Escape of Kdm6a from X chromosome is detrimental to ischemic brains via IRF5 signaling

preprint OA: closed
Full text JSON View at publisher
Full text 132,117 characters · extracted from preprint-html · click to expand
Escape of Kdm6a from X chromosome is detrimental to ischemic brains via IRF5 signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Escape of Kdm6a from X chromosome is detrimental to ischemic brains via IRF5 signaling Conelius Ngwa, Afzal Misrani, Kanaka Valli Manyam, Yan Xu, Shaohua Qi, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4986866/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The role of chromatin biology and epigenetics in disease progression is gaining increasing recognition. Genes that escape X chromosome inactivation (XCI) can impact neuroinflammation through epigenetic mechanisms. Our prior research has suggested that the X escapee genes Kdm6a and Kdm5c are involved in microglial activation after stroke in aged mice. However, the underlying mechanisms remain unclear. We hypothesized that Kdm6a/5c demethylate H3K27Me3/H3K4Me3 in microglia respectively, and mediate the transcription of interferon regulatory factor 5 (IRF5) and IRF4, leading to microglial pro-inflammatory responses and exacerbated stroke injury. Aged (17–20 months) Kdm6a/5c microglial conditional knockout (CKO) female mice (one allele of the gene) were subjected to a 60-min middle cerebral artery occlusion (MCAO). Gene floxed females (two alleles) and males (one allele) were included as controls. Infarct volume and behavioral deficits were quantified 3 days after stroke. Immune responses including microglial activation and infiltration of peripheral leukocytes in the ischemic brain were assessed by flow cytometry. Epigenetic modification of IRF5/4 by Kdm6a/5c were analyzed by CUT&RUN assay. The demethylation of H3K27Me3 by kdm6a increased IRF5 transcription; meanwhile Kdm5c demethylated H3K4Me3 to repress IRF5 . Both Kdm6a fl/fl and Kdm5c fl/fl mice had worse stroke outcomes compared to fl/y and CKO mice. Gene floxed females showed more robust expression of CD68 in microglia, elevated brain and plasma levels of IL-1β or TNF-α, after stroke. We concluded that IRF5 signaling plays a critical role in mediating the deleterious effect of Kdm6a ; whereas Kdm5c’s effect is independent of IRF5. Aging Kdm6a/5c Microglia Epigenetics Ischemia IRF Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Stroke sensitivity in the aged is driven primarily by sex chromosomes [ 1 , 2 ], and through a variety of processes including gene epigenetic modifications such as histone methylation [ 3 – 5 ]and demethylation [ 3 , 4 ]. Histone modifications are indispensable in the regulation of genes for microglia polarization [ 6 – 8 ] and the pathological processes of ischemia [ 8 – 11 ]. In humans, histone modification patterns are associated with X chromosome, especially those genes that escape X-chromosome inactivation (XCI) [ 12 ]. Generally, X-linked genes escape XCI at the embryonic stage [ 13 ], but it is also suggested that some genes escape with aging [ 14 , 15 ], leading to gene dosage imbalanced between males and females. Lysine Demethylase 6a ( Kdm6a) and Kdm5c , are escapee genes that encode demethylases of H3K27Me3 [ 3 , 16 ] and H3K4Me3 [ 4 , 5 ], respectively. The demethylated form H3K27Me1 is active [ 17 – 19 ] and H3K4Me1 suppressive for gene transcription [ 19 , 20 ]. Our previous studies have shown that: 1) microglial interferon regulatory factor 5 (IRF5) and IRF4 regulate neuroinflammation in young [ 21 ] and aged mice [ 22 ]; 2) X chromosomal complement contributes to stroke sensitivity in aged animals [ 23 ]; and 3) the X escapee genes Kdm6a and Kdm5c were involved in IRF5/4 expression and neuroinflammation after stroke [ 24 ]. However, the mechanism by which Kdm6a/Kdm5c modulates IRF5/4 gene signaling and neuroinflammation after stroke is still elusive. We hypothesized that Kdm6a/5c regulate IRF5/4 expression through epigenetic modification of histones, mediate microglial activation/neuroinflammation after stroke, and impact outcomes. To test our hypothesis, we generated microglial Kdm6a or Kdm5c conditional knockout (CKO) mice, in which one allele of Kdm6a or Kdm5c is deleted, and subjected the mice to a 60-min middle cerebral artery occlusion (MCAO). Since stroke is a disease that mainly affects the elderly, aged mice (17–20 months) were used in the present study to enhance the translational research potential. Materials and methods Animal models Kdm6a or Kdm5c (CKO) mice were generated by mating Kdm6a/5c flox/+ female mice (provided by Dr. Author Arnold, UCLA) with CX3CR1-CreER (strain # 021160, The Jackson Laboratory) males, followed by tamoxifen (TMX) induction [ 25 ]. Kdm6a/5c CKO female (there is only one allele of the gene in microglia), Kdm6a/5c flox/flox (fl/fl; two alleles) female, and Kdm6a/5c flox/y (fl/y; one allele) male, aged mice (17–20 months-old) were used in all experiments. All mice were group-housed under pathogen-free conditions with a 12-to-12-h day-night cycle and had access to food and water ad libitum . Mice were randomly chosen and used after they were examined free of aberrations or other abnormalities. All studies were conducted in accordance with NIH guidelines for the care and use of laboratory animals and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at Houston McGovern Medical School. Ischemic stroke model Cerebral ischemia was induced mice by reversible MCAO and under isoflurane anesthesia as previously described [ 21 , 23 , 26 , 27 ]. Briefly, a midline ventral neck incision was made, and unilateral MCAO was performed by inserting a 6–0 silicone-coated suture into the right internal carotid artery 6 mm from the internal carotid/ pterygopalatine artery bifurcation via an external carotid artery stump. Reperfusion was performed by withdrawing the suture 60-min after the occlusion. Rectal temperature was maintained at 36.5 ± 0.5°C during surgery with an automated TC-1000 temperature-control feedback system (CWE, Inc., Ardmore, PA, USA). All mice were monitored on a daily basis and then sacrificed at 2 days (for histone mechanistic studies) or 3 days (for stroke outcomes and immune responses) of reperfusion. Sham-operated animals underwent the same procedure including exposure to isoflurane and a midline ventral neck incision, but the suture was not advanced into the MCA. Laser Doppler flowmetry (Moor Instruments Ltd, UK) was applied to measure CBF through the skull at the right temporal fossa. Only the mice whose CBF showed a drop of over 85% of baseline after MCAO was included in the following experiments. The mortality after MCAO was 25% after 2 days stroke and 35% after 3 days stroke. The size of the MCAO-induced infarct was measured by Cresyl violet (CV) staining as described in [ 23 ]. Flow cytometry Flow cytometry was performed as previously described with modifications [ 22 ]. Briefly mice were euthanized and transcardially perfused with 1% heparin in cold PBS, and the brains were harvested. The ipsilateral hemispheres were diced and placed in complete RPMI 1640 (cat # 30–200, ATCC) medium and mechanically and enzymatically digested in collagenase/dispase (1 mg/mL) and DNAse (10 mg/mL) purchased from Roche Diagnostics, for 1 h, and at 37 ◦C. The cell suspension was diluted in regular RPMI 1640 and then filtered through a 70 µm filter and placed into a 70%/ 30% Percoll gradient. Cells were harvested from the interphase portion of the gradient, washed, and blocked with purified rat anti-mouse CD16/CD32 (mouse BD FC block, cat # 553142) and then stained for extracellular or intracellular markers and using primary antibody-conjugated fluorophores including: anti-Ly6C Brilliant violet 605 (cat # 128035), anti-IL-10 PerCP-Cy5.5 (cat # 505028) purchased from BioLegend. Anti-CD45.2 eF450 (cat # 48-0451-82), anti-CD11b AF488 (cat # 53-0112-82), anti-IL-1β PE (cat # 12-7114-82), anti-Ly6G PE-eFluor 610 (cat # 61-9668-82), anti-TNFα PE-Cy7 (cat # 25-7321-82), anti-IL-4 APC (Cat # 17-7041-82), anti-CD206 AF700 (cat # 56-2061-82), and anti-CD68 APC-eF780 (cat # 47-0681-82) purchased from ThermoFisher Scientific. For live/dead cell discrimination, a fixable viability dye, carboxylic acid succinimidyl ester (CASE-AF350, Invitrogen), was used. Fluorescence minus ones (FMOs) and beads compensations were used for all staining experiments. Data were acquired on Cytoflex_AS41045 (Beckman Coulter) and analyzed using FlowJo (Treestar Inc.). mRNA extraction and real-time polymerase chain reaction (RT-PCR) RT-PCR was performed as in [ 28 ] with slight modifications. Briefly total RNA was extracted using RNeasy Mini Kit_74104 (QIAGEN, Germantown, MD, USA) according to the manufacturer’s protocol, and quantified using NANODROP ONE (Thermo Fisher Scientific). The RNA was converted to cDNA by iScript™ Reverse Transcription Supermix_1708841. C1000 Touch Thermal Cycler CFX384 Real-Time System (Bio-Rad, Hercules, CA, USA) and the SsoAdvanced Universal SYBR Green Supermix_1725274 (Bio-Rad) were used to perform qPCR. The following gene primers from Integrated DNA Technologies (Coralville, IA, USA) were used: Kdm6a F_ CCAATCCCCGCAGAGCTTACCT, R_TTGCTCGGAGCTGTTCCAAGTG; Kdm5c F_ACCCACCTGGCAAAAACATTGG, R_ACTGTCGAAGGGGGATGCTGTG and the housekeeping gene GAPDH F_GTGTTCCTACCCCCAATGTGT, R_ ATTGTCATACCAGGAAATGAGCTT [ 24 ]. The results are reported as normalized fold changes in mRNA, which were determined by the ΔΔCt method using the threshold cycle (Ct) value. Neurologic deficit scores (NDS) Neurological deficits were assessed by the Benderson score system from 0 to 4 as in [ 21 , 22 ]. Briefly 0-no deficit; 1-forelimb weakness, torso turning to the ipsilateral side when held by the tail; 2-circling to the affected side; 3-unable to bear weight on affected side, and 4-no spontaneous activity or barrel rolling. Open field The open field test (OFT) is a common measure of exploratory behavior, general activity and anxiety-like behavior in rodents, where both the quality and quantity of the activity can be measured [ 29 ]. Briefly, mice were placed in a single arena facing the middle of a wall. Mice were allowed to explore the arena for 20 min [ 23 ]. After the 20 min duration, the mice were returned to the home cage and arena cleaned with 70% ethanol. The distance moved was analyzed as the locomotor and exploratory behavior of the mice. Grip strength We used the conventional forelimb grip strength test to assess motor function in the mice [ 30 – 32 ]. Briefly, a mouse was gently pulled by its tail ensuring the mouse grips the top portion of the grid and the torso remains horizontal and record the maximal grip strength value of the mouse that is displayed on the screen. This procedure was repeated 3 times to obtain 3 forelimb grip strength measurements for each mouse, and the average strength was calculated. Cleavage under targets & release using nuclease (CUT&RUN) assays IRF DNA binding to histones in microglia was measured by using the CUTANA™ ChIC/CUT&RUN Kit (Cat # 14-1048, Epicypher)[ 33 ] and CUTANA™ DNA purification Kit (Cat # 14–0050)[ 34 ], with modifications. Briefly, microglia were isolated for CUT&RUN from mouse brain tissue, using ANTI-PE MICROBEADS (Cat # 130-048-801, Miltenyi Biotech) [ 35 ] and PE-TMEM119 monoclonal antibody antibody (Cat # 12-6119-86), binding assays. The ANTI-PE MICROBEADS isolated microglia, were washed with spermidine formulated wash-buffer, and then bound onto activated Concanavalin A conjugated paramagnetic beads (Cat # 21-1401, Epicypher) by gentle agitation for 10 mins and at RT. The cells bound to Concanavalin A beads were then incubated overnight with 2 µg of anti-H3K4Me1 (Cat # 13–0057, Epicypher), anti-H3K4Me3 (Cat # 13–0041, Epicypher), anti-H3K27Me1 (Cat # 61015, Active Motive), or anti-H3K27Me3 (Cat # 13–0055, Epicypher) antibody. After overnight incubation, the antibody-cell-bead complex was washed with wash buffer containing 5% digitonin (permeabilization buffer), and then 3 µL of the cleavage CUTANA™ pAG-MNase enzyme (cat# 15-1016, Epicypher)[ 36 ], was added and incubated at RT for 10 minutes with no agitation. The complex was further washed with permeabilization buffer and then resuspended in permeabilization buffer (50 µL) and cooled in ice for 4 mins. Digestion, by the pAG-MNase enzyme incorporated into the cells was induced by addition of calcium chloride (100 mM, 1 µL), followed by incubation for 2 hr and at 4 o C. At the end of the digestion step, stop buffer (33 µL, cat # 14-1048, Epicypher) was added to the digestion complex and the complex incubated for 30 mins and at 37 o C without shaking, in order to release DNA fragments. The supernatant containing the released DNA fragments was collected by centrifugation at 16,000 x g, at 4 o C and for 2 min. Total DNA was purified by the CUTANA™ DNA purification Kit (Cat # 14–0050) following the vendor’s specifications. DNA was quantified using NANODROP ONE (Thermo Scientific). IRF5 and IRF4 in the purified DNA was quantified by qPCR and using primers including: IRF5 F_5’-GTTTGGTCTGGGTTTTGAGTC-3’, R_5’-ATGTCTGTAACCCTAGCACTTG-3’; IRF4 F_5’-AATGGGAAACTCCGACAGTG-3’, R_5’-TCACGATTGTAGTCCTGCTTG-3’; GAPDH F_5’-GTGTTCCTACCCCCAATGTGT-3’, R_5’-ATTGTCATACCAGGAAATGAGCTT-3’. The results are reported as normalized fold changes in DNA gene expression, which were determined by the ΔΔCt method using the threshold cycle (Ct) value for gene of interest. Plasma and brain cytokine levels by conventional enzyme-linked immunosorbent assay (ELISA) We used the same procedure as in [ 22 , 24 ] with modification. Briefly blood samples were obtained by cardiac puncture with EDTA-soaked syringed-needles and then centrifuged at 15000 RPM for 20 min, and at 4° C. Brain tissue in non-pyrogenic 5 mL polystyrene round-bottom tubes (Ref # 352235, Corning USA) were homogenized using glass pistons, in complete NP40 buffer, and also centrifuged at 15000 RPM for 20 mins, and at 4 o C. After centrifugation, the supernatant was collected and analyzed with Nunc™ MaxiSorp™ ELISA plates_423501 and the ELISA MAX™ Deluxe kits including TNF_430904, IL-1β_432604, IL-4_431104 and IL-10_431414 (BioLegend USA). Signals were measured at 450 nm in EnSpire™ Multimode Plate Reader (Perkin Elmer USA). Statistical analysis Data from individual experiments were presented as mean ± SEM, and assessed by Student’s t test, One-way ANOVA or 2-way ANOVA with Tukey post hoc test for multiple comparisons using GraphPad Prism Software 10.1.2 (324). P < 0.0500 was considered statistically significant. Investigators were blinded to mouse strains for stroke surgery, behavioral testing, infarct, and inflammation analysis. Results Validation of microglial Kdm6a/Kdm5c CKO mouse model We generated microglial Kdm6a and Kdm5c CKO female mouse models, by injecting TMX (75 mg/kg) to Kdm6a or Kdm5c fl/+ :CX3CR1-CreER mice (16 months). Four weeks after the TMX injection, the mice were ready for downstream experiments. We validated the CKO mouse model (deletion of one allele of Kdm6a or Kdm5c in microglia) by isolating microglia (using anti-Tmem119 antibody and ANTI-PE microbeads), followed by q-PCR for Kdm6a/Kdm5c mRNA gene expression (fold change) (Fig. 1 ). The Kdm6a/Kdm5c mRNA fold change was significantly reduced in CKO vs. fl/fl microglia (Fig. 1 A, 1 B), indicating the success of the CKO model. Kdm6a modulates IRF5 through H3K27Me3 demethylation Our previous study [ 24 ] has suggested that Kdm6a is involved in regulation of IRF5 (pro-inflammatory) signaling. Here we further tested if Kdm6a, a demethylase of histone, can epigenetically modulate IRF5 transcription. We performed MCAO in three strains of mice: Kdm6a fl/y (male; one allele of Kdm6a), Kdm6a fl/fl (female; two alleles), and Kdm6a CKO (female; one allele). At two days after MCAO, microglia were isolated, and CUT&RUN was performed to detect the amount of IRF5 DNA binding to either H3K27Me1(active form for gene expression) or H3K27Me3 (suppressive form). The ratio of IRF5 DNA binding with H3K27Me1 over H3K27Me3 is indicative of the predominance of IRF5 active or suppressive transcription. There was a significant increase in IRF5 DNA binding to H3K27Me3 in Kdm6a CKO vs. fl/fl, although no difference was found between strains in H3K27Me1 binding (Fig. 2 A &B ). The binding ratio of H3K27Me1/H3K27Me3 was significantly higher in microglia isolated from Kdm6a fl/fl mouse, when compared with either fl/y or CKO (Fig. 2 C). There was no significant difference in IRF5 DNA binding to H3K4 between strains (Fig. 2 D, E, F). We also examined another transcription factor IRF4 (anti-inflammatory), but found IRF4 DNA binding to either H3K27 or H3K4 did not show any difference between groups ( Suppl. 1 A-F ). Kdm5c represses IRF5 transcription through H3K4Me3 demethylation Next, we examined the effect of another histone demethylase/X escapee gene, Kdm5c , on IRF5’s transcription with CUT&RUN assay, as Kdm5c was also previously found to be involved [ 24 ]. The demethylation of microglial H3K4Me3 (active form) by two alleles of Kdm5c in Kdm5c fl/fl mice induced a significant increase in IRF5 DNA binding to H3K4Me1 form (suppressive) compared with fl/y or CKO mice (both have one allele of Kdm5c ) (Fig. 3 A). The binding ratio of H3K4Me1/H3K4Me3 was significantly higher in the microglia from Kdm5c fl/fl vs. fl/y or CKO mice. (Fig. 3 A-C). We did not observe any significant difference in IRF5 DNA binding to H3K27 between strains ( Suppl. 2 A-C ). Again, IRF4 DNA binding to either H3K27 or H3K4 did not show difference in these mice (Suppl. 2 D-I). Taken together, data of Fig. 2 & 3 suggest that IRF5 transcription is regulated by both Kdm6a and Kdm5c, with an active effect by the former but a suppressive effect by the latter. Kdm6a/5c signaling are pro-inflammatory after stroke Inflammatory responses to stroke can be determined by examination of infiltrating immune cells in the brain, microglial cell membrane and intracellular inflammatory mediator levels, plasma and brain cytokine levels [ 21 , 22 , 37 ]. We first examined membrane and intracellular inflammatory markers in microglia by flow cytometry. The gating strategy for all immune cells is as shown in Suppl. 3 . CD68 and CD206 are established cell membrane markers for pro- and anti-inflammatory response of microglia respectively [ 22 , 38 – 40 ]. In stroke groups, CD68 was significantly increased in the microglia from Kdm6a fl/fl vs. fl/y mice, and Kdm5c fl/fl mice had significantly higher CD68 than either fl/y or CKO mice (Fig. 4 B, E). However, CD206 expression on microglia did not differ between strains (Fig. 4 C, F). We also examined intracellular markers (TNF-α, IL-1β, IL-4, and IL-10) in microglia, but two alleles of Kdm6a or Kdm5c did not induce higher expression of any of the cytokines compared with one allele of the two genes ( Suppl. 4 ). Kdm6a fl/fl mice had significantly higher plasma levels of IL-1β than fl/y mice; whereas Kdm5c fl/fl mice had higher levels of TNF-α than either fl/y and CKO mice after stroke (Fig. 5 A, B). Negative results were found in other cytokines in these mice ( Suppl. 5 ). For cytokines assayed in whole brain homogenates, both Kdm6a fl/fl and Kdm5c fl/fl mice had significantly higher levels of TNF-α than either fl/y or CKO mice after stroke (Fig. 6 A, C). Meanwhile Kdm6a fl/fl (but not Kdm5c fl/fl ) mice showed a significant increase in IL-1β when compared with CKO (Fig. 6 B, D). For anti-inflammatory cytokines, we only found a significant decrease in IL-4 in the Kdm6a fl/fl vs. CKO mice brains after stroke ( Suppl. 6A-D ). We also observed significantly greater lymphocyte infiltration in the brains of Kdm5c fl/fl mice compared to fl/y or CKO mice after stroke, although there were no significant difference in monocyte or neutrophil infiltration between the strains ( Suppl. 7 ). All these data suggest that Kdm6a and Kdm5c signaling are pro-inflammatory after stroke in the aged. Two alleles of Kdm6a exacerbate stroke injury in the aged We next evaluated stroke outcomes in Kdm6a fl/fl , fl/y, and CKO aged mice by examining infarct volumes and a battery of neurobehavior tests, three days after MCAO. We found that the striatal infarct in Kdm6a fl /fl mice were significantly larger vs. fl/y mice. In addition, the fl/fl mice had significantly larger infarct in total ipsilateral hemisphere than fl/y or CKO mice (Fig. 7 A, B). However, there were no significant differences between the strains in distance travelled (open field test) (Fig. 7 C), grip strength (Fig. 7 D) and NDS (Fig. 7 E) at the acute timepoint (3d) after stroke. Kdm5c’s effect on IRF5 transcription does not contribute to stroke outcomes We also examined the effect of Kdm5c’s signaling on stroke outcomes, and found the similar results as that of Kdm6a . Kdm5c fl/fl mice exhibited significantly larger infarcts in the striatum compared to fl/y or CKO mice after 3d of stroke, but no differences were observed in neurobehavior deficits (Fig. 8 A-D). IRF5 signaling is detrimental in stroke [ 21 , 22 ], but in Fig. 3 we found two alleles of Kdm5c suppressed IRF5 transcription. Our data (Fig. 3 & Fig. 8 ) suggest Kdm5c’s detrimental effect on stroke injury is independent of IRF5 signaling. Discussion It is well known that some X chromosome genes escape XCI [ 14 , 15 , 41 , 42 ], leading to gene dosage imbalance between males and females [ 43 , 44 ], which could impact post-stroke inflammation and outcomes once a stroke occurs. The present study focused on two X chromosome escapee genes, Kdm6a and Kdm5c , and investigated their epigenetic modulation of IRF5/IRF4 via demethylation of H3K27Me3/H3K4Me3 in aged microglia after stroke. IRF5-IRF4 regulatory axis has been previously found to be the determinant pathway that regulates microglial pro-/anti-inflammatory responses [ 21 , 22 , 28 , 45 , 46 ], and is critical in mediating stroke injury. The current data showed that Kdm6a and Kdm5c signaling both impact on one end of the axis, i.e. IRF5, but in an opposite pattern. Two alleles of Kdm6a led to active transcription of IRF5 ; whereas two alleles of Kdm5c caused suppressive transcription of the pro-inflammatory factor. Two alleles of either Kdm6a or Kdm5c in microglia induced exacerbated pro-inflammatory responses after stroke, which led to worsened stroke injury. The different effect of the two Kdms on IRF5 transcripti on suggests that the two X escapee genes impact on stroke outcomes in the aged via different pathways. Stroke is a sexually dimorphic disease [ 47 , 48 ]; ischemic stroke sensitivity is mediated primarily by gonadal hormones in young population [ 49 , 50 ] and by sex chromosomal complement in the aged [ 23 , 51 ]. The contribution of the second X chromosome to stroke sensitivity in the aged has been observed in our previous study, with the two XCI escapee genes ( Kdm6a/Kdm5c ) involved [ 24 ]. The double expression of the two alleles of Kdm6a/Kdm5c due to the escape has been found also implicated in sex differences in cardiac infarction and adiposity [ 52 , 53 ]. The current study utilized three animal models with different allele numbers of active Kdm6a or Kdm5c , and demonstrated the detrimental effects of both X escapee genes on stroke injury. Since the Kdm CKO female mice only has one allele of Kdm6a or Kdm5c and without Y chromosome, the comparison between CKO and Kdm fl/fl females is exclusively reflective of the effect of X chromosome dosage but none of Y effect. Therefore, the current data convincingly indicate that the escape of Kdm6a or Kdm5c plays a detrimental role in post-stroke inflammation and stroke injury, and support the rational that the Y chromosome has limited effect on the stroke sensitivity [ 23 ]. The current study focused on the effect of Kdm6a/5c escape from XCI in aged microglia on stroke, as microglia play important roles in initiating and perpetuating post-stroke neuroinflammation. The inducible CKO model utilized in the study makes it feasible to investigate gene escape in microglia specifically. Although CX3CR1-CreER system targets both microglia and infiltrating monocytes in the ischemic brain, we did not perform experiments until 6 weeks after TMX induction so that the microglia can be the sole target. Infiltrating monocytes have gone through ‘turnover”[ 54 , 55 ] and no longer bear the TMX induced gene knockout after 6 weeks of TMX induction; whereas microglia still have the KO due to their longevity [ 56 ]. Gene escape from XCI is random, and has tissue and cell variability [ 57 , 58 ]. In addition, gene escape from XCI may be affected by various biological homeostasis changes including aging and stroke injury. XCI becomes unstable with age, which is a frequently proposed explanation for the phenotype spectrum of disease in females [ 42 , 59 , 60 ], suggesting some X-linked genes escape more easily with aging. Our previous study has found Kdm6a/5c were significantly higher expressed in sorted aged female vs. male microglia from naïve mice, and the sex difference was lost when evaluated in whole brain tissue in sham mice but present in brain tissue homogenates after stroke [ 24 ]. These data suggest that Kdm6a/5c escape from XCI has cell variability, and is sensitive to stroke stimulus. Epigenetic regulation of genes has been widely studied including DNA methylation [ 61 ], histone [ 62 ] and non-coding RNAs [ 63 ] modifications, with growing interest in exploring the related regulatory mechanisms underlying neuroinflammation in stroke [ 11 , 64 , 65 ]. Techniques such as chromatin immunoprecipitation (ChIP) [ 62 , 66 ], and CUT&RUN [ 67 – 69 ] have accelerated the advance of epigenetic studies, by elucidating gene-protein interactions and the downstream targets. Epigenetics involves histones which serve as “gatekeepers” to modulate DNA replication/transcription and gene expression [ 70 ]. Kdm6a and Kdm5c are demethylases for H3K27Me3 [ 71 ] and H3K4Me3 [ 72 ], and the demethylation of the two histones induces active and a transcriptive effect on gene transcription [ 73 – 76 ], respectively. Recently we have demonstrated by ChIP that the inflammatory transcription factors, IRF 5/4, bind to H3K27Me3 or H3K4Me3, suggesting the two IRFs are subjected to the epigenetic modulation of the histones [ 24 ]. Histones contain five components: H1, H2A, H2B, H3, and H4 [ 12 ], and undergo post-translational modifications of the N-terminal tail by acetylation, methylation, phosphorylation, ubiquitination, demethylation, and lactylation [ 77 – 80 ]. The modifications of histone tails affect the interaction of histones and DNA, and alter the structure and stability of chromatin [ 81 ], and regulate the gene transcription through modulating the affinity of transcription factors and structural gene promoters [ 14 ]. X chromosome-linked genes have been shown to play important roles in epigenetic modification of genes related to post-stroke inflammation [ 23 , 82 ]. Our data show that kdm6a/5c both regulate IRF5 transcription as in (Fig. 2 & 3 ), however in an opposite pattern (active vs. suppressive) through different histone demethylation, reflecting the complex nature of histone chromatin accessibility to transcriptional elements of the IRF5 gene after stroke. Epigenetic mechanisms after stroke are critical in the molecular pathophysiology of the disease, and are potential therapeutic targets [ 64 , 83 ] to salvage the hypoperfused ischemic penumbra that has not yet evolved into infarcted tissue [ 84 ]. The present study provided potential epigenetic avenues to target XCI escapee genes to regulate the expression of the pro-inflammatory transcription factor IRF5. IRF5 is a well-established pro-inflammatory transcription factor responsible for mediating microglial production of inflammatory cytokines [ 21 ]. Of note, our data demonstrated that Kdm6a and Kdm5c signaling have opposite effects on IRF5 transcription (Figs. 2 & 3 ). However, the escape of both Kdms from XCI has pro-inflammatory effects including promoting microglial pro-inflammatory response (Fig. 4 ), increasing plasma/brain levels of pro-inflammatory cytokines (Fig. 5 & 6 ), and both led to exacerbated stroke injury (Figs. 7 & 8 ). The active effect of Kdm6a on IRF5 transcription is logic to the downstream pro-inflammatory response and worsened stroke injury, but the suppressive effect of Kdm5c on IRF5 seems irrelevant to the downstream outcomes. Different Kdm family proteins finetune the switch of gene expression by manipulating active or repressive histone methylation markers, thus participating in various links of immune cells and inflammatory activities [ 85 , 86 ]. Kdm6a is a demethylase for H3K27Me3 [ 87 ], whereas Kdm5c is responsible for demethylation of H3K4Me3 [ 88 ]. Our data are consistent with this as H3K4-IRF5 axis was not affected by Kdm6a (Fig. 2 D-F) and K3K27-IRF5 not changed by Kdm5c ( Suppl. 2 A-C ). The specific histone target for the two Kdms might be the reason why they have different effect on IRF5 transcription. It is likely that Kdm5 c suppresses transcription of some anti-inflammatory genes to confer detrimental effects on neuroinflammation. The current study has some caveats that we should keep in mind when interpreting the data. We examined the Kdm-histone-IRF axis in aged microglia only at the acute phase of stroke (3 days after MCAO), and did not include a chronic stage cohort study which is still on-going (years of work). However, our acute study has already elucidated the mechanistic link between Kdm6a/5c and post-stroke inflammation, which will be further confirmed in the following experiments. Another caveat of the study is that we did not examine Kdm-IRF5 signaling in infiltrating monocytes. It has been reported [ 89 ] that demethylation of H3K27Me3 by Kdm6a markedly increased IL-1β expression through a Caspase-1 pathway in macrophages. The infiltrating monocytes in the ischemic brain also express IRF5 [ 45 , 90 , 91 ]. Nevertheless, our previous study has already suggested that the central (microglia) IRF signaling is more important than the IRFs expressed on peripheral immune cells in post-stroke inflammation [ 92 ]. In summary, the present study investigated the demethylating effects of Kdm6a/5c on H3K27Me3/H3K4Me3-IRF5/4 signaling in microglia, and assessed their impact on stroke outcomes in aged mice. Our findings reveal that the escape of microglial Kdm6a/5c from XCI exacerbates post-stroke inflammation and worsens outcomes. IRF5 signaling plays a critical role in mediating the deleterious effect of Kdm6a ( Fig. 9 ) ; whereas Kdm5c’s effect is independent of IRF5. The epigenetic modification of histones by X escapee genes is a novel mechanism in inducing sex differences in stroke among the elderly, highlighting new, sex-specific therapeutic targets for this devastating disease. Abbreviations ATCC, American Type Culture Collection BCA, Bicinchoninic acid assay ChIP, Chromatin immunoprecipitation CKO, Conditional knock out CUT&RUN, Cleavage Under Targets & Release Using Nuclease ELISA, Enzyme-Linked Immunosorbent Assay fl/fl, flox/flox H3k27Me3, trimethylation of histone H3 at lysine 27 H3k27Me1, monomethylation of histone H3 at lysine 27 H3k4Me3, trimethylation of Histone H3 at Lysine 4 H3k4Me1, monomethylation of Histone H3 at Lysine 4 ISRE, Interferon stimulatory regulatory element IRF5 Interferon regulatory factor 5 IRF4 Interferon regulatory factor 4 Kdm6a , Lysine-specific demethylase 6A Kdm5c , Lysine demethylase 5C MCAO, Middle cerebral artery occlusion MFI, Mean fluorescence intensity RPMI, Roswell Park Memorial Institute RT, Room temperature USP9X, Ubiquitin specific peptidase 9 X-linked XCI, X chromosome inactivation Declarations Ethical Statement. All studies were conducted in accordance with NIH guidelines for the care and use of laboratory animals and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at Houston McGovern Medical School. Competing interests. The authors declare no competing interests. Funding. This work was supported by funding from AHA Grant 23POST1019058 to Conelius Ngwa and NIH Grants R01 NS108779/NS129977 to Fudong Liu. Author Contribution C.N.: project conception and design, conducting of experiments, acquisition of data, analysis, and interpretation of data, and manuscript writing. A.F. and S.Q.: conducting experiment and acquisition of data and analysis. K.V., Y.X. and R.S.: mouse breeding and colony maintenance. L.M. and F.L.: contributed to conception and design, interpretation of data, and manuscript writing. All authors have read and approved the final version of the manuscript. Acknowledgement We thank Dr. Arthur Arnold from UCLA for his courtesy in providing us Kdm6a and Kdm5c flox mice. Data Availability The datasets used and/or analyzed in the present study are available from the corresponding author upon reasonable request. References Balderman S, Lichtman MA. A history of the discovery of random X chromosome inactivation in the human female and its significance. Rambam Maimonides Med J, 2011. 2(3). McCullough LD, et al. Stroke sensitivity in the aged: sex chromosome complement vs. gonadal hormones. Aging. 2016;8(7):1432–41. Tran N, Broun A, Ge K. Lysine Demethylase KDM6A in Differentiation, Development, and Cancer. Mol Cell Biol, 2020. 40(20). Outchkourov NS, et al. Balancing of histone H3K4 methylation states by the Kdm5c/SMCX histone demethylase modulates promoter and enhancer function. Cell Rep. 2013;3(4):1071–9. Leonardi E, et al. Expanding the genetics and phenotypic spectrum of Lysine-specific demethylase 5C (KDM5C): a report of 13 novel variants. Eur J Hum Genet. 2023;31(2):202–15. Cheray M, Joseph B. Epigenetics control microglia plasticity. Front Cell Neurosci. 2018;12:243. Patnala R, et al. HDAC inhibitor sodium butyrate-mediated epigenetic regulation enhances neuroprotective function of microglia during ischemic stroke. Mol Neurobiol. 2017;54:6391–411. Qiu M, Xu E, Zhan L. Epigenetic Regulations of Microglia/Macrophage Polarization in Ischemic Stroke. Front Mol Neurosci. 2021;14:697416. Kong Q, et al. HDAC4 in ischemic stroke: mechanisms and therapeutic potential. Clin epigenetics. 2018;10:1–9. Stanzione R et al. Pathogenesis of Ischemic Stroke: Role of Epigenetic Mechanisms. Genes (Basel), 2020. 11(1). Ng GY, et al. Epigenetic regulation of inflammation in stroke. Ther Adv Neurol Disord. 2018;11:1756286418771815. Brinkman AB, et al. Histone modification patterns associated with the human X chromosome. EMBO Rep. 2006;7(6):628–34. Moreira de Mello JC, et al. Early X chromosome inactivation during human preimplantation development revealed by single-cell RNA-sequencing. Sci Rep. 2017;7(1):10794. Chaligné R, Heard E. X-chromosome inactivation in development and cancer. FEBS Lett. 2014;588(15):2514–22. Lee JT. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 2011;12(12):815–26. van Haaften G, et al. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer. Nat Genet. 2009;41(5):521–3. Ferrari KJ, et al. Polycomb-Dependent H3K27me1 and H3K27me2 Regulate Active Transcription and Enhancer Fidelity. Mol Cell. 2014;53(1):49–62. Kim K, et al. H3K27me1 is essential for MMP-9-dependent H3N-terminal tail proteolysis during osteoclastogenesis. Epigenetics Chromatin. 2018;11(1):23. Yu Y, et al. H3K27me3-H3K4me1 transition at bivalent promoters instructs lineage specification in development. Cell Biosci. 2023;13(1):66. Cheng J, et al. A role for H3K4 monomethylation in gene repression and partitioning of chromatin readers. Mol Cell. 2014;53(6):979–92. Al Mamun A, et al. Microglial IRF5-IRF4 regulatory axis regulates neuroinflammation after cerebral ischemia and impacts stroke outcomes. Proc Natl Acad Sci U S A. 2020;117(3):1742–52. Ngwa C, et al. Regulation of microglial activation in stroke in aged mice: a translational study. Aging. 2022;14(15):6047–65. Qi S, et al. X, but not Y, Chromosomal Complement Contributes to Stroke Sensitivity in Aged Animals. Transl Stroke Res. 2023;14(5):776–89. Qi S, et al. X chromosome escapee genes are involved in ischemic sexual dimorphism through epigenetic modification of inflammatory signals. J Neuroinflammation. 2021;18(1):70. Al Mamun A, et al. Neuronal CD200 Signaling Is Protective in the Acute Phase of Ischemic Stroke. Stroke. 2021;52(10):3362–73. Liu F, Schafer DP, McCullough LD. TTC, fluoro-Jade B and NeuN staining confirm evolving phases of infarction induced by middle cerebral artery occlusion. J Neurosci Methods. 2009;179(1):1–8. Misrani A, et al. Brain endothelial CD200 signaling protects brain against ischemic damage. Brain Res Bull. 2024;207:110864. Ngwa C et al. Phosphorylation of Microglial IRF5 and IRF4 by IRAK4 Regulates Inflammatory Responses to Ischemia. Cells, 2021. 10(2). Kraeuter AK, Guest PC, Sarnyai Z. The Open Field Test for Measuring Locomotor Activity and Anxiety-Like Behavior. Methods Mol Biol, 2019. 1916: 99–103. Meyer OA, et al. A method for the routine assessment of fore-and hindlimb grip strength of rats and mice. Neurobehavioral Toxicol. 1979;1(3):233–6. Cabe PA, et al. A simple recording grip strength device. Pharmacol Biochem Behav. 1978;8(1):101–2. Smith JP, et al. Quantitative measurement of muscle strength in the mouse. J Neurosci Methods. 1995;62(1–2):5–19. Agustinus AS, et al. Epigenetic dysregulation from chromosomal transit in micronuclei. Nature. 2023;619(7968):176–83. Franklin R, et al. Regulation of chromatin accessibility by the histone chaperone CAF-1 sustains lineage fidelity. Nat Commun. 2022;13(1):2350. Barnes E, et al. Ultra-sensitive class I tetramer analysis reveals previously undetectable populations of antiviral CD8 + T cells. Eur J Immunol. 2004;34(6):1570–7. Skene PJ, Henikoff S. An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife, 2017. 6. Ngwa C, et al. Central IRF4/5 Signaling Are Critical for Microglial Activation and Impact on Stroke Outcomes. Transl Stroke Res; 2023. Jurga AM, Paleczna M, Kuter KZ. Overview of General and Discriminating Markers of Differential Microglia Phenotypes. Front Cell Neurosci. 2020;14:198. Butturini E, et al. STAT1 drives M1 microglia activation and neuroinflammation under hypoxia. Arch Biochem Biophys. 2019;669:22–30. Bok E, et al. Modulation of M1/M2 polarization by capsaicin contributes to the survival of dopaminergic neurons in the lipopolysaccharide-lesioned substantia nigra in vivo. Exp Mol Med. 2018;50(7):1–14. Liu Y, et al. The inactive X chromosome accumulates widespread epigenetic variability with age. Clin Epigenetics. 2023;15(1):135. Juchniewicz P, et al. X-chromosome inactivation patterns depend on age and tissue but not conception method in humans. Chromosome Res. 2023;31(1):4. Fang H, Disteche CM, Berletch JB. X Inactivation and Escape: Epigenetic and Structural Features. Front Cell Dev Biol. 2019;7:219. Berletch JB, et al. Genes that escape from X inactivation. Hum Genet. 2011;130(2):237–45. Al Mamun A, et al. Interferon regulatory factor 4/5 signaling impacts on microglial activation after ischemic stroke in mice. Eur J Neurosci. 2018;47(2):140–9. Zhao S-c, et al. Age-related differences in interferon regulatory factor-4 and – 5 signaling in ischemic brains of mice. Acta Pharmacol Sin. 2017;38(11):1425–34. Sealy-Jefferson S, et al. Age-and ethnic-specific sex differences in stroke risk. Gend Med. 2012;9(2):121–8. Petrea RE, et al. Gender differences in stroke incidence and poststroke disability in the Framingham heart study. Stroke. 2009;40(4):1032–7. McCullough LD, Hurn PD. Estrogen and ischemic neuroprotection: an integrated view. Trends Endocrinol Metabolism. 2003;14(5):228–35. Manwani B, et al. Sex differences in ischemic stroke sensitivity are influenced by gonadal hormones, not by sex chromosome complement. J Cereb Blood Flow Metabolism. 2015;35(2):221–9. McCullough LD, et al. Stroke sensitivity in the aged: sex chromosome complement vs. gonadal hormones. Aging. 2016;8(7):1432. Li J, et al. The number of X chromosomes influences protection from cardiac ischaemia/reperfusion injury in mice: one X is better than two. Cardiovasc Res. 2014;102(3):375–84. Chen X, et al. The number of x chromosomes causes sex differences in adiposity in mice. PLoS Genet. 2012;8(5):e1002709. Ronning KE, Karlen SJ, Burns ME. Structural and functional distinctions of co-resident microglia and monocyte-derived macrophages after retinal degeneration. J Neuroinflammation. 2022;19(1):299. Guilliams M, Mildner A, Yona S. Developmental and Functional Heterogeneity of Monocytes. Immunity. 2018;49(4):595–613. Manjally AV, Tay TL. Attack of the Clones: Microglia in Health and Disease. Front Cell Neurosci. 2022;16:831747. Zito A, et al. Escape from X-inactivation in twins exhibits intra- and inter-individual variability across tissues and is heritable. PLoS Genet. 2023;19(2):e1010556. Werner JM, et al. Variability of cross-tissue X-chromosome inactivation characterizes timing of human embryonic lineage specification events. Dev Cell. 2022;57(16):1995–e20085. Mengel-From J, et al. Skewness of X-chromosome inactivation increases with age and varies across birth cohorts in elderly Danish women. Sci Rep. 2021;11(1):4326. Roberts AL et al. Age acquired skewed X chromosome inactivation is associated with adverse health outcomes in humans. Elife, 2022. 11. Weinhold B. Epigenetics: the science of change. Environ Health Perspect. 2006;114(3):A160–7. Bannister AJ, Kouzarides T. Regulation of chromatin by histone modifications. Cell Res. 2011;21(3):381–95. Holoch D, Moazed D. RNA-mediated epigenetic regulation of gene expression. Nat Rev Genet. 2015;16(2):71–84. Morris-Blanco KC, et al. Epigenetic mechanisms and potential therapeutic targets in stroke. J Cereb Blood Flow Metab. 2022;42(11):2000–16. Kumar A, et al. Epigenetics Mechanisms in Ischemic Stroke: A Promising Avenue? J Stroke Cerebrovasc Dis. 2021;30(5):105690. Gade P, Kalvakolanu DV. Chromatin immunoprecipitation assay as a tool for analyzing transcription factor activity. Transcriptional Regulation: Methods Protocols, 2012: 85–104. Agustinus AS, et al. Epigenetic dysregulation from chromosomal transit in micronuclei. Nature. 2023;619(7968):176–83. Kaya-Okur HS et al. CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nature Communications, 2019. 10(1): 1930. Salma M et al. High-throughput methods for the analysis of transcription factors and chromatin modifications: Low input, single cell and spatial genomic technologies. Blood Cells, Molecules, and Diseases, 2023. 101: 102745. Mozzetta C, et al. Sound of silence: the properties and functions of repressive Lys methyltransferases. Nat Rev Mol Cell Biol. 2015;16(8):499–513. Cuyàs E, et al. Metformin directly targets the H3K27me3 demethylase KDM6A/UTX. Aging Cell. 2018;17(4):e12772. Xiao M, et al. Elevated histone demethylase KDM5C increases recurrent miscarriage risk by preventing trophoblast proliferation and invasion. Cell Death Discov. 2022;8(1):495. Chen J, et al. Kdm6a suppresses the alternative activation of macrophages and impairs energy expenditure in obesity. Cell Death Differ. 2021;28(5):1688–704. Abu-Hanna J, et al. Therapeutic potential of inhibiting histone 3 lysine 27 demethylases: a review of the literature. Clin Epigenetics. 2022;14(1):98. Trempenau ML, et al. The histone demethylase KDM5C functions as a tumor suppressor in AML by repression of bivalently marked immature genes. Leukemia. 2023;37(3):593–605. Pavlenko E, et al. Functions and Interactions of Mammalian KDM5 Demethylases. Front Genet. 2022;13:906662. Liu R et al. Post-translational modifications of histones: Mechanisms, biological functions, and therapeutic targets. MedComm (2020), 2023. 4(3): e292. Zhang D, et al. Metabolic regulation of gene expression by histone lactylation. Nature. 2019;574(7779):575–80. Kouzarides T. Chromatin modifications and their function. Cell. 2007;128(4):693–705. Chen LJ, et al. The role of lysine-specific demethylase 6A (KDM6A) in tumorigenesis and its therapeutic potentials in cancer therapy. Bioorg Chem. 2023;133:106409. Strahl BD, Allis CD. The language of covalent histone modifications. Nature. 2000;403(6765):41–5. Qi S, et al. X chromosome escapee genes are involved in ischemic sexual dimorphism through epigenetic modification of inflammatory signals. J Neuroinflamm. 2021;18:1–16. Hwang J-Y, Aromolaran KA, Zukin RS. Epigenetic Mechanisms in Stroke and Epilepsy. Neuropsychopharmacology. 2013;38(1):167–82. Baron J-C. Protecting the ischaemic penumbra as an adjunct to thrombectomy for acute stroke. Nat Reviews Neurol. 2018;14(6):325–37. Qu L, et al. Histone demethylases in the regulation of immunity and inflammation. Cell Death Discovery. 2023;9(1):188. Önder Ö, et al. Progress in epigenetic histone modification analysis by mass spectrometry for clinical investigations. Expert Rev Proteom. 2015;12(5):499–517. Hong S et al. Identification of JmjC domain-containing UTX and JMJD3 as histone H3 lysine 27 demethylases. Proceedings of the National Academy of Sciences, 2007. 104(47): 18439–18444. Zhang S et al. Targeting epigenetic regulators for inflammation: Mechanisms and intervention therapy. MedComm (2020), 2022. 3(4): e173. Yang X, et al. Zoledronic acid regulates the synthesis and secretion of IL-1β through Histone methylation in macrophages. Cell Death Discov. 2020;6:47. Corbin AL et al. IRF5 guides monocytes toward an inflammatory CD11c(+) macrophage phenotype and promotes intestinal inflammation. Sci Immunol, 2020. 5(47). Yang L, et al. Monocytes from Irf5-/- mice have an intrinsic defect in their response to pristane-induced lupus. J Immunol. 2012;189(7):3741–50. Ngwa C, et al. Central IRF4/5 Signaling Are Critical for Microglial Activation and Impact on Stroke Outcomes. Transl Stroke Res. 2024;15(4):831–43. Additional Declarations No competing interests reported. Supplementary Files SupplementaryManuscriptDraft08262024.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4986866","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":359034649,"identity":"c0f0a493-81a7-41f9-b9c6-2cb61f40e3bf","order_by":0,"name":"Conelius Ngwa","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Conelius","middleName":"","lastName":"Ngwa","suffix":""},{"id":359034650,"identity":"b5406f95-f4e0-4be5-aba0-701ee13bb413","order_by":1,"name":"Afzal Misrani","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Afzal","middleName":"","lastName":"Misrani","suffix":""},{"id":359034651,"identity":"3010ef57-1283-45ba-9899-41217be6c0a4","order_by":2,"name":"Kanaka Valli Manyam","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Kanaka","middleName":"Valli","lastName":"Manyam","suffix":""},{"id":359034652,"identity":"532ab2cd-6cad-47e7-8ca4-62188df42a71","order_by":3,"name":"Yan Xu","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Xu","suffix":""},{"id":359034653,"identity":"4d360b2f-f24a-43d6-81c2-600be8bb3bcd","order_by":4,"name":"Shaohua Qi","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Shaohua","middleName":"","lastName":"Qi","suffix":""},{"id":359034654,"identity":"6a3b0c79-c5a2-480e-a422-aa64cb2593be","order_by":5,"name":"Romana Sharmeen","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Romana","middleName":"","lastName":"Sharmeen","suffix":""},{"id":359034656,"identity":"bd78eda2-04d8-4a34-9e24-3e806ec7231e","order_by":6,"name":"Louise McCullough","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":false,"prefix":"","firstName":"Louise","middleName":"","lastName":"McCullough","suffix":""},{"id":359034658,"identity":"c0d94ca4-3626-443b-9a63-9350f31d43b7","order_by":7,"name":"Fudong Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYBAC+wMMBiA6gY2B+QADYwNUmAePFgMGuBa2BIaDDQwSxGsBKjMgUotE8sbHBb8YEvgkcr5Jf9zBUKfbfoDxwds2PH6RSCs2ntkHdJhE7jaJg2cYJMzOJDAbzsWjxUAix0yatwempQ2o5QYDmzQvcVpynsG0sP8mqIXnB1gLG9wWZrxaeJ4VG/M2SCSw8TwztjjbJiG57Uxis+Scc3i0sANDjOePTb18e/LDG5VtNvxmxw8f/PCmDLcWMGBsk4AxQQx4GsAH/hChZhSMglEwCkYuAACIWkjPBVkSDQAAAABJRU5ErkJggg==","orcid":"","institution":"The University of Texas Health Science Center at Houston, McGovern Medical School","correspondingAuthor":true,"prefix":"","firstName":"Fudong","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-08-27 21:27:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4986866/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4986866/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65464109,"identity":"1052f2cf-ae49-4abc-96f1-5bd2ead74429","added_by":"auto","created_at":"2024-09-27 18:54:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":208180,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/8421f9fbbd65ed8e9e99d957.jpg"},{"id":65464111,"identity":"b602f0f4-0910-48c5-bcf8-cb019c9c70b8","added_by":"auto","created_at":"2024-09-27 18:54:58","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":518991,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/76286035edb20cd05c90d911.jpg"},{"id":65464110,"identity":"acb6b564-01e2-4ecc-9224-1934f3a8da24","added_by":"auto","created_at":"2024-09-27 18:54:58","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":334988,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/15dd01e3dc310ca28515f534.jpg"},{"id":65464427,"identity":"509eaf82-c631-4d7d-a584-df6c82f34003","added_by":"auto","created_at":"2024-09-27 19:02:58","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":627511,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/222616985aed83446c85eb20.jpg"},{"id":65464115,"identity":"ddd63150-d87e-4f6e-9a10-319f0cbf57aa","added_by":"auto","created_at":"2024-09-27 18:54:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":256517,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/5064a35b80ed4d5ed9378c3d.jpg"},{"id":65464430,"identity":"deb40fa6-455a-46d9-8cc1-a5b5bdbf3385","added_by":"auto","created_at":"2024-09-27 19:02:59","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":350819,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/0706d28936581768828ed965.jpg"},{"id":65464429,"identity":"14de83ba-4909-4c9f-bb69-e839d2bd1a80","added_by":"auto","created_at":"2024-09-27 19:02:58","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":379531,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/668288924d582e4b3315ae20.jpg"},{"id":65464113,"identity":"db2dbe65-2190-48ad-aa27-e4069ed74801","added_by":"auto","created_at":"2024-09-27 18:54:58","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":334898,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/dc21f51188de7b408497e85e.jpg"},{"id":65464428,"identity":"e117b589-e38f-4f36-8c5e-44bb08a2e54b","added_by":"auto","created_at":"2024-09-27 19:02:58","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":320496,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/499296628382007096cd3fe0.jpg"},{"id":67661193,"identity":"109eb363-9cb7-4aff-bfd6-ea26f79d2172","added_by":"auto","created_at":"2024-10-28 13:02:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4027410,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/af9c150a-cf1c-4a86-af9f-f25b8bdaeac5.pdf"},{"id":65464118,"identity":"1b83e4be-8010-4bfd-95f8-1e759e966b95","added_by":"auto","created_at":"2024-09-27 18:54:59","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":760267,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryManuscriptDraft08262024.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4986866/v1/8fc32a64fbe47a1664122ae4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Escape of Kdm6a from X chromosome is detrimental to ischemic brains via IRF5 signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eStroke sensitivity in the aged is driven primarily by sex chromosomes [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], and through a variety of processes including gene epigenetic modifications such as histone methylation [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]and demethylation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Histone modifications are indispensable in the regulation of genes for microglia polarization [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] and the pathological processes of ischemia [\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In humans, histone modification patterns are associated with X chromosome, especially those genes that escape X-chromosome inactivation (XCI) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Generally, X-linked genes escape XCI at the embryonic stage [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], but it is also suggested that some genes escape with aging [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], leading to gene dosage imbalanced between males and females. Lysine Demethylase 6a (\u003cem\u003eKdm6a)\u003c/em\u003e and \u003cem\u003eKdm5c\u003c/em\u003e, are escapee genes that encode demethylases of H3K27Me3 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and H3K4Me3 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], respectively. The demethylated form H3K27Me1 is active [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and H3K4Me1 suppressive for gene transcription [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur previous studies have shown that: 1) microglial interferon regulatory factor 5 (IRF5) and IRF4 regulate neuroinflammation in young [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and aged mice [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]; 2) X chromosomal complement contributes to stroke sensitivity in aged animals [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]; and 3) the X escapee genes \u003cem\u003eKdm6a\u003c/em\u003e and \u003cem\u003eKdm5c\u003c/em\u003e were involved in IRF5/4 expression and neuroinflammation after stroke [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, the mechanism by which \u003cem\u003eKdm6a/Kdm5c\u003c/em\u003e modulates IRF5/4 gene signaling and neuroinflammation after stroke is still elusive. We hypothesized that \u003cem\u003eKdm6a/5c\u003c/em\u003e regulate IRF5/4 expression through epigenetic modification of histones, mediate microglial activation/neuroinflammation after stroke, and impact outcomes. To test our hypothesis, we generated microglial \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e conditional knockout (CKO) mice, in which one allele of \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e is deleted, and subjected the mice to a 60-min middle cerebral artery occlusion (MCAO). Since stroke is a disease that mainly affects the elderly, aged mice (17\u0026ndash;20 months) were used in the present study to enhance the translational research potential.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal models\u003c/h2\u003e \u003cp\u003e\u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e (CKO) mice were generated by mating \u003cem\u003eKdm6a/5c\u003c/em\u003e flox/+ female mice (provided by Dr. Author Arnold, UCLA) with CX3CR1-CreER (strain # 021160, The Jackson Laboratory) males, followed by tamoxifen (TMX) induction [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. \u003cem\u003eKdm6a/5c\u003c/em\u003e CKO female (there is only one allele of the gene in microglia), \u003cem\u003eKdm6a/5c\u003c/em\u003e flox/flox (fl/fl; two alleles) female, and \u003cem\u003eKdm6a/5c\u003c/em\u003e flox/y (fl/y; one allele) male, aged mice (17\u0026ndash;20 months-old) were used in all experiments. All mice were group-housed under pathogen-free conditions with a 12-to-12-h day-night cycle and had access to food and water \u003cem\u003ead libitum\u003c/em\u003e. Mice were randomly chosen and used after they were examined free of aberrations or other abnormalities. All studies were conducted in accordance with NIH guidelines for the care and use of laboratory animals and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at Houston McGovern Medical School.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eIschemic stroke model\u003c/h2\u003e \u003cp\u003eCerebral ischemia was induced mice by reversible MCAO and under isoflurane anesthesia as previously described [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Briefly, a midline ventral neck incision was made, and unilateral MCAO was performed by inserting a 6\u0026ndash;0 silicone-coated suture into the right internal carotid artery 6 mm from the internal carotid/ pterygopalatine artery bifurcation via an external carotid artery stump. Reperfusion was performed by withdrawing the suture 60-min after the occlusion. Rectal temperature was maintained at 36.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u0026deg;C during surgery with an automated TC-1000 temperature-control feedback system (CWE, Inc., Ardmore, PA, USA). All mice were monitored on a daily basis and then sacrificed at 2 days (for histone mechanistic studies) or 3 days (for stroke outcomes and immune responses) of reperfusion. Sham-operated animals underwent the same procedure including exposure to isoflurane and a midline ventral neck incision, but the suture was not advanced into the MCA. Laser Doppler flowmetry (Moor Instruments Ltd, UK) was applied to measure CBF through the skull at the right temporal fossa. Only the mice whose CBF showed a drop of over 85% of baseline after MCAO was included in the following experiments. The mortality after MCAO was 25% after 2 days stroke and 35% after 3 days stroke. The size of the MCAO-induced infarct was measured by Cresyl violet (CV) staining as described in [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eFlow cytometry was performed as previously described with modifications [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Briefly mice were euthanized and transcardially perfused with 1% heparin in cold PBS, and the brains were harvested. The ipsilateral hemispheres were diced and placed in complete RPMI 1640 (cat # 30\u0026ndash;200, ATCC) medium and mechanically and enzymatically digested in collagenase/dispase (1 mg/mL) and DNAse (10 mg/mL) purchased from Roche Diagnostics, for 1 h, and at 37 ◦C. The cell suspension was diluted in regular RPMI 1640 and then filtered through a 70 \u0026micro;m filter and placed into a 70%/ 30% Percoll gradient. Cells were harvested from the interphase portion of the gradient, washed, and blocked with purified rat anti-mouse CD16/CD32 (mouse BD FC block, cat # 553142) and then stained for extracellular or intracellular markers and using primary antibody-conjugated fluorophores including: anti-Ly6C Brilliant violet 605 (cat # 128035), anti-IL-10 PerCP-Cy5.5 (cat # 505028) purchased from BioLegend. Anti-CD45.2 eF450 (cat # 48-0451-82), anti-CD11b AF488 (cat # 53-0112-82), anti-IL-1β PE (cat # 12-7114-82), anti-Ly6G PE-eFluor 610 (cat # 61-9668-82), anti-TNFα PE-Cy7 (cat # 25-7321-82), anti-IL-4 APC (Cat # 17-7041-82), anti-CD206 AF700 (cat # 56-2061-82), and anti-CD68 APC-eF780 (cat # 47-0681-82) purchased from ThermoFisher Scientific. For live/dead cell discrimination, a fixable viability dye, carboxylic acid succinimidyl ester (CASE-AF350, Invitrogen), was used. Fluorescence minus ones (FMOs) and beads compensations were used for all staining experiments. Data were acquired on Cytoflex_AS41045 (Beckman Coulter) and analyzed using FlowJo (Treestar Inc.).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003emRNA extraction and real-time polymerase chain reaction (RT-PCR)\u003c/h2\u003e \u003cp\u003eRT-PCR was performed as in [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] with slight modifications. Briefly total RNA was extracted using RNeasy Mini Kit_74104 (QIAGEN, Germantown, MD, USA) according to the manufacturer\u0026rsquo;s protocol, and quantified using NANODROP ONE (Thermo Fisher Scientific). The RNA was converted to cDNA by iScript\u0026trade; Reverse Transcription Supermix_1708841. C1000 Touch Thermal Cycler CFX384 Real-Time System (Bio-Rad, Hercules, CA, USA) and the SsoAdvanced Universal SYBR Green Supermix_1725274 (Bio-Rad) were used to perform qPCR. The following gene primers from Integrated DNA Technologies (Coralville, IA, USA) were used: Kdm6a F_ CCAATCCCCGCAGAGCTTACCT, R_TTGCTCGGAGCTGTTCCAAGTG; Kdm5c F_ACCCACCTGGCAAAAACATTGG, R_ACTGTCGAAGGGGGATGCTGTG and the housekeeping gene GAPDH F_GTGTTCCTACCCCCAATGTGT, R_ ATTGTCATACCAGGAAATGAGCTT [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The results are reported as normalized fold changes in mRNA, which were determined by the ΔΔCt method using the threshold cycle (Ct) value.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eNeurologic deficit scores (NDS)\u003c/h2\u003e \u003cp\u003eNeurological deficits were assessed by the Benderson score system from 0 to 4 as in [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Briefly 0-no deficit; 1-forelimb weakness, torso turning to the ipsilateral side when held by the tail; 2-circling to the affected side; 3-unable to bear weight on affected side, and 4-no spontaneous activity or barrel rolling.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eOpen field\u003c/h2\u003e \u003cp\u003eThe open field test (OFT) is a common measure of exploratory behavior, general activity and anxiety-like behavior in rodents, where both the quality and quantity of the activity can be measured [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Briefly, mice were placed in a single arena facing the middle of a wall. Mice were allowed to explore the arena for 20 min [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. After the 20 min duration, the mice were returned to the home cage and arena cleaned with 70% ethanol. The distance moved was analyzed as the locomotor and exploratory behavior of the mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGrip strength\u003c/h2\u003e \u003cp\u003eWe used the conventional forelimb grip strength test to assess motor function in the mice [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Briefly, a mouse was gently pulled by its tail ensuring the mouse grips the top portion of the grid and the torso remains horizontal and record the maximal grip strength value of the mouse that is displayed on the screen. This procedure was repeated 3 times to obtain 3 forelimb grip strength measurements for each mouse, and the average strength was calculated.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCleavage under targets \u0026amp; release using nuclease (CUT\u0026amp;RUN) assays\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIRF DNA binding to histones in microglia was measured by using the CUTANA\u0026trade; ChIC/CUT\u0026amp;RUN Kit (Cat # 14-1048, Epicypher)[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and CUTANA\u0026trade; DNA purification Kit (Cat # 14\u0026ndash;0050)[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], with modifications. Briefly, microglia were isolated for CUT\u0026amp;RUN from mouse brain tissue, using ANTI-PE MICROBEADS (Cat # 130-048-801, Miltenyi Biotech) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] and PE-TMEM119 monoclonal antibody antibody (Cat # 12-6119-86), binding assays. The ANTI-PE MICROBEADS isolated microglia, were washed with spermidine formulated wash-buffer, and then bound onto activated Concanavalin A conjugated paramagnetic beads (Cat # 21-1401, Epicypher) by gentle agitation for 10 mins and at RT. The cells bound to Concanavalin A beads were then incubated overnight with 2 \u0026micro;g of anti-H3K4Me1 (Cat # 13\u0026ndash;0057, Epicypher), anti-H3K4Me3 (Cat # 13\u0026ndash;0041, Epicypher), anti-H3K27Me1 (Cat # 61015, Active Motive), or anti-H3K27Me3 (Cat # 13\u0026ndash;0055, Epicypher) antibody. After overnight incubation, the antibody-cell-bead complex was washed with wash buffer containing 5% digitonin (permeabilization buffer), and then 3 \u0026micro;L of the cleavage CUTANA\u0026trade; pAG-MNase enzyme (cat# 15-1016, Epicypher)[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], was added and incubated at RT for 10 minutes with no agitation. The complex was further washed with permeabilization buffer and then resuspended in permeabilization buffer (50 \u0026micro;L) and cooled in ice for 4 mins. Digestion, by the pAG-MNase enzyme incorporated into the cells was induced by addition of calcium chloride (100 mM, 1 \u0026micro;L), followed by incubation for 2 hr and at 4 \u003csup\u003eo\u003c/sup\u003eC. At the end of the digestion step, stop buffer (33 \u0026micro;L, cat # 14-1048, Epicypher) was added to the digestion complex and the complex incubated for 30 mins and at 37 \u003csup\u003eo\u003c/sup\u003eC without shaking, in order to release DNA fragments. The supernatant containing the released DNA fragments was collected by centrifugation at 16,000 x g, at 4 \u003csup\u003eo\u003c/sup\u003eC and for 2 min. Total DNA was purified by the CUTANA\u0026trade; DNA purification Kit (Cat # 14\u0026ndash;0050) following the vendor\u0026rsquo;s specifications. DNA was quantified using NANODROP ONE (Thermo Scientific). IRF5 and IRF4 in the purified DNA was quantified by qPCR and using primers including: IRF5 F_5\u0026rsquo;-GTTTGGTCTGGGTTTTGAGTC-3\u0026rsquo;, R_5\u0026rsquo;-ATGTCTGTAACCCTAGCACTTG-3\u0026rsquo;; IRF4 F_5\u0026rsquo;-AATGGGAAACTCCGACAGTG-3\u0026rsquo;, R_5\u0026rsquo;-TCACGATTGTAGTCCTGCTTG-3\u0026rsquo;; GAPDH F_5\u0026rsquo;-GTGTTCCTACCCCCAATGTGT-3\u0026rsquo;, R_5\u0026rsquo;-ATTGTCATACCAGGAAATGAGCTT-3\u0026rsquo;. The results are reported as normalized fold changes in DNA gene expression, which were determined by the ΔΔCt method using the threshold cycle (Ct) value for gene of interest.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePlasma and brain cytokine levels by conventional enzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eWe used the same procedure as in [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] with modification. Briefly blood samples were obtained by cardiac puncture with EDTA-soaked syringed-needles and then centrifuged at 15000 RPM for 20 min, and at 4\u0026deg; C. Brain tissue in non-pyrogenic 5 mL polystyrene round-bottom tubes (Ref # 352235, Corning USA) were homogenized using glass pistons, in complete NP40 buffer, and also centrifuged at 15000 RPM for 20 mins, and at 4 \u003csup\u003eo\u003c/sup\u003eC. After centrifugation, the supernatant was collected and analyzed with Nunc\u0026trade; MaxiSorp\u0026trade; ELISA plates_423501 and the ELISA MAX\u0026trade; Deluxe kits including TNF_430904, IL-1β_432604, IL-4_431104 and IL-10_431414 (BioLegend USA). Signals were measured at 450 nm in EnSpire\u0026trade; Multimode Plate Reader (Perkin Elmer USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData from individual experiments were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM, and assessed by Student\u0026rsquo;s t test, One-way ANOVA or 2-way ANOVA with Tukey post hoc test for multiple comparisons using GraphPad Prism Software 10.1.2 (324). P\u0026thinsp;\u0026lt;\u0026thinsp;0.0500 was considered statistically significant. Investigators were blinded to mouse strains for stroke surgery, behavioral testing, infarct, and inflammation analysis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eValidation of microglial\u003c/b\u003e \u003cb\u003eKdm6a/Kdm5c\u003c/b\u003e \u003cb\u003eCKO mouse model\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe generated microglial \u003cem\u003eKdm6a\u003c/em\u003e and \u003cem\u003eKdm5c\u003c/em\u003e CKO female mouse models, by injecting TMX (75 mg/kg) to \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/+\u003c/sup\u003e:CX3CR1-CreER mice (16 months). Four weeks after the TMX injection, the mice were ready for downstream experiments. We validated the CKO mouse model (deletion of one allele of \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e in microglia) by isolating microglia (using anti-Tmem119 antibody and ANTI-PE microbeads), followed by q-PCR for \u003cem\u003eKdm6a/Kdm5c\u003c/em\u003e mRNA gene expression (fold change) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The \u003cem\u003eKdm6a/Kdm5c\u003c/em\u003e mRNA fold change was significantly reduced in CKO vs. fl/fl microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), indicating the success of the CKO model.\u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eKdm6a modulates IRF5 through H3K27Me3 demethylation\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur previous study [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] has suggested that Kdm6a is involved in regulation of IRF5 (pro-inflammatory) signaling. Here we further tested if Kdm6a, a demethylase of histone, can epigenetically modulate IRF5 transcription. We performed MCAO in three strains of mice: \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/y\u003c/sup\u003e (male; one allele of Kdm6a), \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e (female; two alleles), and \u003cem\u003eKdm6a\u003c/em\u003e CKO (female; one allele). At two days after MCAO, microglia were isolated, and CUT\u0026amp;RUN was performed to detect the amount of IRF5 DNA binding to either H3K27Me1(active form for gene expression) or H3K27Me3 (suppressive form). The ratio of IRF5 DNA binding with H3K27Me1 over H3K27Me3 is indicative of the predominance of IRF5 active or suppressive transcription. There was a significant increase in IRF5 DNA binding to H3K27Me3 in \u003cem\u003eKdm6a\u003c/em\u003e CKO vs. fl/fl, although no difference was found between strains in H3K27Me1 binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e\u0026amp;B\u003c/b\u003e). The binding ratio of H3K27Me1/H3K27Me3 was significantly higher in microglia isolated from Kdm6a \u003csup\u003efl/fl\u003c/sup\u003e mouse, when compared with either fl/y or CKO (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). There was no significant difference in IRF5 DNA binding to H3K4 between strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E, F). We also examined another transcription factor IRF4 (anti-inflammatory), but found IRF4 DNA binding to either H3K27 or H3K4 did not show any difference between groups (\u003cb\u003eSuppl. 1 A-F\u003c/b\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eKdm5c represses IRF5 transcription through H3K4Me3 demethylation\u003c/h2\u003e \u003cp\u003eNext, we examined the effect of another histone demethylase/X escapee gene, \u003cem\u003eKdm5c\u003c/em\u003e, on IRF5\u0026rsquo;s transcription with CUT\u0026amp;RUN assay, as \u003cem\u003eKdm5c\u003c/em\u003e was also previously found to be involved [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The demethylation of microglial H3K4Me3 (active form) by two alleles of \u003cem\u003eKdm5c\u003c/em\u003e in \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice induced a significant increase in IRF5 DNA binding to H3K4Me1 form (suppressive) compared with fl/y or CKO mice (both have one allele of \u003cem\u003eKdm5c\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The binding ratio of H3K4Me1/H3K4Me3 was significantly higher in the microglia from \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e vs. fl/y or CKO mice. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). We did not observe any significant difference in IRF5 DNA binding to H3K27 between strains (\u003cb\u003eSuppl. 2 A-C\u003c/b\u003e). Again, IRF4 DNA binding to either H3K27 or H3K4 did not show difference in these mice (Suppl. \u003cb\u003e2 D-I).\u003c/b\u003e Taken together, data of Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u0026amp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e suggest that IRF5 transcription is regulated by both Kdm6a and Kdm5c, with an active effect by the former but a suppressive effect by the latter.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eKdm6a/5c\u003c/b\u003e \u003cb\u003esignaling are pro-inflammatory after stroke\u003c/b\u003e\u003c/p\u003e \u003cp\u003eInflammatory responses to stroke can be determined by examination of infiltrating immune cells in the brain, microglial cell membrane and intracellular inflammatory mediator levels, plasma and brain cytokine levels [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. We first examined membrane and intracellular inflammatory markers in microglia by flow cytometry. The gating strategy for all immune cells is as shown in \u003cb\u003eSuppl. 3\u003c/b\u003e. CD68 and CD206 are established cell membrane markers for pro- and anti-inflammatory response of microglia respectively [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In stroke groups, CD68 was significantly increased in the microglia from \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e vs. fl/y mice, and Kdm5c\u003csup\u003efl/fl\u003c/sup\u003e mice had significantly higher CD68 than either fl/y or CKO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, E). However, CD206 expression on microglia did not differ between strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, F). We also examined intracellular markers (TNF-α, IL-1β, IL-4, and IL-10) in microglia, but two alleles of \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e did not induce higher expression of any of the cytokines compared with one allele of the two genes (\u003cb\u003eSuppl. 4\u003c/b\u003e). \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice had significantly higher plasma levels of IL-1β than fl/y mice; whereas \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice had higher levels of TNF-α than either fl/y and CKO mice after stroke (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). Negative results were found in other cytokines in these mice (\u003cb\u003eSuppl. 5\u003c/b\u003e). For cytokines assayed in whole brain homogenates, both \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice had significantly higher levels of TNF-α than either fl/y or CKO mice after stroke (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, C). Meanwhile \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e (but not \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e) mice showed a significant increase in IL-1β when compared with CKO (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, D). For anti-inflammatory cytokines, we only found a significant decrease in IL-4 in the \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e vs. CKO mice brains after stroke (\u003cb\u003eSuppl. 6A-D\u003c/b\u003e). We also observed significantly greater lymphocyte infiltration in the brains of \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice compared to fl/y or CKO mice after stroke, although there were no significant difference in monocyte or neutrophil infiltration between the strains (\u003cb\u003eSuppl. 7\u003c/b\u003e). All these data suggest that \u003cem\u003eKdm6a\u003c/em\u003e and \u003cem\u003eKdm5c\u003c/em\u003e signaling are pro-inflammatory after stroke in the aged.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTwo alleles of\u003c/b\u003e \u003cb\u003eKdm6a\u003c/b\u003e \u003cb\u003eexacerbate stroke injury in the aged\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe next evaluated stroke outcomes in \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e, fl/y, and CKO aged mice by examining infarct volumes and a battery of neurobehavior tests, three days after MCAO. We found that the striatal infarct in \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003e\u003cem\u003efl\u003c/em\u003e/fl\u003c/sup\u003e mice were significantly larger vs. fl/y mice. In addition, the fl/fl mice had significantly larger infarct in total ipsilateral hemisphere than fl/y or CKO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B). However, there were no significant differences between the strains in distance travelled (open field test) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC), grip strength (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD) and NDS (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE) at the acute timepoint (3d) after stroke.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eKdm5c\u0026rsquo;s\u003c/b\u003e \u003cb\u003eeffect on IRF5 transcription does not contribute to stroke outcomes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe also examined the effect of \u003cem\u003eKdm5c\u0026rsquo;s\u003c/em\u003e signaling on stroke outcomes, and found the similar results as that of \u003cem\u003eKdm6a\u003c/em\u003e. \u003cem\u003eKdm5c\u003c/em\u003e \u003csup\u003efl/fl\u003c/sup\u003e mice exhibited significantly larger infarcts in the striatum compared to fl/y or CKO mice after 3d of stroke, but no differences were observed in neurobehavior deficits (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-D). IRF5 signaling is detrimental in stroke [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], but in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e we found two alleles of \u003cem\u003eKdm5c\u003c/em\u003e suppressed IRF5 transcription. Our data (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e \u0026amp; Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e) suggest \u003cem\u003eKdm5c\u0026rsquo;s\u003c/em\u003e detrimental effect on stroke injury is independent of IRF5 signaling.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIt is well known that some X chromosome genes escape XCI [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], leading to gene dosage imbalance between males and females [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], which could impact post-stroke inflammation and outcomes once a stroke occurs. The present study focused on two X chromosome escapee genes, \u003cem\u003eKdm6a\u003c/em\u003e and \u003cem\u003eKdm5c\u003c/em\u003e, and investigated their epigenetic modulation of IRF5/IRF4 via demethylation of H3K27Me3/H3K4Me3 in aged microglia after stroke. IRF5-IRF4 regulatory axis has been previously found to be the determinant pathway that regulates microglial pro-/anti-inflammatory responses [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], and is critical in mediating stroke injury. The current data showed that Kdm6a and Kdm5c signaling both impact on one end of the axis, i.e. IRF5, but in an opposite pattern. Two alleles of \u003cem\u003eKdm6a\u003c/em\u003e led to active transcription of \u003cem\u003eIRF5\u003c/em\u003e; whereas two alleles of \u003cem\u003eKdm5c\u003c/em\u003e caused suppressive transcription of the pro-inflammatory factor. Two alleles of either \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e in microglia induced exacerbated pro-inflammatory responses after stroke, which led to worsened stroke injury. The different effect of the two Kdms on \u003cem\u003eIRF5\u003c/em\u003e transcripti on suggests that the two X escapee genes impact on stroke outcomes in the aged via different pathways.\u003c/p\u003e \u003cp\u003eStroke is a sexually dimorphic disease [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]; ischemic stroke sensitivity is mediated primarily by gonadal hormones in young population [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and by sex chromosomal complement in the aged [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. The contribution of the second X chromosome to stroke sensitivity in the aged has been observed in our previous study, with the two XCI escapee genes (\u003cem\u003eKdm6a/Kdm5c\u003c/em\u003e) involved [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The double expression of the two alleles of \u003cem\u003eKdm6a/Kdm5c\u003c/em\u003e due to the escape has been found also implicated in sex differences in cardiac infarction and adiposity [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. The current study utilized three animal models with different allele numbers of active \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e, and demonstrated the detrimental effects of both X escapee genes on stroke injury. Since the \u003cem\u003eKdm\u003c/em\u003e CKO female mice only has one allele of \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e and without Y chromosome, the comparison between CKO and \u003cem\u003eKdm\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e females is exclusively reflective of the effect of X chromosome dosage but none of Y effect. Therefore, the current data convincingly indicate that the escape of \u003cem\u003eKdm6a\u003c/em\u003e or \u003cem\u003eKdm5c\u003c/em\u003e plays a detrimental role in post-stroke inflammation and stroke injury, and support the rational that the Y chromosome has limited effect on the stroke sensitivity [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe current study focused on the effect of \u003cem\u003eKdm6a/5c\u003c/em\u003e escape from XCI in aged microglia on stroke, as microglia play important roles in initiating and perpetuating post-stroke neuroinflammation. The inducible CKO model utilized in the study makes it feasible to investigate gene escape in microglia specifically. Although CX3CR1-CreER system targets both microglia and infiltrating monocytes in the ischemic brain, we did not perform experiments until 6 weeks after TMX induction so that the microglia can be the sole target. Infiltrating monocytes have gone through \u0026lsquo;turnover\u0026rdquo;[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] and no longer bear the TMX induced gene knockout after 6 weeks of TMX induction; whereas microglia still have the KO due to their longevity [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Gene escape from XCI is random, and has tissue and cell variability [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. In addition, gene escape from XCI may be affected by various biological homeostasis changes including aging and stroke injury. XCI becomes unstable with age, which is a frequently proposed explanation for the phenotype spectrum of disease in females [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], suggesting some X-linked genes escape more easily with aging. Our previous study has found \u003cem\u003eKdm6a/5c\u003c/em\u003e were significantly higher expressed in sorted aged female vs. male microglia from na\u0026iuml;ve mice, and the sex difference was lost when evaluated in whole brain tissue in sham mice but present in brain tissue homogenates after stroke [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. These data suggest that \u003cem\u003eKdm6a/5c\u003c/em\u003e escape from XCI has cell variability, and is sensitive to stroke stimulus.\u003c/p\u003e \u003cp\u003eEpigenetic regulation of genes has been widely studied including DNA methylation [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e], histone [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] and non-coding RNAs [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e] modifications, with growing interest in exploring the related regulatory mechanisms underlying neuroinflammation in stroke [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Techniques such as chromatin immunoprecipitation (ChIP) [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], and CUT\u0026amp;RUN [\u003cspan additionalcitationids=\"CR68\" citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e] have accelerated the advance of epigenetic studies, by elucidating gene-protein interactions and the downstream targets. Epigenetics involves histones which serve as \u0026ldquo;gatekeepers\u0026rdquo; to modulate DNA replication/transcription and gene expression [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. Kdm6a and Kdm5c are demethylases for H3K27Me3 [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e] and H3K4Me3 [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e], and the demethylation of the two histones induces active and a transcriptive effect on gene transcription [\u003cspan additionalcitationids=\"CR74 CR75\" citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e], respectively. Recently we have demonstrated by ChIP that the inflammatory transcription factors, IRF 5/4, bind to H3K27Me3 or H3K4Me3, suggesting the two IRFs are subjected to the epigenetic modulation of the histones [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Histones contain five components: H1, H2A, H2B, H3, and H4 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and undergo post-translational modifications of the N-terminal tail by acetylation, methylation, phosphorylation, ubiquitination, demethylation, and lactylation [\u003cspan additionalcitationids=\"CR78 CR79\" citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]. The modifications of histone tails affect the interaction of histones and DNA, and alter the structure and stability of chromatin [\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e], and regulate the gene transcription through modulating the affinity of transcription factors and structural gene promoters [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. X chromosome-linked genes have been shown to play important roles in epigenetic modification of genes related to post-stroke inflammation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]. Our data show that kdm6a/5c both regulate \u003cem\u003eIRF5\u003c/em\u003e transcription as in (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u0026amp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), however in an opposite pattern (active vs. suppressive) through different histone demethylation, reflecting the complex nature of histone chromatin accessibility to transcriptional elements of the \u003cem\u003eIRF5\u003c/em\u003e gene after stroke. Epigenetic mechanisms after stroke are critical in the molecular pathophysiology of the disease, and are potential therapeutic targets [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e] to salvage the hypoperfused ischemic penumbra that has not yet evolved into infarcted tissue [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]. The present study provided potential epigenetic avenues to target XCI escapee genes to regulate the expression of the pro-inflammatory transcription factor IRF5.\u003c/p\u003e \u003cp\u003eIRF5 is a well-established pro-inflammatory transcription factor responsible for mediating microglial production of inflammatory cytokines [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Of note, our data demonstrated that Kdm6a and Kdm5c signaling have opposite effects on IRF5 transcription (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u0026amp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). However, the escape of both \u003cem\u003eKdms\u003c/em\u003e from XCI has pro-inflammatory effects including promoting microglial pro-inflammatory response (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e), increasing plasma/brain levels of pro-inflammatory cytokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u0026amp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003e), and both led to exacerbated stroke injury (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u0026amp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The active effect of Kdm6a on \u003cem\u003eIRF5\u003c/em\u003e transcription is logic to the downstream pro-inflammatory response and worsened stroke injury, but the suppressive effect of Kdm5c on \u003cem\u003eIRF5\u003c/em\u003e seems irrelevant to the downstream outcomes. Different \u003cem\u003eKdm\u003c/em\u003e family proteins finetune the switch of gene expression by manipulating active or repressive histone methylation markers, thus participating in various links of immune cells and inflammatory activities [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e]. \u003cem\u003eKdm6a\u003c/em\u003e is a demethylase for H3K27Me3 [\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e], whereas \u003cem\u003eKdm5c\u003c/em\u003e is responsible for demethylation of H3K4Me3 [\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]. Our data are consistent with this as H3K4-IRF5 axis was not affected by Kdm6a (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-F) and K3K27-IRF5 not changed by \u003cem\u003eKdm5c\u003c/em\u003e (\u003cb\u003eSuppl. 2 A-C\u003c/b\u003e). The specific histone target for the two Kdms might be the reason why they have different effect on \u003cem\u003eIRF5\u003c/em\u003e transcription. It is likely that \u003cem\u003eKdm5\u003c/em\u003ec suppresses transcription of some anti-inflammatory genes to confer detrimental effects on neuroinflammation.\u003c/p\u003e \u003cp\u003eThe current study has some caveats that we should keep in mind when interpreting the data. We examined the Kdm-histone-IRF axis in aged microglia only at the acute phase of stroke (3 days after MCAO), and did not include a chronic stage cohort study which is still on-going (years of work). However, our acute study has already elucidated the mechanistic link between Kdm6a/5c and post-stroke inflammation, which will be further confirmed in the following experiments. Another caveat of the study is that we did not examine Kdm-IRF5 signaling in infiltrating monocytes. It has been reported [\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e] that demethylation of H3K27Me3 by Kdm6a markedly increased IL-1β expression through a Caspase-1 pathway in macrophages. The infiltrating monocytes in the ischemic brain also express IRF5 [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]. Nevertheless, our previous study has already suggested that the central (microglia) IRF signaling is more important than the IRFs expressed on peripheral immune cells in post-stroke inflammation [\u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn summary, the present study investigated the demethylating effects of Kdm6a/5c on H3K27Me3/H3K4Me3-IRF5/4 signaling in microglia, and assessed their impact on stroke outcomes in aged mice. Our findings reveal that the escape of microglial \u003cem\u003eKdm6a/5c\u003c/em\u003e from XCI exacerbates post-stroke inflammation and worsens outcomes. IRF5 signaling plays a critical role in mediating the deleterious effect of \u003cem\u003eKdm6a\u003c/em\u003e \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e; whereas \u003cem\u003eKdm5c\u0026rsquo;s\u003c/em\u003e effect is independent of IRF5. The epigenetic modification of histones by X escapee genes is a novel mechanism in inducing sex differences in stroke among the elderly, highlighting new, sex-specific therapeutic targets for this devastating disease.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eATCC, American Type Culture Collection\u003c/p\u003e\n\u003cp\u003eBCA, Bicinchoninic acid assay\u003c/p\u003e\n\u003cp\u003eChIP, Chromatin immunoprecipitation\u003c/p\u003e\n\u003cp\u003eCKO, Conditional knock out\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCUT\u0026amp;RUN, \u003cem\u003eCleavage Under Targets \u0026amp; Release Using Nuclease\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eELISA, Enzyme-Linked Immunosorbent Assay\u0026nbsp;\u003c/p\u003e\n\u003cp\u003efl/fl, flox/flox \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eH3k27Me3, trimethylation of histone H3 at lysine 27\u003c/p\u003e\n\u003cp\u003eH3k27Me1, monomethylation of histone H3 at lysine 27\u003c/p\u003e\n\u003cp\u003eH3k4Me3, trimethylation of Histone H3 at Lysine 4\u003c/p\u003e\n\u003cp\u003eH3k4Me1, monomethylation of Histone H3 at Lysine 4\u003c/p\u003e\n\u003cp\u003eISRE, Interferon stimulatory regulatory element\u003c/p\u003e\n\u003cp\u003eIRF5 Interferon regulatory factor 5\u003c/p\u003e\n\u003cp\u003eIRF4 Interferon regulatory factor 4\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKdm6a\u003c/em\u003e, Lysine-specific demethylase 6A\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKdm5c\u003c/em\u003e, Lysine demethylase 5C\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMCAO, Middle cerebral artery occlusion\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMFI, Mean fluorescence intensity\u003c/p\u003e\n\u003cp\u003eRPMI, Roswell Park Memorial Institute\u003c/p\u003e\n\u003cp\u003eRT, Room temperature\u003c/p\u003e\n\u003cp\u003eUSP9X, Ubiquitin specific peptidase 9 X-linked\u003c/p\u003e\n\u003cp\u003eXCI, X chromosome inactivation\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cb\u003eEthical Statement.\u003c/b\u003e All studies were conducted in accordance with NIH guidelines for the care and use of laboratory animals and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas Health Science Center at Houston McGovern Medical School.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests.\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding.\u003c/h2\u003e \u003cp\u003eThis work was supported by funding from AHA Grant 23POST1019058 to Conelius Ngwa and NIH Grants R01 NS108779/NS129977 to Fudong Liu.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eC.N.: project conception and design, conducting of experiments, acquisition of data, analysis, and interpretation of data, and manuscript writing. A.F. and S.Q.: conducting experiment and acquisition of data and analysis. K.V., Y.X. and R.S.: mouse breeding and colony maintenance. L.M. and F.L.: contributed to conception and design, interpretation of data, and manuscript writing. All authors have read and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank Dr. Arthur Arnold from UCLA for his courtesy in providing us Kdm6a and Kdm5c flox mice.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analyzed in the present study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBalderman S, Lichtman MA. A history of the discovery of random X chromosome inactivation in the human female and its significance. Rambam Maimonides Med J, 2011. 2(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCullough LD, et al. Stroke sensitivity in the aged: sex chromosome complement vs. gonadal hormones. Aging. 2016;8(7):1432\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran N, Broun A, Ge K. Lysine Demethylase KDM6A in Differentiation, Development, and Cancer. Mol Cell Biol, 2020. 40(20).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOutchkourov NS, et al. Balancing of histone H3K4 methylation states by the Kdm5c/SMCX histone demethylase modulates promoter and enhancer function. Cell Rep. 2013;3(4):1071\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeonardi E, et al. Expanding the genetics and phenotypic spectrum of Lysine-specific demethylase 5C (KDM5C): a report of 13 novel variants. Eur J Hum Genet. 2023;31(2):202\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheray M, Joseph B. Epigenetics control microglia plasticity. Front Cell Neurosci. 2018;12:243.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatnala R, et al. HDAC inhibitor sodium butyrate-mediated epigenetic regulation enhances neuroprotective function of microglia during ischemic stroke. Mol Neurobiol. 2017;54:6391\u0026ndash;411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu M, Xu E, Zhan L. Epigenetic Regulations of Microglia/Macrophage Polarization in Ischemic Stroke. Front Mol Neurosci. 2021;14:697416.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong Q, et al. HDAC4 in ischemic stroke: mechanisms and therapeutic potential. Clin epigenetics. 2018;10:1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStanzione R et al. Pathogenesis of Ischemic Stroke: Role of Epigenetic Mechanisms. Genes (Basel), 2020. 11(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg GY, et al. Epigenetic regulation of inflammation in stroke. Ther Adv Neurol Disord. 2018;11:1756286418771815.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrinkman AB, et al. Histone modification patterns associated with the human X chromosome. EMBO Rep. 2006;7(6):628\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreira de Mello JC, et al. Early X chromosome inactivation during human preimplantation development revealed by single-cell RNA-sequencing. Sci Rep. 2017;7(1):10794.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChalign\u0026eacute; R, Heard E. X-chromosome inactivation in development and cancer. FEBS Lett. 2014;588(15):2514\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JT. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 2011;12(12):815\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Haaften G, et al. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer. Nat Genet. 2009;41(5):521\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerrari KJ, et al. Polycomb-Dependent H3K27me1 and H3K27me2 Regulate Active Transcription and Enhancer Fidelity. Mol Cell. 2014;53(1):49\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim K, et al. H3K27me1 is essential for MMP-9-dependent H3N-terminal tail proteolysis during osteoclastogenesis. Epigenetics Chromatin. 2018;11(1):23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu Y, et al. H3K27me3-H3K4me1 transition at bivalent promoters instructs lineage specification in development. Cell Biosci. 2023;13(1):66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng J, et al. A role for H3K4 monomethylation in gene repression and partitioning of chromatin readers. Mol Cell. 2014;53(6):979\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Mamun A, et al. Microglial IRF5-IRF4 regulatory axis regulates neuroinflammation after cerebral ischemia and impacts stroke outcomes. Proc Natl Acad Sci U S A. 2020;117(3):1742\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgwa C, et al. Regulation of microglial activation in stroke in aged mice: a translational study. Aging. 2022;14(15):6047\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi S, et al. X, but not Y, Chromosomal Complement Contributes to Stroke Sensitivity in Aged Animals. Transl Stroke Res. 2023;14(5):776\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi S, et al. X chromosome escapee genes are involved in ischemic sexual dimorphism through epigenetic modification of inflammatory signals. J Neuroinflammation. 2021;18(1):70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Mamun A, et al. Neuronal CD200 Signaling Is Protective in the Acute Phase of Ischemic Stroke. Stroke. 2021;52(10):3362\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu F, Schafer DP, McCullough LD. TTC, fluoro-Jade B and NeuN staining confirm evolving phases of infarction induced by middle cerebral artery occlusion. J Neurosci Methods. 2009;179(1):1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMisrani A, et al. Brain endothelial CD200 signaling protects brain against ischemic damage. Brain Res Bull. 2024;207:110864.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgwa C et al. Phosphorylation of Microglial IRF5 and IRF4 by IRAK4 Regulates Inflammatory Responses to Ischemia. Cells, 2021. 10(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKraeuter AK, Guest PC, Sarnyai Z. \u003cem\u003eThe Open Field Test for Measuring Locomotor Activity and Anxiety-Like Behavior.\u003c/em\u003e Methods Mol Biol, 2019. 1916: 99\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeyer OA, et al. A method for the routine assessment of fore-and hindlimb grip strength of rats and mice. Neurobehavioral Toxicol. 1979;1(3):233\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCabe PA, et al. A simple recording grip strength device. Pharmacol Biochem Behav. 1978;8(1):101\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith JP, et al. Quantitative measurement of muscle strength in the mouse. J Neurosci Methods. 1995;62(1\u0026ndash;2):5\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgustinus AS, et al. Epigenetic dysregulation from chromosomal transit in micronuclei. Nature. 2023;619(7968):176\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranklin R, et al. Regulation of chromatin accessibility by the histone chaperone CAF-1 sustains lineage fidelity. Nat Commun. 2022;13(1):2350.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarnes E, et al. Ultra-sensitive class I tetramer analysis reveals previously undetectable populations of antiviral CD8\u0026thinsp;+\u0026thinsp;T cells. Eur J Immunol. 2004;34(6):1570\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkene PJ, Henikoff S. An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife, 2017. 6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgwa C, et al. Central IRF4/5 Signaling Are Critical for Microglial Activation and Impact on Stroke Outcomes. Transl Stroke Res; 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJurga AM, Paleczna M, Kuter KZ. Overview of General and Discriminating Markers of Differential Microglia Phenotypes. Front Cell Neurosci. 2020;14:198.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eButturini E, et al. STAT1 drives M1 microglia activation and neuroinflammation under hypoxia. Arch Biochem Biophys. 2019;669:22\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBok E, et al. Modulation of M1/M2 polarization by capsaicin contributes to the survival of dopaminergic neurons in the lipopolysaccharide-lesioned substantia nigra in vivo. Exp Mol Med. 2018;50(7):1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, et al. The inactive X chromosome accumulates widespread epigenetic variability with age. Clin Epigenetics. 2023;15(1):135.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuchniewicz P, et al. X-chromosome inactivation patterns depend on age and tissue but not conception method in humans. Chromosome Res. 2023;31(1):4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang H, Disteche CM, Berletch JB. X Inactivation and Escape: Epigenetic and Structural Features. Front Cell Dev Biol. 2019;7:219.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerletch JB, et al. Genes that escape from X inactivation. Hum Genet. 2011;130(2):237\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Mamun A, et al. Interferon regulatory factor 4/5 signaling impacts on microglial activation after ischemic stroke in mice. Eur J Neurosci. 2018;47(2):140\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao S-c, et al. Age-related differences in interferon regulatory factor-4 and \u0026ndash;\u0026thinsp;5 signaling in ischemic brains of mice. Acta Pharmacol Sin. 2017;38(11):1425\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSealy-Jefferson S, et al. Age-and ethnic-specific sex differences in stroke risk. Gend Med. 2012;9(2):121\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetrea RE, et al. Gender differences in stroke incidence and poststroke disability in the Framingham heart study. Stroke. 2009;40(4):1032\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCullough LD, Hurn PD. Estrogen and ischemic neuroprotection: an integrated view. Trends Endocrinol Metabolism. 2003;14(5):228\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManwani B, et al. Sex differences in ischemic stroke sensitivity are influenced by gonadal hormones, not by sex chromosome complement. J Cereb Blood Flow Metabolism. 2015;35(2):221\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCullough LD, et al. Stroke sensitivity in the aged: sex chromosome complement vs. gonadal hormones. Aging. 2016;8(7):1432.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, et al. The number of X chromosomes influences protection from cardiac ischaemia/reperfusion injury in mice: one X is better than two. Cardiovasc Res. 2014;102(3):375\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, et al. The number of x chromosomes causes sex differences in adiposity in mice. PLoS Genet. 2012;8(5):e1002709.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonning KE, Karlen SJ, Burns ME. Structural and functional distinctions of co-resident microglia and monocyte-derived macrophages after retinal degeneration. J Neuroinflammation. 2022;19(1):299.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuilliams M, Mildner A, Yona S. Developmental and Functional Heterogeneity of Monocytes. Immunity. 2018;49(4):595\u0026ndash;613.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManjally AV, Tay TL. Attack of the Clones: Microglia in Health and Disease. Front Cell Neurosci. 2022;16:831747.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZito A, et al. Escape from X-inactivation in twins exhibits intra- and inter-individual variability across tissues and is heritable. PLoS Genet. 2023;19(2):e1010556.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWerner JM, et al. Variability of cross-tissue X-chromosome inactivation characterizes timing of human embryonic lineage specification events. Dev Cell. 2022;57(16):1995\u0026ndash;e20085.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMengel-From J, et al. Skewness of X-chromosome inactivation increases with age and varies across birth cohorts in elderly Danish women. Sci Rep. 2021;11(1):4326.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts AL et al. Age acquired skewed X chromosome inactivation is associated with adverse health outcomes in humans. Elife, 2022. 11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeinhold B. Epigenetics: the science of change. Environ Health Perspect. 2006;114(3):A160\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBannister AJ, Kouzarides T. Regulation of chromatin by histone modifications. Cell Res. 2011;21(3):381\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoloch D, Moazed D. RNA-mediated epigenetic regulation of gene expression. Nat Rev Genet. 2015;16(2):71\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorris-Blanco KC, et al. Epigenetic mechanisms and potential therapeutic targets in stroke. J Cereb Blood Flow Metab. 2022;42(11):2000\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, et al. Epigenetics Mechanisms in Ischemic Stroke: A Promising Avenue? J Stroke Cerebrovasc Dis. 2021;30(5):105690.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGade P, Kalvakolanu DV. Chromatin immunoprecipitation assay as a tool for analyzing transcription factor activity. Transcriptional Regulation: Methods Protocols, 2012: 85\u0026ndash;104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgustinus AS, et al. Epigenetic dysregulation from chromosomal transit in micronuclei. Nature. 2023;619(7968):176\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaya-Okur HS et al. \u003cem\u003eCUT\u0026amp;Tag for efficient epigenomic profiling of small samples and single cells.\u003c/em\u003e Nature Communications, 2019. 10(1): 1930.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalma M et al. \u003cem\u003eHigh-throughput methods for the analysis of transcription factors and chromatin modifications: Low input, single cell and spatial genomic technologies.\u003c/em\u003e Blood Cells, Molecules, and Diseases, 2023. 101: 102745.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMozzetta C, et al. Sound of silence: the properties and functions of repressive Lys methyltransferases. Nat Rev Mol Cell Biol. 2015;16(8):499\u0026ndash;513.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuy\u0026agrave;s E, et al. Metformin directly targets the H3K27me3 demethylase KDM6A/UTX. Aging Cell. 2018;17(4):e12772.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao M, et al. Elevated histone demethylase KDM5C increases recurrent miscarriage risk by preventing trophoblast proliferation and invasion. Cell Death Discov. 2022;8(1):495.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, et al. Kdm6a suppresses the alternative activation of macrophages and impairs energy expenditure in obesity. Cell Death Differ. 2021;28(5):1688\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbu-Hanna J, et al. Therapeutic potential of inhibiting histone 3 lysine 27 demethylases: a review of the literature. Clin Epigenetics. 2022;14(1):98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrempenau ML, et al. The histone demethylase KDM5C functions as a tumor suppressor in AML by repression of bivalently marked immature genes. Leukemia. 2023;37(3):593\u0026ndash;605.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePavlenko E, et al. Functions and Interactions of Mammalian KDM5 Demethylases. Front Genet. 2022;13:906662.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu R et al. \u003cem\u003ePost-translational modifications of histones: Mechanisms, biological functions, and therapeutic targets.\u003c/em\u003e MedComm (2020), 2023. 4(3): e292.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, et al. Metabolic regulation of gene expression by histone lactylation. Nature. 2019;574(7779):575\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKouzarides T. Chromatin modifications and their function. Cell. 2007;128(4):693\u0026ndash;705.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen LJ, et al. The role of lysine-specific demethylase 6A (KDM6A) in tumorigenesis and its therapeutic potentials in cancer therapy. Bioorg Chem. 2023;133:106409.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrahl BD, Allis CD. The language of covalent histone modifications. Nature. 2000;403(6765):41\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi S, et al. X chromosome escapee genes are involved in ischemic sexual dimorphism through epigenetic modification of inflammatory signals. J Neuroinflamm. 2021;18:1\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang J-Y, Aromolaran KA, Zukin RS. Epigenetic Mechanisms in Stroke and Epilepsy. Neuropsychopharmacology. 2013;38(1):167\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaron J-C. Protecting the ischaemic penumbra as an adjunct to thrombectomy for acute stroke. Nat Reviews Neurol. 2018;14(6):325\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu L, et al. Histone demethylases in the regulation of immunity and inflammation. Cell Death Discovery. 2023;9(1):188.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Ouml;nder \u0026Ouml;, et al. Progress in epigenetic histone modification analysis by mass spectrometry for clinical investigations. Expert Rev Proteom. 2015;12(5):499\u0026ndash;517.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong S et al. \u003cem\u003eIdentification of JmjC domain-containing UTX and JMJD3 as histone H3 lysine 27 demethylases.\u003c/em\u003e Proceedings of the National Academy of Sciences, 2007. 104(47): 18439\u0026ndash;18444.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S et al. \u003cem\u003eTargeting epigenetic regulators for inflammation: Mechanisms and intervention therapy.\u003c/em\u003e MedComm (2020), 2022. 3(4): e173.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, et al. Zoledronic acid regulates the synthesis and secretion of IL-1β through Histone methylation in macrophages. Cell Death Discov. 2020;6:47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorbin AL et al. IRF5 guides monocytes toward an inflammatory CD11c(+) macrophage phenotype and promotes intestinal inflammation. Sci Immunol, 2020. 5(47).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang L, et al. Monocytes from Irf5-/- mice have an intrinsic defect in their response to pristane-induced lupus. J Immunol. 2012;189(7):3741\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgwa C, et al. Central IRF4/5 Signaling Are Critical for Microglial Activation and Impact on Stroke Outcomes. Transl Stroke Res. 2024;15(4):831\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Aging, Kdm6a/5c, Microglia, Epigenetics, Ischemia, IRF","lastPublishedDoi":"10.21203/rs.3.rs-4986866/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4986866/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe role of chromatin biology and epigenetics in disease progression is gaining increasing recognition. Genes that escape X chromosome inactivation (XCI) can impact neuroinflammation through epigenetic mechanisms. Our prior research has suggested that the X escapee genes \u003cem\u003eKdm6a\u003c/em\u003e and \u003cem\u003eKdm5c\u003c/em\u003e are involved in microglial activation after stroke in aged mice. However, the underlying mechanisms remain unclear. We hypothesized that \u003cem\u003eKdm6a/5c\u003c/em\u003e demethylate H3K27Me3/H3K4Me3 in microglia respectively, and mediate the transcription of interferon regulatory factor 5 (IRF5) and IRF4, leading to microglial pro-inflammatory responses and exacerbated stroke injury. Aged (17\u0026ndash;20 months) \u003cem\u003eKdm6a/5c\u003c/em\u003e microglial conditional knockout (CKO) female mice (one allele of the gene) were subjected to a 60-min middle cerebral artery occlusion (MCAO). Gene floxed females (two alleles) and males (one allele) were included as controls. Infarct volume and behavioral deficits were quantified 3 days after stroke. Immune responses including microglial activation and infiltration of peripheral leukocytes in the ischemic brain were assessed by flow cytometry. Epigenetic modification of IRF5/4 by \u003cem\u003eKdm6a/5c\u003c/em\u003e were analyzed by CUT\u0026amp;RUN assay. The demethylation of H3K27Me3 by kdm6a increased \u003cem\u003eIRF5\u003c/em\u003e transcription; meanwhile Kdm5c demethylated H3K4Me3 to repress \u003cem\u003eIRF5\u003c/em\u003e. Both \u003cem\u003eKdm6a\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eKdm5c\u003c/em\u003e\u003csup\u003efl/fl\u003c/sup\u003e mice had worse stroke outcomes compared to fl/y and CKO mice. Gene floxed females showed more robust expression of CD68 in microglia, elevated brain and plasma levels of IL-1β or TNF-α, after stroke. We concluded that IRF5 signaling plays a critical role in mediating the deleterious effect of \u003cem\u003eKdm6a\u003c/em\u003e; whereas \u003cem\u003eKdm5c\u0026rsquo;s\u003c/em\u003e effect is independent of IRF5.\u003c/p\u003e","manuscriptTitle":"Escape of Kdm6a from X chromosome is detrimental to ischemic brains via IRF5 signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-27 18:54:53","doi":"10.21203/rs.3.rs-4986866/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9d3ea6ad-72aa-4623-ab10-d99c8b6e3a07","owner":[],"postedDate":"September 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-28T12:54:18+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-27 18:54:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4986866","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4986866","identity":"rs-4986866","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00