Honokiol, a SIRT3 activator, activates hippocampus mitochondrial MnSOD by deacetylating the enzyme and upregulating FoxO3a-PGC1α axis in a rat model of ammonia neurotoxicity

Honokiol, a SIRT3 activator, activates hippocampus mitochondrial MnSOD by deacetylating the enzyme and upregulating FoxO3a-PGC1α axis in a rat model of ammonia neurotoxicity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Honokiol, a SIRT3 activator, activates hippocampus mitochondrial MnSOD by deacetylating the enzyme and upregulating FoxO3a-PGC1α axis in a rat model of ammonia neurotoxicity Anamika Anamika, Surendra Kumar Kumar Trigun This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1518187/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract We have recently reported that honokiol (HKL), by activating mitochondrial SIRT3, restored ROS led deranged mitochondrial integrity associated with the pathogenesis of ammonia neurotoxicity induced moderate grade hepatic encephalopathy (MoHE). To delineate mechanism by which HKL does so, the present study describes activity vs acetylation level of the mitochondrial MnSOD and its expression vs levels of its main transcription regulators; FOXO3a, PGC1α, in the hippocampus of the MoHE rat model of ammonia neurotoxicity, developed by administration of 100 mg/kg bw of thioacetamide i.p. for 10 days, and in the MoHE rats treated with HKL (10 mg/Kg b.w.) for 7 days. As compared to the control, the hippocampus mitochondria from MoHE rats showed a significantly declined activity of MnSOD coinciding with the increased level of its acetylated form which however, could be restored back due the HKL treatment. Also, a significantly reduced expression of MnSOD in the hippocampus of those MoHE rats coincided with a similar decline in transcript level of FOXO3a and PGC1α. This was consistent with the reduced immunoreactivity of FOXO3a and PGC1α in the hippocampus DG, CA1 and CA3 regions of the MoHE rats. However, all these factors were observed to be restored back to their normal levels in the hippocampus of the MoHE rats treated with HKL. As HKL activates mitochondrial SIRT3, these findings suggest involvement of Sirt3 activation led deacetylation of MnSOD and upregulation of its transcription activators; FOXO3a and PGC1α in activating mitochondrial MnSOD in the hippocampus of the MoHE rat model of ammonia neurotoxicity. Ammonia neurotoxicity Hepatic encephalopathy hippocampus Mn-SOD mitochondrial SIRT3 FOXO3a/PGC1α Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The persistent ammonia neurotoxicity, developed in the patients with chronic liver failure (CLF), results into development of a neuroexcitotoxic brain disorder, known as hepatic encephalopathy (HE), which is characterized mainly by the progressive loss of cognitive and motor functions [ 1 ]. The neurochemistry of HE is argued to implicate mainly glutamate-NMDAR over activation led deranged mitochondrial biochemistry at brain cells level [ 2 , 3 ]. Wherein, mitochondrial ROS load is considered one of the main precipitating events in deranging neuronal functions in most of the brain regions including cortical subregions, brain stem and cerebellum as the most affected ones in case of the HE [ 4 , 5 ]. Thus, preventing/neutralizing mitochondrial ROS load in the cells of the susceptible brain regions could be a relevant approach to manage HE. Mitochondria is the main oxygen consuming organelle and thus faces greater challenge of neutralizing metabolic O 2 − radical. Obviously, the mitochondrial reactive oxygen species (ROS) load is considered more critical in pathogenic mechanisms during brain disorders [ 6 ]. The mitochondrial isoform of Mn-superoxide dismutase (Mn-SOD) is known to catalyze the committed step of neutralizing O 2 − radical. The literature available advocate the implication of this antioxidant enzyme in the pathogenesis of several diseases including the neurodegenerative brain disorders like; AD, PD, ALS etc. as most of them have been reported to implicate deranged mitochondrial functions [ 7 , 8 ]. Obviously, Mn-SOD could be argued as a choice of therapeutic target in various pathologies, however, there was very little success. Alternatively, targeting certain up-stream regulatory steps involved in tackling ROS challenges is now emerging as a relevant approach so far preventing mitochondrial derangement during neurological disorders is concerned [ 9 ]. This necessitates understanding the regulation of Mn-SOD in the mitochondria of the susceptible brain regions in a relevant brain disorder model. In this respect, the development of the chronic type HE via hepatotoxin induced CLF in rats, one of the prevalent syndrome in the patients with liver cirrhosis, is neurochemically and neurobehaviorally argued as the most relevant model of neurexcitotoxicity that can be used to explore pathogenesis vs therapeutic management of HE [ 10 , 11 , 12 ]. So far regulation of Mn-SOD is concerned, in addition to modulating its expression, the alterations in Mn-SOD activity by modulating protein level acetylation of this mitochondrial isoform is emerging as an evolving concept in understanding ROS induced pathogenesis of the neurodegenerative brain disorders [ 13 ]. In this respect, Sirtuin3 (SIRT3), a mitochondrial isoform of SIRTUINs family deacetylase, is now emerging as a master regulator of the mitochondrial functions [ 13 , 14 ] mainly by deacetylating a number of mitochondrial proteins amongst which Mn-SOD is argued to be the most important one [ 14 ]. The enhanced Mn-SOD activity due to its deacetylation by SIRT3 is also on record [ 15 ]. The information during recent past advocate that SIRT3 is likely to modulate Mn-SOD activity in multimodal ways. For example, SIRT3 induces transcription of Mn-SOD by increasing the level of its main transcriptional regulator Fox03a [ 16 , 17 ]. Fox03a has been reported to protect quiescent cells from oxidative stress by increasing the expression of MnSOD [ 18 ]. In response to elevated ROS, Fox03a has been demonstrated to translocate to the nucleus thereby activates transcription of MnSOD and Catalase [ 19 ]. And SIRT3 has been found to enhance FoxO3a translocation to the nucleus and augments FoxO3a-dependent antioxidant defense mechanisms through upregulating the levels of peroxisome proliferator-activated receptor-gamma coactivator 1-alpha (PGC-1α) and SOD2 [ 20 ]. Though information is limited, it is now evident that enhanced SIRT3 activity associates with protection of neurons in culture exposed to excitotoxic and metabolic stress mainly by interacting with the mitochondrial MnSOD [ 21 ]. It has been demonstrated that Honokiol, a SIRT3 activator, is shown to improve spatial memory functions during amyloid-β (Aβ)-induced cognitive impairment in a transgenic mouse model, wherein, it involves the enhancement of PPARγ and decline of proinflammatory cytokines [ 22 ]. These reports strongly suggest about a potent neuroprotective role of Sirt3 possibly by deacetylating Mn-SOD and/or by modulating transcriptional regulators of this antioxidant enzyme. Indeed, in the models of non-neuronal cells with a condition of nutritional manipulation, the SIRT3 deleted mice showed ~ 85% increase in the level of acetylated Mn-SOD [ 23 ]. Also, SIRT3 activation in response to the increased oxidative stress could enhance the status of deacetylated Lys 122 of MnSOD leading to the enhanced Mn-SOD activity [ 24 ]. However, the study about SIRT3 activity vs Mn-SOD acetylation/deacetylation status in the brain cells and in particular, in the animal models of a neurological disorder remains largely unexplored. In order to map out the mechanism by which SIRT3 activation could exert its neuroprotective effects at mitochondria level in the animal models of neurological disorders, the use of honokiol, a SIRT3 specific activator is advocated as the most suitable one [ 25 , 26 ]. Honokiol is a bioactive, phenolic compound, obtained from lignin of the bark of magnolia trees, which is described to maintain mitochondrial integrity via SIRT3 activation [ 25 ]. So far, its neuroprotective effects are concerned, information is limited, however, it was found to prevent age-related learning and memory impairment and neuronal deficits in senescence-accelerated mice [ 27 ]. Moreover, this plant derived compound is known to cross blood brain barrier and even found to cross through the mitochondrial inner membrane as well [ 28 ]. Indeed, we have recently demonstrated a correlation between the declined SIRT3 level and compromised mitochondrial function led enhanced ROS challenge in the hippocampus mitochondria of the MoHE rats [ 29 ]. Also, we found that SIRT3 activation by honokiol during MoHE, resulted in recovery of pathology associated mitochondrial ROS accumulation and deranged mitochondrial function. Therefore, in order to delineate Mn-SOD centric mechanistic aspects of HKL mediated neutralization of mitochondrial ROS load in the hippocampus of the MoHE rats, the present study investigated activity of the mitochondrial Mn-SOD vs its acetylation/deacetylation status and expression of Mn-SOD vs profiles of its transcriptional regulators (FOXO3a & PGC1α) in the hippocampus [undergoes MoHE associated neuronal atrophy; 12] of control, MoHE and the MoHE rats treated with HKL. Material And Methods Animals and Chemicals The study involved adult male Charles foster for experimental studies. The rats were maintained at recommended conditions of 12h:12h light/dark cycle and were fed with the advised diet and water ad libitum at a room temperature of 25 ± 2∘C under standard hygienic conditions. Rats weighing 150–180g were grouped as per experimental plan and were kept in separate cages. All the procedures on rats were performed as approved by the institutional animal ethical committee for the care and use of laboratory animals (F.Sc/IAEC/2016-17/233). All chemicals used were of analytical grade obtained from E-Merck and Sisco research Laboratory, Mumbai (India). Development of model The chronic liver failure rat model of MoHE was developed by the administration of hepatotoxin, thioacetamide (TAA) and characterized as MoHE rats on the basis of neurobehavioural parameters as reported earlier from our lab [ 10 , 30 ]. MoHE rats were further divided into two groups (six animals each) and rats from one of the groups were administered with HKL (10 mg/kg b.w dissolved in 1:1 DMSO: PBS) i.p. once daily, as described by Anamika & Trigun, [ 29 ], referred as MoHE + HKL group. After 24 h of the last dose given, rats were sacrificed under euthanasia. The hippocampus was dissected out and processed for biochemical and molecular studies. Preparation of mitochondrial extract As reported earlier [ 29 ], the mitochondrial fraction was prepared in ice cold MSH homogenization buffer (225 mM Mannitol, 75mM Sucrose, 1mM EGTA, 10mM HEPES (pH 7.2) and 1% bovine serum albumin. Briefly, the tissue was homogenized in MSH buffer in ice and cellular debris was removed by centrifugation at 1200 x g for 5min. The supernatant so obtained was again centrifuged at 10,000 x g for 10min to isolate a crude mitochondrial pellet. The pellet was further washed twice with MSH buffer without EGTA and the pellet thus obtained was re-suspended in the MSH buffer without EGTA stored in a number of aliquots at -80ºC. The mitochondrial extract was prepared by 3–4 freeze-thaw cycles. Protein content in the extract was estimated by Lowry et al., [ 31 ] method. Activity assay MnSOD SOD activity was assayed using the method described by Beauchamp & Fridovich [ 32 ]. The reduced riboflavin generates O 2 radical upon oxidation in air, which in turn reduces NBT forming a blue colored formazon. Briefly, the reaction was setup by mixing 0.1M phosphate buffer (pH7.8), 12mM L methionine, 70µM NBT, 0.2mM riboflavin and 3µM EDTA. The reaction was initiated with the addition of the mitochondrial extract undergone at least three cycles of freeze-thaw releasing its matrix content. One set of tubes were illuminated under light for 30 min and parallelly another set was kept in dark. A similar reaction mixture without tissue extract was run simultaneously and was used as control. O.D. was recorded at 560 nm. The difference between light and dark sets was used to calculate unit of SOD, which was defined as the amount of enzyme that produced 50% inhibition of NBT reduction/min and activity was calculated as: SOD (U) = ([(C-E)/(C/2) X (total volume of assay mixture/ amount of enzyme extract)] Where, C = difference in absorbance of the control tubes kept for incubation in light and dark E = difference in absorbance of the enzyme tubes kept for incubation in light and dark Analysis of SOD activity by non-denaturing PAGE Non-denaturing polyacrylamide gel electrophoresis was performed as described previously [ 33 ]. 60 µg protein of hippocampal mitochondrial extracts of control and experimental rats were loaded on non-denaturing polyacrylamide gel and electrophoresis was carried out at 4ºC at constant voltage (100V) for 2h. The in-gel activity assay was performed by incubating the gel in 20 mL activity staining mixture containing 0.25mM NBT, 28µM Riboflavin and 28mM TEMED at 37ºC for 15–20 min. Biochemically, NBT and SOD in the gel compete for O 2 radical such that the SOD activity zone appeared transparent, while rest of the region became purple blue due to reduced NBT. After development of activity bands, the gels were photographed and intensity of bands was quantified by gel densitometry using Alpha imager 2200 gel documentation software. Western Blotting The western blot analysis of Mn-SOD was performed following the previously described method from our lab [ 29 ]. Briefly, mitochondrial extract equivalent 80µg protein was loaded onto 12% denaturing polyacrylamide gel and electrophoresis was carried at constant voltage of 100V followed by electrotransfer of proteins on nitrocellulose membrane at 35mA for 10-12hrs at 4°C. Efficiency of Protein transfer was assessed by Ponceau S staining and then the nonspecific binding of antibody to protein was avoided by blocking of the membrane using 5% nonfat milk dissolved in 1X PBS for 90min. The membrane was then incubated with primary antibody; anti MnSOD (1:1000), anti Ac-MnSOD (1:500) dilution prepared in blocking solution and was kept at 4ºC overnight. HRP-conjugated secondary antibody was used for final immunodetection using ECL western blotting detection kit. For loading control anti hsp60 (1:1000) was used. Using normalized densitometric values of MnSOD and Ac-MnSOD vs hsp60, was recorded using gel densitometry software Alpha Imager 2200. Real time RT-PCR Quantification of gene expression was carried out by real time PCR. Total RNA of hippocampal tissue was extracted using TRI reagent (Sigma Aldrich) following the manufacturer’s protocol. Briefly, the homogenate prepared in TRI reagent was subjected to centrifugation at 12,000g at 4°C for 10 min and in the supernatant collected chloroform was added and vortexed. After 2 min, the tube was again centrifuged at 12,000g for 10 min, at 4°C. The colorless upper aqueous phase containing RNA isolate was collected and 0.5ml isopropanol was added to it. After 5 min, the tube was again centrifuged at 12,000g at 4°C for 10 min. The RNA precipitated as pellet at bottom of the tube was washed in 75% ethanol and air dried. RNA pellet was dissolved in 60 µL DEPC treated water and subjected to DNase treatment (DNA free-Ambion) to remove any sort of DNA contamination. The RNA samples with value of A260/A280 ratio between 1.8-2.0 were used in the cDNA synthesis reaction. cDNA synthesis was done using Revert Aid first strand cDNA synthesis kit. The reaction mixture consisting 4µg RNA, 1 µL random hexamer primer, made up to12 µL with DEPC treated water was centrifuged briefly and the following components were added; 4µL of 5X reaction buffer, 1µL of RiboLock™ Ribonuclease Inhibitor (20U/µL), 2 µL of 10 mM dNTP mix, 1µL of reverse transcriptase to make a final volume of 20 µL. The components were incubated for 5 min at 25°C followed by cDNA strand synthesis for 60 min at 42°C. The reaction was terminated by heating at 72°C for 5 min. The cDNA was stored at -80°C. Rat gene-specific primers used were: foxO3a (Forward primer 5’-CTCCGCTCGAAGTGGAGCTGGAC-3’, Reverse primer 5’-TACAGGAGACGTGGCCGACTCTG-3’) ppargc1α (Forward primer 5’AGTCCCATACACAACCGCAG 3’, Reverse primer 5’-CCCTTGGGGTCATTTGGTGA-3’); mnsod (Forward primer 5’-CGGGGGCCATATCAATCACA-3’, Reverse primer 5’-GCCTCCAGCAACTCTCCTTT-3’) GAPDH was used for normalization as a reference gene. The real time qPCR was performed using ABI Prism 7500 Sequence Detection System (PE Applied Biosystems, CA, USA). The PCR reaction mixture of (20 µL) consisted of 1µL of sample cDNA (diluted 1:10), 1µL of 10 pmol of forward and reverse primers and 10 µL of 2X Thermo Scientific SYBR Green/ROX qPCR Master Mix and brought to final volume with RNase free water. PCR condition was: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec, and 60°C for 20 sec. Real-time PCR data was analyzed using the ΔΔCT method, normalizing the Ct values of the indicated gene to the Ct values of GAPDH relative to a control sample. Immunofluroscence Briefly, at the end of the experimental dosage, the animals were sacrificed under ether anesthesia by trans-cardiac perfusion with 4% paraformaldehyde prepared in 0.1M phosphate buffer (pH 7.4) and the brains were dissected out, immersed in the same fixative for overnight at 4ºC (post fixation); thereafter the tissue was processed with graded sucrose solutions (15%, 30%, 30%; prepared in Tris buffered saline) keeping it at 4°C. The tissue blocks were prepared by embedding the brain in O.C.T. compound submerged in isopentane at a sub-zero temperature. The blocks were stored at -20º/-80º C for long term use. The hippocampus sections of 25µm thickness were cut for the immunostaining and the section area was marked using PAP pen which provides a thin-film like hydrophobic barrier around the section. The sections were washed thrice with PBS followed by incubation in permeabilization buffer containing 0.2% Triton X-100 for 10 min. The sections were then blocked using 1% BSA, prepared in PBST and left for 1h at room temperature in humified chamber. The slides were then incubated with the Primary Antibody (FoxO3a; 1:200 dilution; PGC1α, 1;100 dilution) in 1% BSA solution prepared in PBST and was kept at 4°C overnight in the humid chamber. The slides, after primary incubation, were washed with PBS and thereafter sections were incubated with alexa fluor tagged secondary antibody suitably diluted in 1% BSA/PBST solution for 1h at room temperature in humid chamber. The sections were counter stained with DAPI (1µg/ml) for 15min at room temperature. Excess of DAPI was removed by PBS washing. Finally, the sections were mounted in DABCO and were observed and photographed under the light microscope (Olympus BX63). The image analysis was done with ImageJ software on a sample of 6 randomly selected images of hippocampus areas from 6 rat brains. Statistical analysis The data have been presented as mean ± SD and were analyzed using one-way Anova and Tukey's as post hoc test analysis to find out the level of significance between Control Vs MoHE & MoHE Vs MoHE + HKL. The probability of p < 0.05 was taken as significant difference between the two groups, where n = 6. Results HKL dependent modulation of MnSOD: activity and acetylation status Our previous report demonstrates that HKL could normalize the MoHE pathogenesis associated enhanced ROS level in the hippocampus mitochondria mainly by activating mitochondrial SIRT3 [ 29 ]. To delineate whether HKL does so by modulating Mn-SOD, the mitochondrial isoform committed to neutralize O 2 − radical, the activity and acetylation status of this enzyme was studied in the hippocampus mitochondrial fraction from the control, the MoHE and the MoHE rats treated with HKL. The findings of Fig. 1 a & b indicate that there is a significant decline in the activity (p < 0.05) as well as in the active level (measured through native PAGE; p < 0.01) of MnSOD in the hippocampus mitochondria of MoHE rats in comparison to the control counterparts. However, treatment of MoHE rats with honokiol, could recover the activity of MnSOD (P < 0.001), analyzed on both the parameters. Further, to ascertain the role of HKL dependent SIRT3 activation, the level of acetylated Mn-SOD was studied in all the three sets. It is evident that there was a significant increase in the level of acetylated MnSOD (p < 0.01) in the hippocampus mitochondria from the MoHE rats as compared to the control rats, whereas the level of acetylated MnSOD was observed to be significantly lowered ( p < 0.001) in case of the MoHE rats treated with honokiol (Fig. 1 c) thereby suggesting more deacetylation of this enzyme due to the HKL treatment and thus indicating a role of SIRT3 activation in normalizing Mn-SOD activity in the HKL treated MoHE rats. Modulation Of Mnsod Expression Due To Hkl Treatment As presented in Fig. 2 a&b, the expression of MnSOD at protein and mRNA level is observed to be declined significantly (p < 0.01) in the hippocampus of MoHE rats as compared to the control rats. However, the expression of MnSOD was found to be activated (attaining even more than normal level) (p < 0.001) in case of the honokiol treated MoHE rats. Hkl Dependent Expression Of Foxo3a And Pgc1α FoxO3a are winged helix structures which binds to DNA and upregulates transcription of MnSOD. FoxO3a is dependent upon PGC-1α to regulate antioxidant genes. Also, PGC1α is a known regulator of mitochondrial functions as well. Therefore, to understand the mechanism of HKL dependent over expression of MnSOD in the hippocampus of the MoHE rats, Foxo3a and PGC-1α levels were monitored in the hippocampus of the control and both the experimental groups. As presented in Fig. 3 a & b, it was observed that the transcript levels of both, foxo3a and pgc1α were sharply declined in the hippocampus of MoHE rats as compared to control rats. However, the mRNA of both these factors were found to be significantly enhanced ( p < 0.001) in response to HKL treatment to MoHE rats. In order to ascertain protein level expression pattern, both these factors were also analyzed by immunofluorescence based detection of Fox03a and PGC1α in the three main hippocampus reagions; DG, CA3 and CA1. According to Fig. 4 a&b, most of the cells in the hippocampus DG region from the control rats showed a uniform distribution and intensity of FoxO3a and PGC1α signals. However, signals for both these factors were found to be declined significantly in case of the MoHE rats. Nonetheless, after HKL treatment to the MoHE rats, immunoreactive signals for both; Foxo3a & PGC1α (Fig. 4 a &b) were found to be recovered back near to the control level in the DG region. The signal intensity, analyzed through the image J software, also matched well with the pattern of immunosignals seen for both the proteins in the hippocampus from control, the MoHE and the MoHE rats treated with HKL (Fig. 4 c). Following a similar trend, the relative immunofluorescence intensity of anti FoxO3a and anti PGC1α, in CA1 region of hippocampus of MoHE rats was observed to be reduced with respect to the control rats (Fig. 5 a &b). However, honokiol treatment of MoHE rats was found to restore the immunoreactivity for FoxO3a and PGC1α in CA1 hippocampus region of the MoHE rats (Fig. 5 ). The quantitative analysis also showed a similar pattern of signal intensities between the control, the MoHE and the HKL treated MoHE rats (Fig. 5 c). Similarly, the FoxO3a and PGC1α immunoreactivity in CA3 region, as depicted in Fig. 6 a&b, we observed significantly reduced immunoreactivity of FoxO3a and PGC1α in the CA3 region of hippocampus of the MoHE rats, as compared to the control plates. However, there was a discernable increase in FoxO3a and PGC1α immune signal following HKL treatment to MoHE rats. A similar pattern was obtained when immunofluroresence intensity was recorded quantitatively (Fig. 6 c). This shows that the SIRT3 activator, honokiol is able to enhance the expression level of transcriptional regulators of MnSOD. Discussion As mitochondria is the site of oxidative phosphorylation, it is likely to produce high amount of O 2 − radicals and thereby making this organelle the most susceptible one to undergo ROS led dysfunctions in the high energy demanding brain cells in particular. Thus, oxidative stress induced mitochondrial dysfunction is now considered the most common neurochemical aberration associated with the pathogenesis of many brain disorders. The neurotoxic effect of ammonia in CNS, symptomized mainly by the HE associated neuropsychiatric complications, is also argued to implicate enhanced mitochondrial ROS load mainly due to declined levels of antioxidant enzymes like; SOD, catalase etc. [ 34 , 35 ]. The mitochondrial MnSOD is considered the committed enzyme to neutralize O 2 − radical and therefore, the declined level of this antioxidant enzyme has been reported associated with the pathogenesis of many brain disorders like AD, PD, ALS [ 8 ]. Consequently, by using knocked in experimental models, many workers have tried to manipulate the expression level MnSOD to prevent neurodegeneration in different neuropathology models [ 7 ]. However, to qualify Mn-SOD as a doable therapeutic target, there is need to define protein level reversible modification vs activity changes and the mechanism by which its expression is regulated during a neuropathogenesis. There are reports suggesting activation of MnSOD by a number of compounds [ 36 ], however, the mode of action of most of them remain unexplained. In this respect, particularly in mitochondria, there is an evolving concept of activating this enzyme by a mitochondrial SIRT3 dependent deacetylation resulting into better cell survival [ 15 ]. In case of the animal model of neurodegenerative brain disorders, such examples are limited. Moreover, in western diet fed SIRT3 −/− mice model, an increased MnSOD acetylation could be correlated with the diminished activity of this enzyme [ 23 ]. We have recently reported a cause-and-effect relationship between SIRT3 activation by a natural compound honokiol (HKL) and recovery in the compromised mitochondrial functions in hippocampus of the MoHE rats [ 29 ]. In this respect, the findings of Fig. 1 (a-c) clearly demonstrate another cause - effect relationship between activation of Mn-SOD vs deacetylation of this enzyme due to the treatment with HKL. Though fragmentary but there are some reports on SIRT3 dependent deacetylation of certain ETS enzymes vis a vis normalizing the declined levels of those enzymes [ 37 ]. However, such reports are scanty in case of deacetylation of Mn-SOD vs recovery in ROS led mitochondrial dysfunction. Our previous report has demonstrated a correlation between the enhanced ROS level led compromised mPTP, declined ETS activity and redox ratio in the hippocampal mitochondria from the MoHE rats. However, all these parameters could be recovered back to the normal level due to SIRT3 activation by HKL [ 29 ]. Herein, the finding of significantly declined level of the acetylated Mn-SOD (Fig. 1 c) due to HKL treatment to the MoHE rats provides evidence to advocate Mn-SOD as another protein target of SIRT3 activation. Thus, suggesting about mechanistic aspect of how HKL could normalize ROS challenges in the hippocampal mitochondria of the MoHE rats. Additionally, this is a first report on HKL dependent alterations in the acetylation status MnSOD vs a similar pattern of its activity changes in mitochondria of a susceptible brain region of an MoHE animal model of excitotoxicity. The argument gets support from a report describing association of SIRT3 deletion with the enhanced acetylation led decreased activity of MnSOD which was found accountable for the increasing oxidative stress and decline of MPTP in an age-related loss of substantia nigra (SNc) dopaminergic neurons of the PD mouse model [ 38 ]. A recent report in metal toxicity model has also shown that fluoride reduced mitochondrial antioxidant enzyme activities and elevated SOD2 acetylation by downregulating SIRT3 expression in the brain of mice and in the SH-SY5Y cells [ 39 ]. Another mechanism advocated accountable for maintaining MnSOD level in the brain cells is the regulation of its expression during pathogenesis and treatment. According to the findings from Fig. 2 , a recovery in the MoHE associated declined expression of MnSOD, both at transcript and at protein levels, due to the treatment with HKL, clearly suggest about a significant role of HKL in the regulation of MnSOD expression in the hippocampus mitochondria. There are some reports, though on other neurodegenerative models, describing recovery in the Mn-SOD expression vis a vis normalization of the disease pathogenesis. In a Diabetic neuropathic pain (DNP) model in rats, upregulation of MnSOD in the spinal dorsal horn could be correlated with the pain reduction [ 40 ]. Another study suggests that a trans sodium crocetinate (TSC) could exert protection against cerebral ischemia/reperfusion (I/R) injury by increasing SOD2 protein levels and decreasing its acetylation [ 41 ]. However, to our knowledge, there is a little information on the HKL dependent modulation of Mn-SOD expression in an excitotoxic brain disorder condition. Therefore, our finding of Fig. 2 necessitated investigation of how HKL could modulate expression of MnSOD expression in the hippocampus of the MoHE rats. In most of the reports describing modulation of the expression of antioxidant enzymes, under the condition of physiological stresses, by a number of modulators, it was observed that in case of MnSOD, there appears concordant interplay of SIRT3-FoXO3a-PGC1α axis in transactivating this mitochondrial isoform of SOD. It has been suggested that FoxO3a forms a feedback loop with PGC1α to regulate antioxidant genes and SIRT3 dependent deacetylation of these transcription factors has been argued as one of the mechanisms to regulate their expression and nuclear translocation to ultimately activate the ARE (the antioxidant response element) of the antioxidant enzymes genes [ 19 ]. Independently also, PGC1α is known to regulate mitochondrial function by stimulating antioxidant enzymes [ 20 ]. Also, the PGC1α is reported to trigger SIRT3 expression which by deacetylating MnSOD, normalizes the increased mitochondrial ROS [ 42 ]. In view of our previous report, describing HKL dependent recovery in SIRT3 activity in the hippocampal mitochondria of the MoHE rats, it is argued that SIRT3 activation could be accountable for not only deacetylating Mn-SOD (Fig. 1 c) but also for the modulation of FoxO3a-PGC1a axis as well. Indeed, we observed a remarkable increase in the transcript levels of both, the Foxo3a and PGC1α, in the hippocampal fraction of the MoHE rats treated with HKL (Fig. 3 ). Importantly, such a pattern of the enhanced expression of both these critical factors was consistent with a similar recovery in the abundance of both these proteins in all the three major regions of hippocampus; DG, CA1 & CA3, accountable for memory formation and consolidation, in the HKL treated MoHE rats (Fig. 4 , 5 & 6 ). HKL is known to display strong anti-inflammatory and antioxidant properties in a variety of diseases including certain neuropathology as well. However, the mechanism by which it imparts its neuroprotective action remains largely unexplored. During recent past, SIRT3 is emerging as a master regulator of mitochondrial integrity and HKL is suggested as an activator of SIRT3 [ 25 , 29 ] both in vitro and in vivo . Therefore, in the present context, it is argued that HKL dependent SIRT3 activation could be accountable to upregulate Mn-SOD mainly by modulating the levels of Foxo3a and PGC1α in the hippocampus of the MoHE rats. This is supported, though indirectly, by the similar findings on the multimodal modulations of SIRT3-FoxO3a-PGC1α axis including SIRT3 dependent deacetylation of both the transcription factors due to the treatment with various other compounds. For example, Chronic fluoride exposure has been found to induce mitochondrial dysfunction through inhibition of Sirt3/FoxO3a signaling in the SH-SY5Y cell lines [ 39 ]. The overexpression of spinal cord SIRT3 in DNP rat model has been demonstrated to increase the expression and deacetylation of FoxO3a to ultimately upregulate MnSOD [ 40 ]. Another study suggests that neuroprotective effect of trans sodium crocetinate (TSC) against cerebral ischemia/reperfusion (I/R) injury is mediated via increasing SIRT3 activity vs decreased acetylation of Foxo3a and SOD2 [ 41 ]. SIRT3 dependent increased expression and nuclear translocation of FoxO3a have also been reported accountable to transactivate antioxidant enzymes like SOD in the activated microglia of the adult rats subjected to the traumatic brain injury [ 16 ]. Similarly, PGC-1α, is a multifunctional critical regulator of various cellular functions including mitochondrial quality by suppressing oxidative damage [ 43 ]. Importantly, FoxO3a has been found to protect cells from oxidative stress through direct interaction with PGC-1α in the promoter regions of the antioxidant enzymes [ 19 ]. In MPTP PD model, PGC1a-ERRα/SIRT3 pathway has been demonstrated to play critical roles in protecting DAergic neurons against oxidative damage and ATP depletion mainly by deacetylating SOD2 and ATP synthase β [ 20 ]. Also, PGC-1α expression is reported to decline in the AD brain as a function of dementia severity [ 44 ]. Taking together, SIRT3-Foxo3a-PGC1a axis act as a master regulator of maintaining the levels of the antioxidant enzymes and the mitochondrial Mn-SOD, in particular, however, evidently this axis seems to be a modifiable target in many ways and therefore, deserve special merit to be categorized as a targetable hot spot in neurological disorders. There is no previous report on HKL dependent modulation of SIRT3-Foxo3a-PGC1a loop in modulating the antioxidant potential of the brain cells in a neurological disorder. Thus, our findings of Fig-3-6 are first of its kind to provide HKL dependent positive modulation of this axis that could be involved in normalizing ROS challenge emerged during MoHE pathogenesis. Conclusion ROS insult lies at the heart of mitochondrial dysfunction which serves as a central point of many neuropathology. The pathogenesis of ammonia neurotoxicity, in general and in the animal model of MoHE in particular, has also been described associated with the enhanced mitochondrial ROS load which could be demonstrated to be normalized due to SIRT3 activation by HKL [ 29 ]. This article describes that HKL does so by deacetylating mitochondrial MnSOD and by recovering its expression level mainly due to HKL dependent increased expression of the constitutive type transcription factors; Foxo3a and PGC1a, of the antioxidant enzymes, in the hippocampus (the most susceptible brain regions to undergo neuroarchitectural aberrations) of the MoHE rats [ 12 ]. Thus, HKL is evident to counteract mitochondrial ROS challenge during MoHE pathogenesis by altering SIRT3 dependent acetylation status of MnSOD and by modulating Foxo3a-PGC1a axis to enhance expression of this antioxidant enzyme. Declarations Declaration: This work was financially supported by a Govt of India DST-SERB project (EMR/2016/006501) to SKT. Anamika acknowledges the award of BHU fellowship, UGC CAS JRF and CSIR SRF. Ethics Declaration The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be interpreted as a potential conflict of interest. Ethics Declaration: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Conflict of Interest Declaration : The authors declare no conflict of interest. The authors have no relevant financial or non-financial interests to disclose Ethics Approval: This study was performed in line with the principles of the institutional animal ethical committee for the care and use of laboratory animals. Approval was granted by the Ethics Committee of University (F.Sc/IAEC/2016-17/233). Consent to Participate: Not applicable (study does not involve human subjects) Consent to publish: Not applicable (study does not involve human subjects) Availability of data and materials: The data sets generated during and/or analysed during the current study are not publicly available but are available from the corresponding author on reasonable request. Competing interests : Author SK Trigun and Anamika declare that they have no relevant financial or non-financial interests to disclose Funding: This work was financially supported by a Govt of India DST-SERB project (EMR/2016/006501) to SKT. Anamika received the BHU fellowship, UGC CAS JRF and CSIR SRF during this research work. Author Contributions: Both authors contributed in concept design of the experiments. Anamika performed the experiments, collected and analysed the data. First manuscript draft was constructed by Anamika. Surendra Kumar Trigun contributed in developing this project, data analysis and manuscript correction. Acknowledgment: This work was financially supported by a Govt of India DST-SERB project (EMR/2016/006501) to SKT. Anamika acknowledges the award of BHU fellowship, UGC CAS JRF and CSIR SRF. The instrumental facilities provided by BHU-DBT ISLS and DST-FIST in Department of Zoology are also acknowledged. Author’s Information: Surendra K Trigun, Professor in BHU, is the Principal Investigator of this research work under a DST project, referred above, granted to him. Anamika has worked as JRF and SRF to carry out experiments under the supervision of SKT. References Felipo V, Urios A, Montesinos E, Molina I, Garcia-Torres ML, Civera M, Montoliu C (2012) Contribution of hyperammonemia and inflammatory factors to cognitive impairment in minimal hepatic encephalopathy. Metab Brain Dis 27(1):51–58. doi: 10.1007/s11011-011-9269-3 Jayakumar AR, Rama Rao KV, Schousboe A, Norenberg MD (2004) Glutamine-induced free radical production in cultured astrocytes. Glia 46(3):296–301. doi: 10.1002/glia.20003 Bai G, Rama Rao KV, Murthy CR, Panickar KS, Jayakumar AR, Norenberg MD (2001) Ammonia induces the mitochondrial permeability transition in primary cultures of rat astrocytes. J Neurosci Res 66(5):981–991. doi: 10.1002/jnr.10056 Bai Y, Wang S, Wu F, Xie X, Wang Y, Yang Y (2019) The changes of mitochondria in substantia nigra and anterior cerebral cortex of hepatic encephalopathy induced by thioacetamide. Anat Rec 302(7):1169–1177. doi: 10.1002/ar.23932 Guazzelli, P. A., Cittolin-Santos, G. F., Meira-Martins, L. A., Grings, M., Nonose,Y., Lazzarotto, G. S., … de Assis, A. M. (2020). Acute liver failure induces glial reactivity, oxidative stress and impairs brain energy metabolism in rats. Front. Cell.Neurosci., 327. doi: 10.3389/fnmol.2019.00327 Angelova PR, Abramov AY (2018) Role of mitochondrial ROS in the brain: from physiology to neurodegeneration. FEBS Lett 592(5):692–702. doi: 10.1002/1873-3468.12964 Flynn JM, Melov S (2013) SOD2 in mitochondrial dysfunction and neurodegeneration. Free Radic Biol Med 62:4–12. doi: 10.1016/j.freeradbiomed.2013.05.027 Bresciani G, da Cruz IBM, González-Gallego J (2015) Manganese superoxide dismutase and oxidative stress modulation. Adv Clin Chem 68:87–130. doi: 10.1016/bs.acc.2014.11.001 Bhatti JS, Bhatti GK, Reddy PH (2017) Mitochondrial dysfunction and oxidative stress in metabolic disorders—A step towards mitochondria based therapeutic strategies. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 1863:1066–1077. 10.1016/j.bbadis.2016.11.010 . 5 Singh S, Trigun SK (2010) Activation of neuronal nitric oxide synthase in cerebellum of chronic hepatic encephalopathy rats is associated with up-regulation of NADPH-producing pathway. Cerebellum 9(3):384–397. doi: 10.1007/s12311-010-0172-y Singh S, Trigun SK (2014) Low grade cirrhosis induces cognitive impairment and motor dysfunction in rats: Could be a model for minimal hepatic encephalopathy. Neurosci Lett 559:136–140. doi: 10.1016/j.neulet.2013.11.058 Khanna A, Anamika CS, Tripathi SJ, Acharjee A, Rao S, Trigun SK (2020) SIRT1 activation by resveratrol reverses atrophy of apical dendrites of hippocampal CA1 pyramidal neurons and neurobehavioral impairments in moderate grade hepatic encephalopathy rats. J Chem Neuroanat 106:101797. doi: 10.1016/j.jchemneu.2020.101797 Waddell J, Banerjee A, Kristian T (2021) Acetylation in Mitochondria Dynamics and Neurodegeneration. Cells 10(11):3031. doi: 10.3390/cells10113031 Meng H, Yan WY, Lei YH, Wan Z, Hou YY, Sun LK, Zhou JP (2019) SIRT3 regulation of mitochondrial quality control in neurodegenerative diseases. Front. Aging Neurosci., 313. doi: 10.3389/fnagi.2019.00313 Santos SS, Moreira JB, Costa M, Rodrigues RS, Sebastião AM, Xapelli S, Solá S (2021) The Mitochondrial Antioxidant Sirtuin3 Cooperates with Lipid Metabolism to Safeguard Neurogenesis in Aging and Depression. Cells 11(1):90. doi: 10.3390/cells11010090 Rangarajan P, Karthikeyan A, Lu J, Ling EA, Dheen ST (2015) Sirtuin 3 regulates Foxo3a-mediated antioxidant pathway in microglia. Neurosci 311:398–414. doi: 10.1016/j.neuroscience.2015.10.048 Ansari A, Rahman MS, Saha SK, Saikot FK, Deep A, Kim KH (2017) Function of the SIRT 3 mitochondrial deacetylase in cellular physiology, cancer, and neurodegenerative disease. Aging Cell 16(1):4–16. doi: 10.1111/acel.12538 Kops G. J., Dansen T. B., Polderman P. E., Saarloos I., Wirtz K. W., Coffer P. J.,… Burgering B. M. (2002). Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nat, 419(6904), 316–321. doi: 10.1038/nature01036 Olmos Y, Valle I, Borniquel S, Tierrez A, Soria E, Lamas S, Monsalve M (2009) Mutual dependence of Foxo3a and PGC-1α in the induction of oxidative stress genes. J Biol Chem 284(21):14476–14484. doi: 10.1074/jbc.M807397200 Zhang X., Ren X., Zhang Q., Li Z., Ma S., Bao J., … Ji J. (2016). PGC-1α/ERRα-Sirt3 pathway regulates DAergic neuronal death by directly deacetylating SOD2 and ATP synthase β. Antioxid. Redox Signal., 24(6), 312–328. doi: 10.1089/ars.2015.6403 Cheng A., Yang Y., Zhou Y., Maharana C., Lu D., Peng W., … Mattson M. P. (2016). Mitochondrial SIRT3 mediates adaptive responses of neurons to exercise and metabolic and excitatory challenges. Cell Metab, 23(1), 128–142. doi: 10.1016/j.cmet.2015.10.013 Wang D, Dong X, Wang C (2018) Honokiol ameliorates amyloidosis and neuroinflammation and improves cognitive impairment in Alzheimer’s disease transgenic mice. J Pharmacol Exp Ther 366(3):470–478. doi: 10.1124/jpet.118.248674 Tyagi A., Nguyen C. U., Chong T., Michel C. R., Fritz K. S., Reisdorph N., … Pugazhenthi S. (2018). SIRT3 deficiency-induced mitochondrial dysfunction and inflammasome formation in the brain. Sci. Rep., 8(1), 1–16. doi: 10.1038/s41598-018-35890-7 Ozden O, Park SH, Kim HS, Jiang H, Coleman MC, Spitz DR, Gius D (2011) Acetylation of MnSOD directs enzymatic activity responding to cellular nutrient status or oxidative stress. Aging 3(2):102. doi: 10.18632/aging.100291 Pillai V. B., Samant S., Sundaresan N. R., Raghuraman H., Kim G., Bonner M. Y., …Gupta M. P. (2015). Honokiol blocks and reverses cardiac hypertrophy in mice by activating mitochondrial Sirt3. Nat. Commun., 6(1), 1–16. doi: 10.1038/ncomms7656 Pillai VB, Kanwal A, Fang YH, Sharp WW, Samant S, Arbiser J, Gupta MP (2018) Honokiol, an activator of Sirtuin-3 (SIRT3) preserves mitochondria and protects the heart from doxorubicin-induced cardiomyopathy in mice. Oncotarget 8(21):34082. doi: 10.18632/oncotarget.16133 Woodbury A, Yu SP, Wei L, García P (2013) Neuro-modulating effects of honokiol: a review. Front Neurol 4:130. doi: 10.3389/fneur.2013.00130 Wang X., Duan X., Yang G., Zhang X., Deng L., Zheng H., … Chen L. (2011). Honokiol crosses BBB and BCSFB, and inhibits brain tumor growth in rat 9L intracerebral gliosarcoma model and human U251 xenograft glioma model. PLoS One, 6(4), e18490. doi: 10.1371/journal.pone.0018490 Anamika, Trigun SK (2021) Sirtuin-3 activation by honokiol restores mitochondrial dysfunction in the hippocampus of the hepatic encephalopathy rat model of ammonia neurotoxicity. J Biochem Mol Toxicol e22735. doi: 10.1002/jbt.22735 Khanna A, Trigun SK (2016) Resveratrol normalizes hyperammonemia induced pro-inflammatory and pro-apoptotic conditions in rat brain. Int J Complement Altern Med 4(2):00115. doi: 10.15406/ijcam.2016.04.00115 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265–275 Beauchamp C, Fridovich I (1971) Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal Biochem 44(1):276–287. doi: 10.1016/0003-2697(71)90370-8 Mehrotra A, Trigun SK (2013) Moderate grade hyperammonemia activates lactate dehydrogenase-4 and 6-phosphofructo-2-kinase to support increased lactate turnover in the brain slices. Mol Cell Biochem 381(1):157–161. doi: 10.1007/s11010-013-1698-3 Felipo V (2009) Hyperammonemia. In Handbook of neurochemistry and molecular neurobiology. US Springer, pp. 43–69. doi.: 10.1007/978-0-387-30375- 8_3 Heidari R (2019) Brain mitochondria as potential therapeutic targets for managing hepatic encephalopathy. Life Sci 218:65–80. doi: 10.1016/j.lfs.2018.12.030 Miriyala S, Spasojevic I, Tovmasyan A, Salvemini D, Vujaskovic Z, Clair DS, Batinic-Haberle I (2012) Manganese superoxide dismutase, MnSOD and its mimics. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 1822:794–814. 10.1016/j.bbadis.2011.12.002 . 5 Haigis MC, Deng CX, Finley LW, Kim HS, Giux D (2012) SIRT3 is a mitochondrial tumor spressor: A scientific tale that connects aberrant cellular ROS, the Warburg effect and carcinogenesis. Cancer res 72:268–272. .doi:.org/10.1158/0008-5472 .. CAN-11-3633 Shi H, Deng HX, Gius D, Schumacker PT, Surmeier DJ, Ma YC (2017) Sirt3 protects dopaminergic neurons from mitochondrial oxidative stress. Hum Mol Genet 26(10):1915–1926. doi: 10.1093/hmg/ddx100 Wang D, Cao L, Pan S, Wang G, Wang L, Cao N, Hao X (2021) Sirt3-mediated mitochondrial dysfunction is involved in fluoride-induced cognitive deficits. Food Chem Toxicol 158:112665. doi: 10.1016/j.fct.2021.112665 Zhou C, Zhang Y, Jiao X, Wang G, Wang R, Wu Y (2021) SIRT3 alleviates neuropathic pain by deacetylating FoxO3a in the spinal dorsal horn of diabetic model rats. Reg Anesth Pain Med 46(1):49–56. doi: 10.1136/rapm-2020-101918 Chang G, Chen Y, Zhang H, Zhou W (2019) Trans sodium crocetinate alleviates ischemia/reperfusion induced myocardial oxidative stress and apoptosis via the SIRT3/FOXO3a/SOD2 signaling pathway. Int Immunopharmacol 71:361–371. doi: 10.1016/j.intimp.2019.03.056 Wenz T (2013) Regulation of mitochondrial biogenesis and PGC-1α under cellular stress. Mitochondrion 13(2):134–142. doi: 10.1016/j.mito.2013.01.006 Rius-Pérez S, Torres-Cuevas I, Millán I, Ortega ÁL, Pérez S (2020) PGC-1α, inflammation, and oxidative stress: an integrative view in metabolism. Oxid. Med. Cell. Longev., 2020. doi: 10.1155/2020/1452696 Qin W, Haroutunian V, Katsel P, Cardozo CP, Ho L, Buxbaum JD, Pasinetti GM (2009) PGC-1α expression decreases in the Alzheimer disease brain as a function of dementia. Arch Neurol 66(3):352–361. doi: 10.1001/archneurol.2008.588 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1518187","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":98357839,"identity":"15aa1111-1c90-4cdb-8d9e-e81a8bc08840","order_by":0,"name":"Anamika Anamika","email":"","orcid":"","institution":"Banaras Hindu University Faculty of Science","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anamika","middleName":"","lastName":"Anamika","suffix":""},{"id":98357840,"identity":"66645eff-46d3-41b7-a45c-f472546fde58","order_by":1,"name":"Surendra Kumar Kumar Trigun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYDACHiBOAGJ+ECehgCgtzBAtkg0gLQbEagEBgwNgkggd8j3nj3148OtwnvH51YkfHhgwyPOLHcCvxeBsM/OMxL7DxWY33m6WADrMcObsBAJa+JmZGRJ7Diduu3F2A0hLgsFtAlrk+6FaNs84u/kHUVoYgA5jSPhxOHEDf+824mwxOHPYmCGxIT1xxg3ebRYJBhKE/SLfk/iY8ccf68T+/rObb/6osJHnlybkMBBgbAMSEmCVEkQoB4M/QMx/gFjVo2AUjIJRMNIAALVIR1ezPJcmAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-5655-9618","institution":"Banaras Hindu University Faculty of Science","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Surendra","middleName":"Kumar Kumar","lastName":"Trigun","suffix":""}],"badges":[],"createdAt":"2022-04-03 07:38:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1518187/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1518187/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":20401485,"identity":"0191e6d7-11af-46a1-9b73-d5297972d5cc","added_by":"auto","created_at":"2022-04-15 20:34:26","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":105108,"visible":true,"origin":"","legend":"\u003cp\u003eA\u003cstrong\u003ecetylation level vs MnSOD activity.\u003c/strong\u003e (\u003cstrong\u003ea)\u003c/strong\u003e The spectrophotometric and \u003cstrong\u003e(b)\u003c/strong\u003e in-gel MnSOD activity profile in the hippocampus mitochondrial fraction from control, MoHE and MoHE rats treated with HKL. (c\u003cstrong\u003e) \u003c/strong\u003eLevel of acetylated MnSOD in case of control, MoHE and MoHE rats treated with honokiol: Shows representative western blot photographs with 60μg protein in each lane. Lower panel shows values of MnSOD/Hsp60 as mean ± SD; n=6; ***p\u0026lt;0.001 (Control vs MoHE), ##p\u0026lt;0.001, ##p\u0026lt;0.001 (MoHE vs MoHE+HKL).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/c72a5231244f0391b61f0cae.png"},{"id":20400800,"identity":"2a1e4e18-2029-41aa-81d2-920cb6a24fb1","added_by":"auto","created_at":"2022-04-15 20:29:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":59168,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of MnSOD at protein and mRNA levels in the hippocampus of control, MoHE and MoHE rats treated with honokiol.\u003c/strong\u003e \u003cstrong\u003e(a)\u003c/strong\u003e Shows representative western blot photographs with 60μg protein in each lane. Lower panel shows values of MnSOD/Hsp60 as mean ± SEM\u003cstrong\u003e \u003c/strong\u003eout of the 3 repeats\u003cstrong\u003e (b)\u003c/strong\u003e Show qPCR result. The Cycle threshold value of mnsod mRNA level was normalized with the cycle threshold value of Gapdh for each sample to give a relative quantity of the mRNA expression by 2-ddCt .; Values are presented as mean ± SD n=6; ***p\u0026lt;0.001 (Control vs MoHE), ##p\u0026lt;0.001, ##p\u0026lt;0.001 (MoHE vs MoHE+HKL).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/9a1846533b486d2efa1ded38.png"},{"id":20401777,"identity":"659a4b7b-5f24-40d8-92c8-4146907ed221","added_by":"auto","created_at":"2022-04-15 20:39:26","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":17269,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLevel of FoxO3a and PGC1α\u003c/strong\u003e in the hippocampus of control, MoHE and MoHE rats treated with honokiol. \u003cstrong\u003e(a)\u003c/strong\u003e \u0026amp; (b) show qPCR result of FoxO3a and PGC1α respectively. The Cycle threshold value of both the mRNAs level were normalized with the cycle threshold value of Gapdh for each sample to give a relative quantity of the mRNA expressed by 2-ddCt . Values are represented as mean ± SD; n=3; Gapdh was taken as the internal control. ***p\u0026lt;0.001, (control vs MoHE), ###p\u0026lt;0.001 (MoHE vs MoHE+HKL).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/1e6e1191e15d73df5527282e.png"},{"id":20401484,"identity":"9f13b25a-6b9f-465d-beb2-6fdd30cb5911","added_by":"auto","created_at":"2022-04-15 20:34:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1551434,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSIRT3 activation restores FoxO3a expression in DG region of hippocampus of the MoHE rats. \u003c/strong\u003eImmunofluorescence of FoxO3a and PGC1α in the dentate gyrus (DG) region of hippocampus of control, MoHE and MoHE treated with Honokiol. \u003cstrong\u003e(a)\u003c/strong\u003e \u0026amp; (b) represent the photomicrograph at 20x magnifications. The arrows indicate FoxO3a and PGC1α immunoreactivity in neurons. \u003cstrong\u003e(c)\u003c/strong\u003e Shows the relative changes in the intensity of immunofluorescence analysed by ImageJ. Values are represented as mean ± SD, where n=6 (*p\u0026lt;0.05, control vs MoHE; ##p\u0026lt;0.01, MoHEvsMoHE + HKL groups).\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/d811f480facfd0ec87914d29.png"},{"id":20400804,"identity":"f406905e-6a59-4ff2-a036-ed2a7f929b8f","added_by":"auto","created_at":"2022-04-15 20:29:26","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1433101,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSIRT3 activation restores FoxO3a expression in CA1 region of hippocampus of the MoHE rats. \u003c/strong\u003eImmunofluorescence of FoxO3a and PGC1α in the Cornu amonis 1 (CA1) region of hippocampus of control, MoHE and MoHE treated with Honokiol. (\u003cstrong\u003ea)\u003c/strong\u003e \u0026amp; (b) represent the photomicrographs at 20x magnifications. The arrows indicate FoxO3a and PGC1α immunoreactivity in neurons. \u003cstrong\u003e(c)\u003c/strong\u003e Shows the relative changes in the intensity of immunofluorescence analyzed by ImageJ. Values are represented as mean ± SD, where n=6 (*p\u0026lt;0.05, control vs MoHE; ##p\u0026lt;0.01, MoHE vs MoHE + HKL groups).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/f77323f9dc5ba39093f35616.png"},{"id":20400803,"identity":"266a2e31-af52-4e87-a1da-0a833c80672f","added_by":"auto","created_at":"2022-04-15 20:29:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1491776,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSIRT3 activation restores FoxO3a expression in CA3 region of hippocampus of the MoHE rats. \u003c/strong\u003eImmunofluorescence of FoxO3a and PGC1α in the Cornu amonis 3 (CA3) region of hippocampus of control, MoHE and MoHE treated with Honokiol. (\u003cstrong\u003ea)\u003c/strong\u003e \u0026amp; (b) represent the photomicrograph at 20x magnifications. The arrows indicate FoxO3a and PGC1α immunoreactivity in neurons. \u003cstrong\u003e(c)\u003c/strong\u003e Shows the relative changes in the intensity of immunofluorescence analyzed by ImageJ. Values are represented as mean ± SD, where n=6 (*p\u0026lt;0.05, control vs MoHE; ##p\u0026lt;0.01, MoHE vs MoHE + HKL groups).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/06d57a79deb5c21e66025669.png"},{"id":21410291,"identity":"49cd71ef-ec9d-48df-b1dc-6f431a9b3589","added_by":"auto","created_at":"2022-05-12 20:24:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1441950,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1518187/v1/595f84c7-39a2-476c-95fb-a260c410790d.pdf"}],"financialInterests":"","formattedTitle":"Honokiol, a SIRT3 activator, activates hippocampus mitochondrial MnSOD by deacetylating the enzyme and upregulating FoxO3a-PGC1α axis in a rat model of ammonia neurotoxicity","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe persistent ammonia neurotoxicity, developed in the patients with chronic liver failure (CLF), results into development of a neuroexcitotoxic brain disorder, known as hepatic encephalopathy (HE), which is characterized mainly by the progressive loss of cognitive and motor functions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The neurochemistry of HE is argued to implicate mainly glutamate-NMDAR over activation led deranged mitochondrial biochemistry at brain cells level [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Wherein, mitochondrial ROS load is considered one of the main precipitating events in deranging neuronal functions in most of the brain regions including cortical subregions, brain stem and cerebellum as the most affected ones in case of the HE [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Thus, preventing/neutralizing mitochondrial ROS load in the cells of the susceptible brain regions could be a relevant approach to manage HE.\u003c/p\u003e \u003cp\u003eMitochondria is the main oxygen consuming organelle and thus faces greater challenge of neutralizing metabolic O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e radical. Obviously, the mitochondrial reactive oxygen species (ROS) load is considered more critical in pathogenic mechanisms during brain disorders [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The mitochondrial isoform of Mn-superoxide dismutase (Mn-SOD) is known to catalyze the committed step of neutralizing O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e radical. The literature available advocate the implication of this antioxidant enzyme in the pathogenesis of several diseases including the neurodegenerative brain disorders like; AD, PD, ALS etc. as most of them have been reported to implicate deranged mitochondrial functions [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Obviously, Mn-SOD could be argued as a choice of therapeutic target in various pathologies, however, there was very little success. Alternatively, targeting certain up-stream regulatory steps involved in tackling ROS challenges is now emerging as a relevant approach so far preventing mitochondrial derangement during neurological disorders is concerned [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This necessitates understanding the regulation of Mn-SOD in the mitochondria of the susceptible brain regions in a relevant brain disorder model.\u003c/p\u003e \u003cp\u003eIn this respect, the development of the chronic type HE via hepatotoxin induced CLF in rats, one of the prevalent syndrome in the patients with liver cirrhosis, is neurochemically and neurobehaviorally argued as the most relevant model of neurexcitotoxicity that can be used to explore pathogenesis vs therapeutic management of HE [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSo far regulation of Mn-SOD is concerned, in addition to modulating its expression, the alterations in Mn-SOD activity by modulating protein level acetylation of this mitochondrial isoform is emerging as an evolving concept in understanding ROS induced pathogenesis of the neurodegenerative brain disorders [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In this respect, Sirtuin3 (SIRT3), a mitochondrial isoform of SIRTUINs family deacetylase, is now emerging as a master regulator of the mitochondrial functions [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] mainly by deacetylating a number of mitochondrial proteins amongst which Mn-SOD is argued to be the most important one [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The enhanced Mn-SOD activity due to its deacetylation by SIRT3 is also on record [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The information during recent past advocate that SIRT3 is likely to modulate Mn-SOD activity in multimodal ways. For example, SIRT3 induces transcription of Mn-SOD by increasing the level of its main transcriptional regulator Fox03a [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Fox03a has been reported to protect quiescent cells from oxidative stress by increasing the expression of MnSOD [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In response to elevated ROS, Fox03a has been demonstrated to translocate to the nucleus thereby activates transcription of MnSOD and Catalase [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. And SIRT3 has been found to enhance FoxO3a translocation to the nucleus and augments FoxO3a-dependent antioxidant defense mechanisms through upregulating the levels of peroxisome proliferator-activated receptor-gamma coactivator 1-alpha (PGC-1α) and SOD2 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThough information is limited, it is now evident that enhanced SIRT3 activity associates with protection of neurons in culture exposed to excitotoxic and metabolic stress mainly by interacting with the mitochondrial MnSOD [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. It has been demonstrated that Honokiol, a SIRT3 activator, is shown to improve spatial memory functions during amyloid-β (Aβ)-induced cognitive impairment in a transgenic mouse model, wherein, it involves the enhancement of PPARγ and decline of proinflammatory cytokines [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. These reports strongly suggest about a potent neuroprotective role of Sirt3 possibly by deacetylating Mn-SOD and/or by modulating transcriptional regulators of this antioxidant enzyme. Indeed, in the models of non-neuronal cells with a condition of nutritional manipulation, the SIRT3 deleted mice showed\u0026thinsp;~\u0026thinsp;85% increase in the level of acetylated Mn-SOD [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Also, SIRT3 activation in response to the increased oxidative stress could enhance the status of deacetylated Lys 122 of MnSOD leading to the enhanced Mn-SOD activity [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, the study about SIRT3 activity vs Mn-SOD acetylation/deacetylation status in the brain cells and in particular, in the animal models of a neurological disorder remains largely unexplored.\u003c/p\u003e \u003cp\u003eIn order to map out the mechanism by which SIRT3 activation could exert its neuroprotective effects at mitochondria level in the animal models of neurological disorders, the use of honokiol, a SIRT3 specific activator is advocated as the most suitable one [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Honokiol is a bioactive, phenolic compound, obtained from lignin of the bark of magnolia trees, which is described to maintain mitochondrial integrity via SIRT3 activation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. So far, its neuroprotective effects are concerned, information is limited, however, it was found to prevent age-related learning and memory impairment and neuronal deficits in senescence-accelerated mice [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Moreover, this plant derived compound is known to cross blood brain barrier and even found to cross through the mitochondrial inner membrane as well [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Indeed, we have recently demonstrated a correlation between the declined SIRT3 level and compromised mitochondrial function led enhanced ROS challenge in the hippocampus mitochondria of the MoHE rats [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Also, we found that SIRT3 activation by honokiol during MoHE, resulted in recovery of pathology associated mitochondrial ROS accumulation and deranged mitochondrial function.\u003c/p\u003e \u003cp\u003eTherefore, in order to delineate Mn-SOD centric mechanistic aspects of HKL mediated neutralization of mitochondrial ROS load in the hippocampus of the MoHE rats, the present study investigated activity of the mitochondrial Mn-SOD vs its acetylation/deacetylation status and expression of Mn-SOD vs profiles of its transcriptional regulators (FOXO3a \u0026amp; PGC1α) in the hippocampus [undergoes MoHE associated neuronal atrophy; 12] of control, MoHE and the MoHE rats treated with HKL.\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and Chemicals\u003c/h2\u003e \u003cp\u003eThe study involved adult male Charles foster for experimental studies. The rats were maintained at recommended conditions of 12h:12h light/dark cycle and were fed with the advised diet and water ad libitum at a room temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2∘C under standard hygienic conditions. Rats weighing 150\u0026ndash;180g were grouped as per experimental plan and were kept in separate cages. All the procedures on rats were performed as approved by the institutional animal ethical committee for the care and use of laboratory animals (F.Sc/IAEC/2016-17/233).\u003c/p\u003e \u003cp\u003eAll chemicals used were of analytical grade obtained from E-Merck and Sisco research Laboratory, Mumbai (India).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDevelopment of model\u003c/h2\u003e \u003cp\u003eThe chronic liver failure rat model of MoHE was developed by the administration of hepatotoxin, thioacetamide (TAA) and characterized as MoHE rats on the basis of neurobehavioural parameters as reported earlier from our lab [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. MoHE rats were further divided into two groups (six animals each) and rats from one of the groups were administered with HKL (10 mg/kg b.w dissolved in 1:1 DMSO: PBS) i.p. once daily, as described by Anamika \u0026amp; Trigun, [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], referred as MoHE\u0026thinsp;+\u0026thinsp;HKL group. After 24 h of the last dose given, rats were sacrificed under euthanasia. The hippocampus was dissected out and processed for biochemical and molecular studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of mitochondrial extract\u003c/h2\u003e \u003cp\u003eAs reported earlier [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], the mitochondrial fraction was prepared in ice cold MSH homogenization buffer (225 mM Mannitol, 75mM Sucrose, 1mM EGTA, 10mM HEPES (pH 7.2) and 1% bovine serum albumin. Briefly, the tissue was homogenized in MSH buffer in ice and cellular debris was removed by centrifugation at 1200 x g for 5min. The supernatant so obtained was again centrifuged at 10,000 x g for 10min to isolate a crude mitochondrial pellet. The pellet was further washed twice with MSH buffer without EGTA and the pellet thus obtained was re-suspended in the MSH buffer without EGTA stored in a number of aliquots at -80\u0026ordm;C. The mitochondrial extract was prepared by 3\u0026ndash;4 freeze-thaw cycles. Protein content in the extract was estimated by Lowry et al., [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eActivity assay MnSOD\u003c/h2\u003e \u003cp\u003eSOD activity was assayed using the method described by Beauchamp \u0026amp; Fridovich [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The reduced riboflavin generates O\u003csub\u003e2\u003c/sub\u003e radical upon oxidation in air, which in turn reduces NBT forming a blue colored formazon. Briefly, the reaction was setup by mixing 0.1M phosphate buffer (pH7.8), 12mM L methionine, 70\u0026micro;M NBT, 0.2mM riboflavin and 3\u0026micro;M EDTA. The reaction was initiated with the addition of the mitochondrial extract undergone at least three cycles of freeze-thaw releasing its matrix content. One set of tubes were illuminated under light for 30 min and parallelly another set was kept in dark. A similar reaction mixture without tissue extract was run simultaneously and was used as control. O.D. was recorded at 560 nm. The difference between light and dark sets was used to calculate unit of SOD, which was defined as the amount of enzyme that produced 50% inhibition of NBT reduction/min and activity was calculated as:\u003c/p\u003e \u003cp\u003eSOD (U) = ([(C-E)/(C/2) X (total volume of assay mixture/ amount of enzyme extract)] Where,\u003c/p\u003e \u003cp\u003eC\u0026thinsp;=\u0026thinsp;difference in absorbance of the control tubes kept for incubation in light and dark\u003c/p\u003e \u003cp\u003eE\u0026thinsp;=\u0026thinsp;difference in absorbance of the enzyme tubes kept for incubation in light and dark\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of SOD activity by non-denaturing PAGE\u003c/h2\u003e \u003cp\u003eNon-denaturing polyacrylamide gel electrophoresis was performed as described previously [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. 60 \u0026micro;g protein of hippocampal mitochondrial extracts of control and experimental rats were loaded on non-denaturing polyacrylamide gel and electrophoresis was carried out at 4\u0026ordm;C at constant voltage (100V) for 2h. The in-gel activity assay was performed by incubating the gel in 20 mL activity staining mixture containing 0.25mM NBT, 28\u0026micro;M Riboflavin and 28mM TEMED at 37\u0026ordm;C for 15\u0026ndash;20 min. Biochemically, NBT and SOD in the gel compete for O\u003csub\u003e2\u003c/sub\u003e radical such that the SOD activity zone appeared transparent, while rest of the region became purple blue due to reduced NBT. After development of activity bands, the gels were photographed and intensity of bands was quantified by gel densitometry using Alpha imager 2200 gel documentation software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blotting\u003c/h2\u003e \u003cp\u003eThe western blot analysis of Mn-SOD was performed following the previously described method from our lab [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Briefly, mitochondrial extract equivalent 80\u0026micro;g protein was loaded onto 12% denaturing polyacrylamide gel and electrophoresis was carried at constant voltage of 100V followed by electrotransfer of proteins on nitrocellulose membrane at 35mA for 10-12hrs at 4\u0026deg;C. Efficiency of Protein transfer was assessed by Ponceau S staining and then the nonspecific binding of antibody to protein was avoided by blocking of the membrane using 5% nonfat milk dissolved in 1X PBS for 90min. The membrane was then incubated with primary antibody; anti MnSOD (1:1000), anti Ac-MnSOD (1:500) dilution prepared in blocking solution and was kept at 4\u0026ordm;C overnight. HRP-conjugated secondary antibody was used for final immunodetection using ECL western blotting detection kit. For loading control anti hsp60 (1:1000) was used. Using normalized densitometric values of MnSOD and Ac-MnSOD vs hsp60, was recorded using gel densitometry software Alpha Imager 2200.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eReal time RT-PCR\u003c/h2\u003e \u003cp\u003eQuantification of gene expression was carried out by real time PCR. Total RNA of hippocampal tissue was extracted using TRI reagent (Sigma Aldrich) following the manufacturer\u0026rsquo;s protocol. Briefly, the homogenate prepared in TRI reagent was subjected to centrifugation at 12,000g at 4\u0026deg;C for 10 min and in the supernatant collected chloroform was added and vortexed. After 2 min, the tube was again centrifuged at 12,000g for 10 min, at 4\u0026deg;C. The colorless upper aqueous phase containing RNA isolate was collected and 0.5ml isopropanol was added to it. After 5 min, the tube was again centrifuged at 12,000g at 4\u0026deg;C for 10 min. The RNA precipitated as pellet at bottom of the tube was washed in 75% ethanol and air dried. RNA pellet was dissolved in 60 \u0026micro;L DEPC treated water and subjected to DNase treatment (DNA free-Ambion) to remove any sort of DNA contamination. The RNA samples with value of A260/A280 ratio between 1.8-2.0 were used in the cDNA synthesis reaction. cDNA synthesis was done using Revert Aid first strand cDNA synthesis kit. The reaction mixture consisting 4\u0026micro;g RNA, 1 \u0026micro;L random hexamer primer, made up to12 \u0026micro;L with DEPC treated water was centrifuged briefly and the following components were added; 4\u0026micro;L of 5X reaction buffer, 1\u0026micro;L of RiboLock\u0026trade; Ribonuclease Inhibitor (20U/\u0026micro;L), 2 \u0026micro;L of 10 mM dNTP mix, 1\u0026micro;L of reverse transcriptase to make a final volume of 20 \u0026micro;L. The components were incubated for 5 min at 25\u0026deg;C followed by cDNA strand synthesis for 60 min at 42\u0026deg;C. The reaction was terminated by heating at 72\u0026deg;C for 5 min. The cDNA was stored at -80\u0026deg;C. Rat gene-specific primers used were: \u003cem\u003efoxO3a\u003c/em\u003e (Forward primer 5\u0026rsquo;-CTCCGCTCGAAGTGGAGCTGGAC-3\u0026rsquo;, Reverse primer 5\u0026rsquo;-TACAGGAGACGTGGCCGACTCTG-3\u0026rsquo;) ppargc1α (Forward primer 5\u0026rsquo;AGTCCCATACACAACCGCAG 3\u0026rsquo;, Reverse primer 5\u0026rsquo;-CCCTTGGGGTCATTTGGTGA-3\u0026rsquo;); mnsod (Forward primer 5\u0026rsquo;-CGGGGGCCATATCAATCACA-3\u0026rsquo;, Reverse primer 5\u0026rsquo;-GCCTCCAGCAACTCTCCTTT-3\u0026rsquo;) GAPDH was used for normalization as a reference gene. The real time qPCR was performed using ABI Prism 7500 Sequence Detection System (PE Applied Biosystems, CA, USA). The PCR reaction mixture of (20 \u0026micro;L) consisted of 1\u0026micro;L of sample cDNA (diluted 1:10), 1\u0026micro;L of 10 pmol of forward and reverse primers and 10 \u0026micro;L of 2X Thermo Scientific SYBR Green/ROX qPCR Master Mix and brought to final volume with RNase free water. PCR condition was: 95\u0026deg;C for 30 sec, followed by 40 cycles at 95\u0026deg;C for 5 sec, and 60\u0026deg;C for 20 sec. Real-time PCR data was analyzed using the ΔΔCT method, normalizing the Ct values of the indicated gene to the Ct values of GAPDH relative to a control sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluroscence\u003c/h2\u003e \u003cp\u003eBriefly, at the end of the experimental dosage, the animals were sacrificed under ether anesthesia by trans-cardiac perfusion with 4% paraformaldehyde prepared in 0.1M phosphate buffer (pH 7.4) and the brains were dissected out, immersed in the same fixative for overnight at 4\u0026ordm;C (post fixation); thereafter the tissue was processed with graded sucrose solutions (15%, 30%, 30%; prepared in Tris buffered saline) keeping it at 4\u0026deg;C. The tissue blocks were prepared by embedding the brain in O.C.T. compound submerged in isopentane at a sub-zero temperature. The blocks were stored at -20\u0026ordm;/-80\u0026ordm; C for long term use. The hippocampus sections of 25\u0026micro;m thickness were cut for the immunostaining and the section area was marked using PAP pen which provides a thin-film like hydrophobic barrier around the section. The sections were washed thrice with PBS followed by incubation in permeabilization buffer containing 0.2% Triton X-100 for 10 min. The sections were then blocked using 1% BSA, prepared in PBST and left for 1h at room temperature in humified chamber. The slides were then incubated with the Primary Antibody (FoxO3a; 1:200 dilution; PGC1α, 1;100 dilution) in 1% BSA solution prepared in PBST and was kept at 4\u0026deg;C overnight in the humid chamber. The slides, after primary incubation, were washed with PBS and thereafter sections were incubated with alexa fluor tagged secondary antibody suitably diluted in 1% BSA/PBST solution for 1h at room temperature in humid chamber. The sections were counter stained with DAPI (1\u0026micro;g/ml) for 15min at room temperature. Excess of DAPI was removed by PBS washing. Finally, the sections were mounted in DABCO and were observed and photographed under the light microscope (Olympus BX63). The image analysis was done with ImageJ software on a sample of 6 randomly selected images of hippocampus areas from 6 rat brains.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data have been presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and were analyzed using one-way Anova and Tukey's as post hoc test analysis to find out the level of significance between Control \u003cem\u003eVs\u003c/em\u003e MoHE \u0026amp; MoHE \u003cem\u003eVs\u003c/em\u003e MoHE\u0026thinsp;+\u0026thinsp;HKL. The probability of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was taken as significant difference between the two groups, where n\u0026thinsp;=\u0026thinsp;6.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eHKL dependent modulation of MnSOD: activity and acetylation status\u003c/h2\u003e \u003cp\u003eOur previous report demonstrates that HKL could normalize the MoHE pathogenesis associated enhanced ROS level in the hippocampus mitochondria mainly by activating mitochondrial SIRT3 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. To delineate whether HKL does so by modulating Mn-SOD, the mitochondrial isoform committed to neutralize O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e radical, the activity and acetylation status of this enzyme was studied in the hippocampus mitochondrial fraction from the control, the MoHE and the MoHE rats treated with HKL. The findings of Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea \u0026amp; b indicate that there is a significant decline in the activity (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) as well as in the active level (measured through native PAGE; p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) of MnSOD in the hippocampus mitochondria of MoHE rats in comparison to the control counterparts. However, treatment of MoHE rats with honokiol, could recover the activity of MnSOD (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), analyzed on both the parameters. Further, to ascertain the role of HKL dependent SIRT3 activation, the level of acetylated Mn-SOD was studied in all the three sets. It is evident that there was a significant increase in the level of acetylated MnSOD (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in the hippocampus mitochondria from the MoHE rats as compared to the control rats, whereas the level of acetylated MnSOD was observed to be significantly lowered (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in case of the MoHE rats treated with honokiol (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec) thereby suggesting more deacetylation of this enzyme due to the HKL treatment and thus indicating a role of SIRT3 activation in normalizing Mn-SOD activity in the HKL treated MoHE rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch2\u003eModulation Of Mnsod Expression Due To Hkl Treatment\u003c/h2\u003e\n\u003cp\u003eAs presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u0026amp;b, the expression of MnSOD at protein and mRNA level is observed to be declined significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in the hippocampus of MoHE rats as compared to the control rats. However, the expression of MnSOD was found to be activated (attaining even more than normal level) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in case of the honokiol treated MoHE rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch2\u003eHkl Dependent Expression Of Foxo3a And Pgc1α\u003c/h2\u003e\n\u003cp\u003eFoxO3a are winged helix structures which binds to DNA and upregulates transcription of MnSOD. FoxO3a is dependent upon PGC-1α to regulate antioxidant genes. Also, PGC1α is a known regulator of mitochondrial functions as well. Therefore, to understand the mechanism of HKL dependent over expression of MnSOD in the hippocampus of the MoHE rats, Foxo3a and PGC-1α levels were monitored in the hippocampus of the control and both the experimental groups. As presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea \u0026amp; b, it was observed that the transcript levels of both, foxo3a and pgc1α were sharply declined in the hippocampus of MoHE rats as compared to control rats. However, the mRNA of both these factors were found to be significantly enhanced (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in response to HKL treatment to MoHE rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to ascertain protein level expression pattern, both these factors were also analyzed by immunofluorescence based detection of Fox03a and PGC1α in the three main hippocampus reagions; DG, CA3 and CA1.\u003c/p\u003e \u003cp\u003eAccording to Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea\u0026amp;b, most of the cells in the hippocampus DG region from the control rats showed a uniform distribution and intensity of FoxO3a and PGC1α signals. However, signals for both these factors were found to be declined significantly in case of the MoHE rats. Nonetheless, after HKL treatment to the MoHE rats, immunoreactive signals for both; Foxo3a \u0026amp; PGC1α (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea \u0026amp;b) were found to be recovered back near to the control level in the DG region. The signal intensity, analyzed through the image J software, also matched well with the pattern of immunosignals seen for both the proteins in the hippocampus from control, the MoHE and the MoHE rats treated with HKL (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFollowing a similar trend, the relative immunofluorescence intensity of anti FoxO3a and anti PGC1α, in CA1 region of hippocampus of MoHE rats was observed to be reduced with respect to the control rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea \u0026amp;b). However, honokiol treatment of MoHE rats was found to restore the immunoreactivity for FoxO3a and PGC1α in CA1 hippocampus region of the MoHE rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The quantitative analysis also showed a similar pattern of signal intensities between the control, the MoHE and the HKL treated MoHE rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilarly, the FoxO3a and PGC1α immunoreactivity in CA3 region, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea\u0026amp;b, we observed significantly reduced immunoreactivity of FoxO3a and PGC1α in the CA3 region of hippocampus of the MoHE rats, as compared to the control plates. However, there was a discernable increase in FoxO3a and PGC1α immune signal following HKL treatment to MoHE rats. A similar pattern was obtained when immunofluroresence intensity was recorded quantitatively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec). This shows that the SIRT3 activator, honokiol is able to enhance the expression level of transcriptional regulators of MnSOD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs mitochondria is the site of oxidative phosphorylation, it is likely to produce high amount of O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e radicals and thereby making this organelle the most susceptible one to undergo ROS led dysfunctions in the high energy demanding brain cells in particular. Thus, oxidative stress induced mitochondrial dysfunction is now considered the most common neurochemical aberration associated with the pathogenesis of many brain disorders. The neurotoxic effect of ammonia in CNS, symptomized mainly by the HE associated neuropsychiatric complications, is also argued to implicate enhanced mitochondrial ROS load mainly due to declined levels of antioxidant enzymes like; SOD, catalase etc. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The mitochondrial MnSOD is considered the committed enzyme to neutralize O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e radical and therefore, the declined level of this antioxidant enzyme has been reported associated with the pathogenesis of many brain disorders like AD, PD, ALS [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Consequently, by using knocked in experimental models, many workers have tried to manipulate the expression level MnSOD to prevent neurodegeneration in different neuropathology models [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, to qualify Mn-SOD as a doable therapeutic target, there is need to define protein level reversible modification vs activity changes and the mechanism by which its expression is regulated during a neuropathogenesis.\u003c/p\u003e \u003cp\u003eThere are reports suggesting activation of MnSOD by a number of compounds [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], however, the mode of action of most of them remain unexplained. In this respect, particularly in mitochondria, there is an evolving concept of activating this enzyme by a mitochondrial SIRT3 dependent deacetylation resulting into better cell survival [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In case of the animal model of neurodegenerative brain disorders, such examples are limited. Moreover, in western diet fed SIRT3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice model, an increased MnSOD acetylation could be correlated with the diminished activity of this enzyme [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. We have recently reported a cause-and-effect relationship between SIRT3 activation by a natural compound honokiol (HKL) and recovery in the compromised mitochondrial functions in hippocampus of the MoHE rats [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In this respect, the findings of Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e(a-c) clearly demonstrate another cause - effect relationship between activation of Mn-SOD vs deacetylation of this enzyme due to the treatment with HKL. Though fragmentary but there are some reports on SIRT3 dependent deacetylation of certain ETS enzymes vis a vis normalizing the declined levels of those enzymes [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, such reports are scanty in case of deacetylation of Mn-SOD vs recovery in ROS led mitochondrial dysfunction. Our previous report has demonstrated a correlation between the enhanced ROS level led compromised mPTP, declined ETS activity and redox ratio in the hippocampal mitochondria from the MoHE rats. However, all these parameters could be recovered back to the normal level due to SIRT3 activation by HKL [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Herein, the finding of significantly declined level of the acetylated Mn-SOD (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec) due to HKL treatment to the MoHE rats provides evidence to advocate Mn-SOD as another protein target of SIRT3 activation. Thus, suggesting about mechanistic aspect of how HKL could normalize ROS challenges in the hippocampal mitochondria of the MoHE rats. Additionally, this is a first report on HKL dependent alterations in the acetylation status MnSOD vs a similar pattern of its activity changes in mitochondria of a susceptible brain region of an MoHE animal model of excitotoxicity. The argument gets support from a report describing association of SIRT3 deletion with the enhanced acetylation led decreased activity of MnSOD which was found accountable for the increasing oxidative stress and decline of MPTP in an age-related loss of substantia nigra (SNc) dopaminergic neurons of the PD mouse model [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. A recent report in metal toxicity model has also shown that fluoride reduced mitochondrial antioxidant enzyme activities and elevated SOD2 acetylation by downregulating SIRT3 expression in the brain of mice and in the SH-SY5Y cells [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnother mechanism advocated accountable for maintaining MnSOD level in the brain cells is the regulation of its expression during pathogenesis and treatment. According to the findings from Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, a recovery in the MoHE associated declined expression of MnSOD, both at transcript and at protein levels, due to the treatment with HKL, clearly suggest about a significant role of HKL in the regulation of MnSOD expression in the hippocampus mitochondria. There are some reports, though on other neurodegenerative models, describing recovery in the Mn-SOD expression vis a vis normalization of the disease pathogenesis. In a Diabetic neuropathic pain (DNP) model in rats, upregulation of MnSOD in the spinal dorsal horn could be correlated with the pain reduction [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Another study suggests that a trans sodium crocetinate (TSC) could exert protection against cerebral ischemia/reperfusion (I/R) injury by increasing SOD2 protein levels and decreasing its acetylation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. However, to our knowledge, there is a little information on the HKL dependent modulation of Mn-SOD expression in an excitotoxic brain disorder condition. Therefore, our finding of Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e necessitated investigation of how HKL could modulate expression of MnSOD expression in the hippocampus of the MoHE rats.\u003c/p\u003e \u003cp\u003eIn most of the reports describing modulation of the expression of antioxidant enzymes, under the condition of physiological stresses, by a number of modulators, it was observed that in case of MnSOD, there appears concordant interplay of SIRT3-FoXO3a-PGC1α axis in transactivating this mitochondrial isoform of SOD. It has been suggested that FoxO3a forms a feedback loop with PGC1α to regulate antioxidant genes and SIRT3 dependent deacetylation of these transcription factors has been argued as one of the mechanisms to regulate their expression and nuclear translocation to ultimately activate the ARE (the antioxidant response element) of the antioxidant enzymes genes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Independently also, PGC1α is known to regulate mitochondrial function by stimulating antioxidant enzymes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Also, the PGC1α is reported to trigger SIRT3 expression which by deacetylating MnSOD, normalizes the increased mitochondrial ROS [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn view of our previous report, describing HKL dependent recovery in SIRT3 activity in the hippocampal mitochondria of the MoHE rats, it is argued that SIRT3 activation could be accountable for not only deacetylating Mn-SOD (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec) but also for the modulation of FoxO3a-PGC1a axis as well. Indeed, we observed a remarkable increase in the transcript levels of both, the Foxo3a and PGC1α, in the hippocampal fraction of the MoHE rats treated with HKL (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Importantly, such a pattern of the enhanced expression of both these critical factors was consistent with a similar recovery in the abundance of both these proteins in all the three major regions of hippocampus; DG, CA1 \u0026amp; CA3, accountable for memory formation and consolidation, in the HKL treated MoHE rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e \u0026amp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHKL is known to display strong anti-inflammatory and antioxidant properties in a variety of diseases including certain neuropathology as well. However, the mechanism by which it imparts its neuroprotective action remains largely unexplored. During recent past, SIRT3 is emerging as a master regulator of mitochondrial integrity and HKL is suggested as an activator of SIRT3 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Therefore, in the present context, it is argued that HKL dependent SIRT3 activation could be accountable to upregulate Mn-SOD mainly by modulating the levels of Foxo3a and PGC1α in the hippocampus of the MoHE rats. This is supported, though indirectly, by the similar findings on the multimodal modulations of SIRT3-FoxO3a-PGC1α axis including SIRT3 dependent deacetylation of both the transcription factors due to the treatment with various other compounds.\u003c/p\u003e \u003cp\u003eFor example, Chronic fluoride exposure has been found to induce mitochondrial dysfunction through inhibition of Sirt3/FoxO3a signaling in the SH-SY5Y cell lines [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The overexpression of spinal cord SIRT3 in DNP rat model has been demonstrated to increase the expression and deacetylation of FoxO3a to ultimately upregulate MnSOD [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Another study suggests that neuroprotective effect of trans sodium crocetinate (TSC) against cerebral ischemia/reperfusion (I/R) injury is mediated via increasing SIRT3 activity vs decreased acetylation of Foxo3a and SOD2 [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. SIRT3 dependent increased expression and nuclear translocation of FoxO3a have also been reported accountable to transactivate antioxidant enzymes like SOD in the activated microglia of the adult rats subjected to the traumatic brain injury [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Similarly, PGC-1α, is a multifunctional critical regulator of various cellular functions including mitochondrial quality by suppressing oxidative damage [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Importantly, FoxO3a has been found to protect cells from oxidative stress through direct interaction with PGC-1α in the promoter regions of the antioxidant enzymes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In MPTP PD model, PGC1a-ERRα/SIRT3 pathway has been demonstrated to play critical roles in protecting DAergic neurons against oxidative damage and ATP depletion mainly by deacetylating SOD2 and ATP synthase β [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Also, PGC-1α expression is reported to decline in the AD brain as a function of dementia severity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Taking together, SIRT3-Foxo3a-PGC1a axis act as a master regulator of maintaining the levels of the antioxidant enzymes and the mitochondrial Mn-SOD, in particular, however, evidently this axis seems to be a modifiable target in many ways and therefore, deserve special merit to be categorized as a targetable hot spot in neurological disorders.\u003c/p\u003e \u003cp\u003eThere is no previous report on HKL dependent modulation of SIRT3-Foxo3a-PGC1a loop in modulating the antioxidant potential of the brain cells in a neurological disorder. Thus, our findings of Fig-3-6 are first of its kind to provide HKL dependent positive modulation of this axis that could be involved in normalizing ROS challenge emerged during MoHE pathogenesis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eROS insult lies at the heart of mitochondrial dysfunction which serves as a central point of many neuropathology. The pathogenesis of ammonia neurotoxicity, in general and in the animal model of MoHE in particular, has also been described associated with the enhanced mitochondrial ROS load which could be demonstrated to be normalized due to SIRT3 activation by HKL [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This article describes that HKL does so by deacetylating mitochondrial MnSOD and by recovering its expression level mainly due to HKL dependent increased expression of the constitutive type transcription factors; Foxo3a and PGC1a, of the antioxidant enzymes, in the hippocampus (the most susceptible brain regions to undergo neuroarchitectural aberrations) of the MoHE rats [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Thus, HKL is evident to counteract mitochondrial ROS challenge during MoHE pathogenesis by altering SIRT3 dependent acetylation status of MnSOD and by modulating Foxo3a-PGC1a axis to enhance expression of this antioxidant enzyme.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration:\u0026nbsp;\u003c/strong\u003eThis work was financially supported by a Govt of India DST-SERB project (EMR/2016/006501) to SKT. Anamika acknowledges the award of BHU fellowship, UGC CAS JRF and CSIR SRF.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be interpreted as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Declaration:\u0026nbsp;\u003c/strong\u003eThe authors declare that the research was conducted in the absence of any commercial \u0026nbsp;or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest Declaration :\u0026nbsp;\u003c/strong\u003eThe authors declare no conflict of interest. \u003cem\u003eThe authors have no\u0026nbsp;\u003c/em\u003e\u003cem\u003erelevant financial or non-financial interests to disclose\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval:\u003c/strong\u003e \u003cem\u003eThis study was performed in line with the principles of\u0026nbsp;\u003c/em\u003ethe institutional animal ethical committee for the care and use of laboratory animals. \u003cem\u003eApproval was granted by the Ethics Committee of University\u003c/em\u003e (F.Sc/IAEC/2016-17/233).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate:\u0026nbsp;\u003c/strong\u003eNot applicable (study does not involve human subjects)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish:\u0026nbsp;\u003c/strong\u003eNot applicable (study does not involve human subjects)\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003e\u003c/em\u003e\u003cem\u003eThe data sets generated during and/or analysed during the current study are not publicly available but are available from the corresponding author on reasonable request.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e: Author SK Trigun and Anamika declare that they have no\u0026nbsp;relevant financial or non-financial interests to disclose\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was financially supported by a Govt of India DST-SERB project (EMR/2016/006501) to SKT. Anamika received the BHU fellowship, UGC CAS JRF and CSIR SRF during this research work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003eBoth authors contributed in concept design of the experiments. Anamika performed the experiments, collected and analysed the data. \u0026nbsp; First manuscript draft was constructed by Anamika. Surendra Kumar Trigun contributed in developing this project, data analysis and manuscript correction. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment:\u0026nbsp;\u003c/strong\u003eThis work was financially supported by a Govt of India DST-SERB project (EMR/2016/006501) to SKT. Anamika acknowledges the award of BHU fellowship, UGC CAS JRF and CSIR SRF. The instrumental facilities provided by BHU-DBT ISLS and DST-FIST in Department of Zoology are also acknowledged.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s Information:\u0026nbsp;\u003c/strong\u003eSurendra K Trigun, Professor in BHU, is the Principal Investigator of this research work under a DST project, referred above, granted to him. Anamika has worked as JRF and SRF to carry out experiments under the supervision of SKT. \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFelipo V, Urios A, Montesinos E, Molina I, Garcia-Torres ML, Civera M, Montoliu C (2012) Contribution of hyperammonemia and inflammatory factors to cognitive impairment in minimal hepatic encephalopathy. Metab Brain Dis 27(1):51\u0026ndash;58. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11011-011-9269-3\u003c/span\u003e\u003cspan address=\"10.1007/s11011-011-9269-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayakumar AR, Rama Rao KV, Schousboe A, Norenberg MD (2004) Glutamine-induced free radical production in cultured astrocytes. Glia 46(3):296\u0026ndash;301. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/glia.20003\u003c/span\u003e\u003cspan address=\"10.1002/glia.20003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai G, Rama Rao KV, Murthy CR, Panickar KS, Jayakumar AR, Norenberg MD (2001) Ammonia induces the mitochondrial permeability transition in primary cultures of rat astrocytes. J Neurosci Res 66(5):981\u0026ndash;991. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jnr.10056\u003c/span\u003e\u003cspan address=\"10.1002/jnr.10056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai Y, Wang S, Wu F, Xie X, Wang Y, Yang Y (2019) The changes of mitochondria in substantia nigra and anterior cerebral cortex of hepatic encephalopathy induced by thioacetamide. Anat Rec 302(7):1169\u0026ndash;1177. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ar.23932\u003c/span\u003e\u003cspan address=\"10.1002/ar.23932\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuazzelli, P. A., Cittolin-Santos, G. F., Meira-Martins, L. A., Grings, M., Nonose,Y., Lazzarotto, G. S., \u0026hellip; de Assis, A. M. (2020). Acute liver failure induces glial reactivity, oxidative stress and impairs brain energy metabolism in rats. Front. Cell.Neurosci., 327. doi: 10.3389/fnmol.2019.00327\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAngelova PR, Abramov AY (2018) Role of mitochondrial ROS in the brain: from physiology to neurodegeneration. FEBS Lett 592(5):692\u0026ndash;702. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/1873-3468.12964\u003c/span\u003e\u003cspan address=\"10.1002/1873-3468.12964\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlynn JM, Melov S (2013) SOD2 in mitochondrial dysfunction and neurodegeneration. Free Radic Biol Med 62:4\u0026ndash;12. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.freeradbiomed.2013.05.027\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2013.05.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBresciani G, da Cruz IBM, Gonz\u0026aacute;lez-Gallego J (2015) Manganese superoxide dismutase and oxidative stress modulation. Adv Clin Chem 68:87\u0026ndash;130. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/bs.acc.2014.11.001\u003c/span\u003e\u003cspan address=\"10.1016/bs.acc.2014.11.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhatti JS, Bhatti GK, Reddy PH (2017) Mitochondrial dysfunction and oxidative stress in metabolic disorders\u0026mdash;A step towards mitochondria based therapeutic strategies. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 1863:1066\u0026ndash;1077. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbadis.2016.11.010\u003c/span\u003e\u003cspan address=\"10.1016/j.bbadis.2016.11.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh S, Trigun SK (2010) Activation of neuronal nitric oxide synthase in cerebellum of chronic hepatic encephalopathy rats is associated with up-regulation of NADPH-producing pathway. Cerebellum 9(3):384\u0026ndash;397. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12311-010-0172-y\u003c/span\u003e\u003cspan address=\"10.1007/s12311-010-0172-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh S, Trigun SK (2014) Low grade cirrhosis induces cognitive impairment and motor dysfunction in rats: Could be a model for minimal hepatic encephalopathy. Neurosci Lett 559:136\u0026ndash;140. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neulet.2013.11.058\u003c/span\u003e\u003cspan address=\"10.1016/j.neulet.2013.11.058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhanna A, Anamika CS, Tripathi SJ, Acharjee A, Rao S, Trigun SK (2020) SIRT1 activation by resveratrol reverses atrophy of apical dendrites of hippocampal CA1 pyramidal neurons and neurobehavioral impairments in moderate grade hepatic encephalopathy rats. J Chem Neuroanat 106:101797. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jchemneu.2020.101797\u003c/span\u003e\u003cspan address=\"10.1016/j.jchemneu.2020.101797\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaddell J, Banerjee A, Kristian T (2021) Acetylation in Mitochondria Dynamics and Neurodegeneration. Cells 10(11):3031. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells10113031\u003c/span\u003e\u003cspan address=\"10.3390/cells10113031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng H, Yan WY, Lei YH, Wan Z, Hou YY, Sun LK, Zhou JP (2019) SIRT3 regulation of mitochondrial quality control in neurodegenerative diseases. Front. Aging Neurosci., 313. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnagi.2019.00313\u003c/span\u003e\u003cspan address=\"10.3389/fnagi.2019.00313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos SS, Moreira JB, Costa M, Rodrigues RS, Sebasti\u0026atilde;o AM, Xapelli S, Sol\u0026aacute; S (2021) The Mitochondrial Antioxidant Sirtuin3 Cooperates with Lipid Metabolism to Safeguard Neurogenesis in Aging and Depression. Cells 11(1):90. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells11010090\u003c/span\u003e\u003cspan address=\"10.3390/cells11010090\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRangarajan P, Karthikeyan A, Lu J, Ling EA, Dheen ST (2015) Sirtuin 3 regulates Foxo3a-mediated antioxidant pathway in microglia. Neurosci 311:398\u0026ndash;414. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuroscience.2015.10.048\u003c/span\u003e\u003cspan address=\"10.1016/j.neuroscience.2015.10.048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnsari A, Rahman MS, Saha SK, Saikot FK, Deep A, Kim KH (2017) Function of the SIRT 3 mitochondrial deacetylase in cellular physiology, cancer, and neurodegenerative disease. Aging Cell 16(1):4\u0026ndash;16. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/acel.12538\u003c/span\u003e\u003cspan address=\"10.1111/acel.12538\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKops G. J., Dansen T. B., Polderman P. E., Saarloos I., Wirtz K. W., Coffer P. J.,\u0026hellip; Burgering B. M. (2002). Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nat, 419(6904), 316\u0026ndash;321. doi: 10.1038/nature01036\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlmos Y, Valle I, Borniquel S, Tierrez A, Soria E, Lamas S, Monsalve M (2009) Mutual dependence of Foxo3a and PGC-1α in the induction of oxidative stress genes. J Biol Chem 284(21):14476\u0026ndash;14484. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M807397200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M807397200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X., Ren X., Zhang Q., Li Z., Ma S., Bao J., \u0026hellip; Ji J. (2016). PGC-1α/ERRα-Sirt3 pathway regulates DAergic neuronal death by directly deacetylating SOD2 and ATP synthase β. Antioxid. Redox Signal., 24(6), 312\u0026ndash;328. doi: 10.1089/ars.2015.6403\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng A., Yang Y., Zhou Y., Maharana C., Lu D., Peng W., \u0026hellip; Mattson M. P. (2016). Mitochondrial SIRT3 mediates adaptive responses of neurons to exercise and metabolic and excitatory challenges. Cell Metab, 23(1), 128\u0026ndash;142. doi: 10.1016/j.cmet.2015.10.013\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Dong X, Wang C (2018) Honokiol ameliorates amyloidosis and neuroinflammation and improves cognitive impairment in Alzheimer\u0026rsquo;s disease transgenic mice. J Pharmacol Exp Ther 366(3):470\u0026ndash;478. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1124/jpet.118.248674\u003c/span\u003e\u003cspan address=\"10.1124/jpet.118.248674\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTyagi A., Nguyen C. U., Chong T., Michel C. R., Fritz K. S., Reisdorph N., \u0026hellip; Pugazhenthi S. (2018). SIRT3 deficiency-induced mitochondrial dysfunction and inflammasome formation in the brain. Sci. Rep., 8(1), 1\u0026ndash;16. doi: 10.1038/s41598-018-35890-7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzden O, Park SH, Kim HS, Jiang H, Coleman MC, Spitz DR, Gius D (2011) Acetylation of MnSOD directs enzymatic activity responding to cellular nutrient status or oxidative stress. Aging 3(2):102. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/aging.100291\u003c/span\u003e\u003cspan address=\"10.18632/aging.100291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePillai V. B., Samant S., Sundaresan N. R., Raghuraman H., Kim G., Bonner M. Y., \u0026hellip;Gupta M. P. (2015). Honokiol blocks and reverses cardiac hypertrophy in mice by activating mitochondrial Sirt3. Nat. Commun., 6(1), 1\u0026ndash;16. doi: 10.1038/ncomms7656\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePillai VB, Kanwal A, Fang YH, Sharp WW, Samant S, Arbiser J, Gupta MP (2018) Honokiol, an activator of Sirtuin-3 (SIRT3) preserves mitochondria and protects the heart from doxorubicin-induced cardiomyopathy in mice. Oncotarget 8(21):34082. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.16133\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.16133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoodbury A, Yu SP, Wei L, Garc\u0026iacute;a P (2013) Neuro-modulating effects of honokiol: a review. Front Neurol 4:130. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fneur.2013.00130\u003c/span\u003e\u003cspan address=\"10.3389/fneur.2013.00130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X., Duan X., Yang G., Zhang X., Deng L., Zheng H., \u0026hellip; Chen L. (2011). Honokiol crosses BBB and BCSFB, and inhibits brain tumor growth in rat 9L intracerebral gliosarcoma model and human U251 xenograft glioma model. PLoS One, 6(4), e18490. doi: 10.1371/journal.pone.0018490\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnamika, Trigun SK (2021) Sirtuin-3 activation by honokiol restores mitochondrial dysfunction in the hippocampus of the hepatic encephalopathy rat model of ammonia neurotoxicity. J Biochem Mol Toxicol e22735. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jbt.22735\u003c/span\u003e\u003cspan address=\"10.1002/jbt.22735\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhanna A, Trigun SK (2016) Resveratrol normalizes hyperammonemia induced pro-inflammatory and pro-apoptotic conditions in rat brain. Int J Complement Altern Med 4(2):00115. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15406/ijcam.2016.04.00115\u003c/span\u003e\u003cspan address=\"10.15406/ijcam.2016.04.00115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265\u0026ndash;275\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeauchamp C, Fridovich I (1971) Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal Biochem 44(1):276\u0026ndash;287. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0003-2697(71)90370-8\u003c/span\u003e\u003cspan address=\"10.1016/0003-2697(71)90370-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehrotra A, Trigun SK (2013) Moderate grade hyperammonemia activates lactate dehydrogenase-4 and 6-phosphofructo-2-kinase to support increased lactate turnover in the brain slices. Mol Cell Biochem 381(1):157\u0026ndash;161. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11010-013-1698-3\u003c/span\u003e\u003cspan address=\"10.1007/s11010-013-1698-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFelipo V (2009) Hyperammonemia. In Handbook of neurochemistry and molecular neurobiology. US Springer, pp.\u0026nbsp;43\u0026ndash;69. doi.: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-0-387-30375- 8_3\u003c/span\u003e\u003cspan address=\"10.1007/978-0-387-30375- 8_3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeidari R (2019) Brain mitochondria as potential therapeutic targets for managing hepatic encephalopathy. Life Sci 218:65\u0026ndash;80. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2018.12.030\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2018.12.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiriyala S, Spasojevic I, Tovmasyan A, Salvemini D, Vujaskovic Z, Clair DS, Batinic-Haberle I (2012) Manganese superoxide dismutase, MnSOD and its mimics. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 1822:794\u0026ndash;814. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbadis.2011.12.002\u003c/span\u003e\u003cspan address=\"10.1016/j.bbadis.2011.12.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaigis MC, Deng CX, Finley LW, Kim HS, Giux D (2012) SIRT3 is a mitochondrial tumor spressor: A scientific tale that connects aberrant cellular ROS, the Warburg effect and carcinogenesis. Cancer res 72:268\u0026ndash;272. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.doi:.org/10.1158/0008-5472\u003c/span\u003e\u003cspan address=\".doi:.10.1158/0008-5472\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.. CAN-11-3633\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi H, Deng HX, Gius D, Schumacker PT, Surmeier DJ, Ma YC (2017) Sirt3 protects dopaminergic neurons from mitochondrial oxidative stress. Hum Mol Genet 26(10):1915\u0026ndash;1926. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/ddx100\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddx100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Cao L, Pan S, Wang G, Wang L, Cao N, Hao X (2021) Sirt3-mediated mitochondrial dysfunction is involved in fluoride-induced cognitive deficits. Food Chem Toxicol 158:112665. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fct.2021.112665\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2021.112665\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou C, Zhang Y, Jiao X, Wang G, Wang R, Wu Y (2021) SIRT3 alleviates neuropathic pain by deacetylating FoxO3a in the spinal dorsal horn of diabetic model rats. Reg Anesth Pain Med 46(1):49\u0026ndash;56. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/rapm-2020-101918\u003c/span\u003e\u003cspan address=\"10.1136/rapm-2020-101918\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang G, Chen Y, Zhang H, Zhou W (2019) Trans sodium crocetinate alleviates ischemia/reperfusion induced myocardial oxidative stress and apoptosis via the SIRT3/FOXO3a/SOD2 signaling pathway. Int Immunopharmacol 71:361\u0026ndash;371. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2019.03.056\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2019.03.056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWenz T (2013) Regulation of mitochondrial biogenesis and PGC-1α under cellular stress. Mitochondrion 13(2):134\u0026ndash;142. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mito.2013.01.006\u003c/span\u003e\u003cspan address=\"10.1016/j.mito.2013.01.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRius-P\u0026eacute;rez S, Torres-Cuevas I, Mill\u0026aacute;n I, Ortega \u0026Aacute;L, P\u0026eacute;rez S (2020) PGC-1α, inflammation, and oxidative stress: an integrative view in metabolism. Oxid. Med. Cell. Longev., 2020. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2020/1452696\u003c/span\u003e\u003cspan address=\"10.1155/2020/1452696\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin W, Haroutunian V, Katsel P, Cardozo CP, Ho L, Buxbaum JD, Pasinetti GM (2009) PGC-1α expression decreases in the Alzheimer disease brain as a function of dementia. Arch Neurol 66(3):352\u0026ndash;361. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1001/archneurol.2008.588\u003c/span\u003e\u003cspan address=\"10.1001/archneurol.2008.588\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Ammonia neurotoxicity, Hepatic encephalopathy, hippocampus, Mn-SOD, mitochondrial SIRT3, FOXO3a/PGC1α ","lastPublishedDoi":"10.21203/rs.3.rs-1518187/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1518187/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWe have recently reported that honokiol (HKL), by activating mitochondrial SIRT3, restored ROS led deranged mitochondrial integrity associated with the pathogenesis of ammonia neurotoxicity induced moderate grade hepatic encephalopathy (MoHE). To delineate mechanism by which HKL does so, the present study describes activity vs acetylation level of the mitochondrial MnSOD and its expression vs levels of its main transcription regulators; FOXO3a, PGC1α, in the hippocampus of the MoHE rat model of ammonia neurotoxicity, developed by administration of 100 mg/kg bw of thioacetamide i.p. for 10 days, and in the MoHE rats treated with HKL (10 mg/Kg b.w.) for 7 days. As compared to the control, the hippocampus mitochondria from MoHE rats showed a significantly declined activity of MnSOD coinciding with the increased level of its acetylated form which however, could be restored back due the HKL treatment.\u0026nbsp;Also, a significantly reduced expression of MnSOD in the hippocampus of those MoHE rats coincided with a similar decline in transcript level of FOXO3a and PGC1α. This was consistent with the reduced immunoreactivity of FOXO3a and PGC1α in the hippocampus DG, CA1 and CA3 regions of the MoHE rats. However, all these factors were observed to be restored back to their normal levels in the hippocampus of the MoHE rats treated with HKL. As HKL activates mitochondrial SIRT3, these findings suggest involvement of Sirt3 activation led deacetylation of MnSOD and upregulation of its transcription activators; FOXO3a and PGC1α in activating mitochondrial MnSOD in the hippocampus of the MoHE rat model of ammonia neurotoxicity.\u0026nbsp;\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Honokiol, a SIRT3 activator, activates hippocampus mitochondrial MnSOD by deacetylating the enzyme and upregulating FoxO3a-PGC1α axis in a rat model of ammonia neurotoxicity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-04-15 20:29:24","doi":"10.21203/rs.3.rs-1518187/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cfb33058-6905-4f8d-95cd-d0617f296ce9","owner":[],"postedDate":"April 15th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-05-12T20:24:21+00:00","versionOfRecord":[],"versionCreatedAt":"2022-04-15 20:29:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1518187","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1518187","identity":"rs-1518187","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}