Serum miR-155, miR-223, miR-17, miR-200a, miR-205, Interleukin 6, and Prostaglandins as Novel Diagnostic Markers for Endometritis in Arabian Mares

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background: So far the intimate link between serum microRNA (miRNA) and uterine inflammation in mares is unknown. We aimed (I) to investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 (II) and to measure the concentrations of interleukin 6 (IL-6), and prostaglandins (PGF2α& PGE2) in serum of Arabian mares with healthy and abnormal uterine status (endometritis).Methods and Results: This study was conducted on 80 Arabian mares; young (4-7 years), and old (8-14 years). These animals were divided into 48 sub-fertile including 16 young and 32 old mares suspected of endometritis and 32 fertile as control (24 young and 8 old) at stud farms. Serum samples were collected for measuring IL-6, PGF2α, and PGE2 concentrations, as well as serum miRNA isolation and qRT-PCR. Serum concentrations of IL-6, PGE2, and PGF2α were higher (P≤0.001) in mares with endometritis (young and old) compared to the control ones. Age of mares had a remarkable effect(0.001≤P≤0.01) onIL-6, PGE2, and PGF2αconcentrations. The relative abundance of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 was higher (P≤0.001) in both young and old mares with endometritis. We noticed that eca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 revealed higher (0.001≤P≤0.01) expression level in old than young mares with endometritis. Conclusions: To the best of our knowledge, this is the first study revealed that serum miRNA and serum inflammatory mediators (IL-6, PGE2, and PGF2α) could be used as non-invasive gold standard biomarkers, and therefore might be served as an important additional diagnostic tool for endometritis in Arabian mares.
Full text 86,268 characters · extracted from preprint-html · click to expand
Serum miR-155, miR-223, miR-17, miR-200a, miR-205, Interleukin 6, and Prostaglandins as Novel Diagnostic Markers for Endometritis in Arabian Mares | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Serum miR-155, miR-223, miR-17, miR-200a, miR-205, Interleukin 6, and Prostaglandins as Novel Diagnostic Markers for Endometritis in Arabian Mares Sally Ibrahim, Mohamed Hedia, Mohamed O. Taqi, Mohamed K. Derbala, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-235385/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: So far the intimate link between serum microRNA (miRNA) and uterine inflammation in mares is unknown. We aimed (I) to investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 (II) and to measure the concentrations of interleukin 6 (IL-6), and prostaglandins (PGF 2α & PGE 2 ) in serum of Arabian mares with healthy and abnormal uterine status (endometritis). Methods and Results: This study was conducted on 80 Arabian mares; young (4-7 years), and old (8-14 years). These animals were divided into 48 sub-fertile including 16 young and 32 old mares suspected of endometritis and 32 fertile as control (24 young and 8 old) at stud farms. Serum samples were collected for measuring IL-6, PGF 2α , and PGE 2 concentrations, as well as serum miRNA isolation and qRT-PCR. Serum concentrations of IL-6, PGE 2 , and PGF 2α were higher ( P ≤0.001) in mares with endometritis (young and old) compared to the control ones. Age of mares had a remarkable effect(0.001≤ P ≤0.01) onIL-6, PGE 2 , and PGF 2α concentrations. The relative abundance of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 was higher ( P ≤0.001) in both young and old mares with endometritis. We noticed that eca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 revealed higher (0.001≤ P ≤0.01) expression level in old than young mares with endometritis. Conclusions: To the best of our knowledge, this is the first study revealed that serum miRNA and serum inflammatory mediators (IL-6, PGE 2 , and PGF 2α ) could be used as non-invasive gold standard biomarkers, and therefore might be served as an important additional diagnostic tool for endometritis in Arabian mares. Molecular Biology Serum miRNA Mares Endometritis Interleukin6 Prostaglandins Age Figures Figure 1 Figure 2 Figure 3 Introduction For years, equine endometritis considers as the most important cause of infertility in horses [ 1 , 2 ]. Infectious endometritis is the first cause of equine subfertility and the third most common disease affecting horses[ 3 ]. Endometrial infections are directly responsible for decreasing conception rates and indirectly disrupt reproductive outcomes leading to early embryonic loss, abortion and delivery of intrauterine infected foals[ 4 ]. An inflammatory response against uterine pathogens is important to control and eliminate the uterine harmful infections, which seems to be the main cause of subfertility and failure of conception[ 2 ]. The initial defense mechanisms against endometrial pathogens are directly evoked as an inflammation, which will activate innate and humoral immune system in the mare [ 5 ]via series of cytokines and chemokines. Cytokines have an important role in a wide range of reproductive related processes. There are several types of cytokines, where each cytokine is responsible for multiple cellular tropism in an array of different organs and their response showed a different manner according to cell type[ 6 ]. Previous studies reported that the RNA gene expression of pro-inflammatory cytokines interleukin 6 (IL-6) and prostaglandins (PGF 2α and PGE 2 ) in the uterine tissue samples were associated with the development of endometritis in mares[ 7 , 8 ]. The proper clearance of excess sperm cells, microorganisms, seminal plasma, and other debris from lumen of uterine tissues is an essential step for qualifying uterine milieu for implantation after embryo arrival[ 2 ]. This step is a complex and influenced by the host's immune system as well as epigenetics regulation[ 9 ]. Nothing is known about the expression pattern of serum miRNA, and post-transcription regulation of inflammatory immune response genes in mares with endometritis. Recently in equine species, many studies revealed that serum miRNA could be used as non-invasive biomarkers either for normal physiological condition (early pregnancy) or disease condition (sarcoid disease)[ 10 , 11 ]. The miRNAis small non-coding RNA molecules that act as post-transcriptional regulators of gene expression by inhibiting translation or degrading mRNA through partial or complete base pairing with three prime untranslated region(3´-UTR) of the target mRNAs[ 12 ]. They are expressed in different cells and tissues, in order to regulate different mechanisms of developmental as well as physiological processes[ 10 , 13 ]. Furthermore, an extended inflammatory response due to aberrant miRNA expression is likely to impair fundamental cellular processes of the endometrium, affecting uterine receptivity, folliculogenesis, oocyte maturation and ovulation, finally leading to reduced fertility[ 14 , 15 ]. So far, the expression pattern of free serum miRNA is unknown during endometritis in equine species. We therefore hypothesize that identification and quantification of some candidates serum miRNA from mares with endometritis might serve as useful and implementable clinical biomarkers for early diagnosis of endometiritis. Moreover, any alteration in the endometrial health status might be accompanied with series of pathophysiological changes, which subsequently dysregulate expression pattern of serum miRNA as well as increase the serum levels of inflammatory biomarkers as IL-6, PGF 2α and PGE 2 .Thus, the current study aimed (I) to investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205, and (II) to measure the concentrations of IL-6, PGF 2α and PGE 2 , in serum of young and old aged Arabian mares with healthy and abnormal uterine status (endometritis). Material And Methods Chemicals All chemicals and reagents were obtained from Qiagen (Hilden, Germany), Thermo Fisher Scientific(Wilmington, USA), unless otherwise stated. Ethical approval for use of animals The present study was approved by the Ethical Use and Animal Care Committee of faculty of veterinary medicine, Cairo University. Animals and management This study was conducted on 80 Arabian mares; young (4–7 years), and old (8–14 years). These mares were divided into 48 sub-fertile mares {young (n = 16), old (n = 32)} suspected of endometritis (diseased group) and 32 fertile mares {control; young (n = 24), old (n = 8)} not suspected of endometritis that served as control group between November 2019 and April 2020 at a number of stud farms nearby Giza, Egypt. Uterine swabs and blood samples were collected only once from each mare after owner's permission. The selected mares experienced normal physical and vital signs where the normal range of vital signs including rectal body temperatures (37.5–38.5 ° C), heart rate (36–40 beats/min), respiratory rate (8–15 breaths/min), capillary refill times (1–2 sec) and a moist with a healthy pink color mucus membrane of the buccal cavity. An orthopedic examination was also performed to exclude mares with lameness or active laminitis. None of the mares had dystocia, retained fetal membranes or problems during puerperium. Additionally, none of the mares was in foaling heat. All animals were submitted to transrectal ultrasonographic (US) uterine examination using real-time B-mode machine (Esaote Mylab30- Netherlands) equipped with 5-7.5 MHz linear-array transducer. Blood and endometrial swabs sampling Blood samples were collected from the jugular vein into untreated vacutainer tubes and the tubes were maintained for 20 min at room temperature in an inclined position. The samples were subsequently centrifuged at 3000 ×g for 10 min (4 ° C) until clear serum was separated. Afterwards, serum was divided into two portions; 1st part was kept at – 20 ° C for measuring IL-6, PGF 2α and PGE 2 concentrations, and the 2nd part was kept at – 80 ° C for RNA isolation. Endometrial swabs were collected as described before[ 16 ] using a sterilized double guarded uterine swab (Minitub GmbH, Germany), Briefly, after removing the feaces, the tail was bandaged, and then vulva and perineum were cleaned with iodopovidine (Betadine, EGIS, Warsaw, Poland), rinsed three times with water, and dried with a paper towel. The tip of the swab was held and covered in the palm, and using a slight rotatory movement, the hand passed into the vagina till enabling palpation of the external cervical os, the index finger passed gently into the external cervical os followed by the uterine swab. After passing the cervical canal, the cotton swab pushed forward through the outer then the inner guards to be contacted with the endometrium then gently rotated for 10–15 seconds. Finally, the swab was retracted back inside the inner guard then into the outer guard and the swab directly immersed into commercial transportation media. Cytological examination After the collection of uterine smears, the cytological samples were fixed and stained with a special commercial cytological stain; Papanicolaou method (Biodiagnostic, Egypt) according to the instruction’s recommendation within two hours at the laboratory. Samples were evaluated in regard to quality of cell morphology, cellularity, number of inflammatory cells per 400× field, as well as any other remarkable features (Zeiss Axioskopmicroscobe, Carl Zeiss, Thornwood, NY)[ 17 ].Uterine samples were considered as marker for inflammation (endometritis) if the amount of PMNs was greater than 2% as described by Aguilar et al.[ 18 ], data not shown. Microbial culturing Immediately after immersing the uterine smears into the transportation media, samples were transported to the laboratory for further microbial analysis. Both bacterial and fungal culturing protocol were carried out to identify the pathologically infected mares showing endometritis according to the general guidelines[ 19 ], data not shown. Here in the current work, the criteria for mares to be enrolled in the diseased group (endometritis) were that they had been bred three or more times unsuccessfully in the breeding season, or had a history more than one year of reproductive failure. In addition, two or more of the following criteria on a checklist were present: abnormal clinical findings, US scanning showed abnormal fluid in the uterus (echogenic or ≥ 2 cm in diameter), positive endometrial cytology; and bacterial and/or fungal growth, as indicated by Amorim et al. [ 20 ]. Serum IL-6, PGF 2α and PGE 2 estimation Serum concentrations of IL-6 were determined by horse IL-6 ELISA kit (SunLong Biotech Co., LTD, Zhejiang, China) and as used according to the manufacturer’s instructions. The assay sensitivity and range were 0.5 pg/ml and 1.6 pg/ml to 100 pg/ml, respectively. For PGF 2α measurement, the commercial PGF 2α high sensitivity horse prostaglandin F 2 alpha ELISA kit (SunLong Biotech Co., LTD, Zhejiang, China) was used and run according to the manufacturer’s instructions. The assay sensitivity and range were 0.5 pg/ml and 3 pg/ml to 210 pg/ml. For PGE 2 measurements, the commercial PGE 2 high sensitivity horse prostaglandin E 2 ELISA kit (SunLong Biotech Co., LTD, Zhejiang, China) was used and run in accordance to the manufacturer’s instructions. The assay sensitivity and range were 0.1 pg/ml and 0.8 pg/ml to 50 pg/ml, respectively. In-silico analysis for the selected candidate miRNA The miRNA prediction tools such as: DIANA-microT v3.0 ( http://diana.cslab.ece.ntua.gr/microT/ ) and miRecords ( http://mirecords.biolead.org/ ) were used for filterations miRNAs hits according to their potential relevance for targeting inflammatory immune response in mammalian uterine tissue at least in four different search algorithms. We found that of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205could be selected as potential targets. Moreover, these targets were shown different expression pattern in response to inflammation[ 14 , 21 – 23 ]. Serum miRNA isolation, cDNA synthesis, and quantitative real-time PCR (qRT-PCR) For purification of cell-free miRNAs, we used a miRNeasy serum/plasma kit. 200 µl of thawed serum samples on ice were used for purification total RNA according to manufactures protocol. During purification steps, a 3.5 µl of lyophilized C. elegans miR-39 miRNA mimic (miRNeasy Serum/PlasmaSpike-In Control) were added, at concentration 1.6×10 8 copies/µl. In order to elute cell-free RNA, 14µl of RNase-free water was added to the center of the spin column membrane. Afterwards, the purified serum free total RNA was kept at -80 ° C.The concentration of total RNA was checked by Nano-drop 2000/c (Thermo Fisher Scientific, Wilmington, USA).We selected the samples, which their ratios of absorbance at 260 and 280 nm (A260/280), and 260 and 230 nm (A260/230) were above 1.7. Furthermore, the integrity of RNA was evaluated by denaturing 1.5% agarose gel electrophoresis and ethidium bromide staining. Around Ten ng of total RNA was reverse transcribed using MultiScribe reverse transcriptase, and RT primers were performed separately for each miRNA according to the supplier’s instructions. Real-time PCR was done in a final volume of 10 µl, using 0.7 µl of RT product, 0.5 µl of specific primers with probes (Table 1 ), and TaqMan Universal PCR Master Mix II. Amplification was performed with initial denaturation for 10 min at 95 ° C, followed by 40 cycles of 15 sec at 95 ° C and 60 sec at 60 ° C with Stratagene Mx3000P (Agilent Technologies, USA), PCR reactions were performed in quadruplicates. The data were analyzed by the comparative threshold cycle (ΔCt) method and normalization was performed using geometric means of cel-miR-39-3p, eca-miR-195, and U6. Table 1 List of miRNA names, miRBase accession numbers and mature sequences. miR name Accession number Mature miRNA sequence eca-miR-223 MIMAT0013205 UGUCAGUUUGUCAAAUACCCCA eca-miR-155 MIMAT0013182 UUAAUGCUAAUCGUGAUAGGGGU eca-miR-200a MIMAT0012909 UAACACUGUCUGGUAACGAUGU eca-miR-17 MIMAT0013084 CAAAGUGCUUACAGUGCAGGUAG eca-miR-205 MIMAT0012962 UCCUUCAUUCCACCGGAGUCUG Statistical analysis The NormFinder was used to select the most stable reference gene for normalization miRNA data[ 24 ].The raw data of fluorescence values (Rn) were imported into PCR Miner in order to calculate efficiency[ 25 ].The normal distribution was checked via Shapiro-Wilk test and Gaussian distribution; and all data was passed normality test (alpha = 0.05), (GraphPad Software, Inc., San Diego, CA, USA). The expression of selected miRNAs and the levels of serum IL-6, PGF 2α and PGE 2 were analyzed using two-way ANOVA, followed by Sidak's multiple comparisons test. The values shown in graphs are presented as the mean ± standard error of the mean (S.E.M) of at least five independent experiments each done in quadruplicate, P values ≤ 0.05 were considered statistically significant. GraphPad Prism 9.0 was used to perform statistical analysis as well as generating bar graphs Results Dynamic pattern of serum IL-6, PGE 2 , and PGF 2α in mares with endometritis (diseased) compared to control ones Serum concentrations of IL-6 were higher ( P < 0.001) in diseased mares (both young and old) compared to the control ones. For both healthy and diseased mares, there was a remarkable increase ( P < 0.01) in the serum IL-6 levels in the old compared to the young mares (Fig. 1a). In the same sense, serum concentrations of PGE 2 displayed higher values ( P < 0.001) in the diseased mares (both young and old) compared to the healthy ones. Old healthy and diseased mares showed increased values ( P < 0.001) of serum PGE 2 compared to the young ones (Fig. 1b). Serum levels of PGF 2α recorded a marked increase ( P < 0.001) in the diseased mares (both young and old) compared to the healthy ones. In addition, young mares (control and diseased) exhibited a higher value ( P < 0.01) of the serum concentration of PGF 2α compared to the old mares (Fig. 1c).In addition, PGE 2 : PGF 2α ratio was significantly ( P < 0.05) higher in the young and old mares with endometritis compared to the control mares (Fig. 2). Fold regulation of serum miRNA in mares with endometritis compared to normal healthy ones In figure (3), the relative abundance of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 was higher ( P ≤ 0.001) in both young and old diseased mares, compared to control healthy mares (young and old). We noticed that eca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 revealed higher (0.001 ≤ P ≤ 0.01) expression in old diseased than young diseased mares, in comparison to control healthy mares. Taken together, there were significant (0.001 ≤ P ≤ 0.05) interactions among groups; control healthy young, control healthy old, diseased young, and diseased old mares as shown by Sidak's multiple comparisons test. Discussion As far as we know, this is the first report measured the serum concentrations of IL-6, PGF 2α and PGE 2 in mares with endometritis compared to the healthy Arabian mares. In mares with endometritis the serum concentrations of IL-6, PGF 2α and PGE 2 were significantly higher compared with mares that did not suffer from endometritis. In addition to these clear points, the present study recorded that the inflammatory response could be different, with respect to the systemic cytokines, according to the age of the mares. Hurtgen[ 26 ]in his review, mentioned that the equine endometritis is classified into more than one category, which are differing according to the causative agent and severity. In addition, he mentioned that the prevention and control of endometritis in mares will be achieved according to the understanding and follow-up the pathophysiology of equine endometritis through its different predisposing factors. Woodward et al. [ 27 ]described that the age of the diseased mares with endometritis as well as the seasonal changes were potential predisposing factors to the susceptibility to endometritis in mares. In the present study, the serum concentrations of IL-6 were markedly increased in mares with endometritis compared with healthy mares. In several species, serum concentrations of IL-6 showed a significant increase in subclinical and clinical endometritis in cows [ 28 ] and ewes [ 29 ] It is well-known that IL-6 considers as the most important pro-inflammatory cytokine through the inflammation cascade. IL-6 has a supporting and modulatory role during the inflammation of the tissues, where IL-6 stimulates and potentiates the immune response as well as the action of the others cytokines as IL-10[ 30 , 31 ]. Prostaglandins (PGs) have a great crucial role during inflammation. PGs considered as main modulators for the inflammatory response against pathogens, where it contributes in the control of the pathogens and alleviate its side effects in different species [ 32 ]. In the present study, serum concentrations of PGF 2α and PGE 2 were markedly increased in mares with endometritis compared to healthy mares. The considerable increase in the concentration of these biomarkers is an indicator of strong response of inflammatory cells against inflammatory status of the endometrial cells in Arabian mares [ 1 ]. In addition, Le Blanc and Causey [ 4 ] investigated that the uterine concentrations of PGE 2 showed a remarkable increase 30 min post intrauterine bacterial inoculation in mares. Interestingly, PGE 2 is a potent uterine vasodilator, which is responsible for hyperemia of uterine blood vessels and chemotactic pattern for immune cells against uterine pathogens [ 33 ]. No doubt that proper uterine function is regulated by multiple arrays of miRNA[ 34 ], which responsible for activation or switched off certain target genes, depending on the physiological and pathological conditions of the animal. Thus, uterine infection does not only affect female fertility by perturbing uterine function, but also by prolonging ovarian cycle [ 35 ]. Therefore, to tackle the continuing fertility problems associated with uterine inflammation, understanding the molecular regulatory mechanisms associated with the inflammatory immune response is crucial to design appropriate therapeutic drugs. Among the many molecular marks, the free serum miRNA expression patterns could be potential diagnostic as well as prognostic indicators of mares affected by endometrial inflammation. Herein, there were a profound over-expression ineca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 in both young and old diseased mares, compared to control healthy mares (young and old). These findings are in agreement with previous studies, which revealed host cells responses to infection via activation the inflammatory immune response mediators, in order to overcome infection[ 14 , 15 , 21 ]. These inflammatory mediators could induce aberration of miRNA expression, which might be associated with an imbalance between pro-inflammatory and anti-inflammatory mediators[ 21 , 36 , 37 ]. Interestingly, there was a clear influence of mare age on the expression pattern of serum microRNA. Whereas, old diseased mares showed higher expression level ofeca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 than young diseased mares, compared to control healthy ones. This might be due to increase fluid retention by mare age, and subsequently associated with clear changes in systemic immune response[ 27 ].To the best of our knowledge, this is the first study investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 in mares serum during endometritis. In conclusion, to the best of our knowledge, this is the first study revealed that serum miRNA and serum inflammatory mediators(IL-6, PGE 2 , and PGF 2α ) could be used as non-invasive gold standard biomarkers, and therefore might be served as an important additional diagnostic tool for endometritis in Arabian mares. Moreover, estimation of the serum concentrations of serum miRNA, IL-6, PGE 2 , and PGF 2α is a promising recommended tool, during the breeding soundness examination in mares. Declarations Acknowledgments: Authors are grateful to Reproductive genetic Lab, Department of Animal Reproduction and AI, Veterinary Research Division, National Research Centre for a great help and support . This work was supported by Science and Technology Development Fund (STDF), project ID: 33342, Egypt. Conflicts of Interest: The authors declare that they don’t have any conflict of interest. Author contribution: Sally Ibrahim: conceptualization, methodology, statistics analysis and writing& editing the manuscript. Mohamed Hedia: methodology and writing & editing the manuscript. Mohamed O. Taqi: data curation, statistics analysis and writing & editing the manuscript. Mohamed K. Derbala: methodology. Karima Gh. M. Mahmoud: conceptualization and review the manuscript. Youssef Ahmed: methodology. Sayed Ismail and Mohamed El-Belely review the manuscript. All authors have read and agreed to the published version of the manuscript. References Christoffersen M, Woodward E, Bojesen AM, Jacobsen S, Petersen MR, Troedsson MH, Lehn-Jensen H (2012) Inflammatory responses to induced infectious endometritis in mares resistant or susceptible to persistent endometritis. BMC Veterinary Research 8:41 Canisso IF, Segabinazzi L, Fedorka CE: Persistent Breeding-Induced Endometritis in Mares - a Multifaceted Challenge: From Clinical Aspects to Immunopathogenesis and Pathobiology . International Journal of Molecular Sciences 2020, 21(4) Troedsson MH (1999) Uterine clearance and resistance to persistent endometritis in the mare. Theriogenology 52(3):461–471 LeBlanc MM, Causey RC (2009) Clinical and subclinical endometritis in the mare: both threats to fertility. Reprod Domest Anim 44(Suppl 3):10–22 Christoffersen M, Baagoe CD, Jacobsen S, Bojesen AM, Petersen MR, Lehn-Jensen H (2010) Evaluation of the systemic acute phase response and endometrial gene expression of serum amyloid A and pro- and anti-inflammatory cytokines in mares with experimentally induced endometritis. Vet Immunol Immunopathol 138(1–2):95–105 Orsi NM, Tribe RM (2008) Cytokine networks and the regulation of uterine function in pregnancy and parturition. J Neuroendocrinol 20(4):462–469 Gabler C, Drillich M, Fischer C, Holder C, Heuwieser W, Einspanier R (2009) Endometrial expression of selected transcripts involved in prostaglandin synthesis in cows with endometritis. Theriogenology 71(6):993–1004 Canisso IF, Stewart J, Coutinho da Silva MA (2016) Endometritis: Managing Persistent Post-Breeding Endometritis. The Veterinary clinics of North America Equine Practice 32(3):465–480 Sharma A, Shandilya UK, Sullivan T, Naylor D, Canovas A, Mallard BA, Karrow NA: Identification of Ovine Serum miRNAs Following Bacterial Lipopolysaccharide Challenge . International Journal of Molecular Sciences 2020, 21(21) Dini P, El-Sheikh Ali H, Carossino M, Esteller-Vico SCL, K A, Daels ES P, B AB: Expression Profile of the Chromosome 14 MicroRNA Cluster (C14MC) Ortholog in Equine Maternal Circulation throughout Pregnancy and Its Potential Implications . International Journal of Molecular Sciences 2019, 20(24) Unger L, Abril C, Gerber V, Jagannathan V, Koch C, Hamza E: Diagnostic potential of three serum microRNAs as biomarkers for equine sarcoid disease in horses and donkeys . Journal of veterinary internal medicine 2021 Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):281–297 Bueno MJ, Perez de Castro I, Malumbres M (2008) Control of cell proliferation pathways by microRNAs. Cell Cycle 7(20):3143–3148 Ibrahim S, Szostek-Mioduchowska A, Skarzynski D (2019) Expression profiling of selected miRNAs in equine endometrium in response to LPS challenge in vitro: A new understanding of the inflammatory immune response. Vet Immunol Immunopathol 209:37–44 Salilew-Wondim D, Ibrahim S, Gebremedhn S, Tesfaye D, Heppelmann M, Bollwein H, Pfarrer C, Tholen E, Neuhoff C, Schellander K et al (2016) Clinical and subclinical endometritis induced alterations in bovine endometrial transcriptome and miRNome profile. BMC Genom 17:218 Dascanio JJ (2014) Uterine Culture Collection: Swab/Brush. Equine Reproductive Procedures. Equine Reproductive Procedures 28:41–43 Bohn AA, Ferris RA, McCue PM (2014) Comparison of equine endometrial cytology samples collected with uterine swab, uterine brush, and low-volume lavage from healthy mares. Vet Clin Pathol 43(4):594–600 Aguilar J, Hanks M, Shaw DJ, Else R, Watson E (2006) Importance of using guarded techniques for the preparation of endometrial cytology smears in mares. Theriogenology 66(2):423–430 Nielsen JM (2005) Endometritis in the mare: a diagnostic study comparing cultures from swab and biopsy. Theriogenology 64(3):510–518 Amorim MD, Gartley CJ, Foster RA, Hill A, Scholtz LE, Hayes A, Chenier TS (2016) Comparison of Clinical Signs, Endometrial Culture, Endometrial Cytology, Uterine Low-Volume Lavage, and Uterine Biopsy and Combinations in the Diagnosis of Equine Endometritis. Journal of Equine Veterinary Science 44:54–61 Kasimanickam V, Kastelic J (2016) Circulating cell-free mature microRNAs and their target gene prediction in bovine metritis. Sci Rep 6:29509 Yu J, Chen J, Yang H, Chen S, Wang Z (2019) Overexpression of miR200a3p promoted inflammation in sepsisinduced brain injury through ROSinduced NLRP3. Int J Mol Med 44(5):1811–1823 Mi S, Zhang J, Zhang W, Huang RS (2013) Circulating microRNAs as biomarkers for inflammatory diseases. MicroRNA 2(1):63–71 Andersen CL, Jensen JL, Orntoft TF (2004) Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Can Res 64(15):5245–5250 Zhao S, Fernald RD (2005) Comprehensive algorithm for quantitative real-time polymerase chain reaction. Journal of computational biology: Journal of Computational Molecular Cell Biology 12(8):1047–1064 Hurtgen JP (2006) Pathogenesis and treatment of endometritis in the mare: a review. Theriogenology 66(3):560–566 Woodward EM, Christoffersen M, Campos J, Squires EL, Troedsson MH (2012) Susceptibility to persistent breeding-induced endometritis in the mare: relationship to endometrial biopsy score and age, and variations between seasons. Theriogenology 78(3):495–501 Kasimanickam RK, Kasimanickam VR, Olsen JR, Jeffress EJ, Moore DA, Kastelic JP: Associations among serum pro - and anti - inflammatory cytokines , metabolic mediators , body condition , and uterine disease in postpartum dairy cows . Reproductive Biology and Endocrinology: RB&E 2013, 11 :103 Nasreldin N, Ali FAZ, Abd-Elhafeez HH, Hassan M, El-Zeftawy M, Senosy W (2020) Characterization of immunological, biochemical and inflammatory response of clinical and subclinical endometritis in ewes in the subtropics. Animal Reproduction Science 219:106541 Diao H, Kohanawa M (2005) Endogenous interleukin-6 plays a crucial protective role in streptococcal toxic shock syndrome via suppression of tumor necrosis factor alpha production. Infect Immun 73(6):3745–3748 Jones SA (2005) Directing transition from innate to acquired immunity: defining a role for IL-6. J Immunol 175(6):3463–3468 Ricciotti E, FitzGerald GA (2011) Prostaglandins and inflammation. Arteriosclerosis Thrombosis Vascular biology 31(5):986–1000 Katila T (1995) Onset and duration of uterine inflammatory response of mares after insemination with fresh semen. Biol Reprod Mono 1:515–517 Pan Q, Chegini N (2008) MicroRNA signature and regulatory functions in the endometrium during normal and disease states. Seminars in Reproductive Medicine 26(6):479–493 L HAM PMM, Aurich C (2020) Equine endometritis: a review of challenges and new approaches. Reproduction 160(5):R95–R110 Mori MA, Ludwig RG, Garcia-Martin R, Brandao BB, Kahn CR (2019) Extracellular miRNAs: From Biomarkers to Mediators of Physiology and Disease. Cell Metab 30(4):656–673 Kamity R, Sharma S, Hanna N (2019) MicroRNA-Mediated Control of Inflammation and Tolerance in Pregnancy. Front Immunol 10:718 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-235385","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":12800897,"identity":"c451af9c-affa-4e38-8f19-22c7b1969162","order_by":0,"name":"Sally Ibrahim","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sally","middleName":"","lastName":"Ibrahim","suffix":""},{"id":12800898,"identity":"dc3d2e81-8ae2-4937-b682-b57ae8d6c350","order_by":1,"name":"Mohamed Hedia","email":"","orcid":"","institution":"Cairo University Faculty of Veterinary Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Hedia","suffix":""},{"id":12800899,"identity":"98716eec-9c83-4627-983e-5930a6eadb74","order_by":2,"name":"Mohamed O. Taqi","email":"","orcid":"","institution":"Agricultural Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"O.","lastName":"Taqi","suffix":""},{"id":12800900,"identity":"7b1759a2-72ee-41d7-95b4-0784a58a15b5","order_by":3,"name":"Mohamed K. Derbala","email":"","orcid":"","institution":"Agricultural Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"K.","lastName":"Derbala","suffix":""},{"id":12800901,"identity":"37dc32fa-49cd-47e3-ab7b-b784f640254f","order_by":4,"name":"karima mahmoud","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYBACCSA+AGIYgAieCiiDBC1niNTCANfC20aEFsn2sw8P3ajZJm8udviYxNt5h+XN2ZsPMPyo2IZTizRPusHhnGO3DXfOTkuTnLvtsOHOnmMJjD1nbuPUIseQxnA4h+0244bbOWbSvNsOM264kWPAzNiGRwv/M6CWf7ftIVrmHLYnqEVaAmhLbtvtRIiWhsOJBLVIzgDaktt3O3nD7bRkyznH0pM3nDmWcBCfXyTOpzF/zvl223bD7eSDN97UWNtuON588MGPCtxa0EEzmDxAtHogqCNF8SgYBaNgFIwQAADEMWBugejwCgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-0482-1207","institution":"National research centre","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"karima","middleName":"","lastName":"mahmoud","suffix":""},{"id":12800902,"identity":"b5cdd09f-5893-44f0-9ade-8ae899159a35","order_by":5,"name":"Youssef Ahmed","email":"","orcid":"","institution":"National Research Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Youssef","middleName":"","lastName":"Ahmed","suffix":""},{"id":12800903,"identity":"31b340c9-45ba-4f35-abef-450bca5120a0","order_by":6,"name":"Sayed Ismail","email":"","orcid":"","institution":"Cairo University Faculty of Veterinary Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sayed","middleName":"","lastName":"Ismail","suffix":""},{"id":12800904,"identity":"9e855bba-30b3-4807-85d6-98758543d479","order_by":7,"name":"Mohamed El-Belely","email":"","orcid":"","institution":"Cairo University Faculty of Veterinary Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"El-Belely","suffix":""}],"badges":[],"createdAt":"2021-02-11 23:24:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-235385/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-235385/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":6332048,"identity":"6770e929-2414-484a-a407-5e44b7d995c1","added_by":"auto","created_at":"2021-02-24 22:34:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":73142,"visible":true,"origin":"","legend":"The levels of IL-6 and prostaglandins (mean±SEM) in serum of mares {young (4-7 years) and old (8-14 years)} with endometritis compared to control ones. (A) The serum concentration of IL-6. (B) The level of PGE2in serum. (C) The serum level of PGF2α. Statistical significance was defined as values of P\u003c0.05. Statistical differences among groups are marked with asterisks (**P\u003c0.01, ***P\u003c0.001).","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-235385/v1/e1ee6e81c4c4498a87b6aacb.png"},{"id":6332517,"identity":"66daa7cd-59c1-4f0f-a054-13c22a5f86ac","added_by":"auto","created_at":"2021-02-24 22:37:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":82381,"visible":true,"origin":"","legend":"Ratio (mean±SEM) of serum PGE2:PGF2α concentrations in serum of mares {young (4-7 years) and old (8-14 years)} with endometritis compared to control healthy ones. Statistical significance was defined as values of P\u003c0.05. Statistical differences among groups are marked with asterisks (*P\u003c0.05).","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-235385/v1/61e739f1abad103890f3e9c1.png"},{"id":6332050,"identity":"0d4e766e-4d6a-4683-9432-24e944a9e323","added_by":"auto","created_at":"2021-02-24 22:34:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":270509,"visible":true,"origin":"","legend":"Expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205in serum of mares {young (4-7 years) and old (8-14 years)} with endometritis compared to control ones. Bars are presented as mean±SEM. Asterisk(s) represent statistical significance;**P\u003c0.01, ***P\u003c0.001.","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-235385/v1/e35b03325c980ea609e31105.png"},{"id":13672149,"identity":"b829ec5f-2be2-4a91-a2a5-64777c3f1667","added_by":"auto","created_at":"2021-09-17 11:12:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":742508,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-235385/v1/f173e7cb-7695-4e18-925a-2a5a585c0ab0.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eSerum miR-155, miR-223, miR-17, miR-200a, miR-205, Interleukin 6, and Prostaglandins as Novel Diagnostic Markers for Endometritis in Arabian Mares\u003c/p\u003e","fulltext":[{"header":"Introduction","content":" \u003cp\u003eFor years, equine endometritis considers as the most important cause of infertility in horses [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Infectious endometritis is the first cause of equine subfertility and the third most common disease affecting horses[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Endometrial infections are directly responsible for decreasing conception rates and indirectly disrupt reproductive outcomes leading to early embryonic loss, abortion and delivery of intrauterine infected foals[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAn inflammatory response against uterine pathogens is important to control and eliminate the uterine harmful infections, which seems to be the main cause of subfertility and failure of conception[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The initial defense mechanisms against endometrial pathogens are directly evoked as an inflammation, which will activate innate and humoral immune system in the mare [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]via series of cytokines and chemokines. Cytokines have an important role in a wide range of reproductive related processes. There are several types of cytokines, where each cytokine is responsible for multiple cellular tropism in an array of different organs and their response showed a different manner according to cell type[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Previous studies reported that the RNA gene expression of pro-inflammatory cytokines interleukin 6 (IL-6) and prostaglandins (PGF\u003csub\u003e2α\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e) in the uterine tissue samples were associated with the development of endometritis in mares[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe proper clearance of excess sperm cells, microorganisms, seminal plasma, and other debris from lumen of uterine tissues is an essential step for qualifying uterine milieu for implantation after embryo arrival[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This step is a complex and influenced by the host's immune system as well as epigenetics regulation[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Nothing is known about the expression pattern of serum miRNA, and post-transcription regulation of inflammatory immune response genes in mares with endometritis. Recently in equine species, many studies revealed that serum miRNA could be used as non-invasive biomarkers either for normal physiological condition (early pregnancy) or disease condition (sarcoid disease)[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The miRNAis small non-coding RNA molecules that act as post-transcriptional regulators of gene expression by inhibiting translation or degrading mRNA through partial or complete base pairing with three prime untranslated region(3\u0026acute;-UTR) of the target mRNAs[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. They are expressed in different cells and tissues, in order to regulate different mechanisms of developmental as well as physiological processes[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Furthermore, an extended inflammatory response due to aberrant miRNA expression is likely to impair fundamental cellular processes of the endometrium, affecting uterine receptivity, folliculogenesis, oocyte maturation and ovulation, finally leading to reduced fertility[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSo far, the expression pattern of free serum miRNA is unknown during endometritis in equine species. We therefore hypothesize that identification and quantification of some candidates serum miRNA from mares with endometritis might serve as useful and implementable clinical biomarkers for early diagnosis of endometiritis. Moreover, any alteration in the endometrial health status might be accompanied with series of pathophysiological changes, which subsequently dysregulate expression pattern of serum miRNA as well as increase the serum levels of inflammatory biomarkers as IL-6, PGF\u003csub\u003e2α\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e.Thus, the current study aimed (I) to investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205, and (II) to measure the concentrations of IL-6, PGF\u003csub\u003e2α\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e, in serum of young and old aged Arabian mares with healthy and abnormal uterine status (endometritis).\u003c/p\u003e "},{"header":"Material And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eChemicals\u003c/h2\u003e\n\u003cp\u003eAll chemicals and reagents were obtained from Qiagen (Hilden, Germany), Thermo Fisher Scientific(Wilmington, USA), unless otherwise stated.\u003c/p\u003e\n\u003cp\u003e\u003cspan class=\"BoldItalic\"\u003eEthical approval for use of animals\u003c/span\u003e\u003c/p\u003e\n\u003cdiv class=\"Ethics-ToolTip\"\u003eThe present study was approved by the Ethical Use and Animal Care Committee of faculty of veterinary medicine, Cairo University.\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eAnimals and management\u003c/h2\u003e\n\u003cp\u003eThis study was conducted on 80 Arabian mares; young (4\u0026ndash;7 years), and old (8\u0026ndash;14 years). These mares were divided into 48 sub-fertile mares {young (n\u0026thinsp;=\u0026thinsp;16), old (n\u0026thinsp;=\u0026thinsp;32)} suspected of endometritis (diseased group) and 32 fertile mares {control; young (n\u0026thinsp;=\u0026thinsp;24), old (n\u0026thinsp;=\u0026thinsp;8)} not suspected of endometritis that served as control group between November 2019 and April 2020 at a number of stud farms nearby Giza, Egypt. Uterine swabs and blood samples were collected only once from each mare after owner's permission. The selected mares experienced normal physical and vital signs where the normal range of vital signs including rectal body temperatures (37.5\u0026ndash;38.5\u003csup\u003e\u0026deg;\u003c/sup\u003eC), heart rate (36\u0026ndash;40 beats/min), respiratory rate (8\u0026ndash;15 breaths/min), capillary refill times (1\u0026ndash;2 sec) and a moist with a healthy pink color mucus membrane of the buccal cavity. An orthopedic examination was also performed to exclude mares with lameness or active laminitis. None of the mares had dystocia, retained fetal membranes or problems during puerperium. Additionally, none of the mares was in foaling heat. All animals were submitted to transrectal ultrasonographic (US) uterine examination using real-time B-mode machine (Esaote Mylab30- Netherlands) equipped with 5-7.5 MHz linear-array transducer.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eBlood and endometrial swabs sampling\u003c/h2\u003e\n\u003cp\u003eBlood samples were collected from the jugular vein into untreated vacutainer tubes and the tubes were maintained for 20 min at room temperature in an inclined position. The samples were subsequently centrifuged at 3000 \u0026times;g for 10 min (4\u003csup\u003e\u0026deg;\u003c/sup\u003eC) until clear serum was separated. Afterwards, serum was divided into two portions; 1st part was kept at \u0026ndash; 20\u003csup\u003e\u0026deg;\u003c/sup\u003eC for measuring IL-6, PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e concentrations, and the 2nd part was kept at \u0026ndash; 80\u003csup\u003e\u0026deg;\u003c/sup\u003eC for RNA isolation.\u003c/p\u003e\n\u003cp\u003eEndometrial swabs were collected as described before[\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e] using a sterilized double guarded uterine swab (Minitub GmbH, Germany), Briefly, after removing the feaces, the tail was bandaged, and then vulva and perineum were cleaned with iodopovidine (Betadine, EGIS, Warsaw, Poland), rinsed three times with water, and dried with a paper towel.\u003c/p\u003e\n\u003cdiv class=\"Ethics-ToolTip\"\u003eThe tip of the swab was held and covered in the palm, and using a slight rotatory movement, the hand passed into the vagina till enabling palpation of the external cervical os, the index finger passed gently into the external cervical os followed by the uterine swab.\u003c/div\u003e\n\u003cp\u003eAfter passing the cervical canal, the cotton swab pushed forward through the outer then the inner guards to be contacted with the endometrium then gently rotated for 10\u0026ndash;15 seconds. Finally, the swab was retracted back inside the inner guard then into the outer guard and the swab directly immersed into commercial transportation media.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003eCytological examination\u003c/h2\u003e\n\u003cp\u003eAfter the collection of uterine smears, the cytological samples were fixed and stained with a special commercial cytological stain; Papanicolaou method (Biodiagnostic, Egypt) according to the instruction\u0026rsquo;s recommendation within two hours at the laboratory. Samples were evaluated in regard to quality of cell morphology, cellularity, number of inflammatory cells per 400\u0026times; field, as well as any other remarkable features (Zeiss Axioskopmicroscobe, Carl Zeiss, Thornwood, NY)[\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e].Uterine samples were considered as marker for inflammation (endometritis) if the amount of PMNs was greater than 2% as described by Aguilar et al.[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e], data not shown.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003eMicrobial culturing\u003c/h2\u003e\n\u003cp\u003eImmediately after immersing the uterine smears into the transportation media, samples were transported to the laboratory for further microbial analysis. Both bacterial and fungal culturing protocol were carried out to identify the pathologically infected mares showing endometritis according to the general guidelines[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e], data not shown.\u003c/p\u003e\n\u003cp\u003eHere in the current work, the criteria for mares to be enrolled in the diseased group (endometritis) were that they had been bred three or more times unsuccessfully in the breeding season, or had a history more than one year of reproductive failure. In addition, two or more of the following criteria on a checklist were present: abnormal clinical findings, US scanning showed abnormal fluid in the uterus (echogenic or \u0026ge;\u0026thinsp;2 cm in diameter), positive endometrial cytology; and bacterial and/or fungal growth, as indicated by Amorim et al. [\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eSerum IL-6, PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e estimation\u003c/h2\u003e\n\u003cdiv class=\"Ethics-ToolTip\"\u003eSerum concentrations of IL-6 were determined by horse IL-6 ELISA kit (SunLong Biotech Co., LTD, Zhejiang, China) and as used according to the manufacturer\u0026rsquo;s instructions.\u003c/div\u003e\n\u003cp\u003eThe assay sensitivity and range were 0.5 pg/ml and 1.6 pg/ml to 100 pg/ml, respectively. For PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e measurement, the commercial PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e high sensitivity horse prostaglandin F\u003csub\u003e2\u003c/sub\u003e alpha ELISA kit (SunLong Biotech Co., LTD, Zhejiang, China) was used and run according to the manufacturer\u0026rsquo;s instructions. The assay sensitivity and range were 0.5 pg/ml and 3 pg/ml to 210 pg/ml. For PGE\u003csub\u003e2\u003c/sub\u003e measurements, the commercial PGE\u003csub\u003e2\u003c/sub\u003e high sensitivity horse prostaglandin E\u003csub\u003e2\u003c/sub\u003e ELISA kit (SunLong Biotech Co., LTD, Zhejiang, China) was used and run in accordance to the manufacturer\u0026rsquo;s instructions. The assay sensitivity and range were 0.1 pg/ml and 0.8 pg/ml to 50 pg/ml, respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003eIn-silico analysis for the selected candidate miRNA\u003c/h2\u003e\n\u003cp\u003eThe miRNA prediction tools such as: DIANA-microT v3.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://diana.cslab.ece.ntua.gr/microT/\u003c/span\u003e\u003c/span\u003e) and miRecords (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://mirecords.biolead.org/\u003c/span\u003e\u003c/span\u003e) were used for filterations miRNAs hits according to their potential relevance for targeting inflammatory immune response in mammalian uterine tissue at least in four different search algorithms. We found that of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205could be selected as potential targets. Moreover, these targets were shown different expression pattern in response to inflammation[\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003eSerum miRNA isolation, cDNA synthesis, and quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e\n\u003cp\u003eFor purification of cell-free miRNAs, we used a miRNeasy serum/plasma kit. 200 \u0026micro;l of thawed serum samples on ice were used for purification total RNA according to manufactures protocol. During purification steps, a 3.5 \u0026micro;l of lyophilized \u003cem\u003eC. elegans\u003c/em\u003e miR-39 miRNA mimic (miRNeasy Serum/PlasmaSpike-In Control) were added, at concentration 1.6\u0026times;10\u003csup\u003e8\u003c/sup\u003e copies/\u0026micro;l. In order to elute cell-free RNA, 14\u0026micro;l of RNase-free water was added to the center of the spin column membrane. Afterwards, the purified serum free total RNA was kept at -80\u003csup\u003e\u0026deg;\u003c/sup\u003eC.The concentration of total RNA was checked by Nano-drop 2000/c (Thermo Fisher Scientific, Wilmington, USA).We selected the samples, which their ratios of absorbance at 260 and 280 nm (A260/280), and 260 and 230 nm (A260/230) were above 1.7. Furthermore, the integrity of RNA was evaluated by denaturing 1.5% agarose gel electrophoresis and ethidium bromide staining.\u003c/p\u003e\n\u003cdiv class=\"Ethics-ToolTip\"\u003eAround Ten ng of total RNA was reverse transcribed using MultiScribe reverse transcriptase, and RT primers were performed separately for each miRNA according to the supplier\u0026rsquo;s instructions.\u003c/div\u003e\n\u003cp\u003eReal-time PCR was done in a final volume of 10 \u0026micro;l, using 0.7 \u0026micro;l of RT product, 0.5 \u0026micro;l of specific primers with probes (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e), and TaqMan Universal PCR Master Mix II. Amplification was performed with initial denaturation for 10 min at 95\u003csup\u003e\u0026deg;\u003c/sup\u003eC, followed by 40 cycles of 15 sec at 95\u003csup\u003e\u0026deg;\u003c/sup\u003eC and 60 sec at 60\u003csup\u003e\u0026deg;\u003c/sup\u003eC with Stratagene Mx3000P (Agilent Technologies, USA), PCR reactions were performed in quadruplicates. The data were analyzed by the comparative threshold cycle (\u0026Delta;Ct) method and normalization was performed using geometric means of cel-miR-39-3p, eca-miR-195, and U6.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eList of miRNA names, miRBase accession numbers and mature sequences.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003cth style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003emiR name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"height: 35px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eAccession number\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eMature miRNA sequence\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eeca-miR-223\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eMIMAT0013205\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eUGUCAGUUUGUCAAAUACCCCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eeca-miR-155\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eMIMAT0013182\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eUUAAUGCUAAUCGUGAUAGGGGU\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eeca-miR-200a\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eMIMAT0012909\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eUAACACUGUCUGGUAACGAUGU\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eeca-miR-17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eMIMAT0013084\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eCAAAGUGCUUACAGUGCAGGUAG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003ctd style=\"height: 35px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eeca-miR-205\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eMIMAT0012962\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003eUCCUUCAUUCCACCGGAGUCUG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eThe NormFinder was used to select the most stable reference gene for normalization miRNA data[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e].The raw data of fluorescence values (Rn) were imported into PCR Miner in order to calculate efficiency[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e].The normal distribution was checked via Shapiro-Wilk test and Gaussian distribution; and all data was passed normality test (alpha\u0026thinsp;=\u0026thinsp;0.05), (GraphPad Software, Inc., San Diego, CA, USA). The expression of selected miRNAs and the levels of serum IL-6, PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003ewere analyzed using two-way ANOVA, followed by Sidak's multiple comparisons test. The values shown in graphs are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (S.E.M) of at least five independent experiments each done in quadruplicate, \u003cem\u003eP\u003c/em\u003e values\u0026thinsp;\u0026le;\u0026thinsp;0.05 were considered statistically significant. GraphPad Prism 9.0 was used to perform statistical analysis as well as generating bar graphs\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eDynamic pattern of serum IL-6, PGE\u003csub\u003e2\u003c/sub\u003e, and PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003ein mares with endometritis (diseased) compared to control ones\u003c/p\u003e\n\u003cp\u003eSerum concentrations of IL-6 were higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in diseased mares (both young and old) compared to the control ones. For both healthy and diseased mares, there was a remarkable increase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in the serum IL-6 levels in the old compared to the young mares (Fig.\u0026nbsp;1a). In the same sense, serum concentrations of PGE\u003csub\u003e2\u003c/sub\u003e displayed higher values (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the diseased mares (both young and old) compared to the healthy ones. Old healthy and diseased mares showed increased values (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) of serum PGE\u003csub\u003e2\u003c/sub\u003e compared to the young ones (Fig.\u0026nbsp;1b). Serum levels of PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e recorded a marked increase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in the diseased mares (both young and old) compared to the healthy ones. In addition, young mares (control and diseased) exhibited a higher value (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) of the serum concentration of PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e compared to the old mares (Fig.\u0026nbsp;1c).In addition, PGE\u003csub\u003e2\u003c/sub\u003e: PGF\u003csub\u003e2\u0026alpha;\u003c/sub\u003e ratio was significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) higher in the young and old mares with endometritis compared to the control mares (Fig.\u0026nbsp;2).\u003c/p\u003e\n\u003cdiv\u003e\n\u003ch2\u003eFold regulation of serum miRNA in mares with endometritis compared to normal healthy ones\u003c/h2\u003e\n\u003cp\u003eIn figure (3), the relative abundance of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 was higher (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001) in both young and old diseased mares, compared to control healthy mares (young and old). We noticed that eca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 revealed higher (0.001\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01) expression in old diseased than young diseased mares, in comparison to control healthy mares.\u003c/p\u003e\n\u003cp\u003eTaken together, there were significant (0.001\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05) interactions among groups; control healthy young, control healthy old, diseased young, and diseased old mares as shown by Sidak's multiple comparisons test.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":" \u003cp\u003eAs far as we know, this is the first report measured the serum concentrations of IL-6, PGF\u003csub\u003e2α\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e in mares with endometritis compared to the healthy Arabian mares. In mares with endometritis the serum concentrations of IL-6, PGF\u003csub\u003e2α\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e were significantly higher compared with mares that did not suffer from endometritis. In addition to these clear points, the present study recorded that the inflammatory response could be different, with respect to the systemic cytokines, according to the age of the mares. Hurtgen[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]in his review, mentioned that the equine endometritis is classified into more than one category, which are differing according to the causative agent and severity. In addition, he mentioned that the prevention and control of endometritis in mares will be achieved according to the understanding and follow-up the pathophysiology of equine endometritis through its different predisposing factors. Woodward et al. [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]described that the age of the diseased mares with endometritis as well as the seasonal changes were potential predisposing factors to the susceptibility to endometritis in mares.\u003c/p\u003e \u003cp\u003eIn the present study, the serum concentrations of IL-6 were markedly increased in mares with endometritis compared with healthy mares. In several species, serum concentrations of IL-6 showed a significant increase in subclinical and clinical endometritis in cows [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] and ewes [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] It is well-known that IL-6 considers as the most important pro-inflammatory cytokine through the inflammation cascade. IL-6 has a supporting and modulatory role during the inflammation of the tissues, where IL-6 stimulates and potentiates the immune response as well as the action of the others cytokines as IL-10[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eProstaglandins (PGs) have a great crucial role during inflammation. PGs considered as main modulators for the inflammatory response against pathogens, where it contributes in the control of the pathogens and alleviate its side effects in different species [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In the present study, serum concentrations of PGF\u003csub\u003e2α\u003c/sub\u003e and PGE\u003csub\u003e2\u003c/sub\u003e were markedly increased in mares with endometritis compared to healthy mares. The considerable increase in the concentration of these biomarkers is an indicator of strong response of inflammatory cells against inflammatory status of the endometrial cells in Arabian mares [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In addition, Le Blanc and Causey [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] investigated that the uterine concentrations of PGE\u003csub\u003e2\u003c/sub\u003e showed a remarkable increase 30 min post intrauterine bacterial inoculation in mares. Interestingly, PGE\u003csub\u003e2\u003c/sub\u003e is a potent uterine vasodilator, which is responsible for hyperemia of uterine blood vessels and chemotactic pattern for immune cells against uterine pathogens [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNo doubt that proper uterine function is regulated by multiple arrays of miRNA[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], which responsible for activation or switched off certain target genes, depending on the physiological and pathological conditions of the animal. Thus, uterine infection does not only affect female fertility by perturbing uterine function, but also by prolonging ovarian cycle [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Therefore, to tackle the continuing fertility problems associated with uterine inflammation, understanding the molecular regulatory mechanisms associated with the inflammatory immune response is crucial to design appropriate therapeutic drugs. Among the many molecular marks, the free serum miRNA expression patterns could be potential diagnostic as well as prognostic indicators of mares affected by endometrial inflammation. Herein, there were a profound over-expression ineca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 in both young and old diseased mares, compared to control healthy mares (young and old). These findings are in agreement with previous studies, which revealed host cells responses to infection via activation the inflammatory immune response mediators, in order to overcome infection[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. These inflammatory mediators could induce aberration of miRNA expression, which might be associated with an imbalance between pro-inflammatory and anti-inflammatory mediators[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Interestingly, there was a clear influence of mare age on the expression pattern of serum microRNA. Whereas, old diseased mares showed higher expression level ofeca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 than young diseased mares, compared to control healthy ones. This might be due to increase fluid retention by mare age, and subsequently associated with clear changes in systemic immune response[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].To the best of our knowledge, this is the first study investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 in mares serum during endometritis.\u003c/p\u003e \u003cp\u003eIn conclusion, to the best of our knowledge, this is the first study revealed that serum miRNA and serum inflammatory mediators(IL-6, PGE\u003csub\u003e2\u003c/sub\u003e, and PGF\u003csub\u003e2α\u003c/sub\u003e) could be used as non-invasive gold standard biomarkers, and therefore might be served as an important additional diagnostic tool for endometritis in Arabian mares. Moreover, estimation of the serum concentrations of serum miRNA, IL-6, PGE\u003csub\u003e2\u003c/sub\u003e, and PGF\u003csub\u003e2α\u003c/sub\u003e is a promising recommended tool, during the breeding soundness examination in mares.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments: \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors are grateful to Reproductive genetic Lab, Department of Animal Reproduction and AI, Veterinary Research Division, National Research Centre \u003cstrong\u003efor a great help and support\u003c/strong\u003e. This work was supported by Science and Technology Development Fund (STDF), project ID: 33342, Egypt.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they don\u0026rsquo;t have any conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSally Ibrahim: conceptualization, methodology, statistics analysis and writing\u0026amp; editing the manuscript. Mohamed Hedia: methodology and writing \u0026amp; editing the manuscript. Mohamed O. Taqi: data curation, statistics analysis and writing \u0026amp; editing the manuscript. Mohamed K. Derbala: methodology. Karima Gh. M. Mahmoud: conceptualization and review the manuscript. Youssef Ahmed: methodology. Sayed Ismail and Mohamed El-Belely review the manuscript. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChristoffersen M, Woodward E, Bojesen AM, Jacobsen S, Petersen MR, Troedsson MH, Lehn-Jensen H (2012) Inflammatory responses to induced infectious endometritis in mares resistant or susceptible to persistent endometritis. BMC Veterinary Research 8:41\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCanisso IF, Segabinazzi L, Fedorka CE: \u003cb\u003ePersistent Breeding-Induced Endometritis in Mares - a Multifaceted Challenge: From Clinical Aspects to Immunopathogenesis and Pathobiology\u003c/b\u003e. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e 2020, 21(4)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTroedsson MH (1999) Uterine clearance and resistance to persistent endometritis in the mare. Theriogenology 52(3):461\u0026ndash;471\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLeBlanc MM, Causey RC (2009) Clinical and subclinical endometritis in the mare: both threats to fertility. Reprod Domest Anim 44(Suppl 3):10\u0026ndash;22\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChristoffersen M, Baagoe CD, Jacobsen S, Bojesen AM, Petersen MR, Lehn-Jensen H (2010) Evaluation of the systemic acute phase response and endometrial gene expression of serum amyloid A and pro- and anti-inflammatory cytokines in mares with experimentally induced endometritis. Vet Immunol Immunopathol 138(1\u0026ndash;2):95\u0026ndash;105\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOrsi NM, Tribe RM (2008) Cytokine networks and the regulation of uterine function in pregnancy and parturition. J Neuroendocrinol 20(4):462\u0026ndash;469\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGabler C, Drillich M, Fischer C, Holder C, Heuwieser W, Einspanier R (2009) Endometrial expression of selected transcripts involved in prostaglandin synthesis in cows with endometritis. Theriogenology 71(6):993\u0026ndash;1004\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCanisso IF, Stewart J, Coutinho da Silva MA (2016) Endometritis: Managing Persistent Post-Breeding Endometritis. The Veterinary clinics of North America Equine Practice 32(3):465\u0026ndash;480\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSharma A, Shandilya UK, Sullivan T, Naylor D, Canovas A, Mallard BA, Karrow NA: \u003cb\u003eIdentification of Ovine Serum miRNAs Following Bacterial Lipopolysaccharide Challenge\u003c/b\u003e. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e 2020, 21(21)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDini P, El-Sheikh Ali H, Carossino M, Esteller-Vico SCL, K A, Daels ES P, B AB: \u003cb\u003eExpression Profile of the Chromosome 14 MicroRNA Cluster (C14MC) Ortholog in Equine Maternal Circulation throughout Pregnancy and Its Potential Implications\u003c/b\u003e. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e 2019, 20(24)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUnger L, Abril C, Gerber V, Jagannathan V, Koch C, Hamza E: \u003cb\u003eDiagnostic potential of three serum microRNAs as biomarkers for equine sarcoid disease in horses and donkeys\u003c/b\u003e. \u003cem\u003eJournal of veterinary internal medicine\u003c/em\u003e 2021\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):281\u0026ndash;297\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBueno MJ, Perez de Castro I, Malumbres M (2008) Control of cell proliferation pathways by microRNAs. Cell Cycle 7(20):3143\u0026ndash;3148\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIbrahim S, Szostek-Mioduchowska A, Skarzynski D (2019) Expression profiling of selected miRNAs in equine endometrium in response to LPS challenge in vitro: A new understanding of the inflammatory immune response. Vet Immunol Immunopathol 209:37\u0026ndash;44\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalilew-Wondim D, Ibrahim S, Gebremedhn S, Tesfaye D, Heppelmann M, Bollwein H, Pfarrer C, Tholen E, Neuhoff C, Schellander K et al (2016) Clinical and subclinical endometritis induced alterations in bovine endometrial transcriptome and miRNome profile. BMC Genom 17:218\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDascanio JJ (2014) Uterine Culture Collection: Swab/Brush. Equine Reproductive Procedures. Equine Reproductive Procedures 28:41\u0026ndash;43\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBohn AA, Ferris RA, McCue PM (2014) Comparison of equine endometrial cytology samples collected with uterine swab, uterine brush, and low-volume lavage from healthy mares. Vet Clin Pathol 43(4):594\u0026ndash;600\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAguilar J, Hanks M, Shaw DJ, Else R, Watson E (2006) Importance of using guarded techniques for the preparation of endometrial cytology smears in mares. Theriogenology 66(2):423\u0026ndash;430\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNielsen JM (2005) Endometritis in the mare: a diagnostic study comparing cultures from swab and biopsy. Theriogenology 64(3):510\u0026ndash;518\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmorim MD, Gartley CJ, Foster RA, Hill A, Scholtz LE, Hayes A, Chenier TS (2016) Comparison of Clinical Signs, Endometrial Culture, Endometrial Cytology, Uterine Low-Volume Lavage, and Uterine Biopsy and Combinations in the Diagnosis of Equine Endometritis. Journal of Equine Veterinary Science 44:54\u0026ndash;61\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKasimanickam V, Kastelic J (2016) Circulating cell-free mature microRNAs and their target gene prediction in bovine metritis. Sci Rep 6:29509\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu J, Chen J, Yang H, Chen S, Wang Z (2019) Overexpression of miR200a3p promoted inflammation in sepsisinduced brain injury through ROSinduced NLRP3. Int J Mol Med 44(5):1811\u0026ndash;1823\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMi S, Zhang J, Zhang W, Huang RS (2013) Circulating microRNAs as biomarkers for inflammatory diseases. MicroRNA 2(1):63\u0026ndash;71\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAndersen CL, Jensen JL, Orntoft TF (2004) Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Can Res 64(15):5245\u0026ndash;5250\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao S, Fernald RD (2005) Comprehensive algorithm for quantitative real-time polymerase chain reaction. Journal of computational biology: Journal of Computational Molecular Cell Biology 12(8):1047\u0026ndash;1064\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHurtgen JP (2006) Pathogenesis and treatment of endometritis in the mare: a review. Theriogenology 66(3):560\u0026ndash;566\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWoodward EM, Christoffersen M, Campos J, Squires EL, Troedsson MH (2012) Susceptibility to persistent breeding-induced endometritis in the mare: relationship to endometrial biopsy score and age, and variations between seasons. Theriogenology 78(3):495\u0026ndash;501\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKasimanickam RK, Kasimanickam VR, Olsen JR, Jeffress EJ, Moore DA, Kastelic JP: \u003cb\u003eAssociations among serum pro\u003c/b\u003e- \u003cb\u003eand anti\u003c/b\u003e-\u003cb\u003einflammatory cytokines\u003c/b\u003e, \u003cb\u003emetabolic mediators\u003c/b\u003e, \u003cb\u003ebody condition\u003c/b\u003e, \u003cb\u003eand uterine disease in postpartum dairy cows\u003c/b\u003e. \u003cem\u003eReproductive Biology and Endocrinology: RB\u0026amp;E\u003c/em\u003e 2013, \u003cb\u003e11\u003c/b\u003e:103\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNasreldin N, Ali FAZ, Abd-Elhafeez HH, Hassan M, El-Zeftawy M, Senosy W (2020) Characterization of immunological, biochemical and inflammatory response of clinical and subclinical endometritis in ewes in the subtropics. Animal Reproduction Science 219:106541\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDiao H, Kohanawa M (2005) Endogenous interleukin-6 plays a crucial protective role in streptococcal toxic shock syndrome via suppression of tumor necrosis factor alpha production. Infect Immun 73(6):3745\u0026ndash;3748\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJones SA (2005) Directing transition from innate to acquired immunity: defining a role for IL-6. J Immunol 175(6):3463\u0026ndash;3468\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRicciotti E, FitzGerald GA (2011) Prostaglandins and inflammation. Arteriosclerosis Thrombosis Vascular biology 31(5):986\u0026ndash;1000\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatila T (1995) Onset and duration of uterine inflammatory response of mares after insemination with fresh semen. Biol Reprod Mono 1:515\u0026ndash;517\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePan Q, Chegini N (2008) MicroRNA signature and regulatory functions in the endometrium during normal and disease states. Seminars in Reproductive Medicine 26(6):479\u0026ndash;493\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL HAM PMM, Aurich C (2020) Equine endometritis: a review of challenges and new approaches. Reproduction 160(5):R95\u0026ndash;R110\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMori MA, Ludwig RG, Garcia-Martin R, Brandao BB, Kahn CR (2019) Extracellular miRNAs: From Biomarkers to Mediators of Physiology and Disease. Cell Metab 30(4):656\u0026ndash;673\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKamity R, Sharma S, Hanna N (2019) MicroRNA-Mediated Control of Inflammation and Tolerance in Pregnancy. Front Immunol 10:718\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Serum miRNA, Mares, Endometritis, Interleukin6, Prostaglandins, Age","lastPublishedDoi":"10.21203/rs.3.rs-235385/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-235385/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e So far the intimate link between serum microRNA (miRNA) and uterine inflammation in mares is unknown. We aimed (I) to investigate the expression profile of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 (II) and to measure the concentrations of interleukin 6 (IL-6), and prostaglandins (PGF\u003csub\u003e2α\u003c/sub\u003e\u0026amp; PGE\u003csub\u003e2\u003c/sub\u003e) in serum of Arabian mares with healthy and abnormal uterine status (endometritis).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods and Results:\u003c/strong\u003e This study was conducted on 80 Arabian mares; young (4-7 years), and old (8-14 years). These animals were divided into 48 sub-fertile including 16 young and 32 old mares suspected of endometritis and 32 fertile as control (24 young and 8 old) at stud farms. Serum samples were collected for measuring IL-6, PGF\u003csub\u003e2α\u003c/sub\u003e, and PGE\u003csub\u003e2 \u003c/sub\u003econcentrations, as well as serum miRNA isolation and qRT-PCR. Serum concentrations of IL-6, PGE\u003csub\u003e2\u003c/sub\u003e, and PGF\u003csub\u003e2α\u003c/sub\u003e were higher (\u003cem\u003eP\u003c/em\u003e≤0.001) in mares with endometritis (young and old) compared to the control ones. Age of mares had a remarkable effect(0.001≤\u003cem\u003eP\u003c/em\u003e≤0.01) onIL-6, PGE\u003csub\u003e2\u003c/sub\u003e, and PGF\u003csub\u003e2α\u003c/sub\u003econcentrations. The relative abundance of eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a, and eca-miR-205 was higher (\u003cem\u003eP\u003c/em\u003e≤0.001) in both young and old mares with endometritis. We noticed that eca-miR-155, eca-miR-223, eca-miR-200a, and eca-miR-205 revealed higher (0.001≤\u003cem\u003eP\u003c/em\u003e≤0.01) expression level in old than young mares with endometritis. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e To the best of our knowledge, this is the first study revealed that serum miRNA and serum inflammatory mediators (IL-6, PGE\u003csub\u003e2\u003c/sub\u003e, and PGF\u003csub\u003e2α\u003c/sub\u003e) could be used as non-invasive gold standard biomarkers, and therefore might be served as an important additional diagnostic tool for endometritis in Arabian mares.\u003c/p\u003e","manuscriptTitle":"Serum miR-155, miR-223, miR-17, miR-200a, miR-205, Interleukin 6, and Prostaglandins as Novel Diagnostic Markers for Endometritis in Arabian Mares","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-02-24 22:34:03","doi":"10.21203/rs.3.rs-235385/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ef73f8e8-7b0c-4988-8476-f7198691b878","owner":[],"postedDate":"February 24th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":2593560,"name":"Molecular Biology"}],"tags":[],"updatedAt":"2021-03-10T08:55:37+00:00","versionOfRecord":[],"versionCreatedAt":"2021-02-24 22:34:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-235385","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-235385","identity":"rs-235385","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

disambig:endometritis

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00