Differential expression of genes due to nucleotide changes responsible for determining bitterness/ sweetness in pummelo (citrus grandis l.) progenies

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Pummelo, though stands nutritionally parallel to mandarin and sweet oranges, it lacks the commercial exploitation due to bitterness caused by naringin flavonoid and limonin limonoid. The present study investigates the genetic basis of bitterness in pummelo, focusing on mutations in the Cm1,2RhaT and UGT gene and their impact on naringin and limonin accumulation respectively. A mutation at 519 bp in HS48-12 resulted in the transversion of arginine (bitter) to serine (sweet), correlating with a lower naringin content (89.52 µg/g). Variation in naringin levels (89.52–336.86 µg/g) was linked to differences in gene expression. Higher levels of bitter amino acids were observed in Acc. 3, HS46-13, and HS48-12, corresponding to increased limonin content, while H17-9 exhibited higher sweet amino acid accumulation and lower limonin content (5.61 µg/g). Understanding these genetic mechanisms can aid in breeding programs for developing non-bitter citrus varieties, improving fruit quality and commercial viability.
Full text 124,134 characters · extracted from preprint-html · click to expand
Differential expression of genes due to nucleotide changes responsible for determining bitterness/ sweetness in pummelo (citrus grandis l.) progenies | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Differential expression of genes due to nucleotide changes responsible for determining bitterness/ sweetness in pummelo (citrus grandis l.) progenies Nitin P S, P Nandeesha, K S Shivashankara, M Sankaran, T Sakthivel, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7180166/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Pummelo, though stands nutritionally parallel to mandarin and sweet oranges, it lacks the commercial exploitation due to bitterness caused by naringin flavonoid and limonin limonoid. The present study investigates the genetic basis of bitterness in pummelo, focusing on mutations in the Cm1,2RhaT and UGT gene and their impact on naringin and limonin accumulation respectively. A mutation at 519 bp in HS48-12 resulted in the transversion of arginine (bitter) to serine (sweet), correlating with a lower naringin content (89.52 µg/g). Variation in naringin levels (89.52–336.86 µg/g) was linked to differences in gene expression. Higher levels of bitter amino acids were observed in Acc. 3, HS46-13, and HS48-12, corresponding to increased limonin content, while H17-9 exhibited higher sweet amino acid accumulation and lower limonin content (5.61 µg/g). Understanding these genetic mechanisms can aid in breeding programs for developing non-bitter citrus varieties, improving fruit quality and commercial viability. Biological sciences/Biochemistry Biological sciences/Genetics Biological sciences/Molecular biology Biological sciences/Plant sciences Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Pummelo, botanically known as Citrus grandis (L.) Osbeck and colloquially referred to as pomelo, shaddock, or Chinese grapefruit, the species Citrus grandis bear biggest fruit in the genus Citrus . Over the years, numerous pummelo-derived cultivars, such as grapefruits (melogold and oroblanco), tangelos (Orlando and Minneola), and hybrids (Chironja, Chandler etc), have been developed [ 1 ]. Pummelo represents a vital gene pool for breeding new citrus fruit varieties [ 2 ]. Pummelo possesses a sweet taste with a slight acidity and a subtle hint of bitterness. Its juice is renowned for its health benefits due to its high content of antioxidants, mineral nutrients, phenolics, ascorbic acid (vitamin C), carotenoids, and flavonoids [ 3 , 4 ]. In addition to the volatiles in pummelo peel, olfactory analysis through gas chromatography–olfactometry (GC–O) identified 50 aroma-active compounds, including unsaturated aliphatic aldehydes, terpene aldehydes, esters, terpene alcohols, and nootakatone, that significantly contribute to the complex pummelo flavor [ 5 ]. Pummelo exhibits two types of bitterness: immediate bitterness during fresh consumption and delayed bitterness after processing. The primary bitterness, experienced when consuming fresh pummelo, results from the flavanone glycoside naringin 4,5,7-trihydroxy flavanone-7-rhamno-glucoside [ 6 , 7 ]. Like all flavonoids, flavanones are synthesized through the phenylpropanoid pathway, with chalcone synthase catalyzing the initial step, followed by chalcone isomerase (Fig. 1). The key flavanone, naringenin, undergoes glycosylation in two steps: first, a 7-O-glucosyltransferase (7GlcT) catalyzes glucosylation at position 7, followed by rhamnosylation via one of two rhamnosyltransferases. In pummelo, naringenin-7-O-glucoside is converted into the bitter neohesperidoside naringin by a 1–2 rhamnosyltransferase ( 1,2RhaT ), whereas in sweet orange and mandarin, a 1–6 rhamnosyltransferase ( 1,6RhaT ) converts it into the tasteless rutinoside narirutin. Due to frameshifts, pummelo lacks functional 1,6RhaT , preventing rutinoside formation. Bitter fruits like pummelo, sour orange, and trifoliate orange accumulate flavanone-7-O-neohesperidosides, whereas non-bitter varieties like sweet orange and mandarin accumulate flavanone-7-O-rutinosides [ 8 ]. Delayed or secondary bitterness develops over time, especially after juicing, freezing, or mechanical damage, due to the accumulation of limonoids like limonin, affecting both bitter and non-bitter citrus species [ 9 ]. Limonin, a highly oxygenated triterpene derivative containing a furan ring and an epoxide group, contributes to the strong bitterness of citrus juice [ 10 ]. In whole, uncut fruit, its precursor, limonate-A-ring lactone (LARL), remains in the juice sacs at a neutral to slightly alkaline pH. However, during juicing, exposure to acidic conditions triggers LARL’s conversion into limonin, reaching levels up to 6 ppm, intensifying bitterness over time [ 11 ] (Fig. 2). Naringin is primarily found in immature fruit [ 12 ], whereas limonin is synthesized in non-bitter form (LARL) in leaves and later transported to fruit and seeds [ 13 ]. UDP-glucosyltransferases ( UGT ), also known as limonoid glucosyltransferases, catalyze the glucosylation of limonoids by attaching a UTP-sugar glycosyl group to hydrophobic molecules, reducing limonin bitterness. This enzyme plays a crucial role in developing citrus fruits without limonoid bitterness, ensuring improved fruit quality [ 9 , 14 ]. Bitterness is a common issue in many horticultural crops, including citrus fruits, almonds, and cucurbitaceous vegetables. Research has identified the genetic basis of bitterness, with a monogenic recessive gene in almonds [ 15 ] and a single dominant gene in cucurbits [ 16 ]. In pummelo, the Cm1,2RhaT gene encodes the 1,2-rhamnosyltransferase enzyme responsible for naringin synthesis (primary bitterness), while the UGT gene regulates limonin accumulation (secondary bitterness). Since bitterness is genetically inherited, it persists in successive generations, making an understanding of inheritance patterns crucial for selecting less bitter parental lines. However, the absence of reliable molecular markers for identifying bitter and non-bitter genotypes poses a challenge to pummelo cultivation. In India, significant genetic variability exists in fruit size, shape, tree vigour, disease susceptibility, pulp colour, juice content, and acidity, highlighting the need for genetic characterization to enhance crop Improvement and commercial cultivation. Thus, there is a pressing need for research efforts to develop pummelo varieties with reduced bitterness and to advance de-bittering technologies, aiming to foster a profitable citrus industry. This research aims to identify pummelo progenies with less bitterness/ high sweetness and the cause of these variation at amino acid level whose study benefits the citrus industry. Results Biochemical analysis for sweetness, acidity and bitterness Significant variation was observed among pummelo hybrids and half-sib progenies for traits associated with fruit sweetness and acidity (Supplementary Table S1 ). Total soluble solids (TSS) content, an indicator of sweetness, ranged from 8.13 to 11.48º Brix across the studied material. The hybrid H17-9, derived from Acc.3 × Acc.19, exhibited the highest TSS (10.53ºB), while H26-9 from Acc.12 × Acc.19 recorded a maximum TSS of 10.87ºB. Within the half-sib population, HS43-6 registered the highest TSS at 11.48ºB. These values are in accordance with previous reports on pummelo and related citrus species. Titratable acidity showed considerable variability. In Acc.12 × Acc.19 hybrids, acidity ranged from 0.60–2.23%, and from 0.80–2.4% in Acc.3 × Acc.19. H18-13 exhibited the lowest acidity (0.60%), followed by H17-5 (0.67%) and H17-9 (0.70%). In the second hybrid group, H23-4 and H24-8 showed the least acidity (0.80%). Half-sib progenies demonstrated wider variation, with acidity ranging from 0.57–3.56%. HS45-1 (0.57%) and HS43-15 (0.59%) recorded the lowest acidity. These findings are consistent with earlier observations Kongsri and Nartvaranant [ 17 ] and Bankar et al . [ 18 ], indicating genotype dependent differences in acidity across pummelo crosses. Sensory evaluation and consumer preference Organoleptic assessment was conducted to evaluate fruit flavor and overall acceptability (Table 1 ). Parental accessions Acc.18 and Acc.19 scored 8 on the 9-point hedonic scale (“like very much”), while Acc.12 and Acc.3 scored 7 (“like moderately”) and 6 (“like slightly”), respectively. Several hybrids were highly preferred: H17-3, H17-5, H17-9, H23-4, and H23-11 received the maximum score of 9 (“like extremely”) owing to their excellent sweetness, low acidity, and absence of bitterness. Hybrids H16-1, H16-2, H18-8, H23-15, and H26-9 also received favourable scores (8) for their mild bitterness and overall flavor quality. Table 1 Sensory evaluation of pummelo fruits Sensory Scores Ratings Hybrids Number of Hybrids 9 Like extremely H17-3, H17-5, H17-9, H23-4, H23-11, HS46-13, HS48-12 7 8 Like very much Acc.18, Acc.19. H16-1, H16-2, H18-8, H23-15, H26-9, HS38-4, HS44-9, HS44-15, HS45-14, HS45-18, HS46-12, HS48-10 14 7 like moderately Acc.12, Acc.6, H16-17, H17-17, H18-17, H19-1, H19-8, H20-12, H21-5, H21-8, H22-5, H22-7, H22-8, H23-6, H24-8, H27-8, H29-4, HS32-3, HS33-3, HS34-8, HS37-2, HS39-14, HS40-7, HS40-16, HS41-7, HS43-6, HS43-15, HS44-1 28 6 Like slightly Acc.3, H16-14, H17-2, H17-18, H18-11, H18-19, H19-5, H19-7, H20-1, H21-16, H23-1, H23-8, H23-18, H24-3, H24-4, H24-6, H24-7, H25-14, H26-6, H27-12, H27-13, H28-7, HS36-6, HS39-4, HS39-10, HS39-13, HS41-11, HS43-7, HS47-3, HS47-6, HS49-11, HS49-12 32 5 Neither like nor dislike H16-3, H16-4, H16-5, H16-6, H16-7, H16-13, H17-8, H17-10, H18-3, H18-13, H19-14, H20-5, H21-15, H22-1, H22-3, H23-3, H23-7, H23-19, H24-9, H24-10, H25-8, H25-15, H26-4, H26-7, H26-8, H26-14, H29-10, HS32-1, HS32-2, HS32-9, HS35-12, HS36-5, HS36-10, HS39-2, HS40-6, HS41-5, HS41-6, HS42-1, HS42-2, HS42-8, HS42-9, HS42-11, HS42-13, HS42-19, HS43-9, HS43-11, HS46-5, HS46-6, 48 4 Dislike slightly H16-18, H18-5, H18-6, H18-10, H19-6, H19-10, H19-19, H20-8, H21-4, H22-2, H24-1, H25-1, H25-2, H25-4, H25-5, H25-6, H25-12, H26-5, H27-15, HS33-4, HS34-13, HS35-4, HS38-3, HS39-9, HS41-8, HS42-15, HS42-16, HS42-18, HS43-5, HS44-12, HS45-1, HS45-9, HS46-14 33 3 Dislike moderately H18-9, H19-3, H28-1, H29-9, HS32-8, HS34-7, HS37-4, HS39-11, HS40-2, HS41-10, HS42-12, HS43-1, HS43-10, HS43-16, HS44-4, HS44-6, HS44-8, HS44-17, HS46-10, HS47-4 20 2 Dislike very much H16-9, H17-12, H18-1, H18-2, H18-4, H28-6, HS34-19, HS35-3, HS35-11, HS36-2, HS36-4, HS38-2, HS38-5, HS40-5, HS42-3, HS45-10 16 1 Dislike extremely HS39-3 1 Among the 92 half-sib genotypes evaluated, HS46-13 and HS48-12 stood out with a score of 9, indicating excellent sensory quality without detectable bitterness. Genotypes HS38-4, HS44-9, HS44-15, HS45-14, HS45-18, HS46-12, and HS48-10 also showed good flavor, though with slight sourness or bitterness. Conversely, HS39-3 received the lowest score (1), attributed to an intense bitter and sour taste. These observations reflect similar trends reported in earlier studies by Cheong et al . [ 5 ] Yusof et al . [ 19 ], Gaikwad et al. [ 20 ] and Nishad et al . [ 21 ], where hedonic scores for pummelo genotypes ranged from 6.24 to 8.08, validating the diversity in sensory preferences among citrus types. Determination of bitterness through LCMS. In the assessment of fruit sensory attributes, specific hybrids and half-siblings were chosen for further analysis. The selected hybrids, including H17-3, H17-5, H17-9, H18-8, H22-1, H23-4, H23-11, H26-9 and seven half-sibs (HS37-2, HS38-4, HS39-13, HS39-13, HS44-15, HS46-13, HS48-12), underwent Liquid Chromatography Mass Spectrometry (LCMS) to further validate bitterness intensity by quantifying their naringin and limonin content. The combined values of TSS content, acidity, naringin and limonin values along with sensory scoring of the shortlisted fruits are presented in Table 2 . Table 2 TSS, Acidity, limonin, naringin and sensory scoring of selected genotype Genotype TSS ( ⁰ B) Acidity (%) Limonin (µg/g) Naringin (µg/g) Sensory scores Acc. 3 8.74 1.70 24.46 285.66 6 Acc. 12 8.94 2.79 14.42 264.22 7 Acc. 19 9.62 1.34 28.21 182.55 8 H17-3. 9.87 0.90 31.55 138.12 9 H17-5. 10.10 0.67 45.05 128.55 9 H17-9. 10.53 0.70 5.61 106.54 9 H18-8. 9.17 1.37 3.92 178.56 8 H22-1. 9.2 1.3 59.27 289.28 5 H23-4. 9.3 0.8 22.94 155.16 9 H23-11 9.7 1.2 12.05 142.82 9 H26-9 10.9 1.2 19.81 182.24 8 HS37-2 10.56 1.13 32.03 252.55 7 HS38-4 9.66 0.95 10.79 207.86 8 HS39-13 9.08 1.27 18.88 246.55 6 HS44-15 9.24 0.96 40.78 248.55 8 HS39-3 7.94 1.03 153.41 336.86 3 HS46-13 10.32 0.60 66.36 154.82 9 HS48-12 10.34 1.00 65.04 89.52 9 Notably, HS48-12 exhibited the lowest naringin content at 89.52 µg/g, succeeded by the hybrid H17-9 at 106.54 µg/g. Other pummelo progenies, such as H17-5, H17-3, H23-11, HS46-13, and H23-4, displayed substantially lower naringin levels. HS39-3 showcased the highest naringin content at 336.86 µg/g among the 18 pummelo trees, while H22-1, Acc3, Acc12, HS37-2, HS44-15, and HS39-13 exhibited considerably elevated naringin levels. Similarly, the limonin content across the 18 pummelo trees ranged from 3.92 µg/g to 153.41 µg/g. Notably, H18-8 and H17-9 displayed the least limonin content (Fig. 3), while HS39-3 recorded the highest at 153.41 µg/g. Xi et al . [ 22 ] reported naringin levels in pummelo ranging from 2186.47 to 9871.69 mg/kg These findings underscore the diverse naringin and limonin profiles within the studied pummelo varieties, offering valuable insights for further research and breeding programs. Validation of gene specific primers The naringin DNA sequence of pummelo plants exhibited a high similarity with ' Citrus maxima flavonoid 1–2 rhamnosyltransferase ( C12RT1 ) mRNA, complete cds (Accession number AY048882.2). Similarly, the DNA sequence of limonin showed a high similarity with ' Citrus maxima cultivar Liangpin’s limonoid UDP-glucosyltransferase mRNA, complete cds (Accession number EU304828.1) (Supplementary Table S4 and S5). Naringin pairwise sequence alignment The utilization of NCBI BLAST for pair-wise sequence alignment demonstrated a remarkable 99.93% similarity between the sequenced genotypes and the reference genome of Citrus maxima's (AY048882.2) 1,2 rhamnosyl-transferase gene. However, in the alignment with the reference sequence of naringin, two nucleotide mutation sites were identified. The initial mutation, occurring at 303 bp, involved a cytosine to thymine substitution in Acc.3, H23-11, and H26-9, distinct from the reference genome. The second mutation at 519 bp was observed in HS48-12, where adenine was replaced by thymine, while the other genotypes maintained thymine (Fig. 3a). This nuanced variation highlights specific genetic distinctions within the studied genotypes. Limonin pairwise sequence alignment In the pair-wise sequence alignment for the UDP-glucosyltransferase gene against the reference genome of Citrus maxima cv. Liangpin (EU304828.1), a high 99.48% similarity was established. Notably, eight sites exhibited variability from the reference gene sequence among the genotypes in the limonin analysis. At 626 bp, Acc.3, Acc.12, Acc.19, Arka Ananta, Arka Chandra, H17-3, H17-5, H23-4, H23-11, H26-9 showcased a thymine substitution for adenine. At 760 bp, a guanine to adenine shift was observed in Acc.12, Acc.19, Arka Ananta, H17-3, H17-5, and H23-4, while the remaining genotypes maintained guanine (Fig. 4). At 940 bp, thymine replaced cytosine in select genotypes, and at 968 bp, a guanine-adenine variation was evident (Fig. 5). At 992 bp, guanine was replaced by adenine in specific genotypes (Fig. 6). Furthermore, at 1213 bp (Fig. 7), all sequenced genotypes exhibited a cytosine instead of the reference gene's guanine, and at 1228 bp, H17-9 and two half-siblings displayed guanine similar to the reference. Lastly, at 1414 bp (Fig. 8), thymine in the reference gene was replaced by adenine in the majority of the sequenced genotypes, highlighting distinct genetic variations in the limonin-related UDP-glucosyltransferase gene among the studied genotypes. Genetic Basis of Bitterness and Its Phenotypic Implications While two nucleotide-level mutations were identified in the naringin biosynthesis gene when aligned with the Citrus maxima reference sequence, only one at 519 bp led to an amino acid substitution (Fig. 3b). In HS48-12, this mutation changed the codon to agt, resulting in serine instead of arginine. Arginine is associated with bitterness, while serine imparts sweetness [ 23 ]. This amino acid-level divergence likely contributes to the favourable taste profile of HS48-12, which also had the lowest naringin content (89.52 µg/g) among all genotypes, as detected by LCMS. The observed range in naringin levels (89.52–336.86 µg/g) suggests that sequence-level mutations may influence gene expression or enzyme activity responsible for naringin biosynthesis. In the limonin-associated UDP-glucosyltransferase gene, eight nucleotide polymorphisms were identified, of which five resulted in amino acid changes. At 760 bp, a guanine-to-adenine mutation translated valine (neutral) to isoleucine (bitter) in specific genotypes. At 968 bp, a change led to glycine (sweet) replacing aspartic acid (neutral). Similarly, at 992 bp, arginine (bitter) was substituted with lysine (neutral), while at 1213 bp, glutamic acid was replaced with glutamine (sweet). At 1414 bp, a shift from leucine (bitter) to isoleucine was observed. These amino acid substitutions may have contributed to the variation in limonin content (3.92–153.41 µg/g), with genotypes like H17-9 showing lower levels potentially due to the higher proportion of sweet or neutral amino acids. The central dogma of molecular biology i.e. , DNA to RNA to protein, underpins the observed link between gene sequence variation and fruit taste. The amino acid shift from arginine to serine in HS48-12 exemplifies this, reflecting both the genetic and biochemical basis for reduced bitterness. Conversely, the presence of multiple bitter-associated amino acids in genotypes such as Acc.3 and HS39-3 correlated with higher bitterness scores and compound concentrations (Table 3 ). Table 3 Translation of amino acids and their nature Sl. no. Base pairs Reference codon Mutation in progenies Change in character Observed in genotypes Naringin 1 519 AGA (Arginine) AGT (Serine) Bitter to Sweet HS48-12 Limonin 1 760 GTC (Valine) ATC (Isoleucine) Neutral to Bitter Acc.12, Acc.19, Arka Ananta, H17-3,H17-5, H23-4 2 968 GAC (Aspartic acid) GGC (Glysine) Neutral to Sweet Acc.12, Acc.19, Arka Ananta, H17-3,H17-5, H17-9, H23-4, H23-4, H23-11, H26-9 3 993 AGA (Arginine) AAA (Lysine) Bitter to Neutral Acc.19, Arka Ananta, Arka Chandra, H17-3, H17-5, H17-9, H23-4, H23-11, H26-9 4 1213 GAG (Glutamic acid) CAG (Glutamine) Neutral to Bitter All 5 1414 TTA (Leusine) ATA (Isoleusine) Bitter to Neutral Acc.3, Acc. 12, Acc.19, Arka Ananta, Arka Chandra, H17-3, H17-5, H23-4, HS46-13, HS48-12 These findings are consistent with studies by Hasegawa et al . [ 24 ], Karim and Hashinaga [ 25 ], and Kita et al . [ 26 ], which reported genotype-specific expression of limonoid glucosyltransferases in citrus species like navel orange, pummelo, and Satsuma mandarin. The role of inheritance and gene expression in bitterness traits has also been emphasized by Frydman et al . [ 8 ] and Zaare et al . [ 9 ], who investigated the impact of rhamnosyltransferase gene mutations and expression on flavonoid bitterness during domestication. Karim and Hashinaga [ 25 ] successfully isolated and characterized the limonoid glucosyltransferase responsible for reducing bitterness in pummelo. Similarly, Frydman et al . [ 8 ] studied the Cm1,2RhaT gene encoding 1,2-rhamnosyltransferase responsible for naringin biosynthesis, revealing that its RNA expression is highest in young fruits and leaves and declines with maturity. More recently, Liu et al . [ 27 ] and Chen et al. [ 28 ] corroborated the role of gene expression and structural mutations in determining flavonoid content and taste traits. Materials and methods The present research work was carried out during 2020 to 2023 at the Division of Fruit Crops, ICAR-Indian Institute of Horticultural Research, Hesaraghatta, Bengaluru- 560089. Fruits collected from 102 segregating progenies from two different crosses and 92 half-sibs were used for analysis (Supplementary Table S2). The hybrids and the half-sibs were planted during August 2016 with the spacing of 4 × 4 m. All the trees received recommended doses of fertilizers and other cultural practices during the course of these investigations. The fruits were harvested at the physiological maturity as adjudged by TSS/TA ratio equal to 12. All the parameters were evaluated in 3 replications. The TSS of the pummelo juice was calculated using a digital refractometer and expressed in degree Brix, while the titratable acidity was determined by titration method [ 29 ] and expressed as per cent of citric acid equivalents. All the fruits evaluated for this biochemical study were organoleptically evaluated for taste, flavour, presence of bitterness and acidity. The fruits were then categorized using 9-point Hedonic scale (Supplementary Table S3) [ 20 ]. Determination of Bitter compounds through LCMS. Sensory evaluation was used to assess bitterness levels (Naringin and Limonin content) in progenies and parental accessions. Liquid Chromatography Mass Spectrometry (LCMS) was employed, with minor adjustments [ 30 , 31 ]. An Acquity UPLC H-Class system coupled with a TQD-MS/MS instrument (Waters, USA) featuring an Electrospray Ionization (ESI) source was used. Fresh pulp (5 g) was ground in 80% methanol to obtain a 15 ml extract. A mixture of 0.1 ml extract and 0.9 ml distilled water was analysed. Compounds were identified by comparing retention times with standards, and calibration curves determined concentration. Validation of gene specific primers. Designing of Gene specific primer for naringin and limonin. The primary bitterness in citrus fruits (naringin) is attributed to the enzyme 1,2 rhamnosyltransferase, encoded by Cm1,2RhaT gene [ 8 , 32 , 33 , 34 ]. The essential nucleotide sequence of this gene, responsible for the synthesis of naringin, was retrieved from the National Centre for Biotechnology Information (NCBI) with the accession number AY048882.2 (Supplementary Table S4). The Cm1,2RhaT gene has a documented size of 1359 base pairs. Additionally, the gene associated with secondary bitterness due to limonin, encoding UDP-glucosyltransferase ( UGT ), has had its nucleotide sequence obtained from the reference Citrus maxima cv. Liangpin (EU304828.1), spanning a length of 1536 base pairs (Supplementary Table S5). The primers for both the genes were designed and synthesised through Bioserve company, Hyderabad, India (Table 4 ). Table 4 Designed gene specific primers Gene Forward Primer 5’– 3’ Naringin : 1,2Rhamnosyl transferase ( 1,2Rhat ) F : ATGGATACCAAGCATCAAG R : CACCACACTCATCTCTGCGT F : GCTCCACACCTTGAACTTGC R : GTTTAATGACCCTCGCCAC F : TGCTCTACTCCCAACAATCTAC R : ATTTTAGCCTGCGGAACCCA F : CTCATCTTCAATACAACTCA R : TTATTCCTTTCAATCTCCTC Limonin : UDP glucosyl-transferase (UGT) F : GTAACTTCACCTACGAGCCTAC R : CATCAGAGACCCAAGGGATAAA F : ACCCTAAAGCTCCAACCTTAAC R : GTCGTGACTCCACCAATTCTAC F : TTTCACGGTTTGGTTCCATTTC R : CTCGACACTTGTCCTTCTTACTT F : GTGTGATGTGTCCAAGACCG R : CCTATCTGACGAGCCACCAT F : TAGTTTCATTCCCCGGCCAT R : TGGTCAAGATCTTCGCGTCT F : AGACGCGAAGATCTTGACCA R : CATAGCAGACGGAAGCCCTA DNA isolation The genomic DNA of the shortlisted genotypes, parents and check varieties (Arka Ananta and Arka Chandra) were isolated from young leaves following Doyle and Doyle's [ 35 ] method with minor modifications [ 36 ]. Young leaves collected from trees were wiped with 70% ethanol, ground in liquid nitrogen in pre-chilled pestle and mortar, and mixed with polyvinyl pyrrolidone and pre-warmed CTAB buffer. After incubation and centrifugation, the supernatant containing nucleic acids was extracted. DNA precipitation involved adding sodium chloride and isopropanol, followed by overnight storage at -20°C. Pellets were then treated with RNAse and ethanol (70%), air-dried, and finally re-suspended in a 10mM TRIS-EDTA buffer. The quality and quantity of DNA was confirmed by Agarose gel electrophoresis and Nano Drop Spectrophotometer. PCR assays were conducted using specific primers for naringin and limonin. The PCR reaction, with a total volume of 25 ml, included 100 ng plant genomic DNA, 2.5 µl taq buffer, 2 µl dNTP mix, 0.5 µl MgCl 2 , and 15.5 µl milliQ water. Amplification was carried out in a thermocycler (Eppendorf) through 35 cycles (95º C for 4 min, 94 ºC for 30 secs, 55ºC for 30 secs, and 72º C for 6 min). Aliquots of the final products were loaded onto 2% agarose gels with 1x loading dye for easy amplicon recognition. Specific bands were identified using a 100bp ladder, and gel visualization occurred under a UV gel documentation unit (UVI-TEC, Cambridge, UK). The PCR amplicons of the desired band length were carefully excised from the gel using a clean scalpel under a UV trans-illuminator, minimizing gel volume. Gel fragments containing the amplicons were purified using Qiagene DNA elution kit as per the manufacturer’s instructions and used for sequencing. Sequence identification and consensus sequence development Short nucleotide sequences obtained from Sanger sequencing (Supplementary Figure S1 and Figure S2) were analysed for local similarity by aligning them with original reference using BLAST [ 37 ]. After assessing the quality of each strand, forward and reverse strands of each fragment were assembled to generate a single consensus sequence for naringin and limonin. Overlapping regions were aligned and assembled using UGENE software with ClustalW, following the approach outlined by Crossley et al . [ 38 ]. Sequence alignment and identification of mutation Consensus sequences from each shortlisted genotype were aligned with the reference sequence to detect mutations. Identified nucleotide mutations were further analysed to determine their impact on amino acid composition at the translation level [ 39 ]. Study of variation at translation level The consensus sequences obtained were analyzed using the Expasy software to examine variations at the translation level, which revealed the corresponding amino acids of the resulting codons [ 39 ]. According to Birch et al . [ 23 ], the amino acids alanine, glutamine, glycine, proline, serine, and threonine are categorized as sweet amino acids, whereas arginine and isoleucine are classified as bitter amino acids (Table 5 ). Table 5 Amino acids and their effects Amino acid code taste Alanine A Bitter Glutamine Q Glycine G Proline P Serine S Threonine T Arginine R Sweet Isoleucine I Conclusion This study establishes a clear genotype–phenotype relationship in pummelo, demonstrating how specific genetic mutations influence the accumulation of bitter compounds and, ultimately, fruit taste. Mutations in the Cm1,2RhaT and UGT genes significantly impacted naringin and limonin levels. Notably, a 519 bp mutation in HS48-12 led to an arginine-to-serine substitution, correlating with the lowest naringin content (89.52 µg/g) and improved sensory appeal. In contrast, genotypes such as Acc.3 and HS46-13 showed elevated bitter amino acid profiles and higher limonin content, while H17-9 exhibited greater accumulation of sweet amino acids and lower limonin levels (5.61 µg/g). These findings are consistent with earlier reports linking gene expression and amino acid variation to bitterness in citrus. The molecular insights gained here offer valuable markers for selecting low-bitterness genotypes and can be directly applied in breeding programs aimed at developing consumer-preferred, non-bitter pummelo cultivars with enhanced fruit quality and market potential. Declarations Acknowledgement This research was supported by institutional funding from ICAR and Ph. D fellowship awarded to Nitin P S by ICAR-IARI, New Delhi. We gratefully acknowledge Dr. Lakshman Reddy for providing laboratory facilities. We also extend our sincere thanks to Dr. Pydi Roshni, Dr. Sai Timmarao Koka, Shashidhar B. R., Kiran K. N., and Sharanya for their valuable assistance in the laboratory. Author contributions Nitin P. S. was responsible for methodology development, crop management, data curation, validation, and writing of the original draft. M. Sankaran contributed to conceptualization, methodology, supervision, and critical review and editing of the manuscript. P. Nandeesha was involved in conceptualization, methodology, provision of resources, supervision, data visualization and result analysis, and manuscript review and editing. T. Sakthivel contributed to conceptualization and resource support. K. S. Shivashankara was involved in conceptualization and methodological design. K. Himabindu contributed to conceptualization, methodology, and analysis of results. Competing interests The authors declare no competing interests. Funding Declaration No funding was provided for this particular research work. References Louzada, E. S. & Ramadugu, C. Grapefruit: history, use, and breeding. HortTechnology 31 , 243–258 (2021). García-Lor, A., Luro, F., Navarro, L. & Ollitrault, P. Comparative use of InDel and SSR markers in deciphering the interspecific structure of cultivated citrus genetic diversity: a perspective for genetic association studies. Mol. Genet. Genomics 287 , 77–94 (2012). Jayaprakasha, G. K. & Patil, B. S. In vitro evaluation of the antioxidant activities in fruit extracts from citron and blood orange. Food Chem . 101 , 410–418 (2007). Singh, N. et al. Citrus improvement for enhanced mineral nutrients in fruit juice through interspecific hybridization. J. Food Compos. Anal. 119 , 105259 (2023). Cheong, M. W., Liu, S. Q., Zhou, W., Curran, P. & Yu, B. Chemical composition and sensory profile of pomelo ( Citrus grandis (L.) Osbeck) juice. Food Chem . 135 , 2505–2513 (2012). Haenen, G. R., Paquay, J. B., Korthouwer, R. E. & Bast, A. Peroxynitrite scavenging by flavonoids. Biochem. Biophys. Res. Commun . 236 , 591–593 (1997). Burda, S. & Oleszek, W. Antioxidant and antiradical activities of flavonoids. J. Agric. Food Chem . 49 , 2774–2779 (2001). Frydman, A. et al. Citrus fruit bitter flavors: isolation and functional characterization of the gene Cm1,2RhaT encoding a 1,2-rhamnosyltransferase, a key enzyme in the biosynthesis of the bitter flavonoids of citrus. Plant J. 40 , 88–100 (2004). Zaare, F., Hosseinkhani, S., Zamani, Z., Asadi, A. A. & Omidbaigi, R. Delayed expression of limonoid UDP-glucosyltransferase makes delayed bitterness in citrus. Biochem. Biophys. Res. Commun. 371 , 59–62 (2008). Kefford, J. F. & Chandler, B. V. The Chemical Constituents of Citrus Fruits . 43 , 246 (Academic Press, 1970). Guadagni, D. G., Maier, V. P. & Turnbaugh, J. G. Effect of some citrus juice constituents on taste thresholds for limonin and naringin bitterness. J. Sci. Food Agric. 24 , 1277–1288 (1973). Kore, V. T. & Chakraborty, I. Efficacy of various techniques on biochemical characteristics and bitterness of pummelo juice. J. Food Sci. Technol. 52, 6073–6077 (2015). Akyildiz, A. & Ağçam, E. Citrus juices technology. In Food Processing: Strategies for Quality Assessment 37–103 (Springer, New York, NY, 2014). Karim, M. R. & Hashinaga, F. Screening and some properties of limonoid glucosyltransferase. Pak. J. Biol. Sci. 4 , 483–486 (2001). Dicenta, F., Ortega, E. & Martínez, G. P. Use of recessive homozygous genotypes to assess genetic control of kernel bitterness in almond. Euphytica 153 , 221–225 (2007). Andeweg, J. M. & De, B. J. W. Breeding of non-bitter cucumbers. Euphytica , 8 :13-20 (1959). Kongsri, S. & Nartvaranant, P. Fruit morphological characteristics and fruit quality of pomelo cv. Tabtim Siam grown in Nakhon Pathom and Nakhon Si Thammarat Provinces. Interdiscip. Res. Rev. 14 , 5–11 (2019). Bankar, P. B., Damodhar, V. P., Salvi, B. R., Pawar, C. D. & Sawant, P. S. Qualitative and quantitative parameters of fruit in different pummelo ( Citrus grandis L. Osbeck) genotypes grown in Konkan conditions. Pharma Innov. J . 10 , 218–222 (2021). Yusof, S., Ghazali, H. M. & King, G. S. Naringin content in local citrus fruits. Food Chem. 37 , 113–121 (1990). Gaikwad, K. A., Haldavanekar, P. C. & Jadhav, Y. S. Sensory and chemical studies in pummelo genotypes. Int. J. Univ. Sci. Technol . 5 , 196–203 (2019). Nishad, J. et al . Bioactive compounds and antioxidant activity of selected Indian pummelo ( Citrus grandis L. Osbeck) germplasm. Sci. Hortic . 233 , 446–454 (2018). Xi, W., Fang, B., Zhao, Q., Jiao, B. & Zhou, Z. Flavonoid composition and antioxidant activities of Chinese local pummelo ( Citrus grandis (L.) Osbeck) varieties. Food Chem . 161 , 230–238 (2014). Birch, G. G. & Kemp, S. E. Apparent specific volumes and tastes of amino acids. Chem. Senses 14 , 249–258 (1989). Hasegawa, S., Suhayda, C. G., Hsu, W. J. & Robertson, G. H. Purification of limonoid glucosyltransferase from navel orange albedo tissues. Phytochemistry 46 , 33–37 (1997). Karim, M. R. & Hashinaga, F. Isolation and characterization of limonoid glucosyltransferase from pummelo albedo tissue. Food Chem . 76 , 431–436 (2002). Kita, M. et al. Allelic structures of UDP-glucose: limonoid glucosyltransferase affect limonoid bitterness in Citrus unshiu and C. sinensis . Euphytica 132 , 87–94 (2003). Liu, Y. et al. Structural diversity and distribution of limonoids in pummelo (Citrus grandis) fruit revealed by comprehensive UHPLC-MS/MS analysis. Sci. Hortic. 282, 109996 (2021). Chen, J. et al. Transcriptome analysis and HPLC profiling of flavonoid biosynthesis in Citrus aurantium L. during its key developmental stages. Biology (Basel) 11 , 1078 (2022). AOAC International. Official Methods of Analysis, 18th ed. (AOAC International, Gaithersburg, MD, 2005). Weidner, S., Amarowicz, R., Karamac, M. & Fręś, T. E. Changes in endogenous phenolic acids during development of Secale cereale caryopses and after dehydration treatment of unripe rye grains. Plant Physiol. Biochem . 38 , 595–602 (2000). Chen, H., Zuo, Y. & Deng, Y. Separation and determination of flavonoids and other phenolic compounds in cranberry juice by high-performance liquid chromatography. J. Chromatogr . A 913 , 387–395 (2001). Frydman, A. et al. The molecular and enzymatic basis of bitter/non-bitter flavor of citrus fruit: evolution of branch-forming rhamnosyltransferases under domestication. Plant J. 73 , 166–178 (2013). Bar-Peled, M., Fluhr, R. & Gressel, J. Juvenile-specific localization and accumulation of a rhamnosyltransferase and its bitter flavonoid in foliage, flowers, and young citrus fruits. Plant Physiol . 103 , 1377–1384 (1993). Chen, J. et al. Cit1, 2RhaT and two novel CitdGlcTs participate in flavor-related flavonoid metabolism during citrus fruit development. J. Exp. Bot. 70 , 2759–2771 (2019). Doyle, J. J. & Doyle, J. L. Isolation of plant DNA from fresh tissue. Focus 12 , 13–15 (1990). Cheng, Y. J., Guo, W. W., Yi, H. L., Pang, X. M. & Deng, X. An efficient protocol for genomic DNA extraction from Citrus species. Plant Mol. Biol. Rep . 21 , 177–178 (2003). Umar, J. A., Aliero, A. A., Shehu, K. & Dikko, O. C. Genotypic screening of tomato AREB1 gene for drought tolerance and computational protein structure prediction. Afr. J. Plant Sci . 15 , 138–143 (2021). Crossley, B. M. et al. Guidelines for Sanger sequencing and molecular assay monitoring. J. Vet. Diagn. Invest. 32, 767–775 (2020). Cárdenas EMB. Bioinformatic analysis of insertion, deletion, and substitution mutations in the human β‑globin gene. Computational Molecular Bioscience 11, 1–17 (2021). Additional Declarations No competing interests reported. Supplementary Files Supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7180166","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":494849404,"identity":"37122635-4cae-4cef-a89e-37842f1f24ae","order_by":0,"name":"Nitin P S","email":"","orcid":"","institution":"Indian Institute of Horticultural Research","correspondingAuthor":false,"prefix":"","firstName":"Nitin","middleName":"P","lastName":"S","suffix":""},{"id":494849408,"identity":"a89a1907-028b-4328-bbb5-ac1ef770a7bc","order_by":1,"name":"P Nandeesha","email":"","orcid":"","institution":"Indian Institute of Horticultural Research","correspondingAuthor":false,"prefix":"","firstName":"P","middleName":"","lastName":"Nandeesha","suffix":""},{"id":494849410,"identity":"23798833-731e-45ed-8cd5-19dcf6625bd5","order_by":2,"name":"K S Shivashankara","email":"","orcid":"","institution":"Indian Institute of Horticultural Research","correspondingAuthor":false,"prefix":"","firstName":"K","middleName":"S","lastName":"Shivashankara","suffix":""},{"id":494849412,"identity":"ecbb8039-4484-428a-aa8b-adc0898c622e","order_by":3,"name":"M Sankaran","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYBACCTB5AEQwg0gJGVK0sCWA+DykaOExAJMEtUhOO/7wc8EZu3z+2T2fX92oseBhYD98dAM+LdLSOcbSM24kW864c3abdc4xoMN40tJu4NMiJ53DIM3zgdmA4UbuNuMcNqAWCR4zAlrSH//m+VBvIH8j55lxzj8itEhLJ5hJ89w4bGBwI4f5cW4bEVokZ+eYWfOcOW5geCPNjDm3T4KHjZBfJG6nP77Nc6zaQO5G8uPPOd/q5PjZDx/DqwUZsIEjiY1Y5SDA/IEU1aNgFIyCUTByAABMKkV7StYvOQAAAABJRU5ErkJggg==","orcid":"","institution":"Indian Institute of Horticultural Research","correspondingAuthor":true,"prefix":"","firstName":"M","middleName":"","lastName":"Sankaran","suffix":""},{"id":494849414,"identity":"9586fe93-d304-4c44-90a4-76370156c208","order_by":4,"name":"T Sakthivel","email":"","orcid":"","institution":"Indian Institute of Horticultural Research","correspondingAuthor":false,"prefix":"","firstName":"T","middleName":"","lastName":"Sakthivel","suffix":""},{"id":494849416,"identity":"a05355dd-eb3d-47b8-8cea-64673a1502be","order_by":5,"name":"Hima Bindu K","email":"","orcid":"","institution":"Indian Institute of Horticultural Research","correspondingAuthor":false,"prefix":"","firstName":"Hima","middleName":"Bindu","lastName":"K","suffix":""}],"badges":[],"createdAt":"2025-07-21 18:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7180166/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7180166/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88274371,"identity":"08c76629-0080-48c8-b696-eb4f048426a4","added_by":"auto","created_at":"2025-08-04 17:45:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":398405,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/ae7e7859ecf691248dcd4174.png"},{"id":88273684,"identity":"57746841-3a06-405c-9369-da3e7cb87b44","added_by":"auto","created_at":"2025-08-04 17:37:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":205034,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/81c90af24fa011cc53314ae9.png"},{"id":88273258,"identity":"c1367392-36b1-4b93-8237-21d993de7562","added_by":"auto","created_at":"2025-08-04 17:29:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1455270,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/0a7fbb1dc15a6068b06781d4.png"},{"id":88273260,"identity":"da167cf8-775f-4200-a184-aabb4f24c360","added_by":"auto","created_at":"2025-08-04 17:29:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1111887,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/a8549881bd876a893ee52cd6.png"},{"id":88274374,"identity":"fa75a860-e1de-4d27-aef3-127f527326f3","added_by":"auto","created_at":"2025-08-04 17:45:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1050553,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/15b9ddce004bca4a753595ef.png"},{"id":88273687,"identity":"ddea279f-f5a1-4b19-99e6-90bf8cdbf9cc","added_by":"auto","created_at":"2025-08-04 17:37:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1043740,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/084172f0627e78318773fc67.png"},{"id":88274375,"identity":"cd3d8f26-cfe9-45fe-b7b9-143ec64dc582","added_by":"auto","created_at":"2025-08-04 17:45:25","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1098136,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/6859739274bd369bc67a46c2.png"},{"id":88273692,"identity":"3729d1de-9e7a-4f8f-9592-c8944d036a4f","added_by":"auto","created_at":"2025-08-04 17:37:25","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1118393,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/ccebf59ffc8e8460235f57ed.png"},{"id":88744063,"identity":"9c5c01c7-dc08-4924-9b77-9c44bc2ef8c6","added_by":"auto","created_at":"2025-08-11 03:46:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7974223,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/c02e5dd5-0493-4ccb-8222-6d5c6463de36.pdf"},{"id":88273690,"identity":"17e3a33d-fe7c-4a57-b2f2-32fdd556ebe6","added_by":"auto","created_at":"2025-08-04 17:37:25","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":928856,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-7180166/v1/48b952edcf06c4ffa08baf27.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Differential expression of genes due to nucleotide changes responsible for determining bitterness/ sweetness in pummelo (citrus grandis l.) progenies","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePummelo, botanically known as \u003cem\u003eCitrus grandis\u003c/em\u003e (L.) Osbeck and colloquially referred to as pomelo, shaddock, or Chinese grapefruit, the species \u003cem\u003eCitrus grandis\u003c/em\u003e bear biggest fruit in the genus \u003cem\u003eCitrus\u003c/em\u003e. Over the years, numerous pummelo-derived cultivars, such as grapefruits (melogold and oroblanco), tangelos (Orlando and Minneola), and hybrids (Chironja, Chandler etc), have been developed [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Pummelo represents a vital gene pool for breeding new citrus fruit varieties [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Pummelo possesses a sweet taste with a slight acidity and a subtle hint of bitterness. Its juice is renowned for its health benefits due to its high content of antioxidants, mineral nutrients, phenolics, ascorbic acid (vitamin C), carotenoids, and flavonoids [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition to the volatiles in pummelo peel, olfactory analysis through gas chromatography\u0026ndash;olfactometry (GC\u0026ndash;O) identified 50 aroma-active compounds, including unsaturated aliphatic aldehydes, terpene aldehydes, esters, terpene alcohols, and nootakatone, that significantly contribute to the complex pummelo flavor [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePummelo exhibits two types of bitterness: immediate bitterness during fresh consumption and delayed bitterness after processing. The primary bitterness, experienced when consuming fresh pummelo, results from the flavanone glycoside naringin 4,5,7-trihydroxy flavanone-7-rhamno-glucoside [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Like all flavonoids, flavanones are synthesized through the phenylpropanoid pathway, with chalcone synthase catalyzing the initial step, followed by chalcone isomerase (Fig.\u0026nbsp;1). The key flavanone, naringenin, undergoes glycosylation in two steps: first, a 7-O-glucosyltransferase (7GlcT) catalyzes glucosylation at position 7, followed by rhamnosylation \u003cem\u003evia\u003c/em\u003e one of two rhamnosyltransferases. In pummelo, naringenin-7-O-glucoside is converted into the bitter neohesperidoside naringin by a 1\u0026ndash;2 rhamnosyltransferase (\u003cem\u003e1,2RhaT\u003c/em\u003e), whereas in sweet orange and mandarin, a 1\u0026ndash;6 rhamnosyltransferase (\u003cem\u003e1,6RhaT\u003c/em\u003e) converts it into the tasteless rutinoside narirutin. Due to frameshifts, pummelo lacks functional \u003cem\u003e1,6RhaT\u003c/em\u003e, preventing rutinoside formation. Bitter fruits like pummelo, sour orange, and trifoliate orange accumulate flavanone-7-O-neohesperidosides, whereas non-bitter varieties like sweet orange and mandarin accumulate flavanone-7-O-rutinosides [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eDelayed or secondary bitterness develops over time, especially after juicing, freezing, or mechanical damage, due to the accumulation of limonoids like limonin, affecting both bitter and non-bitter citrus species [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Limonin, a highly oxygenated triterpene derivative containing a furan ring and an epoxide group, contributes to the strong bitterness of citrus juice [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In whole, uncut fruit, its precursor, limonate-A-ring lactone (LARL), remains in the juice sacs at a neutral to slightly alkaline pH. However, during juicing, exposure to acidic conditions triggers LARL\u0026rsquo;s conversion into limonin, reaching levels up to 6 ppm, intensifying bitterness over time [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] (Fig.\u0026nbsp;2). Naringin is primarily found in immature fruit [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], whereas limonin is synthesized in non-bitter form (LARL) in leaves and later transported to fruit and seeds [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. UDP-glucosyltransferases (\u003cem\u003eUGT\u003c/em\u003e), also known as limonoid glucosyltransferases, catalyze the glucosylation of limonoids by attaching a UTP-sugar glycosyl group to hydrophobic molecules, reducing limonin bitterness. This enzyme plays a crucial role in developing citrus fruits without limonoid bitterness, ensuring improved fruit quality [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBitterness is a common issue in many horticultural crops, including citrus fruits, almonds, and cucurbitaceous vegetables. Research has identified the genetic basis of bitterness, with a monogenic recessive gene in almonds [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and a single dominant gene in cucurbits [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In pummelo, the \u003cem\u003eCm1,2RhaT\u003c/em\u003e gene encodes the 1,2-rhamnosyltransferase enzyme responsible for naringin synthesis (primary bitterness), while the \u003cem\u003eUGT\u003c/em\u003e gene regulates limonin accumulation (secondary bitterness). Since bitterness is genetically inherited, it persists in successive generations, making an understanding of inheritance patterns crucial for selecting less bitter parental lines. However, the absence of reliable molecular markers for identifying bitter and non-bitter genotypes poses a challenge to pummelo cultivation. In India, significant genetic variability exists in fruit size, shape, tree vigour, disease susceptibility, pulp colour, juice content, and acidity, highlighting the need for genetic characterization to enhance crop Improvement and commercial cultivation. Thus, there is a pressing need for research efforts to develop pummelo varieties with reduced bitterness and to advance de-bittering technologies, aiming to foster a profitable citrus industry. This research aims to identify pummelo progenies with less bitterness/ high sweetness and the cause of these variation at amino acid level whose study benefits the citrus industry.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eBiochemical analysis for sweetness, acidity and bitterness\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSignificant variation was observed among pummelo hybrids and half-sib progenies for traits associated with fruit sweetness and acidity (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Total soluble solids (TSS) content, an indicator of sweetness, ranged from 8.13 to 11.48\u0026ordm; Brix across the studied material. The hybrid H17-9, derived from Acc.3 \u0026times; Acc.19, exhibited the highest TSS (10.53\u0026ordm;B), while H26-9 from Acc.12 \u0026times; Acc.19 recorded a maximum TSS of 10.87\u0026ordm;B. Within the half-sib population, HS43-6 registered the highest TSS at 11.48\u0026ordm;B. These values are in accordance with previous reports on pummelo and related citrus species.\u003c/p\u003e\u003cp\u003eTitratable acidity showed considerable variability. In Acc.12 \u0026times; Acc.19 hybrids, acidity ranged from 0.60\u0026ndash;2.23%, and from 0.80\u0026ndash;2.4% in Acc.3 \u0026times; Acc.19. H18-13 exhibited the lowest acidity (0.60%), followed by H17-5 (0.67%) and H17-9 (0.70%). In the second hybrid group, H23-4 and H24-8 showed the least acidity (0.80%). Half-sib progenies demonstrated wider variation, with acidity ranging from 0.57\u0026ndash;3.56%. HS45-1 (0.57%) and HS43-15 (0.59%) recorded the lowest acidity. These findings are consistent with earlier observations Kongsri and Nartvaranant [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and Bankar \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], indicating genotype dependent differences in acidity across pummelo crosses.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSensory evaluation and consumer preference\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOrganoleptic assessment was conducted to evaluate fruit flavor and overall acceptability (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Parental accessions Acc.18 and Acc.19 scored 8 on the 9-point hedonic scale (\u0026ldquo;like very much\u0026rdquo;), while Acc.12 and Acc.3 scored 7 (\u0026ldquo;like moderately\u0026rdquo;) and 6 (\u0026ldquo;like slightly\u0026rdquo;), respectively. Several hybrids were highly preferred: H17-3, H17-5, H17-9, H23-4, and H23-11 received the maximum score of 9 (\u0026ldquo;like extremely\u0026rdquo;) owing to their excellent sweetness, low acidity, and absence of bitterness. Hybrids H16-1, H16-2, H18-8, H23-15, and H26-9 also received favourable scores (8) for their mild bitterness and overall flavor quality.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSensory evaluation of pummelo fruits\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSensory Scores\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRatings\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHybrids\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNumber of Hybrids\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLike extremely\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eH17-3, H17-5, H17-9, H23-4, H23-11, HS46-13, HS48-12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLike very much\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAcc.18, Acc.19. H16-1, H16-2, H18-8, H23-15, H26-9, HS38-4, HS44-9, HS44-15, HS45-14, HS45-18, HS46-12, HS48-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003elike moderately\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAcc.12, Acc.6, H16-17, H17-17, H18-17, H19-1, H19-8, H20-12, H21-5, H21-8, H22-5, H22-7, H22-8, H23-6, H24-8, H27-8, H29-4, HS32-3, HS33-3, HS34-8, HS37-2, HS39-14, HS40-7, HS40-16, HS41-7, HS43-6, HS43-15, HS44-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e28\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLike slightly\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAcc.3, H16-14, H17-2, H17-18, H18-11, H18-19, H19-5, H19-7, H20-1, H21-16, H23-1, H23-8, H23-18, H24-3, H24-4, H24-6, H24-7, H25-14, H26-6, H27-12, H27-13, H28-7, HS36-6, HS39-4, HS39-10, HS39-13, HS41-11, HS43-7, HS47-3, HS47-6, HS49-11, HS49-12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNeither like nor dislike\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eH16-3, H16-4, H16-5, H16-6, H16-7, H16-13, H17-8, H17-10, H18-3, H18-13, H19-14, H20-5, H21-15, H22-1, H22-3, H23-3, H23-7, H23-19, H24-9, H24-10, H25-8, H25-15, H26-4, H26-7, H26-8, H26-14, H29-10, HS32-1, HS32-2, HS32-9, HS35-12, HS36-5, HS36-10, HS39-2, HS40-6, HS41-5, HS41-6, HS42-1, HS42-2, HS42-8, HS42-9, HS42-11, HS42-13, HS42-19, HS43-9, HS43-11, HS46-5, HS46-6,\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e48\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDislike slightly\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eH16-18, H18-5, H18-6, H18-10, H19-6, H19-10, H19-19, H20-8, H21-4, H22-2, H24-1, H25-1, H25-2, H25-4, H25-5, H25-6, H25-12, H26-5, H27-15, HS33-4, HS34-13, HS35-4, HS38-3, HS39-9, HS41-8, HS42-15, HS42-16, HS42-18, HS43-5, HS44-12, HS45-1, HS45-9, HS46-14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDislike moderately\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eH18-9, H19-3, H28-1, H29-9, HS32-8, HS34-7, HS37-4, HS39-11, HS40-2, HS41-10, HS42-12, HS43-1, HS43-10, HS43-16, HS44-4, HS44-6, HS44-8, HS44-17, HS46-10, HS47-4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDislike very much\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eH16-9, H17-12, H18-1, H18-2, H18-4, H28-6, HS34-19, HS35-3, HS35-11, HS36-2, HS36-4, HS38-2, HS38-5, HS40-5, HS42-3, HS45-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDislike extremely\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHS39-3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAmong the 92 half-sib genotypes evaluated, HS46-13 and HS48-12 stood out with a score of 9, indicating excellent sensory quality without detectable bitterness. Genotypes HS38-4, HS44-9, HS44-15, HS45-14, HS45-18, HS46-12, and HS48-10 also showed good flavor, though with slight sourness or bitterness. Conversely, HS39-3 received the lowest score (1), attributed to an intense bitter and sour taste. These observations reflect similar trends reported in earlier studies by Cheong \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] Yusof \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], Gaikwad et al. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and Nishad \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], where hedonic scores for pummelo genotypes ranged from 6.24 to 8.08, validating the diversity in sensory preferences among citrus types.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetermination of bitterness through LCMS.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn the assessment of fruit sensory attributes, specific hybrids and half-siblings were chosen for further analysis. The selected hybrids, including H17-3, H17-5, H17-9, H18-8, H22-1, H23-4, H23-11, H26-9 and seven half-sibs (HS37-2, HS38-4, HS39-13, HS39-13, HS44-15, HS46-13, HS48-12), underwent Liquid Chromatography Mass Spectrometry (LCMS) to further validate bitterness intensity by quantifying their naringin and limonin content. The combined values of TSS content, acidity, naringin and limonin values along with sensory scoring of the shortlisted fruits are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTSS, Acidity, limonin, naringin and sensory scoring of selected genotype\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTSS (\u003csup\u003e⁰\u003c/sup\u003eB)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAcidity (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLimonin (\u0026micro;g/g)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNaringin (\u0026micro;g/g)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSensory scores\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAcc. 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e8.74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e24.46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e285.66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAcc. 12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e8.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e2.79\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e14.42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e264.22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAcc. 19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.34\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e28.21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e182.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH17-3.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.87\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e31.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e138.12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH17-5.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e45.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e128.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH17-9.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.61\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e106.54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH18-8.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.37\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3.92\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e178.56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH22-1.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e59.27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e289.28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH23-4.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e22.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e155.16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH23-11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e12.05\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e142.82\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eH26-9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e19.81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e182.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS37-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e32.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e252.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e7\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS38-4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.95\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e10.79\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e207.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS39-13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e18.88\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e246.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS44-15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.96\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e40.78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e248.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS39-3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e7.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e153.41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e336.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS46-13\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e66.36\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e154.82\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHS48-12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.34\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e65.04\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e89.52\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eNotably, HS48-12 exhibited the lowest naringin content at 89.52 \u0026micro;g/g, succeeded by the hybrid H17-9 at 106.54 \u0026micro;g/g. Other pummelo progenies, such as H17-5, H17-3, H23-11, HS46-13, and H23-4, displayed substantially lower naringin levels. HS39-3 showcased the highest naringin content at 336.86 \u0026micro;g/g among the 18 pummelo trees, while H22-1, Acc3, Acc12, HS37-2, HS44-15, and HS39-13 exhibited considerably elevated naringin levels. Similarly, the limonin content across the 18 pummelo trees ranged from 3.92 \u0026micro;g/g to 153.41 \u0026micro;g/g. Notably, H18-8 and H17-9 displayed the least limonin content (Fig.\u0026nbsp;3), while HS39-3 recorded the highest at 153.41 \u0026micro;g/g. Xi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] reported naringin levels in pummelo ranging from 2186.47 to 9871.69 mg/kg These findings underscore the diverse naringin and limonin profiles within the studied pummelo varieties, offering valuable insights for further research and breeding programs.\u003c/p\u003e\u003cp\u003e\u003cb\u003eValidation of gene specific primers\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe naringin DNA sequence of pummelo plants exhibited a high similarity with '\u003cem\u003eCitrus maxima\u003c/em\u003e flavonoid 1\u0026ndash;2 rhamnosyltransferase (\u003cem\u003eC12RT1\u003c/em\u003e) mRNA, complete cds (Accession number AY048882.2). Similarly, the DNA sequence of limonin showed a high similarity with '\u003cem\u003eCitrus maxima\u003c/em\u003e cultivar Liangpin\u0026rsquo;s limonoid UDP-glucosyltransferase mRNA, complete cds (Accession number EU304828.1) (Supplementary Table S4 and S5).\u003c/p\u003e\u003cp\u003e\u003cb\u003eNaringin pairwise sequence alignment\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe utilization of NCBI BLAST for pair-wise sequence alignment demonstrated a remarkable 99.93% similarity between the sequenced genotypes and the reference genome of Citrus maxima's (AY048882.2) 1,2 rhamnosyl-transferase gene. However, in the alignment with the reference sequence of naringin, two nucleotide mutation sites were identified. The initial mutation, occurring at 303 bp, involved a cytosine to thymine substitution in Acc.3, H23-11, and H26-9, distinct from the reference genome. The second mutation at 519 bp was observed in HS48-12, where adenine was replaced by thymine, while the other genotypes maintained thymine (Fig.\u0026nbsp;3a). This nuanced variation highlights specific genetic distinctions within the studied genotypes.\u003c/p\u003e\u003cp\u003e\u003cb\u003eLimonin pairwise sequence alignment\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn the pair-wise sequence alignment for the UDP-glucosyltransferase gene against the reference genome of \u003cem\u003eCitrus maxima\u003c/em\u003e cv. Liangpin (EU304828.1), a high 99.48% similarity was established. Notably, eight sites exhibited variability from the reference gene sequence among the genotypes in the limonin analysis. At 626 bp, Acc.3, Acc.12, Acc.19, Arka Ananta, Arka Chandra, H17-3, H17-5, H23-4, H23-11, H26-9 showcased a thymine substitution for adenine. At 760 bp, a guanine to adenine shift was observed in Acc.12, Acc.19, Arka Ananta, H17-3, H17-5, and H23-4, while the remaining genotypes maintained guanine (Fig.\u0026nbsp;4). At 940 bp, thymine replaced cytosine in select genotypes, and at 968 bp, a guanine-adenine variation was evident (Fig.\u0026nbsp;5). At 992 bp, guanine was replaced by adenine in specific genotypes (Fig.\u0026nbsp;6). Furthermore, at 1213 bp (Fig.\u0026nbsp;7), all sequenced genotypes exhibited a cytosine instead of the reference gene's guanine, and at 1228 bp, H17-9 and two half-siblings displayed guanine similar to the reference. Lastly, at 1414 bp (Fig.\u0026nbsp;8), thymine in the reference gene was replaced by adenine in the majority of the sequenced genotypes, highlighting distinct genetic variations in the limonin-related UDP-glucosyltransferase gene among the studied genotypes.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGenetic Basis of Bitterness and Its Phenotypic Implications\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWhile two nucleotide-level mutations were identified in the naringin biosynthesis gene when aligned with the Citrus maxima reference sequence, only one at 519 bp led to an amino acid substitution (Fig.\u0026nbsp;3b). In HS48-12, this mutation changed the codon to agt, resulting in serine instead of arginine. Arginine is associated with bitterness, while serine imparts sweetness [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This amino acid-level divergence likely contributes to the favourable taste profile of HS48-12, which also had the lowest naringin content (89.52 \u0026micro;g/g) among all genotypes, as detected by LCMS. The observed range in naringin levels (89.52\u0026ndash;336.86 \u0026micro;g/g) suggests that sequence-level mutations may influence gene expression or enzyme activity responsible for naringin biosynthesis.\u003c/p\u003e\u003cp\u003eIn the limonin-associated UDP-glucosyltransferase gene, eight nucleotide polymorphisms were identified, of which five resulted in amino acid changes. At 760 bp, a guanine-to-adenine mutation translated valine (neutral) to isoleucine (bitter) in specific genotypes. At 968 bp, a change led to glycine (sweet) replacing aspartic acid (neutral). Similarly, at 992 bp, arginine (bitter) was substituted with lysine (neutral), while at 1213 bp, glutamic acid was replaced with glutamine (sweet). At 1414 bp, a shift from leucine (bitter) to isoleucine was observed. These amino acid substitutions may have contributed to the variation in limonin content (3.92\u0026ndash;153.41 \u0026micro;g/g), with genotypes like H17-9 showing lower levels potentially due to the higher proportion of sweet or neutral amino acids.\u003c/p\u003e\u003cp\u003eThe central dogma of molecular biology \u003cem\u003ei.e.\u003c/em\u003e, DNA to RNA to protein, underpins the observed link between gene sequence variation and fruit taste. The amino acid shift from arginine to serine in HS48-12 exemplifies this, reflecting both the genetic and biochemical basis for reduced bitterness. Conversely, the presence of multiple bitter-associated amino acids in genotypes such as Acc.3 and HS39-3 correlated with higher bitterness scores and compound concentrations (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTranslation of amino acids and their nature\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSl. no.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBase pairs\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReference codon\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMutation in progenies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eChange in character\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eObserved in genotypes\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e\u003cp\u003eNaringin\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e519\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGA\u003c/p\u003e\u003cp\u003e(Arginine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAGT\u003c/p\u003e\u003cp\u003e(Serine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eBitter to Sweet\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eHS48-12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e\u003cp\u003e\u003cb\u003eLimonin\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e760\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTC\u003c/p\u003e\u003cp\u003e(Valine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eATC\u003c/p\u003e\u003cp\u003e(Isoleucine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNeutral to Bitter\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAcc.12, Acc.19, Arka Ananta, H17-3,H17-5, H23-4\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e968\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAC\u003c/p\u003e\u003cp\u003e(Aspartic acid)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGC\u003c/p\u003e\u003cp\u003e(Glysine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNeutral to Sweet\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAcc.12, Acc.19, Arka Ananta, H17-3,H17-5, H17-9, H23-4, H23-4, H23-11, H26-9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e993\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGA\u003c/p\u003e\u003cp\u003e(Arginine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAAA\u003c/p\u003e\u003cp\u003e(Lysine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eBitter to Neutral\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAcc.19, Arka Ananta, Arka Chandra, H17-3, H17-5, H17-9, H23-4, H23-11, H26-9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1213\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAG\u003c/p\u003e\u003cp\u003e(Glutamic acid)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCAG\u003c/p\u003e\u003cp\u003e(Glutamine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNeutral to Bitter\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAll\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1414\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTA\u003c/p\u003e\u003cp\u003e(Leusine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eATA\u003c/p\u003e\u003cp\u003e(Isoleusine)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eBitter to Neutral\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAcc.3, Acc. 12, Acc.19, Arka Ananta, Arka Chandra, H17-3, H17-5, H23-4, HS46-13, HS48-12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThese findings are consistent with studies by Hasegawa \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], Karim and Hashinaga [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and Kita \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], which reported genotype-specific expression of limonoid glucosyltransferases in citrus species like navel orange, pummelo, and Satsuma mandarin. The role of inheritance and gene expression in bitterness traits has also been emphasized by Frydman \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] and Zaare \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], who investigated the impact of rhamnosyltransferase gene mutations and expression on flavonoid bitterness during domestication.\u003c/p\u003e\u003cp\u003eKarim and Hashinaga [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] successfully isolated and characterized the limonoid glucosyltransferase responsible for reducing bitterness in pummelo. Similarly, Frydman \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] studied the \u003cem\u003eCm1,2RhaT\u003c/em\u003e gene encoding 1,2-rhamnosyltransferase responsible for naringin biosynthesis, revealing that its RNA expression is highest in young fruits and leaves and declines with maturity. More recently, Liu \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] and Chen \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] corroborated the role of gene expression and structural mutations in determining flavonoid content and taste traits.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eThe present research work was carried out during 2020 to 2023 at the Division of Fruit Crops, ICAR-Indian Institute of Horticultural Research, Hesaraghatta, Bengaluru- 560089. Fruits collected from 102 segregating progenies from two different crosses and 92 half-sibs were used for analysis (Supplementary Table S2). The hybrids and the half-sibs were planted during August 2016 with the spacing of 4 \u0026times; 4 m. All the trees received recommended doses of fertilizers and other cultural practices during the course of these investigations. The fruits were harvested at the physiological maturity as adjudged by TSS/TA ratio equal to 12. All the parameters were evaluated in 3 replications.\u003c/p\u003e\u003cp\u003eThe TSS of the pummelo juice was calculated using a digital refractometer and expressed in degree Brix, while the titratable acidity was determined by titration method [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and expressed as per cent of citric acid equivalents. All the fruits evaluated for this biochemical study were organoleptically evaluated for taste, flavour, presence of bitterness and acidity. The fruits were then categorized using 9-point Hedonic scale (Supplementary Table S3) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetermination of Bitter compounds through LCMS.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSensory evaluation was used to assess bitterness levels (Naringin and Limonin content) in progenies and parental accessions. Liquid Chromatography Mass Spectrometry (LCMS) was employed, with minor adjustments [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. An Acquity UPLC H-Class system coupled with a TQD-MS/MS instrument (Waters, USA) featuring an Electrospray Ionization (ESI) source was used. Fresh pulp (5 g) was ground in 80% methanol to obtain a 15 ml extract. A mixture of 0.1 ml extract and 0.9 ml distilled water was analysed. Compounds were identified by comparing retention times with standards, and calibration curves determined concentration.\u003c/p\u003e\u003cp\u003e\u003cb\u003eValidation of gene specific primers.\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDesigning of Gene specific primer for naringin and limonin.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe primary bitterness in citrus fruits (naringin) is attributed to the enzyme 1,2 rhamnosyltransferase, encoded by \u003cem\u003eCm1,2RhaT\u003c/em\u003e gene [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The essential nucleotide sequence of this gene, responsible for the synthesis of naringin, was retrieved from the National Centre for Biotechnology Information (NCBI) with the accession number AY048882.2 (Supplementary Table S4). The \u003cem\u003eCm1,2RhaT\u003c/em\u003e gene has a documented size of 1359 base pairs. Additionally, the gene associated with secondary bitterness due to limonin, encoding UDP-glucosyltransferase (\u003cem\u003eUGT\u003c/em\u003e), has had its nucleotide sequence obtained from the reference \u003cem\u003eCitrus maxima\u003c/em\u003e cv. Liangpin (EU304828.1), spanning a length of 1536 base pairs (Supplementary Table S5). The primers for both the genes were designed and synthesised through Bioserve company, Hyderabad, India (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDesigned gene specific primers\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer 5\u0026rsquo;\u0026ndash; 3\u0026rsquo;\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e\u003cp\u003e\u003cb\u003eNaringin\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cb\u003e1,2Rhamnosyl transferase (\u003c/b\u003e\u003cb\u003e1,2Rhat\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: ATGGATACCAAGCATCAAG\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CACCACACTCATCTCTGCGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: GCTCCACACCTTGAACTTGC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: GTTTAATGACCCTCGCCAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: TGCTCTACTCCCAACAATCTAC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: ATTTTAGCCTGCGGAACCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: CTCATCTTCAATACAACTCA\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: TTATTCCTTTCAATCTCCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e\u003cb\u003eLimonin\u003c/b\u003e:\u003c/p\u003e\u003cp\u003e\u003cb\u003eUDP glucosyl-transferase (UGT)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: GTAACTTCACCTACGAGCCTAC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CATCAGAGACCCAAGGGATAAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: ACCCTAAAGCTCCAACCTTAAC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: GTCGTGACTCCACCAATTCTAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: TTTCACGGTTTGGTTCCATTTC\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CTCGACACTTGTCCTTCTTACTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: GTGTGATGTGTCCAAGACCG\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CCTATCTGACGAGCCACCAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: TAGTTTCATTCCCCGGCCAT\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: TGGTCAAGATCTTCGCGTCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eF\u003c/b\u003e: AGACGCGAAGATCTTGACCA\u003c/p\u003e\u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CATAGCAGACGGAAGCCCTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eDNA isolation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe genomic DNA of the shortlisted genotypes, parents and check varieties (Arka Ananta and Arka Chandra) were isolated from young leaves following Doyle and Doyle's [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] method with minor modifications [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Young leaves collected from trees were wiped with 70% ethanol, ground in liquid nitrogen in pre-chilled pestle and mortar, and mixed with polyvinyl pyrrolidone and pre-warmed CTAB buffer. After incubation and centrifugation, the supernatant containing nucleic acids was extracted. DNA precipitation involved adding sodium chloride and isopropanol, followed by overnight storage at -20\u0026deg;C. Pellets were then treated with RNAse and ethanol (70%), air-dried, and finally re-suspended in a 10mM TRIS-EDTA buffer. The quality and quantity of DNA was confirmed by Agarose gel electrophoresis and Nano Drop Spectrophotometer. PCR assays were conducted using specific primers for naringin and limonin. The PCR reaction, with a total volume of 25 ml, included 100 ng plant genomic DNA, 2.5 \u0026micro;l taq buffer, 2 \u0026micro;l dNTP mix, 0.5 \u0026micro;l MgCl\u003csub\u003e2\u003c/sub\u003e, and 15.5 \u0026micro;l milliQ water. Amplification was carried out in a thermocycler (Eppendorf) through 35 cycles (95\u0026ordm; C for 4 min, 94 \u0026ordm;C for 30 secs, 55\u0026ordm;C for 30 secs, and 72\u0026ordm; C for 6 min). Aliquots of the final products were loaded onto 2% agarose gels with 1x loading dye for easy amplicon recognition. Specific bands were identified using a 100bp ladder, and gel visualization occurred under a UV gel documentation unit (UVI-TEC, Cambridge, UK).\u003c/p\u003e\u003cp\u003eThe PCR amplicons of the desired band length were carefully excised from the gel using a clean scalpel under a UV trans-illuminator, minimizing gel volume. Gel fragments containing the amplicons were purified using Qiagene DNA elution kit as per the manufacturer\u0026rsquo;s instructions and used for sequencing.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSequence identification and consensus sequence development\u003c/b\u003e\u003c/p\u003e\u003cp\u003eShort nucleotide sequences obtained from Sanger sequencing (Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e and Figure S2) were analysed for local similarity by aligning them with original reference using BLAST [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. After assessing the quality of each strand, forward and reverse strands of each fragment were assembled to generate a single consensus sequence for naringin and limonin. Overlapping regions were aligned and assembled using UGENE software with ClustalW, following the approach outlined by Crossley \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cb\u003eSequence alignment and identification of mutation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eConsensus sequences from each shortlisted genotype were aligned with the reference sequence to detect mutations. Identified nucleotide mutations were further analysed to determine their impact on amino acid composition at the translation level [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cb\u003eStudy of variation at translation level\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe consensus sequences obtained were analyzed using the Expasy software to examine variations at the translation level, which revealed the corresponding amino acids of the resulting codons [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. According to Birch \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], the amino acids alanine, glutamine, glycine, proline, serine, and threonine are categorized as sweet amino acids, whereas arginine and isoleucine are classified as bitter amino acids (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAmino acids and their effects\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAmino acid\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecode\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003etaste\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAlanine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e\u003cb\u003eBitter\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGlutamine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eQ\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGlycine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eProline\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eP\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSerine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eS\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eThreonine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eArginine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cb\u003eSweet\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIsoleucine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eI\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study establishes a clear genotype\u0026ndash;phenotype relationship in pummelo, demonstrating how specific genetic mutations influence the accumulation of bitter compounds and, ultimately, fruit taste. Mutations in the \u003cem\u003eCm1,2RhaT\u003c/em\u003e and \u003cem\u003eUGT\u003c/em\u003e genes significantly impacted naringin and limonin levels. Notably, a 519 bp mutation in HS48-12 led to an arginine-to-serine substitution, correlating with the lowest naringin content (89.52 \u0026micro;g/g) and improved sensory appeal. In contrast, genotypes such as Acc.3 and HS46-13 showed elevated bitter amino acid profiles and higher limonin content, while H17-9 exhibited greater accumulation of sweet amino acids and lower limonin levels (5.61 \u0026micro;g/g). These findings are consistent with earlier reports linking gene expression and amino acid variation to bitterness in citrus. The molecular insights gained here offer valuable markers for selecting low-bitterness genotypes and can be directly applied in breeding programs aimed at developing consumer-preferred, non-bitter pummelo cultivars with enhanced fruit quality and market potential.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by institutional funding from ICAR and Ph. D fellowship awarded to Nitin P S by ICAR-IARI, New Delhi. We gratefully acknowledge Dr. Lakshman Reddy for providing laboratory facilities. We also extend our sincere thanks to Dr. Pydi Roshni, Dr. Sai Timmarao Koka, Shashidhar B. R., Kiran K. N., and Sharanya for their valuable assistance in the laboratory.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNitin P. S. was responsible for methodology development, crop management, data curation, validation, and writing of the original draft. M. Sankaran contributed to conceptualization, methodology, supervision, and critical review and editing of the manuscript. P. Nandeesha was involved in conceptualization, methodology, provision of resources, supervision, data visualization and result analysis, and manuscript review and editing. T. Sakthivel contributed to conceptualization and resource support. K. S. Shivashankara was involved in conceptualization and methodological design. K. Himabindu contributed to conceptualization, methodology, and analysis of results.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo funding was provided for this particular research work.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eLouzada, E. S. \u0026amp; Ramadugu, C. Grapefruit: history, use, and breeding. HortTechnology \u003cstrong\u003e31\u003c/strong\u003e, 243\u0026ndash;258 (2021).\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eGarc\u0026iacute;a-Lor, A., Luro, F., Navarro, L. \u0026amp; Ollitrault, P. Comparative use of InDel and SSR markers in deciphering the interspecific structure of cultivated citrus genetic diversity: a perspective for genetic association studies. \u003cem\u003eMol. Genet. Genomics\u003c/em\u003e\u003cstrong\u003e287\u003c/strong\u003e, 77\u0026ndash;94 (2012).\u003c/li\u003e\n \u003cli\u003eJayaprakasha, G. K. \u0026amp; Patil, B. S. In vitro evaluation of the antioxidant activities in fruit extracts from citron and blood orange. \u003cem\u003eFood Chem\u003c/em\u003e. \u003cstrong\u003e101\u003c/strong\u003e, 410\u0026ndash;418 (2007).\u003c/li\u003e\n \u003cli\u003eSingh, N. et al. Citrus improvement for enhanced mineral nutrients in fruit juice through interspecific hybridization. J. Food Compos. Anal. \u003cstrong\u003e119\u003c/strong\u003e, 105259 (2023).\u003c/li\u003e\n \u003cli\u003eCheong, M. W., Liu, S. Q., Zhou, W., Curran, P. \u0026amp; Yu, B. Chemical composition and sensory profile of pomelo (\u003cem\u003eCitrus grandis\u003c/em\u003e (L.) Osbeck) juice. \u003cem\u003eFood Chem\u003c/em\u003e. \u003cstrong\u003e135\u003c/strong\u003e, 2505\u0026ndash;2513 (2012).\u003c/li\u003e\n \u003cli\u003eHaenen, G. R., Paquay, J. B., Korthouwer, R. E. \u0026amp; Bast, A. Peroxynitrite scavenging by flavonoids. \u003cem\u003eBiochem. Biophys. Res. Commun\u003c/em\u003e. \u003cstrong\u003e236\u003c/strong\u003e, 591\u0026ndash;593 (1997).\u003c/li\u003e\n \u003cli\u003eBurda, S. \u0026amp; Oleszek, W. Antioxidant and antiradical activities of flavonoids. \u003cem\u003eJ. Agric. Food Chem\u003c/em\u003e. \u003cstrong\u003e49\u003c/strong\u003e, 2774\u0026ndash;2779 (2001).\u003c/li\u003e\n \u003cli\u003eFrydman, A. \u003cem\u003eet al.\u003c/em\u003e Citrus fruit bitter flavors: isolation and functional characterization of the gene \u003cem\u003eCm1,2RhaT\u003c/em\u003e encoding a 1,2-rhamnosyltransferase, a key enzyme in the biosynthesis of the bitter flavonoids of citrus. \u003cem\u003ePlant J.\u003c/em\u003e\u003cstrong\u003e40\u003c/strong\u003e, 88\u0026ndash;100 (2004).\u003c/li\u003e\n \u003cli\u003eZaare, F., Hosseinkhani, S., Zamani, Z., Asadi, A. A. \u0026amp; Omidbaigi, R. Delayed expression of limonoid UDP-glucosyltransferase makes delayed bitterness in citrus. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e\u003cstrong\u003e371\u003c/strong\u003e, 59\u0026ndash;62 (2008).\u003c/li\u003e\n \u003cli\u003eKefford, J. F. \u0026amp; Chandler, B. V. \u003cem\u003eThe Chemical Constituents of Citrus Fruits\u003c/em\u003e. \u003cstrong\u003e43\u003c/strong\u003e, 246 (Academic Press, 1970).\u003c/li\u003e\n \u003cli\u003eGuadagni, D. G., Maier, V. P. \u0026amp; Turnbaugh, J. G. Effect of some citrus juice constituents on taste thresholds for limonin and naringin bitterness. \u003cem\u003eJ. Sci. Food Agric.\u003c/em\u003e\u003cstrong\u003e24\u003c/strong\u003e, 1277\u0026ndash;1288 (1973).\u003c/li\u003e\n \u003cli\u003eKore, V. T. \u0026amp; Chakraborty, I. Efficacy of various techniques on biochemical characteristics and bitterness of pummelo juice. J. Food Sci. Technol. 52, 6073\u0026ndash;6077 (2015).\u003c/li\u003e\n \u003cli\u003eAkyildiz, A. \u0026amp; Ağ\u0026ccedil;am, E. Citrus juices technology. \u003cem\u003eIn Food Processing: Strategies for Quality Assessment\u003c/em\u003e 37\u0026ndash;103 (Springer, New York, NY, 2014).\u003c/li\u003e\n \u003cli\u003eKarim, M. R. \u0026amp; Hashinaga, F. Screening and some properties of limonoid glucosyltransferase. \u003cem\u003ePak. J. Biol. Sci.\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 483\u0026ndash;486 (2001).\u003c/li\u003e\n \u003cli\u003eDicenta, F., Ortega, E. \u0026amp; Mart\u0026iacute;nez, G. P. Use of recessive homozygous genotypes to assess genetic control of kernel bitterness in almond. \u003cem\u003eEuphytica\u003c/em\u003e\u003cstrong\u003e153\u003c/strong\u003e, 221\u0026ndash;225 (2007).\u003c/li\u003e\n \u003cli\u003eAndeweg, J. M. \u0026amp; De, B. J. W. Breeding of non-bitter cucumbers. \u003cem\u003eEuphytica\u003c/em\u003e, \u003cstrong\u003e8\u0026nbsp;\u003c/strong\u003e:13-20 (1959).\u003c/li\u003e\n \u003cli\u003eKongsri, S. \u0026amp; Nartvaranant, P. Fruit morphological characteristics and fruit quality of pomelo cv. Tabtim Siam grown in Nakhon Pathom and Nakhon Si Thammarat Provinces. \u003cem\u003eInterdiscip. Res. Rev.\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 5\u0026ndash;11 (2019).\u003c/li\u003e\n \u003cli\u003eBankar, P. B., Damodhar, V. P., Salvi, B. R., Pawar, C. D. \u0026amp; Sawant, P. S. Qualitative and quantitative parameters of fruit in different pummelo (\u003cem\u003eCitrus grandis\u003c/em\u003e L. Osbeck) genotypes grown in Konkan conditions. \u003cem\u003ePharma Innov. J\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 218\u0026ndash;222 (2021).\u003c/li\u003e\n \u003cli\u003eYusof, S., Ghazali, H. M. \u0026amp; King, G. S. Naringin content in local citrus fruits. \u003cem\u003eFood Chem.\u003c/em\u003e\u003cstrong\u003e37\u003c/strong\u003e, 113\u0026ndash;121 (1990).\u003c/li\u003e\n \u003cli\u003eGaikwad, K. A., Haldavanekar, P. C. \u0026amp; Jadhav, Y. S. Sensory and chemical studies in pummelo genotypes. \u003cem\u003eInt. J. Univ. Sci. Technol\u003c/em\u003e. \u003cstrong\u003e5\u003c/strong\u003e, 196\u0026ndash;203 (2019).\u003c/li\u003e\n \u003cli\u003eNishad, J. \u003cem\u003eet al\u003c/em\u003e. Bioactive compounds and antioxidant activity of selected Indian pummelo (\u003cem\u003eCitrus grandis\u003c/em\u003e L. Osbeck) germplasm. \u003cem\u003eSci. Hortic\u003c/em\u003e. \u003cstrong\u003e233\u003c/strong\u003e, 446\u0026ndash;454 (2018).\u003c/li\u003e\n \u003cli\u003eXi, W., Fang, B., Zhao, Q., Jiao, B. \u0026amp; Zhou, Z. Flavonoid composition and antioxidant activities of Chinese local pummelo (\u003cem\u003eCitrus grandis\u003c/em\u003e (L.) Osbeck) varieties. \u003cem\u003eFood Chem\u003c/em\u003e. \u003cstrong\u003e161\u003c/strong\u003e, 230\u0026ndash;238 (2014).\u003c/li\u003e\n \u003cli\u003eBirch, G. G. \u0026amp; Kemp, S. E. Apparent specific volumes and tastes of amino acids. \u003cem\u003eChem. Senses\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 249\u0026ndash;258 (1989).\u003c/li\u003e\n \u003cli\u003eHasegawa, S., Suhayda, C. G., Hsu, W. J. \u0026amp; Robertson, G. H. Purification of limonoid glucosyltransferase from navel orange albedo tissues. \u003cem\u003ePhytochemistry\u003c/em\u003e\u003cstrong\u003e46\u003c/strong\u003e, 33\u0026ndash;37 (1997).\u003c/li\u003e\n \u003cli\u003eKarim, M. R. \u0026amp; Hashinaga, F. Isolation and characterization of limonoid glucosyltransferase from pummelo albedo tissue. \u003cem\u003eFood Chem\u003c/em\u003e. \u003cstrong\u003e76\u003c/strong\u003e, 431\u0026ndash;436 (2002).\u003c/li\u003e\n \u003cli\u003eKita, M. \u003cem\u003eet al.\u003c/em\u003e Allelic structures of UDP-glucose: limonoid glucosyltransferase affect limonoid bitterness in \u003cem\u003eCitrus unshiu\u003c/em\u003e and \u003cem\u003eC. sinensis\u003c/em\u003e. \u003cem\u003eEuphytica\u003c/em\u003e\u003cstrong\u003e132\u003c/strong\u003e, 87\u0026ndash;94 (2003).\u003c/li\u003e\n \u003cli\u003eLiu, Y. et al. Structural diversity and distribution of limonoids in pummelo (Citrus grandis) fruit revealed by comprehensive UHPLC-MS/MS analysis. Sci. Hortic. 282, 109996 (2021).\u003c/li\u003e\n \u003cli\u003eChen, J. et al. Transcriptome analysis and HPLC profiling of flavonoid biosynthesis in \u003cem\u003eCitrus aurantium\u003c/em\u003e L. during its key developmental stages. \u003cem\u003eBiology (Basel)\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 1078 (2022).\u003c/li\u003e\n \u003cli\u003eAOAC International. Official Methods of Analysis, 18th ed. (AOAC International, Gaithersburg, MD, 2005).\u003c/li\u003e\n \u003cli\u003eWeidner, S., Amarowicz, R., Karamac, M. \u0026amp; Fręś, T. E. Changes in endogenous phenolic acids during development of Secale cereale caryopses and after dehydration treatment of unripe rye grains. \u003cem\u003ePlant Physiol. Biochem\u003c/em\u003e. \u003cstrong\u003e38\u003c/strong\u003e, 595\u0026ndash;602 (2000).\u003c/li\u003e\n \u003cli\u003eChen, H., Zuo, Y. \u0026amp; Deng, Y. Separation and determination of flavonoids and other phenolic compounds in cranberry juice by high-performance liquid chromatography. \u003cem\u003eJ. Chromatogr\u003c/em\u003e. A \u003cstrong\u003e913\u003c/strong\u003e, 387\u0026ndash;395 (2001).\u003c/li\u003e\n \u003cli\u003eFrydman, A. \u003cem\u003eet al.\u003c/em\u003e The molecular and enzymatic basis of bitter/non-bitter flavor of citrus fruit: evolution of branch-forming rhamnosyltransferases under domestication. \u003cem\u003ePlant J.\u003c/em\u003e\u003cstrong\u003e73\u003c/strong\u003e, 166\u0026ndash;178 (2013).\u003c/li\u003e\n \u003cli\u003eBar-Peled, M., Fluhr, R. \u0026amp; Gressel, J. Juvenile-specific localization and accumulation of a rhamnosyltransferase and its bitter flavonoid in foliage, flowers, and young citrus fruits. \u003cem\u003ePlant Physiol\u003c/em\u003e. \u003cstrong\u003e103\u003c/strong\u003e, 1377\u0026ndash;1384 (1993).\u003c/li\u003e\n \u003cli\u003eChen, J. et al. \u003cem\u003eCit1, 2RhaT\u003c/em\u003e and two novel \u003cem\u003eCitdGlcTs\u003c/em\u003e participate in flavor-related flavonoid metabolism during citrus fruit development. \u003cem\u003eJ. Exp. Bot.\u003c/em\u003e\u003cstrong\u003e70\u003c/strong\u003e, 2759\u0026ndash;2771 (2019).\u003c/li\u003e\n \u003cli\u003eDoyle, J. J. \u0026amp; Doyle, J. L. Isolation of plant DNA from fresh tissue. \u003cem\u003eFocus\u003c/em\u003e\u003cstrong\u003e12\u003c/strong\u003e, 13\u0026ndash;15 (1990).\u003c/li\u003e\n \u003cli\u003eCheng, Y. J., Guo, W. W., Yi, H. L., Pang, X. M. \u0026amp; Deng, X. An efficient protocol for genomic DNA extraction from \u003cem\u003eCitrus\u003c/em\u003e species. \u003cem\u003ePlant Mol. Biol. Rep\u003c/em\u003e. \u003cstrong\u003e21\u003c/strong\u003e, 177\u0026ndash;178 (2003).\u003c/li\u003e\n \u003cli\u003eUmar, J. A., Aliero, A. A., Shehu, K. \u0026amp; Dikko, O. C. Genotypic screening of tomato AREB1 gene for drought tolerance and computational protein structure prediction. \u003cem\u003eAfr. J. Plant Sci\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, 138\u0026ndash;143 (2021).\u003c/li\u003e\n \u003cli\u003eCrossley, B. M. et al. Guidelines for Sanger sequencing and molecular assay monitoring. J. Vet. Diagn. Invest. 32, 767\u0026ndash;775 (2020).\u003c/li\u003e\n \u003cli\u003eC\u0026aacute;rdenas EMB. Bioinformatic analysis of insertion, deletion, and substitution mutations in the human \u0026beta;‑globin gene. Computational Molecular Bioscience 11, 1\u0026ndash;17 (2021).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7180166/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7180166/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePummelo, though stands nutritionally parallel to mandarin and sweet oranges, it lacks the commercial exploitation due to bitterness caused by naringin flavonoid and limonin limonoid. The present study investigates the genetic basis of bitterness in pummelo, focusing on mutations in the \u003cem\u003e\u003cstrong\u003eCm1,2RhaT\u003c/strong\u003e\u003c/em\u003e and \u003cem\u003e\u003cstrong\u003eUGT\u003c/strong\u003e\u003c/em\u003e gene and their impact on naringin and limonin accumulation respectively. A mutation at 519 bp in HS48-12 resulted in the transversion of arginine (bitter) to serine (sweet), correlating with a lower naringin content (89.52 µg/g). Variation in naringin levels (89.52–336.86 µg/g) was linked to differences in gene expression. Higher levels of bitter amino acids were observed in Acc. 3, HS46-13, and HS48-12, corresponding to increased limonin content, while H17-9 exhibited higher sweet amino acid accumulation and lower limonin content (5.61 µg/g). Understanding these genetic mechanisms can aid in breeding programs for developing non-bitter citrus varieties, improving fruit quality and commercial viability.\u003c/p\u003e","manuscriptTitle":"Differential expression of genes due to nucleotide changes responsible for determining bitterness/ sweetness in pummelo (citrus grandis l.) progenies","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-04 17:29:20","doi":"10.21203/rs.3.rs-7180166/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f1d75d24-8daf-42f7-bd8b-027a03f5d109","owner":[],"postedDate":"August 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":52553815,"name":"Biological sciences/Biochemistry"},{"id":52553816,"name":"Biological sciences/Genetics"},{"id":52553817,"name":"Biological sciences/Molecular biology"},{"id":52553818,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2025-08-11T03:38:47+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-04 17:29:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7180166","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7180166","identity":"rs-7180166","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00