-day induction","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-09-25 23:17:05","doi":"10.21203/rs.3.rs-3362672/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"511e577e-7af6-480e-87a3-aee70ece3bb0","owner":[],"postedDate":"September 25th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-09-25T23:25:08+00:00","versionOfRecord":[],"versionCreatedAt":"2023-09-25 23:17:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3362672","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3362672","identity":"rs-3362672","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.