Differential epithelial requirements for Escargot define Dpp-dependent and Dpp-independent pathways in Drosophila head appendage formation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Differential epithelial requirements for Escargot define Dpp-dependent and Dpp-independent pathways in Drosophila head appendage formation Fernando Rosales-Bravo, Iván Sánchez-Díaz, Raquel Martínez-Méndez, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7992861/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract The development of Drosophila head appendages requires precise coordination between distinct imaginal-disc primordia. While the transcription factor Escargot (Esg) is known to maintain epithelial integrity and progenitor identity in several imaginal tissues, its role in anterior head morphogenesis has remained unclear. Here we show that esg regulates the growth and patterning of the antennal and labial discs through layer- and tissue-specific mechanisms. Using RNAi knockdown driven by two independent esg -Gal4 lines and a peripodial-specific driver (c311-Gal4), we demonstrate that esg depletion causes severe malformations of head appendages, including antennal loss and absence of the distal proboscis. In the antennal disc, esg activity in the peripodial membrane is necessary and sufficient to maintain compartmental organization, whereas in the labial disc, esg function within the disc-proper epithelium drives disc growth and normal adult proboscis formation. Moreover, dpp knockdown phenocopies the esg-RNAi phenotype, and esg loss reduces dpp mRNA levels in labial discs, while ectopic Dpp expression restores labial-disc size. Thus, esg acts upstream of Dpp signaling during proboscis development. These findings reveal a context-dependent mechanism by which a single transcription factor coordinates morphogenesis across epithelial layers, integrating esg -dependent transcriptional regulation with morphogen signaling. Biological sciences/Cell biology Biological sciences/Developmental biology Escargot transcription factor Peripodial membrane Decapentaplegic (Dpp) signaling Head appendage morphogenesis antennal imaginal disc labial imaginal disc Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Proper development of the adult Drosophila head requires the coordinated morphogenesis of distinct imaginal disc primordia, including the antennal and labial discs, which give rise to the antennae, maxillary palps, and the proboscis 1 . While much is known about the genetic programs that specify appendage identity—such as the homeotic functions of Proboscipedia (pb), Sex combs reduced (Scr) and labial (lab) in proboscis formation 2 – 4 —the molecular mechanisms that govern growth, compartmental architecture, and epithelial integrity within these discs remain incompletely understood. escargot ( esg ) encodes a Snail-family zinc‐finger transcription factor that is broadly expressed in imaginal-disc progenitors and is essential for progenitor‐cell maintenance, epithelial integrity, and growth in the wing, leg, eye, and genital discs 5 , 6 . In these contexts, esg prevents premature differentiation and restrains aberrant endoreplication by regulating cell‐cycle factors such as Cdc2. Despite its well‐characterized roles in these tissues, the function of escargot in the anterior head imaginal discs (antennae and labial) has not been systematically explored. Decapentaplegic (Dpp) signaling is another critical regulator of head-appendage development, acting downstream of Hox genes to promote proliferation and patterning in imaginal discs 7 , 8 . In the labial disc, Dpp is required for distal‐proboscis outgrowth, yet how Dpp activity is coordinated with upstream transcriptional regulators remains unclear. Moreover, whether esg interacts with Dpp signaling to control disc growth and morphogenesis in a tissue‐ or layer‐specific manner has not been addressed. Here, we investigate the role of escargot in Drosophila head-appendage development by combining RNA interference (RNAi) knockdown with two independent Gal4 drivers— esg NP5130 , which faithfully recapitulates endogenous esg expression without altering mRNA levels 9 , 10 , and esg L4 , a hypomorphic insertion in the 5′ UTR that behaves as a loss-of-function allele 11 . We quantify morphological outcomes, gene‐expression changes, and apoptotic events to dissect how esg dosage affects labial and antennal discs growth and patterning. By employing peripodial‐specific knockdown (c311-Gal4) 12 , we further delineate the epithelial domains in which esg is required. Finally, we test genetic interactions with Dpp to determine whether escargot acts upstream of this morphogen in labial‐disc outgrowth. Our results reveal that escargot functions in a dosage— layer-specific—anteroposterior—manner to control imaginal-disc morphogenesis: peripodial esg activity is both necessary and sufficient for antennal‐disc compartmentalization and growth, whereas disc-proper esg function drives labial-disc expansion and labellum formation through regulation of Dpp expression. These findings uncover a novel context-dependent mechanism by which a single transcription factor orchestrates distinct developmental programs across epithelial layers and imaginal‐disc types. Results Loss of esg leads to severe morphological defects in anterior head appendages The zinc-finger transcription factor escargot ( esg ) is required for progenitor-cell maintenance, epithelial integrity, and growth in Drosophila imaginal discs 6 , 13 . Although its roles in the wing, leg, eye and genital discs are well characterized, its function in the labial and antennal discs remains to be understood. To investigate the role of esg in these anterior head structures, we performed RNAi-mediated knockdown using three independent lines (v9793, v9794, 34063) driven by two GAL4 drivers: esg NP5130 , a P{GaWB} insertion which faithfully recapitulates endogenous esg expression without altering mRNA levels and has been widely used 9 , 10 , and esg L4 , a P{GaWB} insertion in the 5’ UTR of esg transcript that behaves as a loss-of-function allele obtained in our laboratory 11 . To rescue esg expression, we used the P{EP}esg EU143 enhancer-promoter insertion (esg-EP), as this element results in over-expression of the endogenous gene in the presence of a GAL4 driver 14 . A schematic of the esg locus showing the P-element insertions and RNAi target sites is presented in Fig. 1 a. When alone, neither the driver lines nor any of the parental RNAi lines had any head defects. esg NP5130 homozygotes are viable, fertile and appear to be phenotypically wild type; in contrast, esg L4 homozygotes are lethal in first instar larva while the heterozygotes are viable, fertile and morphologically normal. By themselves, the RNAi lines v9793, v9794 and 34063 have normal head appendages (a representative wild type head is shown in Fig. 1 b with normal antennae and proboscis). Knockdown of esg combining either of the two drivers with any of the RNAi lines caused severe malformations of head appendages, the severity of these depending on the RNAi used. The most common malformation was the loss of the distal proboscis, as no labium nor labellum was formed, remaining only the labrum (a representative head is shown in Fig. 1 c where the arrow shows the remaining labrum and lack of labellum). We also observed bilateral or unilateral antenna loss (Fig. 1 d and e , arrowheads mark where the antennae should be), and in some cases duplicated antennae (Fig. 1 f). We also found malformations in maxillary palps where severe shape and size abnormalities were evident (Fig. 1 g). At 25°C, even the least penetrant genotype, esg L4 >esg-RNAi(v9794) , consistently displayed proboscis defects in 100% of individuals, ranging from partial to complete loss of the labellum. In addition to this fully penetrant phenotype, 22% of flies showed unilateral or bilateral antennal loss, 10% exhibited duplicated antennae, and 5% presented simultaneous damage to both the antennae and maxillary palps. Remarkably, despite these pronounced morphological abnormalities, affected flies remained viable, fertile, and exhibited normal feeding behavior. When the esg -EP allele is introduced, the effect of the expression of any of the esg -RNAis is significantly rescued, restoring normal head structures morphology, thus confirming the specificity of the knockdown effect. We quantified esg mRNA levels in third instar eye-antennal discs by qPCR (Fig. 1 h). As expected, esg NP5130 did not alter transcript levels, while esg L4 heterozygotes expressed approximately 50% of wild type esg . All RNAi lines reduced esg mRNA to varying extents, where the least penetrant was v9794, then v9793, and the most penetrant one is 34063, correlating with phenotype severity; the strongest RNAi (34063) was predominantly lethal, with only a few pupal escapers that failed to eclose. For adult phenotypic analysis of this line, pharates had to be manually extracted from their cases. Co-expression of these RNAi with the esg-EP rescued esg transcript levels, with esg NP5130 >esg-EP, esg-RNAi (v9793) restoring levels to approximately twice that of wild type, and esg L4 >esg-EP, esg-RNAi (v9793) restoring them to near wild-type levels. To determine whether apoptosis is involved in causing these malformations, we performed TUNEL assays on third instar labial and eye-antennal discs. In antennal discs, esg L4 heterozygotes showed a modest increase in apoptotic cells relative to w 1118 controls, and this was further elevated in esg L4 >esg-RNAi(v9793) (Fig. 1 i). However, since morphological defects only arose upon RNAi knockdown, apoptosis alone cannot fully account for the abnormal antennal phenotype. In labial discs, neither esg L4 heterozygotes nor esg L4 >esg-RNAi(v9793) showed a significant increase in apoptosis compared to controls (Fig. 1 j) despite severe proboscis defects found in the latter genotype. These results imply that additional mechanisms—such as altered patterning, proliferation, or cell-fate specification—contribute to the developmental disruption of labial and antennal discs upon esg loss. Loss of esg disrupts compartmental architecture of the antennal disc To test whether the adult antennal malformations observed arise during larval development, we examined third-instar antennal discs using two independent reporters of esg expression: esg L4 >UAS-mCD8::GFP (Fig. 2 a-f) and esg NP5130 >UAS-mCD8::Cherry (Fig. 2 g-i). Engrailed (En, red) was used to mark the posterior compartment (Fig. 2 a–m, red) , Cubitus interruptus (Ci) as anterior compartment marker (Fig. 2 j-m, white ) and nuclei were counterstained with DAPI (blue). Disc area quantification is shown in Fig. 2 n. Control discs shown Fig. 2 a, d and g display a stereotyped morphology characterized by a central concentric domain (orange dotted line) surrounded by a less organized posterior peripheral field (white dotted line). This architecture has been previously described, where the central domain—composed of tightly packed, columnar epithelial cells—is prepatterned into concentric rings that give rise to the adult antenna. In contrast, the outer posterior peripheral region is less compact and contributes not to the antenna itself, but to the surrounding head epidermis and maxillary palps 1 . This peripheral zone includes the junction with the cephalopharyngeal skeleton and is continuous with the tissue that will form the dorsal head cuticle. The anteroposterior (A/P) axis was well defined, with the posterior compartment marked by a semicircular domain where Engrailed (red) was localized. The esg NP5130 driver revealed a broad and homogeneous esg expression (green) spanning both the central domain and the periphery (Fig. 2 g), consistent with wild-type levels of esg . In contrast, esg L4 , which carries only one functional esg allele, showed a more intense but restricted expression pattern, limited to the dorsal portion of the central domain and the posterior peripheral region (Fig. 2 d). These differences are consistent with the reduced esg expression in esg L4 and the higher expression detected in esg NP5130 , as shown by the qPCR results (Fig. 1 h). Upon esg knockdown ( esg L4 >esg-RNAi(v9793) or esg NP5130 >esg-RNAi(v9793) ; Fig. 2 b, e, h) the well-defined anatomical organization was markedly disrupted and disc area was significantly reduced (Fig. 2 n). The characteristic concentric architecture was lost, and En staining was severely reduced or mislocalized (Fig. 2 b, e, h, red ). Most strikingly, the posterior cephalopharyngeal junction is absent or diminished (absence of the white dotted line), leaving only the central domain. This disruption was particularly evident in Fig. 2 b, where merged confocal and brightfield images show the mandibular structures (red arrow) in direct contact with the central antennal disc. Co-expression of the enhancer-promoter insertion esg-EP alongside RNAi restored disc size (Fig. 2 n), re-established the posterior peripheral region (white dotted line), and rescued Engrailed-defined compartment boundaries (Fig. 2 c, f and i ). Because esg is known to be expressed in all imaginal discs 6 , we next asked whether its depletion also disrupted anterior–posterior patterning in other discs. We assessed Ci (white, anterior) and En (red, posterior) distribution in antennal (Fig. 2 j, k) and wing discs (Fig. 2 l, m). In antennal discs, esg knockdown caused disorganized Ci/En domains (Fig. 2 k), whereas wing discs from the same larvae maintained normal Ci/En compartmentalization (Fig. 2 m), indicating that esg is specifically required for the maintenance of antennal A/P organization. Together, these results show that esg is essential not only for antennal disc growth, but also for maintaining its compartmental architecture. Esg function in the peripodial membrane is required for antennal—but not proboscis—morphogenesis Since the restricted esg expression observed in the esg L4 background was localized mainly to the dorsal periphery of the antennal disc, where the peripodial epithelium resides, we asked whether esg function in this tissue could account for the observed phenotypes. To test this possibility, we used a peripodial-specific driver to determine whether targeted knockdown of esg in this layer could phenocopy the defects seen with the more broadly expressed esg drivers. To test whether esg activity specifically in the peripodial epithelium underlies the antennal-disc defects observed with knockdown driven by the broad esg -Gal4 lines, we used the peripodial‐specific driver c311-Gal4 to express esg-RNAi(v9793) and examined both third‐instar eye–antennal discs and adult head morphology (Fig. 3 ). Control antennal discs ( c311-Gal4 > UAS-mCD8::Cherry , Fig. 3 a upper panels) showed its characteristic concentric organization, with the peripodial membrane labeled in red and En (white) defining the posterior compartment. Compared to esg L4 and esg NP5130 drivers, c311 -driven expression was more extensive but overlapped with the dorsal peripodial domain and the posterior edge of the antennal disc near the cephalopharyngeal skeleton. Notably, c311 also labeled a population of large, basally located cells with irregular morphology, similar to those observed with esg -specific drivers (as indicated in Fig. 3 a, top panels, white arrowhead), suggesting that this driver captures key esg -expressing territories involved in disc organization. Upon esg knockdown in the peripodial membrane (Fig. 3 a, middle panels), the antennal disc became significantly smaller (Fig. 3 c) and severely disorganized, exhibiting loss of the typical concentric architecture and posterior patterning. These defects were qualitatively similar—and in some cases even more pronounced—than those observed when using esg -specific drivers, suggesting that esg activity in the peripodial epithelium is critical for organizing the underlying disc. Co-expression of esg-EP insertion alongside with esg-RNAi restored both antennal disc morphology (Fig. 3 a, bottom panels) and size (Fig. 3 c) to near control levels with a partial to almost complete rescue of antennal disc architecture, validating the specificity of the observed phenotypes. Consistent with the larval phenotypes, adult flies expressing esg-RNAi under c311-Gal4 exhibited defects in antennal formation, as flies frequently showed partial or complete loss of antennal structures (Fig. 3 b, middle row, arrowhead). Controls ( c311-Gal4 > UAS-GFP ) developed normal antennae (Fig. 3 b, top row). Co-expression of esg-EP with esg-RNAi rescued almost normal adult antennae (Fig. 3 b, bottom row). qPCR of esg expression levels in these lines showed that expressing an RNAi against esg in the peripodial membrane is effectively downregulating esg expression and that co-expression of the esg RNAi with esg - EP estores esg expression levels in the antennal disc (Fig. 3 d). Despite the dramatic antennal defects, the proboscis of c311 > esg-RNAi adults developed normally, even though c311 drives expression in the peripodial membrane of the labial disc, in contrast to the fully penetrant proboscis defects observed with the broader esg -Gal4 drivers. Together, these results show that esg function in the peripodial membrane is both necessary and sufficient for antennal-disc growth and compartmental organization, yet dispensable for labial‐disc (labellum) morphogenesis—illustrating that, although esg is expressed in all imaginal discs, its developmental role is highly context-dependent across different imaginal discs. Loss of esg function leads to labial disc reduction. Because knocking down esg specifically in the peripodial membrane ( c311 > esg-RNAi ) leaves the adult proboscis intact, the extensive loss of the distal proboscis seen with the broader esg L4 and esg NP5130 drivers must reflect esg function in a different cellular domain. Unlike c311 , both esg L4 and esg NP5130 are active within the disc-proper epithelium of the labial disc, suggesting that escargot’s expression there—rather than in the overlying peripodial layer—is essential for normal proboscis growth. To determine how esg ‐expressing cells within the disc proper regulate labial disc growth and patterning, we examined their distribution and requirement using two independent drivers (esg L4 >UAS-mCD8::GFP (Fig. 4 a-c) and esg NP5130 >UAS-mCD8::Cherry (Fig. 4 d-f). In control lines ( esg L4 >UAS-mCD8::GFP and esg NP5130 >UAS-mCD8::Cherry ), esg expression is strongest in the proximal labial disc, at the junction with the mandibular structures (Fig. 4 a, d), and adults develop a normal proboscis. By contrast, knockdown of esg with esg-RNAi(v9793) caused a severe reduction or complete loss of the labial disc in most larvae (Fig. 4 b, e; quantified in g ) and resulted in adults lacking the distal proboscis (labellum). This severe phenotype was consistently observed with both the esg L4 and esg NP5130 drivers, confirming that it arises from loss of esg function in the disc proper. Co-expression of the esg-EP allele with esg-RNAi(v9793) fully restored labial disc size, and yielded normal proboscis development (Fig. 4 c, f; quantified in h ) confirming the specificity of the observed phenotypes. Thus, although esg is broadly expressed across imaginal discs, its developmental role is highly domain- and tissue-specific, with peripodial expression critical in the antennal disc and disc-proper expression essential in the labial disc. Together, our antennal- and labial‐disc experiments reveal that escargot has highly specific domain roles in head imaginal discs. In the antennal disc, esg expression in the peripodial membrane is both necessary and sufficient to drive disc growth and maintain compartment boundaries. By contrast, labial‐disc (proboscis) growth depends on escargot function within the disc‐proper epithelium: knockdown using esg L4 or esg NP5130 reduces disc size and adult labellum is not formed, whereas peripodial‐restricted knockdown ( c311 > esg-RNAi ) leaves the proboscis intact. Therefore, even though esg is broadly expressed in all imaginal discs, its developmental function differs strikingly between disc types and epithelial layers, underscoring its context-dependent mechanism of action. Dpp signaling is required downstream of esg for labial disc growth and proboscis formation Given the complete loss of the distal proboscis in esg-RNAi adults and the well described requirement for Decapentaplegic (Dpp) in head-appendage development 7 , 15 , we asked whether Dpp acts downstream of esg in the labial disc. Using the esg L4 driver to express dpp-RNAi , we found that dpp knockdown phenocopies the esg-RNAi labial defects: third-instar labial discs are dramatically reduced in size and adult flies entirely lack the labellum (Fig. 5c1-5; quantified in Fig. 5 E). Conversely, co-expression of UAS-dpp with esg-RNAi ( esg L4 >esg-RNAi;+dpp ) fully restores labial‐disc area to control dimensions (Fig. 5d1-5, e ), although these pharates fail to eclose—likely reflecting deleterious effects of ectopic Dpp outside its normal domain. This observation underscores the importance of spatially restricted dpp activity for normal development. qPCR on dissected labial discs confirms that esg knockdown significantly reduces dpp mRNA levels (Fig. 5 f), whereas dpp expression in the antennal disc remains unchanged under esg-RNAi conditions (Fig. 5 g). These findings are consistent with the idea that Dpp signalling is required downstream of escargot for labial disc growth, although it remains to be determined whether this regulation is direct or indirect. Discussion We show that decreasing esg expression levels using two independent Gal4 drivers ( esg L4 and esg NP5130 ) in combination with three different esg-RNAi lines produces a spectrum of head-appendage defects, from malformed or missing antennae and maxillary palps to complete loss of the distal proboscis that leaves only the labrum. Quantitative RT–PCR on dissected eye–antennal discs confirms that the three RNAi lines reduce esg transcript to varying degrees; the degree of this reduction positively correlates with phenotype severity. TUNEL assays reveal only a modest increase in apoptosis in antennal discs upon esg knockdown—and none in labial discs— thus indicating that altered programed cell dead alone cannot account for the observed severe morphological defects, and therefore implicating mis-patterning or cell fate changes as major phenotype contributors. This idea is supported by previous work that shows that in esg snail (sna) double mutants, wing-disc primordia convert into larval epidermis rather than undergoing apoptosis 5 . Given the low levels of cell death we observed, one hypothesis is that head-disc cells lacking Esg may similarly adopt alternative fates (e.g. epidermal), contributing to the morphogenetic defects. Future experiments using lineage-tracing could be used to discern such trans- or de-differentiation events. An alternative hypothesis is that escargot also restrains endoreplication in imaginal cells by upregulating Cdc2, preventing their conversion into polyploid larval epidermal cells 6 , 13 . Loss of esg in head discs may similarly trigger ectopic endocycles, altering cell size or identity in ways that disrupt normal patterning. Reducing esg expression levels disrupts the concentric organization of third-instar antennal discs, mislocalizes En disturbing their anterior-posterior pattering, and results in a significant reduction in disc size. Restoring esg expression levels using a P{EP}esg enhancer-promoter insertion rescues disc size, re-establishes compartment boundaries, and restores En‐defined patterning. Thus, esg is both necessary and sufficient to maintain antennal‐disc integrity. By comparing broad ( esg L4 , esg NP5130 ) versus peripodial-specific ( c311-Gal4 ) esg -knockdown, we found that Esg activity in the peripodial epithelium is both necessary and sufficient for antennal-disc growth and patterning—but does not affect proboscis formation. In contrast, labial-disc outgrowth (proboscis morphogenesis) requires Esg function within the disc-proper epithelium as peripodial-restricted knockdown leaves the proboscis intact, whereas broad drivers abolish the distal labial domain and adult labellum. These findings reveal that esg function is context-dependent therefore, a single transcription factor exerts layer-specific control over different imaginal discs. Interestingly, a recent study showed that loss of eyes absent ( eya ) specifically in the cuboidal margin (“M-cells”) of the peripodial epithelium disrupts dpp signaling and blocks eye morphogenesis, yet leaves the antennal disc largely unaffected 16 . Their work highlights how a restricted subset of peripodial cells can exert compartmentalized control over dpp-mediated growth. By contrast, in our hands, esg knockdown under the same c311-Gal4 driver yields a strong antennal-disc phenotype despite apparent dpp independence, suggesting that esg acts within a distinct peripodial subdomain—perhaps analogous to the M-cell subset—to control antennal development via a dpp-independent pathway. These contrasting outcomes underscore functional specialization among peripodial subpopulations and support the idea that a small subset of peripodial cells can determine the morphogenetic outcome of the underlying disc In the wing imaginal disc, Esg and its family member Sna engage in a redundant auto- and cross-activation to establish a robust feed-forward circuit that locks in wing-cell fate (prospective wing cells induce both esg and snail , which then sustain each other’s expression and jointly activate downstream targets such as vestigial ) 5 . These studies even point out that while esg–sna interactions are critical in the wing, they do not occur in the leg disc, implying disc-specific regulatory circuitry. We propose that a similar Sna-mediated redundancy may buffer wing discs against loss of esg —explaining why wing patterning remains intact in our esg -RNAi larvae—whereas the absence of this backup in the antennal disc unmasks a strict requirement for Escargot. Given the complete proboscis loss upon esg knockdown, and the known requirement for Decapentaplegic ( Dpp ) in head-appendage development, we used esg L4 >dpp-RNAi to show that dpp depletion phenocopies esg-RNAi labial defects—and the co-expression of UAS-dpp with esg-RNAi fully rescues labial-disc area and proboscis formation (though this genotype is pharate lethal, probably due to ectopic Dpp ). qPCR on isolated labial discs confirms that esg knockdown significantly lowers dpp mRNA, while antennal-disc dpp levels remain unaffected. Together, these data place Dpp directly or indirectly downstream of esg in the labial disc, where dpp expression is both necessary and sufficient for proboscis outgrowth. While our work establishes Dpp as a key effector of Esg in this context, other signaling pathways such as Wg, Hedgehog, Notch, and EGF modulate Dpp’s context-dependent outputs 17 . Future genetic interaction studies could clarify how these networks integrate to refine head-appendage growth and patterning. In adults, the complete absence of the labellum is a striking phenotype. To our knowledge, a total loss of the labellum caused by genetic manipulation (without homeotic transformation) has not been reported previously. It is important to note that described classical head-appendage mutants never produce a simple deletion of the labellum. In proboscipedia null alleles, the labial distal proboscis is homeotically transformed into prothoracic (T1) legs rather than eliminated 2 . Combined proboscipedia + Sex combs reduced loss yields a full proboscis-to-antenna conversion, again replacing the labellum with antenna-type structures 15 . Also, previous studies described physical ablation of the labellum for behavioral assays, but not genetic ablation. By contrast, our esg knockdown produces complete absence of the entire distal taste organ—including the labellum—with no homeotic replacement. To our knowledge, this is the first reported case of genetic labellum ablation in Drosophila , highlighting Escargot’s indispensable function in labial-disc for sustaining distal growth and, consequently, for labellum formation. Conclusions Esg has long been implicated in imaginal-disc progenitor maintenance and epithelial integrity, notably in wing, leg, and eye discs (Fuse et al. 1994; Hayashi et al. 1993; Voas & Rebay 2004). Our data extend these roles to the labial and antennal compartments, uncovering a novel layer-specific requirement: peripodial function for antennal architecture versus disc-proper activity for labial outgrowth via direct regulation of a key morphogen. Although a working Esg antibody for immunofluorescence remains elusive, the use of two independent esg -Gal4 drivers with overlapping yet distinct domains and a peripodial Gal4 driver provides a robust proxy for the study of endogenous esg expression. Future studies should dissect the molecular link between escargot and dpp transcription—identifying direct versus indirect regulation—as well as explore how peripodial-driven esg activity influences underlying disc growth. Finally, it will be important to assess downstream effectors (e.g., DE-cadherin) and cell-shape changes to fully elucidate escargot’s context-dependent mechanisms. Our work demonstrates that Esg functions as a pleiotropic regulator of head-appendage development, with dosage-sensitive, layer-specific roles that differentially control antennal architecture and proboscis morphogenesis through Dpp-dependent and -independent pathways. These findings enrich our understanding of how a single transcription factor can orchestrate diverse developmental programs across distinct epithelial contexts. Materials and method Stocks and crosses Flies were raised on standard yeast medium at 25°C. Oregon-R and w 1118 [Bloomington Drosophila Stock Center (BDSC)]. esg L4 ( w 1118 ; P{GawB-GAL4 . esg} L4 ) was obtained in our laboratory by mobilization of P-element P{GawB} 11 . All other lines used in this work are available at the Bloomington Drosophila Stock Center (NIH P40OD018537): esg NP5130 =P{GawB}NP5130 (BDSC 93857), RNAi knockdown: UAS-esg-RNAi (BDSC 34063), UAS-esg-RNAi [Vienna Drosophila Resource Center (VDRC), v9794 and v9793], UAS-dpp-RNAi (BDSC 25782), C311-GAL4 (BDSC 5937), P{EP}esg (BDSC 30934), UAS-mCD8::Cherry UAS-GFP (BDSC 27391; BDSC27392). Quantitative PCR Total RNA was extracted from third-instar larval imaginal discs (eye/antennal and labial discs; in the latter case, the anterior larval region was dissected excluding the mandibles) with TRIzol™ Reagent (Invitrogen, #15596018). At least 30 pairs of discs were collected per sample. RNA was treated with DNase I, RNase-free (Thermo Fisher Scientific, #EN0521), and reverse transcribed using NZY Reverse Transcriptase (NZYTech, #MB12401) with random primers (Invitrogen, #48190011), starting from 0.5–1 µg of total RNA. qPCR reactions for esg were performed using TaqMan™ Gene Expression Master Mix (Applied Biosystems, #4369016), while dpp reactions were carried out with qPCR GreenMaster highROX (Jena Bioscience, #PCR-374), according to the manufacturer’s instructions using 20 ng of cDNA for each reaction. For esg , a TaqMan® probe was used at a final concentration of 25 nM (5’-/56-FAM/TTCTTGATGTCCGAGTGGGTCTGC/36-TAMSp/-31), together with the primers 5’-TGCAGATCGCTCGAATCTGC-3’ and 5’-AGCAACTGGTGCAGGAGTAC-3’. For dpp , the primers dpp-Fwd 5′-GCCAACACAGTGCGAAGTT-3’ and dpp-Rev 5′-CGCGTGATGTCGTAGACAAG-3’ were used, which had been previously reported by Denton et al. (Cell Death Differ 26 , 763–778, 2019). Thermal cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 58°C for 1 min. For labial disc samples, the cycle number was extended to 50 to ensure amplification curve saturation. TUNEL cell death detection Cell death was labeled using the In Situ Cell Death Detection Kit, TMR red (Roche). Imaginal discs were dissected in PBS, fixed in PBS 4% paraformaldehyde for 1hr at 4°C, washed three time in PBST (PBS supplemented with 0.1% Triton X-100). Discs were blocked in PBST with 5% pre-immune goat serum for 12 hours at 4°C and transferred to permeabilization solution (0.1% Sodium citrate, 0.1% Triton X-100) at room temperature then followed the manufacturer’s instructions. Labeled were imagined using confocal microscopy. Signal was quantified using imageJ’s analyze particle tool. Immunohistochemistry Tissue was dissected in PBS, fixed in PBS 4% formaldehyde, permeabilized with 0.2% TritonX-100 and blocked for 30 min with 5% goat pre-immune serum at room temperature. The primary antibodies were added in permeabilization buffer (see antibodies and concentrations below), incubated overnight at 4°C and washed 3 times in PBS 0.2% TritonX-100 at room temperature. The secondary antibodies were added, incubated for 90 min, and washed 3 times in PBS 0.2% TritonX-100 at room temperature. Primary antibodies used: Rabbit anti-GFP (Abcam ab290 1:1000), Mouse anti-Arm (N2 7A1, DSHB 1:50), Mouse Anti-En (4D9, DSHB 1:50), Rat anti-Ci (2A1, DSHB 1:50). Secondary antibodies Cy2 anti-rabbit, Cy2 anti-mouse, Cy2 anti-Rat, Cy3 anti-mouse, Cy3 anti-rat and Cy5 anti-mouse (Jackson immunoResearch) at 1:300 dilutions. Samples were mounted in Citifluor (Ted Pella Inc). Confocal Imaging Images were collected at the “Laboratorio Nacional de Microscopía Avanzada (LNMA)” in an inverted Confocal multiphotonic Olympus FV1000 using an optimal confocal pinhole and Z steps. Images were analyzed and reconstructed using the open source ImageJ program 18 . Statistical Analysis All quantitative data are presented as mean ± standard deviation (SD). Statistical analyses were performed using one-way analysis of variance (ANOVA) to evaluate differences among experimental groups. When significant main effects were detected, Tukey’s multiple comparison post hoc test was applied to identify pairwise differences. The level of statistical significance was set at p < 0.05. Significance levels are indicated in the figures as follows: p < 0.05 (* ), p < 0.01 (**), p < 0.001 (***) and p < 0.0001 (**** ); “ns” denotes non-significant differences. All analyses were carried out using GraphPad Prism (version X; GraphPad Software, San Diego, CA, USA) unless otherwise stated. Declarations Author statements: The authors declare no competing interests. The authors declare that this work has not been submitted to other journals. The authors declare that no human subjects or vertebrates were used in this work and comply with the bioethical guidelines of their institutions. Funding: This project was financed by the following research grants: CONAHCyT : CF-2023-I-703 (VNP); PAPIIT- UNAM : IN210124 (ER). RMM was financed by a postdoctoral scholarship granted by Consejo Técnico de la Investigación Científica DGAPA-UNAM CJIC/CTIC1370/2024 FRB (CVU481914) was financed by a postdoctoral scholarship granted by SECIHTY. Author Contribution VNP and ER conceived and supervised the study. VNP, ER, FRB, ISD, RMM designed the experiments. FRB, ISD and RMM performed the genetic crosses, immunostainings, confocal imaging, qPCR and TUNEL assays. Data analysis was carried out by VNP, ER, FRB, ISD and RMM. VNP and ER wrote the manuscript with input from all authors. All authors reviewed and approved the final version of the manuscript. Acknowledgement The authors want to thankM.Sc. Andrés Saralegui and Dr. Arturo Pimentel from the Laboratorio Nacional de Microscopía Avanzada (LNMA) for technical support. Dr. Paul Gaytan from the Unidad de Síntesis de Oligonucleótidos (IBT-UNAM) for technical support. Also to Agustín Reyes-Pérez (CIDC-UAEM) and René Hernandez- Vargas (IBT-UNAM) for technical support. Data Availability All data and materials are available upon request. For any data or material request from this study contact Dr. Verónica Narváez-Padilla at [email protected] References Haynie, J. L. & Bryant, P. J. Development of the eye-antenna imaginal disc and morphogenesis of the adult head inDrosophila melanogaster. J. Exp. Zool. 237 , 293–308 (1986). Aplin, A. C. & Kaufman, T. C. Homeotic transformation of legs to mouthparts by proboscipedia expression in Drosophila imaginal discs. Mech. Dev. 62 , 51–60 (1997). Abzhanov, A., Holtzman, S. & Kaufman, T. C. The Drosophila proboscis is specified by two Hox genes, proboscipedia and Sex combs reduced, via repression of leg and antennal appendage genes. Development 128 , 2803–2814 (2001). Merrill, V. K. L., Diederich, R. J., Turner, F. R. & Kaufman, T. C. A genetic and developmental analysis of mutations in labial, a gene necessary for proper head formation in Drosophila melanogaster. Dev. Biol. 135 , 376–391 (1989). Fuse, N., Hirose, S. & Hayashi, S. Determination of wing cell fate by the escargot and snail genes in Drosophila. Development 122 , 1059–1067 (1996). Hayashi, S., Hirose, S., Metcalfe, T. & Shirras, A. Control of imaginal cell development by the escargot gene of Drosophila. Development 118 , 105–115 (1993). Affolter, M. & Basler, K. The Decapentaplegic morphogen gradient: from pattern formation to growth regulation. Nat. Rev. Genet. 8 , 663–674 (2007). Morimura, S., Maves, L., Chen, Y. & Hoffmann, F. M. decapentaplegic overexpression affects Drosophila wing and leg imaginal disc development and wingless expression. Dev. Biol. 177 , 136–151 (1996). Hayashi, S. et al. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis 34 , 58–61 (2002). Goto, S. & Hayashi, S. Proximal to distal cell communication in the Drosophila leg provides a basis for an intercalary mechanism of limb patterning. Development 126 , 3407–3413 (1999). Sanchez-Díaz, I. et al. The Esg Gene Is Involved in Nicotine Sensitivity in Drosophila melanogaster. PLoS One . 10 , e0133956 (2015). Gibson, M. C. & Schubiger, G. Peripodial Cells Regulate Proliferation and Patterning of Drosophila Imaginal Discs. Cell 103 , 343–350 (2000). Fuse, N., Hirose, S. & Hayashi, S. Diploidy of Drosophila imaginal cells is maintained by a transcriptional repressor encoded by escargot. Genes Dev. 8 , 2270–2281 (1994). Roørth, P. et al. Systematic gain-of-function genetics in Drosophila. Development 125 , 1049–1057 (1998). Yasunaga, K., Saigo, K. & Kojima, T. Fate map of the distal portion of Drosophila proboscis as inferred from the expression and mutations of basic patterning genes. Mech. Dev. 123 , 893–906 (2006). Weasner, B. M. & Kumar, J. P. The timing of cell fate decisions is crucial for initiating pattern formation in the Drosophila eye. Development 149 , dev199634 (2022). Upadhyay, A., Moss-Taylor, L., Kim, M. J., Ghosh, A. C. & O’Connor, M. B. TGF-β Family Signaling in Drosophila. Cold Spring Harb Perspect. Biol. 9 , a022152 (2017). Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods . 9 , 671–675 (2012). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 27 Apr, 2026 Reviews received at journal 20 Feb, 2026 Reviewers agreed at journal 10 Feb, 2026 Reviews received at journal 30 Nov, 2025 Reviewers agreed at journal 25 Nov, 2025 Reviewers invited by journal 25 Nov, 2025 Editor assigned by journal 25 Nov, 2025 Editor invited by journal 21 Nov, 2025 Submission checks completed at journal 18 Nov, 2025 First submitted to journal 18 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7992861","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":550762145,"identity":"a57ec870-e129-4d8c-8ac2-fea7b68b3b5d","order_by":0,"name":"Fernando Rosales-Bravo","email":"","orcid":"","institution":"Universidad Nacional Autonoma de Mexico","correspondingAuthor":false,"prefix":"","firstName":"Fernando","middleName":"","lastName":"Rosales-Bravo","suffix":""},{"id":550762146,"identity":"3bb79c57-166e-47ca-b4a6-5c59a4fd4f60","order_by":1,"name":"Iván Sánchez-Díaz","email":"","orcid":"","institution":"Universidad Nacional Autonoma de Mexico","correspondingAuthor":false,"prefix":"","firstName":"Iván","middleName":"","lastName":"Sánchez-Díaz","suffix":""},{"id":550762147,"identity":"bd877102-8f70-4dd2-bfb0-94255936b980","order_by":2,"name":"Raquel Martínez-Méndez","email":"","orcid":"","institution":"Universidad Nacional Autonoma de Mexico","correspondingAuthor":false,"prefix":"","firstName":"Raquel","middleName":"","lastName":"Martínez-Méndez","suffix":""},{"id":550762148,"identity":"e186592c-67a6-4048-9733-f52be81584f4","order_by":3,"name":"Enrique Reynaud","email":"","orcid":"","institution":"Universidad Nacional Autonoma de Mexico","correspondingAuthor":false,"prefix":"","firstName":"Enrique","middleName":"","lastName":"Reynaud","suffix":""},{"id":550762149,"identity":"87756f8e-7a89-46f0-a858-90c33a650949","order_by":4,"name":"Verónica Narváez-Padilla","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsUlEQVRIiWNgGAWjYDADftK1SDaQrMXgANEqbzc/+8xTY2NvfCP54aMbDNsSCdpmcOeY8WyeY2nMZjfSjI1zGG4bE7RFckaCMeMMtsNsZjcSzKSBWuSI0JL+mXHGv/88xjPSv/8GauEhqIVfIseY4WPbAQkDiRwzZqJsAWopZvjYl2wgceZNsXSOARF+YZNI38yQ8M3Onr89fePnnIrbhEMMDRiQqH4UjIJRMApGAXYAAH1+NsmD+pbAAAAAAElFTkSuQmCC","orcid":"","institution":"Universidad Autónoma del Estado de Morelos","correspondingAuthor":true,"prefix":"","firstName":"Verónica","middleName":"","lastName":"Narváez-Padilla","suffix":""}],"badges":[],"createdAt":"2025-10-30 22:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7992861/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7992861/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97015506,"identity":"d44af372-0842-48bc-ae4c-325aa8639cf5","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5505823,"visible":true,"origin":"","legend":"","description":"","filename":"Rosalesetal2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/da3c057cbef638c9b83cd307.docx"},{"id":97015503,"identity":"5e4ca9c3-7bf0-4088-a518-a7e849748d55","added_by":"auto","created_at":"2025-11-28 16:53:54","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7113,"visible":true,"origin":"","legend":"","description":"","filename":"408de9e8603549edac60a4bf273da70a.json","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/8bd9ee54fd8799f56dd37078.json"},{"id":97137843,"identity":"886533c5-168a-4de7-96de-e00b91d61ec1","added_by":"auto","created_at":"2025-12-01 09:58:14","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122409,"visible":true,"origin":"","legend":"","description":"","filename":"408de9e8603549edac60a4bf273da70a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/39b07c577b05caaebfe811f9.xml"},{"id":97015507,"identity":"f9e8f9f7-c78f-494e-811d-a9dc814d2d82","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156751,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/f314b6dcbe7a38de7f884a8f.png"},{"id":97015512,"identity":"69d8b0ba-cca0-46b6-ac2d-c3bb05e123e5","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":141107,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/4a140d37bd11c8dbbd7b582c.png"},{"id":97015514,"identity":"eee8a671-1000-401f-bec6-c1ed796e175b","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130826,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/4690b87395da2ff7be8e4d8b.png"},{"id":97139031,"identity":"8978e558-7e1f-490f-9b55-432dc5a837e8","added_by":"auto","created_at":"2025-12-01 09:59:33","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":164702,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/03f5866ee7855d8856a7261f.png"},{"id":97015513,"identity":"0b26475b-8f0b-4e44-ac1b-f7db13d36c93","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":240683,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/e36c9e12bcd3a248ddb3cde0.png"},{"id":97139922,"identity":"774051c3-5b5a-4daf-ab25-ed59a15828aa","added_by":"auto","created_at":"2025-12-01 10:03:21","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121078,"visible":true,"origin":"","legend":"","description":"","filename":"408de9e8603549edac60a4bf273da70a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/11e4b97b5d33cfa0a6b16877.xml"},{"id":97015517,"identity":"da254072-f6f8-4456-bc0b-6a6abf1e2860","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":143159,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/51a6d9d1acbc4ab943f20a7d.html"},{"id":97015504,"identity":"737e87b1-babd-4336-983b-7a3c6ade6c2d","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2060761,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eesg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e causes severe defects in anterior head appendages adult head phenotypes following \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eesg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e knockdown\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea)\u003c/strong\u003e Map of the \u003cem\u003eesg\u003c/em\u003e locus indicating the locations of P-element insertions used in this study: the GAL4 drivers \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e (does not alter \u003cem\u003eesg\u003c/em\u003e mRNA) and esg\u003csup\u003eL4\u003c/sup\u003e (inserted in the 5′ UTR, loss-of-function allele), the enhancer-promoter insertion \u003cem\u003eP{EP}esg\u003c/em\u003e\u003csup\u003e\u003cem\u003eEU143\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003eesg\u003c/em\u003e-\u003cem\u003eEP\u003c/em\u003e), and the target regions for the UAS-\u003cem\u003eesg\u003c/em\u003e RNAi lines (v9793, v9794, 34063).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb) \u003c/strong\u003eRepresentative adult head with wild type morphology. Flies carrying individual driver alleles or RNAi constructs exhibit normal head structures.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec)\u003c/strong\u003e \u003cem\u003eesg\u003c/em\u003e knockdown causes loss of the distal proboscis; the arrow marks the remaining labrum and the absence of labium/labellum.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed-e) \u003c/strong\u003eUnilateral (d) and bilateral (e) antennal loss in \u003cem\u003eesg\u003c/em\u003e knockdown (arrowheads mark the antennal positions).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef)\u003c/strong\u003e Antennal duplication (arrowheads).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg)\u003c/strong\u003e Maxillary palp malformation (arrow).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh)\u003c/strong\u003e qPCR of \u003cem\u003eesg\u003c/em\u003e mRNA in third-instar eye–antennal discs. \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130 \u003c/em\u003e\u003c/sup\u003edoes not change \u003cem\u003eesg\u003c/em\u003e transcript levels; \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e/+ reduces them to ~50% of wild type. All three RNAi lines decrease \u003cem\u003eesg\u003c/em\u003e mRNA to varying extents (v9794 \u0026lt; v9793 \u0026lt; 34063), correlating with phenotype severity. Co-expression of esg-EP rescues \u003cem\u003eesg\u003c/em\u003e expression (dotted line, wild-type level).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ei, j)\u003c/strong\u003e TUNEL quantification in third-instar eye–antennal discs (i) and labial discs (j). \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e/+ shows a modest increase in apoptosis versus \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e, which is further elevated in \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u0026gt;\u003cem\u003eUAS-esg-RNAi (v9793)\u003c/em\u003e antennal discs; labial discs show no significant increase despite strong proboscis defects. Points represent individual discs.\u003c/p\u003e\n\u003cp\u003eBars show mean ± SD; asterisks indicate significant differences; “ns”, not significant (details in Methods). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test (* p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/d85925f5467075337a754e53.png"},{"id":97139614,"identity":"f08bfe29-33c5-48e4-9f08-a2145df04c00","added_by":"auto","created_at":"2025-12-01 10:00:57","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":342264,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eesg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e disrupts the spatial organization and compartmental identity of the antennal disc, but not the wing disc\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea-c)\u003c/strong\u003e Brightfield-overlay confocal images of third-instar antennal discs immunostained for Engrailed (En, red) and DAPI (blue). Orange dotted lines outline the central domain, and white dotted lines mark the posterior peripheral region. a) Controls (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u0026gt;\u003cem\u003eUAS-mCD8::GFP\u003c/em\u003e) show a concentric central domain surrounded by a peripheral field. b) \u003cem\u003eesg\u003c/em\u003e knockdown (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-RNAi [v9793\u003c/em\u003e] causes loss of the peripheral posterior region and disrupts disc architecture, allowing mandibular structures to contact the disc (red arrow). c) Co-expression of \u003cem\u003eesg-EP\u003c/em\u003e (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-EP;esg-RNAi [v9793]) \u003c/em\u003erestores disc size and organization\u003cem\u003e.\u003c/em\u003e\u003cbr\u003e\n\u003cstrong\u003ed-f\u003c/strong\u003e) Confocal images of the same genotypes. d) In control discs, GFP marks \u003cem\u003eesg\u003c/em\u003e-expressing cells predominantly within the dorsal central and peripheral domains. e) \u003cem\u003eesg\u003c/em\u003e knockdown reduces disc size and disrupts GFP patterning. f)\u0026nbsp; \u003cem\u003eesg-EP\u003c/em\u003e co-expression restores disc size and pattering.\u003cbr\u003e\n\u003cstrong\u003eg-i)\u003c/strong\u003e Antennal discs labeled with \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::Cherry\u003c/em\u003e (green), immunostained for En (red) and DAPI (blue).\u0026nbsp; g) Controls display a well-defined concentric central domain (orange dashed line) surrounded by a continuous peripheral field, with broad, relatively homogeneous Cherry signal and normal En patterning.\u003cstrong\u003e \u003c/strong\u003eh) With \u003cem\u003eesg\u003c/em\u003e RNAi(v9793), the disc is smaller; the central concentric organization collapses, the posterior peripheral region (white dotted line) is largely absent, and Cherry signal becomes patchy. i) With \u003cem\u003eesg-EP\u003c/em\u003e co-expression, disc size and architecture are restored.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ej-m)\u003c/strong\u003e Antennal (j, k) and wing (l, m) discs stained for Ci (gray; anterior) and En (red; posterior). j, l)\u003cstrong\u003e \u003c/strong\u003eControls show complementary Ci/En domains separated by a sharp anteroposterior (AP) boundary. k) In \u003cem\u003eesg\u003c/em\u003e RNAi antennal discs, AP compartmental organization is disrupted (irregular/blurred Ci–En boundary and domain disarray). m) Wing discs from the same individuals retain normal AP patterning. Scale bars: 50 µm.\u003cbr\u003e\n\u003cstrong\u003en)\u003c/strong\u003e Quantification of antennal disc area (µm²) for the indicated genotypes. \u003cem\u003eesg\u003c/em\u003e knockdown significantly reduces disc size compared to controls, while \u003cem\u003eesg-EP\u003c/em\u003e co-expression restores normal dimensions. Bars show mean ± SD; asterisks indicate significant differences; “ns”, not significant (details in Methods). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test (* p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/b0fa77ab5727c46af5cadc31.jpeg"},{"id":97015511,"identity":"1796d7f6-4938-44b0-bd4d-fafa8fb39b0b","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":318544,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eesg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in the peripodial membrane using \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ec311-Gal4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e disorganizes the antennal disc and causes antennal loss in adults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea) \u003c/strong\u003eConfocal images of third instar eye–antennal discs from \u003cem\u003ec311-Gal4\u0026gt;UAS-mCD8::Cherry\u003c/em\u003e animals. In control discs (top row), Cherry expression (red) extensively labels the peripodial epithelium, while Engrailed (En, grayscale) marks the posterior compartment. Knockdown of \u003cem\u003eesg\u003c/em\u003e using \u003cem\u003ec311-Gal4\u0026gt;esg-RNAi (v9793)\u003c/em\u003e(middle row) causes severe disorganization of the antennal disc, including loss of concentric patterning and posterior compartment integrity. Co-expression of \u003cem\u003eesg-EP\u003c/em\u003ewith \u003cem\u003eesg\u003c/em\u003e-RNAi (bottom row) partially to nearly completely rescues disc morphology and Engrailed patterning.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb)\u003c/strong\u003e Adult head images show phenotypic consequences of peripodial \u003cem\u003eesg\u003c/em\u003e knockdown. Control flies (\u003cem\u003ec311-Gal4\u0026gt;UAS-GFP \u003c/em\u003e(top row) display normal antennae. In contrast, \u003cem\u003ec311-Gal4\u0026gt;esg-RNAi (v9794)\u003c/em\u003e animals (middle row) frequently exhibit partial or complete antennal loss (arrowhead), consistent with the developmental defects observed in the larval discs. Co-expression of \u003cem\u003ec311-Gal4\u0026gt;esg-RNAi (v9794) \u003c/em\u003ewith \u003cem\u003eesg\u003c/em\u003e-\u003cem\u003eEP\u003c/em\u003e restores normal antennae morphology (bottom row).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec)\u003c/strong\u003e Quantification of disc areas. Knockdown of \u003cem\u003eesg\u003c/em\u003e under \u003cem\u003ec311-Gal4\u003c/em\u003e significantly reduces antennal disc area compared to controls (***p \u0026lt; 0.001). Co-expression of \u003cem\u003eesg-EP\u003c/em\u003erestores antennal disc size to control levels (ns = not significant). Each dot represents a single disc.\u003c/p\u003e\n\u003cp\u003eBars show mean ± SD; asterisks indicate significant differences; “ns”, not significant (details in Methods). Statistical significance was determined by one-way ANOVA followed by Tukey’s post hoc test (* p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/b7fedeec1976b3da899480f0.jpeg"},{"id":97015509,"identity":"0d28aaad-d1da-4399-99b1-3ea93ad9d49f","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":387380,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eesg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e function leads to labial disc reduction, and proboscis loss in adults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea-c)\u003c/strong\u003e \u003cem\u003eesgL4\u0026gt;UAS-mCD8::GFP\u003c/em\u003e marks \u003cem\u003eesg\u003c/em\u003e-expressing cells (green) in third-instar labial discs, counterstained with DAPI (blue).\u0026nbsp; a) In controls, \u003cem\u003eesg\u003c/em\u003e expression is strongest in the proximal disc (top), and adults develop a normal proboscis (bottom). b) Knockdown of \u003cem\u003eesg\u003c/em\u003e with \u003cem\u003eesg-RNAi(v9793)\u003c/em\u003e results in a severe reduction or complete loss of the labial disc (outlined, top) and produces adults lacking the distal proboscis (bottom). \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ec)\u003cstrong\u003e \u003c/strong\u003eCo-expression of the \u003cem\u003eesg\u003c/em\u003e-\u003cem\u003eEP\u003c/em\u003e allele rescues labial disc size and restores proboscis development.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed–f)\u003c/strong\u003e \u003cem\u003eesgNP5130\u0026gt;UAS-mCD8::Cherry\u003c/em\u003e marks \u003cem\u003eesg\u003c/em\u003e expressing cells (green) in third instar labial discs, counterstained with DAPI (blue). d) Control discs show proximal \u003cem\u003eesg\u003c/em\u003e expression (top) and yield a normal proboscis (bottom). e) \u003cem\u003eesg-RNAi(v9793)\u003c/em\u003e knockdown reduces disc size (top) and produces adults without a proboscis (bottom). f) Rescue with \u003cem\u003eesg\u003c/em\u003e-\u003cem\u003eEP\u003c/em\u003e restores disc morphology (top) and proboscis development (bottom)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg) \u003c/strong\u003eQuantification of labial disc area for both drivers (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003eand \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e). In both cases, disc size is strongly reduced upon \u003cem\u003eesg-RNAi(v9793)\u003c/em\u003e knockdown, and rescued to control levels by co-expression of \u003cem\u003eesg-EP\u003c/em\u003e. (**** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001; one-way ANOVA with Tukey post-hoc).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eh) \u003c/strong\u003eQuantification of adult proboscis morphology for both drivers. Knockdown of \u003cem\u003eesg\u003c/em\u003e eliminates the proboscis, while rescue with \u003cem\u003eesg-EP\u003c/em\u003e restores normal development. ns = not significant; ****p \u0026lt; 0.0001 (one-way ANOVA with Tukey’s post hoc test.Blue = DAPI (nuclei); Green = GFP or Cherry. White dotted lines delineate the labial disc. Scale bars, 20 µm (all panels).\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/d94daa5b1897b4203954eebf.jpeg"},{"id":97015515,"identity":"e1a61f83-c7fe-4a97-b5d1-6fdd25f84e13","added_by":"auto","created_at":"2025-11-28 16:53:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2309906,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDpp is required downstream of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eesg\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e for labial disc growth and proboscis development\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColumns 1-4)\u003c/strong\u003e confocal images of third instar labial discs: 1) DAPI labels nuclei; 2) GFP marks \u003cem\u003eesg\u003c/em\u003e-expressing cells; 3) armadillo (Arm) outlines cell borders; 4) merge. Scale bars, 20 μm. \u003cstrong\u003eColumns 5)\u003c/strong\u003e adult head morphology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea1–a5)\u003c/strong\u003e Control labial discs (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-GFP\u003c/em\u003e) show normal morphology and adults develop a normal proboscis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eb1-b5)\u003c/strong\u003e \u003cem\u003eesg\u003c/em\u003e knockdown (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-GFP\u003c/em\u003e; \u003cem\u003eUAS-esg-RNAi (v9793)\u003c/em\u003e) causes severe labial disc reduction and adults lack the distal proboscis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ec1-c5)\u003c/strong\u003e \u003cem\u003edpp\u003c/em\u003e knockdown (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-GFP; UAS-dpp-RNAi\u003c/em\u003e) phenocopies the \u003cem\u003eesg-RNAi\u003c/em\u003e phenotype: discs are reduced and adults lack the proboscis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ed1–d5) \u003c/strong\u003eCo-expression of \u003cem\u003edpp\u003c/em\u003e (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-GFP; UAS-esg-RNAi (v9793\u003c/em\u003e); \u003cem\u003eUAS-dpp\u003c/em\u003e) rescues labial disc size and architecture, however, pharates fail to eclose consistent with deleterious effects of ectopic Dpp.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ee) \u0026nbsp;\u003c/strong\u003eQuantification of labial disc area in controls, \u003cem\u003eesg\u003c/em\u003e-RNAi, \u003cem\u003edpp\u003c/em\u003e-RNAi, and \u003cem\u003eesg\u003c/em\u003e-RNAi;\u003cem\u003edpp\u003c/em\u003e rescue (****p \u0026lt; 0.0001; one-way ANOVA with Tukey’s post-hoc test).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ef) \u003c/strong\u003eqPCR on dissected labial discs shows that \u003cem\u003eesg\u003c/em\u003e knockdown significantly reduces \u003cem\u003edpp\u003c/em\u003e transcript levels (*p \u0026lt; 0.05; **p \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eg)\u003c/strong\u003e \u003cem\u003edpp\u003c/em\u003e expression in eye–antennal discs are unchanged under \u003cem\u003eesg\u003c/em\u003e-RNAi conditions (ns, not significant).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/55d8ec8cd3d5333ad3cd8ef5.png"},{"id":97145015,"identity":"d7b1ba5a-a86e-4fcf-86dc-c7dff97a1fa2","added_by":"auto","created_at":"2025-12-01 10:12:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6371681,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7992861/v1/226c129e-a8b1-4339-89b9-77d1ffd02cb3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Differential epithelial requirements for Escargot define Dpp-dependent and Dpp-independent pathways in Drosophila head appendage formation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eProper development of the adult \u003cem\u003eDrosophila\u003c/em\u003e head requires the coordinated morphogenesis of distinct imaginal disc primordia, including the antennal and labial discs, which give rise to the antennae, maxillary palps, and the proboscis \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. While much is known about the genetic programs that specify appendage identity\u0026mdash;such as the homeotic functions of Proboscipedia (pb), Sex combs reduced (Scr) and labial (lab) in proboscis formation\u003csup\u003e\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e \u0026mdash;the molecular mechanisms that govern growth, compartmental architecture, and epithelial integrity within these discs remain incompletely understood.\u003c/p\u003e\u003cp\u003e\u003cem\u003eescargot\u003c/em\u003e (\u003cem\u003eesg\u003c/em\u003e) encodes a Snail-family zinc‐finger transcription factor that is broadly expressed in imaginal-disc progenitors and is essential for progenitor‐cell maintenance, epithelial integrity, and growth in the wing, leg, eye, and genital discs \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In these contexts, \u003cem\u003eesg\u003c/em\u003e prevents premature differentiation and restrains aberrant endoreplication by regulating cell‐cycle factors such as Cdc2. Despite its well‐characterized roles in these tissues, the function of \u003cem\u003eescargot\u003c/em\u003e in the anterior head imaginal discs (antennae and labial) has not been systematically explored.\u003c/p\u003e\u003cp\u003eDecapentaplegic (Dpp) signaling is another critical regulator of head-appendage development, acting downstream of Hox genes to promote proliferation and patterning in imaginal discs\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. In the labial disc, Dpp is required for distal‐proboscis outgrowth, yet how Dpp activity is coordinated with upstream transcriptional regulators remains unclear. Moreover, whether \u003cem\u003eesg\u003c/em\u003e interacts with \u003cem\u003eDpp\u003c/em\u003e signaling to control disc growth and morphogenesis in a tissue‐ or layer‐specific manner has not been addressed.\u003c/p\u003e\u003cp\u003eHere, we investigate the role of escargot in Drosophila head-appendage development by combining RNA interference (RNAi) knockdown with two independent Gal4 drivers\u0026mdash;\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e, which faithfully recapitulates endogenous \u003cem\u003eesg\u003c/em\u003e expression without altering mRNA levels\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e, a hypomorphic insertion in the 5\u0026prime; UTR that behaves as a loss-of-function allele\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. We quantify morphological outcomes, gene‐expression changes, and apoptotic events to dissect how \u003cem\u003eesg\u003c/em\u003e dosage affects labial and antennal discs growth and patterning. By employing peripodial‐specific knockdown (c311-Gal4)\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, we further delineate the epithelial domains in which \u003cem\u003eesg\u003c/em\u003e is required. Finally, we test genetic interactions with Dpp to determine whether escargot acts upstream of this morphogen in labial‐disc outgrowth.\u003c/p\u003e\u003cp\u003eOur results reveal that escargot functions in a dosage\u0026mdash; layer-specific\u0026mdash;anteroposterior\u0026mdash;manner to control imaginal-disc morphogenesis: peripodial \u003cem\u003eesg\u003c/em\u003e activity is both necessary and sufficient for antennal‐disc compartmentalization and growth, whereas disc-proper \u003cem\u003eesg\u003c/em\u003e function drives labial-disc expansion and labellum formation through regulation of Dpp expression. These findings uncover a novel context-dependent mechanism by which a single transcription factor orchestrates distinct developmental programs across epithelial layers and imaginal‐disc types.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eLoss of esg leads to severe morphological defects in anterior head appendages\u003c/h2\u003e\n \u003cp\u003eThe zinc-finger transcription factor escargot (\u003cem\u003eesg\u003c/em\u003e) is required for progenitor-cell maintenance, epithelial integrity, and growth in \u003cem\u003eDrosophila\u003c/em\u003e imaginal discs \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Although its roles in the wing, leg, eye and genital discs are well characterized, its function in the labial and antennal discs remains to be understood. To investigate the role of esg in these anterior head structures, we performed RNAi-mediated knockdown using three independent lines (v9793, v9794, 34063) driven by two GAL4 drivers: \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e, a \u003cem\u003eP{GaWB}\u003c/em\u003e insertion which faithfully recapitulates endogenous \u003cem\u003eesg\u003c/em\u003e expression without altering mRNA levels and has been widely used\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e, a \u003cem\u003eP{GaWB}\u003c/em\u003e insertion in the 5\u0026rsquo; UTR of \u003cem\u003eesg\u003c/em\u003e transcript that behaves as a loss-of-function allele obtained in our laboratory \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n \u003cp\u003eTo rescue \u003cem\u003eesg\u003c/em\u003e expression, we used the \u003cem\u003eP{EP}esg\u003c/em\u003e\u003csup\u003e\u003cem\u003eEU143\u003c/em\u003e\u003c/sup\u003e enhancer-promoter insertion (esg-EP), as this element results in over-expression of the endogenous gene in the presence of a GAL4 driver \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. A schematic of the \u003cem\u003eesg\u003c/em\u003e locus showing the P-element insertions and RNAi target sites is presented in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea.\u003c/p\u003e\n \u003cp\u003eWhen alone, neither the driver lines nor any of the parental RNAi lines had any head defects. \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e homozygotes are viable, fertile and appear to be phenotypically wild type; in contrast, \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e homozygotes are lethal in first instar larva while the heterozygotes are viable, fertile and morphologically normal. By themselves, the RNAi lines v9793, v9794 and 34063 have normal head appendages (a representative wild type head is shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb with normal antennae and proboscis).\u003c/p\u003e\n \u003cp\u003eKnockdown of \u003cem\u003eesg\u003c/em\u003e combining either of the two drivers with any of the RNAi lines caused severe malformations of head appendages, the severity of these depending on the RNAi used. The most common malformation was the loss of the distal proboscis, as no labium nor labellum was formed, remaining only the labrum (a representative head is shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec where the arrow shows the remaining labrum and lack of labellum). We also observed bilateral or unilateral antenna loss (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed and \u003cstrong\u003ee\u003c/strong\u003e, arrowheads mark where the antennae should be), and in some cases duplicated antennae (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef). We also found malformations in maxillary palps where severe shape and size abnormalities were evident (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eg).\u003c/p\u003e\n \u003cp\u003eAt 25\u0026deg;C, even the least penetrant genotype, \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-RNAi(v9794)\u003c/em\u003e, consistently displayed proboscis defects in 100% of individuals, ranging from partial to complete loss of the labellum. In addition to this fully penetrant phenotype, 22% of flies showed unilateral or bilateral antennal loss, 10% exhibited duplicated antennae, and 5% presented simultaneous damage to both the antennae and maxillary palps. Remarkably, despite these pronounced morphological abnormalities, affected flies remained viable, fertile, and exhibited normal feeding behavior.\u003c/p\u003e\n \u003cp\u003eWhen the \u003cem\u003eesg\u003c/em\u003e-EP allele is introduced, the effect of the expression of any of the \u003cem\u003eesg\u003c/em\u003e-RNAis is significantly rescued, restoring normal head structures morphology, thus confirming the specificity of the knockdown effect.\u003c/p\u003e\n \u003cp\u003eWe quantified \u003cem\u003eesg\u003c/em\u003e mRNA levels in third instar eye-antennal discs by qPCR (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eh). As expected, \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e did not alter transcript levels, while \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e heterozygotes expressed approximately 50% of wild type \u003cem\u003eesg\u003c/em\u003e. All RNAi lines reduced \u003cem\u003eesg\u003c/em\u003e mRNA to varying extents, where the least penetrant was v9794, then v9793, and the most penetrant one is 34063, correlating with phenotype severity; the strongest RNAi (34063) was predominantly lethal, with only a few pupal escapers that failed to eclose. For adult phenotypic analysis of this line, pharates had to be manually extracted from their cases. Co-expression of these RNAi with the \u003cem\u003eesg-EP\u003c/em\u003e rescued \u003cem\u003eesg\u003c/em\u003e transcript levels, with \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e \u003cem\u003e\u0026gt;esg-EP, esg-RNAi (v9793)\u003c/em\u003e restoring levels to approximately twice that of wild type, and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e \u003cem\u003e\u0026gt;esg-EP, esg-RNAi (v9793)\u003c/em\u003e restoring them to near wild-type levels.\u003c/p\u003e\n \u003cp\u003eTo determine whether apoptosis is involved in causing these malformations, we performed TUNEL assays on third instar labial and eye-antennal discs. In antennal discs, \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e heterozygotes showed a modest increase in apoptotic cells relative to \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e controls, and this was further elevated in \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-RNAi(v9793)\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ei). However, since morphological defects only arose upon RNAi knockdown, apoptosis alone cannot fully account for the abnormal antennal phenotype. In labial discs, neither \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e heterozygotes nor \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u0026gt;esg-RNAi(v9793) showed a significant increase in apoptosis compared to controls (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ej) despite severe proboscis defects found in the latter genotype. These results imply that additional mechanisms\u0026mdash;such as altered patterning, proliferation, or cell-fate specification\u0026mdash;contribute to the developmental disruption of labial and antennal discs upon \u003cem\u003eesg\u003c/em\u003e loss.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eLoss of\u003c/strong\u003e \u003cstrong\u003eesg\u003c/strong\u003e \u003cstrong\u003edisrupts compartmental architecture of the antennal disc\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo test whether the adult antennal malformations observed arise during larval development, we examined third-instar antennal discs using two independent reporters of \u003cem\u003eesg\u003c/em\u003e expression: \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::GFP\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea-f) and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::Cherry\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eg-i). Engrailed (En, red) was used to mark the posterior compartment (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea\u0026ndash;m, \u003cstrong\u003ered)\u003c/strong\u003e, Cubitus interruptus (Ci) as anterior compartment marker (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ej-m, \u003cstrong\u003ewhite\u003c/strong\u003e) and nuclei were counterstained with DAPI (blue). Disc area quantification is shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003en.\u003c/p\u003e\n \u003cp\u003eControl discs shown Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea, d \u003cstrong\u003eand g\u003c/strong\u003e display a stereotyped morphology characterized by a central concentric domain (orange dotted line) surrounded by a less organized posterior peripheral field (white dotted line). This architecture has been previously described, where the central domain\u0026mdash;composed of tightly packed, columnar epithelial cells\u0026mdash;is prepatterned into concentric rings that give rise to the adult antenna. In contrast, the outer posterior peripheral region is less compact and contributes not to the antenna itself, but to the surrounding head epidermis and maxillary palps \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. This peripheral zone includes the junction with the cephalopharyngeal skeleton and is continuous with the tissue that will form the dorsal head cuticle. The anteroposterior (A/P) axis was well defined, with the posterior compartment marked by a semicircular domain where Engrailed (red) was localized. The \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e driver revealed a broad and homogeneous \u003cem\u003eesg\u003c/em\u003e expression (green) spanning both the central domain and the periphery (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eg), consistent with wild-type levels of \u003cem\u003eesg\u003c/em\u003e. In contrast, \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e, which carries only one functional \u003cem\u003eesg\u003c/em\u003e allele, showed a more intense but restricted expression pattern, limited to the dorsal portion of the central domain and the posterior peripheral region (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed). These differences are consistent with the reduced \u003cem\u003eesg\u003c/em\u003e expression in \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e and the higher expression detected in \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e, as shown by the qPCR results (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eh). Upon \u003cem\u003eesg\u003c/em\u003e knockdown (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-RNAi(v9793)\u003c/em\u003e or \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-RNAi(v9793)\u003c/em\u003e; Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb, e, h) the well-defined anatomical organization was markedly disrupted and disc area was significantly reduced (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003en). The characteristic concentric architecture was lost, and En staining was severely reduced or mislocalized (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb, e, h, \u003cstrong\u003ered\u003c/strong\u003e). Most strikingly, the posterior cephalopharyngeal junction is absent or diminished (absence of the white dotted line), leaving only the central domain. This disruption was particularly evident in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb, where merged confocal and brightfield images show the mandibular structures (red arrow) in direct contact with the central antennal disc.\u003c/p\u003e\n \u003cp\u003eCo-expression of the enhancer-promoter insertion \u003cem\u003eesg-EP\u003c/em\u003e alongside RNAi restored disc size (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003en), re-established the posterior peripheral region (white dotted line), and rescued Engrailed-defined compartment boundaries (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec, f \u003cstrong\u003eand i\u003c/strong\u003e).\u003c/p\u003e\n \u003cp\u003eBecause \u003cem\u003eesg\u003c/em\u003e is known to be expressed in all imaginal discs \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e, we next asked whether its depletion also disrupted anterior\u0026ndash;posterior patterning in other discs. We assessed Ci (white, anterior) and En (red, posterior) distribution in antennal (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ej, k) and wing discs (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003el, m). In antennal discs, \u003cem\u003eesg\u003c/em\u003e knockdown caused disorganized Ci/En domains (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ek), whereas wing discs from the same larvae maintained normal Ci/En compartmentalization (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003em), indicating that \u003cem\u003eesg\u003c/em\u003e is specifically required for the maintenance of antennal A/P organization.\u003c/p\u003e\n \u003cp\u003eTogether, these results show that \u003cem\u003eesg\u003c/em\u003e is essential not only for antennal disc growth, but also for maintaining its compartmental architecture.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eEsg function in the peripodial membrane is required for antennal\u0026mdash;but not proboscis\u0026mdash;morphogenesis\u003c/h3\u003e\n\u003cp\u003eSince the restricted \u003cem\u003eesg\u003c/em\u003e expression observed in the \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e background was localized mainly to the dorsal periphery of the antennal disc, where the peripodial epithelium resides, we asked whether \u003cem\u003eesg\u003c/em\u003e function in this tissue could account for the observed phenotypes. To test this possibility, we used a peripodial-specific driver to determine whether targeted knockdown of \u003cem\u003eesg\u003c/em\u003e in this layer could phenocopy the defects seen with the more broadly expressed \u003cem\u003eesg\u003c/em\u003e drivers.\u003c/p\u003e\n\u003cp\u003eTo test whether \u003cem\u003eesg\u003c/em\u003e activity specifically in the peripodial epithelium underlies the antennal-disc defects observed with knockdown driven by the broad \u003cem\u003eesg\u003c/em\u003e-Gal4 lines, we used the peripodial‐specific driver \u003cem\u003ec311-Gal4\u003c/em\u003e to express \u003cem\u003eesg-RNAi(v9793)\u003c/em\u003e and examined both third‐instar eye\u0026ndash;antennal discs and adult head morphology (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eControl antennal discs (\u003cem\u003ec311-Gal4\u0026thinsp;\u0026gt;\u0026thinsp;UAS-mCD8::Cherry\u003c/em\u003e, Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea upper panels) showed its characteristic concentric organization, with the peripodial membrane labeled in red and En (white) defining the posterior compartment. Compared to \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e drivers, \u003cem\u003ec311\u003c/em\u003e-driven expression was more extensive but overlapped with the dorsal peripodial domain and the posterior edge of the antennal disc near the cephalopharyngeal skeleton. Notably, \u003cem\u003ec311\u003c/em\u003e also labeled a population of large, basally located cells with irregular morphology, similar to those observed with \u003cem\u003eesg\u003c/em\u003e-specific drivers (as indicated in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, top panels, white arrowhead), suggesting that this driver captures key \u003cem\u003eesg\u003c/em\u003e-expressing territories involved in disc organization.\u003c/p\u003e\n\u003cp\u003eUpon \u003cem\u003eesg\u003c/em\u003e knockdown in the peripodial membrane (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, middle panels), the antennal disc became significantly smaller (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec) and severely disorganized, exhibiting loss of the typical concentric architecture and posterior patterning. These defects were qualitatively similar\u0026mdash;and in some cases even more pronounced\u0026mdash;than those observed when using \u003cem\u003eesg\u003c/em\u003e-specific drivers, suggesting that \u003cem\u003eesg\u003c/em\u003e activity in the peripodial epithelium is critical for organizing the underlying disc.\u003c/p\u003e\n\u003cp\u003eCo-expression of \u003cem\u003eesg-EP\u003c/em\u003e insertion alongside with \u003cem\u003eesg-RNAi\u003c/em\u003e restored both antennal disc morphology (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, bottom panels) and size (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec) to near control levels with a partial to almost complete rescue of antennal disc architecture, validating the specificity of the observed phenotypes.\u003c/p\u003e\n\u003cp\u003eConsistent with the larval phenotypes, adult flies expressing \u003cem\u003eesg-RNAi\u003c/em\u003e under \u003cem\u003ec311-Gal4\u003c/em\u003e exhibited defects in antennal formation, as flies frequently showed partial or complete loss of antennal structures (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb, middle row, arrowhead). Controls (\u003cem\u003ec311-Gal4\u0026thinsp;\u0026gt;\u0026thinsp;UAS-GFP\u003c/em\u003e) developed normal antennae (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb, top row). Co-expression of \u003cem\u003eesg-EP\u003c/em\u003e with \u003cem\u003eesg-RNAi\u003c/em\u003e rescued almost normal adult antennae (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb, bottom row).\u003c/p\u003e\n\u003cp\u003eqPCR of \u003cem\u003eesg\u003c/em\u003e expression levels in these lines showed that expressing an RNAi against \u003cem\u003eesg\u003c/em\u003e in the peripodial membrane is effectively downregulating \u003cem\u003eesg\u003c/em\u003e expression and that co-expression of the \u003cem\u003eesg RNAi\u003c/em\u003e with \u003cem\u003eesg\u003c/em\u003e-\u003cem\u003eEP\u003c/em\u003e estores \u003cem\u003eesg\u003c/em\u003e expression levels in the antennal disc (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed).\u003c/p\u003e\n\u003cp\u003eDespite the dramatic antennal defects, the proboscis of \u003cem\u003ec311\u0026thinsp;\u0026gt;\u0026thinsp;esg-RNAi\u003c/em\u003e adults developed normally, even though c311 drives expression in the peripodial membrane of the labial disc, in contrast to the fully penetrant proboscis defects observed with the broader \u003cem\u003eesg\u003c/em\u003e-Gal4 drivers. Together, these results show that \u003cem\u003eesg\u003c/em\u003e function in the peripodial membrane is both necessary and sufficient for antennal-disc growth and compartmental organization, yet dispensable for labial‐disc (labellum) morphogenesis\u0026mdash;illustrating that, although \u003cem\u003eesg\u003c/em\u003e is expressed in all imaginal discs, its developmental role is highly context-dependent across different imaginal discs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLoss of\u003c/strong\u003e \u003cstrong\u003eesg\u003c/strong\u003e \u003cstrong\u003efunction leads to labial disc reduction.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBecause knocking down \u003cem\u003eesg\u003c/em\u003e specifically in the peripodial membrane (\u003cem\u003ec311\u0026thinsp;\u0026gt;\u0026thinsp;esg-RNAi\u003c/em\u003e) leaves the adult proboscis intact, the extensive loss of the distal proboscis seen with the broader \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e drivers must reflect \u003cem\u003eesg\u003c/em\u003e function in a different cellular domain. Unlike \u003cem\u003ec311\u003c/em\u003e, both \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e are active within the disc-proper epithelium of the labial disc, suggesting that escargot\u0026rsquo;s expression there\u0026mdash;rather than in the overlying peripodial layer\u0026mdash;is essential for normal proboscis growth. To determine how \u003cem\u003eesg\u003c/em\u003e‐expressing cells within the disc proper regulate labial disc growth and patterning, we examined their distribution and requirement using two independent drivers \u003cem\u003e(esg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::GFP\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea-c) and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::Cherry\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed-f).\u003c/p\u003e\n\u003cp\u003eIn control lines (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::GFP\u003c/em\u003e and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;UAS-mCD8::Cherry\u003c/em\u003e), \u003cem\u003eesg\u003c/em\u003e expression is strongest in the proximal labial disc, at the junction with the mandibular structures (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea, d), and adults develop a normal proboscis. By contrast, knockdown of \u003cem\u003eesg\u003c/em\u003e with \u003cem\u003eesg-RNAi(v9793)\u003c/em\u003e caused a severe reduction or complete loss of the labial disc in most larvae (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb, e; quantified in \u003cstrong\u003eg\u003c/strong\u003e) and resulted in adults lacking the distal proboscis (labellum). This severe phenotype was consistently observed with both the \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e drivers, confirming that it arises from loss of \u003cem\u003eesg\u003c/em\u003e function in the disc proper.\u003c/p\u003e\n\u003cp\u003eCo-expression of the \u003cem\u003eesg-EP\u003c/em\u003e allele with \u003cem\u003eesg-RNAi(v9793)\u003c/em\u003e fully restored labial disc size, and yielded normal proboscis development (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec, f; quantified in \u003cstrong\u003eh\u003c/strong\u003e) confirming the specificity of the observed phenotypes.\u003c/p\u003e\n\u003cp\u003eThus, although \u003cem\u003eesg\u003c/em\u003e is broadly expressed across imaginal discs, its developmental role is highly domain- and tissue-specific, with peripodial expression critical in the antennal disc and disc-proper expression essential in the labial disc.\u003c/p\u003e\n\u003cp\u003eTogether, our antennal- and labial‐disc experiments reveal that \u003cem\u003eescargot\u003c/em\u003e has highly specific domain roles in head imaginal discs. In the antennal disc, \u003cem\u003eesg\u003c/em\u003e expression in the peripodial membrane is both necessary and sufficient to drive disc growth and maintain compartment boundaries. By contrast, labial‐disc (proboscis) growth depends on \u003cem\u003eescargot\u003c/em\u003e function within the disc‐proper epithelium: knockdown using \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e or \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e reduces disc size and adult labellum is not formed, whereas peripodial‐restricted knockdown (\u003cem\u003ec311\u0026thinsp;\u0026gt;\u0026thinsp;esg-RNAi\u003c/em\u003e) leaves the proboscis intact. Therefore, even though \u003cem\u003eesg\u003c/em\u003e is broadly expressed in all imaginal discs, its developmental function differs strikingly between disc types and epithelial layers, underscoring its context-dependent mechanism of action.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDpp signaling is required downstream of\u003c/strong\u003e \u003cstrong\u003eesg\u003c/strong\u003e \u003cstrong\u003efor labial disc growth and proboscis formation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGiven the complete loss of the distal proboscis in \u003cem\u003eesg-RNAi\u003c/em\u003e adults and the well described requirement for \u003cem\u003eDecapentaplegic (Dpp)\u003c/em\u003e in head-appendage development\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e, we asked whether \u003cem\u003eDpp\u003c/em\u003e acts downstream of \u003cem\u003eesg\u003c/em\u003e in the labial disc.\u003c/p\u003e\n\u003cp\u003eUsing the \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e driver to express \u003cem\u003edpp-RNAi\u003c/em\u003e, we found that \u003cem\u003edpp\u003c/em\u003e knockdown phenocopies the \u003cem\u003eesg-RNAi\u003c/em\u003e labial defects: third-instar labial discs are dramatically reduced in size and adult flies entirely lack the labellum (Fig. 5c1-5; quantified in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE). Conversely, co-expression of \u003cem\u003eUAS-dpp\u003c/em\u003e with \u003cem\u003eesg-RNAi\u003c/em\u003e (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;esg-RNAi;+dpp\u003c/em\u003e) fully restores labial‐disc area to control dimensions (Fig. 5d1-5, \u003cstrong\u003ee\u003c/strong\u003e), although these pharates fail to eclose\u0026mdash;likely reflecting deleterious effects of ectopic \u003cem\u003eDpp\u003c/em\u003e outside its normal domain. This observation underscores the importance of spatially restricted \u003cem\u003edpp\u003c/em\u003e activity for normal development.\u003c/p\u003e\n\u003cp\u003eqPCR on dissected labial discs confirms that \u003cem\u003eesg\u003c/em\u003e knockdown significantly reduces \u003cem\u003edpp\u003c/em\u003e mRNA levels (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ef), whereas \u003cem\u003edpp\u003c/em\u003e expression in the antennal disc remains unchanged under \u003cem\u003eesg-RNAi\u003c/em\u003e conditions (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eg). These findings are consistent with the idea that Dpp signalling is required downstream of \u003cem\u003eescargot\u003c/em\u003e for labial disc growth, although it remains to be determined whether this regulation is direct or indirect.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe show that decreasing \u003cem\u003eesg\u003c/em\u003e expression levels using two independent Gal4 drivers (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e) in combination with three different esg-RNAi lines produces a spectrum of head-appendage defects, from malformed or missing antennae and maxillary palps to complete loss of the distal proboscis that leaves only the labrum. Quantitative RT\u0026ndash;PCR on dissected eye\u0026ndash;antennal discs confirms that the three RNAi lines reduce \u003cem\u003eesg\u003c/em\u003e transcript to varying degrees; the degree of this reduction positively correlates with phenotype severity. TUNEL assays reveal only a modest increase in apoptosis in antennal discs upon \u003cem\u003eesg\u003c/em\u003e knockdown\u0026mdash;and none in labial discs\u0026mdash; thus indicating that altered programed cell dead alone cannot account for the observed severe morphological defects, and therefore implicating mis-patterning or cell fate changes as major phenotype contributors. This idea is supported by previous work that shows that in \u003cem\u003eesg snail (sna)\u003c/em\u003e double mutants, wing-disc primordia convert into larval epidermis rather than undergoing apoptosis \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Given the low levels of cell death we observed, one hypothesis is that head-disc cells lacking Esg may similarly adopt alternative fates (e.g. epidermal), contributing to the morphogenetic defects. Future experiments using lineage-tracing could be used to discern such trans- or de-differentiation events. An alternative hypothesis is that escargot also restrains endoreplication in imaginal cells by upregulating Cdc2, preventing their conversion into polyploid larval epidermal cells \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Loss of \u003cem\u003eesg\u003c/em\u003e in head discs may similarly trigger ectopic endocycles, altering cell size or identity in ways that disrupt normal patterning.\u003c/p\u003e\u003cp\u003eReducing \u003cem\u003eesg\u003c/em\u003e expression levels disrupts the concentric organization of third-instar antennal discs, mislocalizes En disturbing their anterior-posterior pattering, and results in a significant reduction in disc size. Restoring \u003cem\u003eesg\u003c/em\u003e expression levels using a \u003cem\u003eP{EP}esg\u003c/em\u003e enhancer-promoter insertion rescues disc size, re-establishes compartment boundaries, and restores En‐defined patterning. Thus, \u003cem\u003eesg\u003c/em\u003e is both necessary and sufficient to maintain antennal‐disc integrity.\u003c/p\u003e\u003cp\u003eBy comparing broad (\u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e) versus peripodial-specific (\u003cem\u003ec311-Gal4\u003c/em\u003e) \u003cem\u003eesg\u003c/em\u003e-knockdown, we found that Esg activity in the peripodial epithelium is both necessary and sufficient for antennal-disc growth and patterning\u0026mdash;but does not affect proboscis formation. In contrast, labial-disc outgrowth (proboscis morphogenesis) requires Esg function within the disc-proper epithelium as peripodial-restricted knockdown leaves the proboscis intact, whereas broad drivers abolish the distal labial domain and adult labellum. These findings reveal that \u003cem\u003eesg\u003c/em\u003e function is context-dependent therefore, a single transcription factor exerts layer-specific control over different imaginal discs.\u003c/p\u003e\u003cp\u003eInterestingly, a recent study showed that loss of \u003cem\u003eeyes absent\u003c/em\u003e (\u003cem\u003eeya\u003c/em\u003e) specifically in the cuboidal margin (\u0026ldquo;M-cells\u0026rdquo;) of the peripodial epithelium disrupts dpp signaling and blocks eye morphogenesis, yet leaves the antennal disc largely unaffected \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Their work highlights how a restricted subset of peripodial cells can exert compartmentalized control over dpp-mediated growth. By contrast, in our hands, \u003cem\u003eesg\u003c/em\u003e knockdown under the same \u003cem\u003ec311-Gal4\u003c/em\u003e driver yields a strong antennal-disc phenotype despite apparent dpp independence, suggesting that \u003cem\u003eesg\u003c/em\u003e acts within a distinct peripodial subdomain\u0026mdash;perhaps analogous to the M-cell subset\u0026mdash;to control antennal development via a dpp-independent pathway. These contrasting outcomes underscore functional specialization among peripodial subpopulations and support the idea that a small subset of peripodial cells can determine the morphogenetic outcome of the underlying disc\u003c/p\u003e\u003cp\u003eIn the wing imaginal disc, Esg and its family member Sna engage in a redundant auto- and cross-activation to establish a robust feed-forward circuit that locks in wing-cell fate (prospective wing cells induce both \u003cem\u003eesg\u003c/em\u003e and \u003cem\u003esnail\u003c/em\u003e, which then sustain each other\u0026rsquo;s expression and jointly activate downstream targets such as \u003cem\u003evestigial\u003c/em\u003e) \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. These studies even point out that while \u003cem\u003eesg\u0026ndash;sna\u003c/em\u003e interactions are critical in the wing, they do not occur in the leg disc, implying disc-specific regulatory circuitry. We propose that a similar Sna-mediated redundancy may buffer wing discs against loss of \u003cem\u003eesg\u003c/em\u003e\u0026mdash;explaining why wing patterning remains intact in our \u003cem\u003eesg\u003c/em\u003e-RNAi larvae\u0026mdash;whereas the absence of this backup in the antennal disc unmasks a strict requirement for Escargot.\u003c/p\u003e\u003cp\u003eGiven the complete proboscis loss upon \u003cem\u003eesg\u003c/em\u003e knockdown, and the known requirement for \u003cem\u003eDecapentaplegic\u003c/em\u003e (\u003cem\u003eDpp\u003c/em\u003e) in head-appendage development, we used \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;dpp-RNAi\u003c/em\u003e to show that \u003cem\u003edpp\u003c/em\u003e depletion phenocopies \u003cem\u003eesg-RNAi\u003c/em\u003e labial defects\u0026mdash;and the co-expression of \u003cem\u003eUAS-dpp\u003c/em\u003e with \u003cem\u003eesg-RNAi\u003c/em\u003e fully rescues labial-disc area and proboscis formation (though this genotype is pharate lethal, probably due to ectopic \u003cem\u003eDpp\u003c/em\u003e). qPCR on isolated labial discs confirms that \u003cem\u003eesg\u003c/em\u003e knockdown significantly lowers \u003cem\u003edpp\u003c/em\u003e mRNA, while antennal-disc \u003cem\u003edpp\u003c/em\u003e levels remain unaffected. Together, these data place \u003cem\u003eDpp\u003c/em\u003e directly or indirectly downstream of \u003cem\u003eesg\u003c/em\u003e in the labial disc, where \u003cem\u003edpp\u003c/em\u003e expression is both necessary and sufficient for proboscis outgrowth. While our work establishes Dpp as a key effector of Esg in this context, other signaling pathways such as Wg, Hedgehog, Notch, and EGF modulate Dpp\u0026rsquo;s context-dependent outputs\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Future genetic interaction studies could clarify how these networks integrate to refine head-appendage growth and patterning.\u003c/p\u003e\u003cp\u003eIn adults, the complete absence of the labellum is a striking phenotype. To our knowledge, a total loss of the labellum caused by genetic manipulation (without homeotic transformation) has not been reported previously. It is important to note that described classical head-appendage mutants never produce a simple deletion of the labellum. In \u003cem\u003eproboscipedia\u003c/em\u003e null alleles, the labial distal proboscis is homeotically transformed into prothoracic (T1) legs rather than eliminated \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Combined \u003cem\u003eproboscipedia\u0026thinsp;+\u0026thinsp;Sex combs reduced\u003c/em\u003e loss yields a full proboscis-to-antenna conversion, again replacing the labellum with antenna-type structures \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Also, previous studies described physical ablation of the labellum for behavioral assays, but not genetic ablation. By contrast, our \u003cem\u003eesg\u003c/em\u003e knockdown produces complete absence of the entire distal taste organ\u0026mdash;including the labellum\u0026mdash;with no homeotic replacement. To our knowledge, this is the first reported case of genetic labellum ablation in \u003cem\u003eDrosophila\u003c/em\u003e, highlighting Escargot\u0026rsquo;s indispensable function in labial-disc for sustaining distal growth and, consequently, for labellum formation.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003e\u003cem\u003eEsg\u003c/em\u003e has long been implicated in imaginal-disc progenitor maintenance and epithelial integrity, notably in wing, leg, and eye discs (Fuse et al. 1994; Hayashi et al. 1993; Voas \u0026amp; Rebay 2004). Our data extend these roles to the labial and antennal compartments, uncovering a novel layer-specific requirement: peripodial function for antennal architecture versus disc-proper activity for labial outgrowth via direct regulation of a key morphogen.\u003c/p\u003e\u003cp\u003eAlthough a working Esg antibody for immunofluorescence remains elusive, the use of two independent \u003cem\u003eesg\u003c/em\u003e-Gal4 drivers with overlapping yet distinct domains and a peripodial Gal4 driver provides a robust proxy for the study of endogenous \u003cem\u003eesg\u003c/em\u003e expression. Future studies should dissect the molecular link between \u003cem\u003eescargot\u003c/em\u003e and \u003cem\u003edpp\u003c/em\u003e transcription\u0026mdash;identifying direct versus indirect regulation\u0026mdash;as well as explore how peripodial-driven \u003cem\u003eesg\u003c/em\u003e activity influences underlying disc growth. Finally, it will be important to assess downstream effectors (e.g., DE-cadherin) and cell-shape changes to fully elucidate escargot\u0026rsquo;s context-dependent mechanisms.\u003c/p\u003e\u003cp\u003eOur work demonstrates that Esg functions as a pleiotropic regulator of head-appendage development, with dosage-sensitive, layer-specific roles that differentially control antennal architecture and proboscis morphogenesis through Dpp-dependent and -independent pathways. These findings enrich our understanding of how a single transcription factor can orchestrate diverse developmental programs across distinct epithelial contexts.\u003c/p\u003e"},{"header":"Materials and method","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eStocks and crosses\u003c/h2\u003e\u003cp\u003eFlies were raised on standard yeast medium at 25\u0026deg;C. \u003cem\u003eOregon-R\u003c/em\u003e and \u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e [Bloomington \u003cem\u003eDrosophila\u003c/em\u003e Stock Center (BDSC)]. \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003ew\u003c/em\u003e\u003csup\u003e\u003cem\u003e1118\u003c/em\u003e\u003c/sup\u003e; \u003cem\u003eP{GawB-GAL4\u003c/em\u003e. \u003cem\u003eesg}\u003c/em\u003e\u003csup\u003e\u003cem\u003eL4\u003c/em\u003e\u003c/sup\u003e) was obtained in our laboratory by mobilization of P-element P{GawB}\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. All other lines used in this work are available at the Bloomington Drosophila Stock Center (NIH P40OD018537): \u003cem\u003eesg\u003c/em\u003e\u003csup\u003e\u003cem\u003eNP5130\u003c/em\u003e\u003c/sup\u003e \u003cem\u003e=P{GawB}NP5130\u003c/em\u003e (BDSC 93857), RNAi knockdown: \u003cem\u003eUAS-esg-RNAi\u003c/em\u003e (BDSC 34063), \u003cem\u003eUAS-esg-RNAi\u003c/em\u003e [Vienna \u003cem\u003eDrosophila\u003c/em\u003e Resource Center (VDRC), v9794 and v9793], \u003cem\u003eUAS-dpp-RNAi\u003c/em\u003e (BDSC 25782), \u003cem\u003eC311-GAL4\u003c/em\u003e (BDSC 5937), \u003cem\u003eP{EP}esg\u003c/em\u003e (BDSC 30934), \u003cem\u003eUAS-mCD8::Cherry UAS-GFP\u003c/em\u003e (BDSC 27391; BDSC27392).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eQuantitative PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from third-instar larval imaginal discs (eye/antennal and labial discs; in the latter case, the anterior larval region was dissected excluding the mandibles) with TRIzol\u0026trade; Reagent (Invitrogen, #15596018). At least 30 pairs of discs were collected per sample. RNA was treated with DNase I, RNase-free (Thermo Fisher Scientific, #EN0521), and reverse transcribed using NZY Reverse Transcriptase (NZYTech, #MB12401) with random primers (Invitrogen, #48190011), starting from 0.5\u0026ndash;1 \u0026micro;g of total RNA. qPCR reactions for \u003cem\u003eesg\u003c/em\u003e were performed using TaqMan\u0026trade; Gene Expression Master Mix (Applied Biosystems, #4369016), while \u003cem\u003edpp\u003c/em\u003e reactions were carried out with qPCR GreenMaster highROX (Jena Bioscience, #PCR-374), according to the manufacturer\u0026rsquo;s instructions using 20 ng of cDNA for each reaction. For \u003cem\u003eesg\u003c/em\u003e, a TaqMan\u0026reg; probe was used at a final concentration of 25 nM (5\u0026rsquo;-/56-FAM/TTCTTGATGTCCGAGTGGGTCTGC/36-TAMSp/-31), together with the primers 5\u0026rsquo;-TGCAGATCGCTCGAATCTGC-3\u0026rsquo; and 5\u0026rsquo;-AGCAACTGGTGCAGGAGTAC-3\u0026rsquo;. For \u003cem\u003edpp\u003c/em\u003e, the primers dpp-Fwd 5\u0026prime;-GCCAACACAGTGCGAAGTT-3\u0026rsquo; and dpp-Rev 5\u0026prime;-CGCGTGATGTCGTAGACAAG-3\u0026rsquo; were used, which had been previously reported by Denton \u003cem\u003eet al.\u003c/em\u003e (Cell Death Differ \u003cb\u003e26\u003c/b\u003e, 763\u0026ndash;778, 2019). Thermal cycling conditions were as follows: 95\u0026deg;C for 10 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 58\u0026deg;C for 1 min. For labial disc samples, the cycle number was extended to 50 to ensure amplification curve saturation.\u003c/p\u003e\n\u003ch3\u003eTUNEL cell death detection\u003c/h3\u003e\n\u003cp\u003eCell death was labeled using the In Situ Cell Death Detection Kit, TMR red (Roche). Imaginal discs were dissected in PBS, fixed in PBS 4% paraformaldehyde for 1hr at 4\u0026deg;C, washed three time in PBST (PBS supplemented with 0.1% Triton X-100). Discs were blocked in PBST with 5% pre-immune goat serum for 12 hours at 4\u0026deg;C and transferred to permeabilization solution (0.1% Sodium citrate, 0.1% Triton X-100) at room temperature then followed the manufacturer\u0026rsquo;s instructions. Labeled were imagined using confocal microscopy. Signal was quantified using imageJ\u0026rsquo;s analyze particle tool.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry\u003c/h2\u003e\u003cp\u003eTissue was dissected in PBS, fixed in PBS 4% formaldehyde, permeabilized with 0.2% TritonX-100 and blocked for 30 min with 5% goat pre-immune serum at room temperature. The primary antibodies were added in permeabilization buffer (see antibodies and concentrations below), incubated overnight at 4\u0026deg;C and washed 3 times in PBS 0.2% TritonX-100 at room temperature. The secondary antibodies were added, incubated for 90 min, and washed 3 times in PBS 0.2% TritonX-100 at room temperature. Primary antibodies used: Rabbit anti-GFP (Abcam ab290 1:1000), Mouse anti-Arm (N2 7A1, DSHB 1:50), Mouse Anti-En (4D9, DSHB 1:50), Rat anti-Ci (2A1, DSHB 1:50). Secondary antibodies Cy2 anti-rabbit, Cy2 anti-mouse, Cy2 anti-Rat, Cy3 anti-mouse, Cy3 anti-rat and Cy5 anti-mouse (Jackson immunoResearch) at 1:300 dilutions. Samples were mounted in Citifluor (Ted Pella Inc).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eConfocal Imaging\u003c/h2\u003e\u003cp\u003eImages were collected at the \u0026ldquo;Laboratorio Nacional de Microscop\u0026iacute;a Avanzada (LNMA)\u0026rdquo; in an inverted Confocal multiphotonic Olympus FV1000 using an optimal confocal pinhole and Z steps. Images were analyzed and reconstructed using the open source ImageJ program \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAll quantitative data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analyses were performed using one-way analysis of variance (ANOVA) to evaluate differences among experimental groups. When significant main effects were detected, Tukey\u0026rsquo;s multiple comparison post hoc test was applied to identify pairwise differences. The level of statistical significance was set at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Significance levels are indicated in the figures as follows: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*\u003cem\u003e), p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 (**), p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 (***) and p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 (****\u003c/em\u003e); \u0026ldquo;ns\u0026rdquo; denotes non-significant differences. All analyses were carried out using GraphPad Prism (version X; GraphPad Software, San Diego, CA, USA) unless otherwise stated.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor statements:\u003c/h2\u003e\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003cp\u003eThe authors declare that this work has not been submitted to other journals.\u003c/p\u003e\u003cp\u003eThe authors declare that no human subjects or vertebrates were used in this work and comply with the bioethical guidelines of their institutions.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e\u003cp\u003eThis project was financed by the following research grants: \u003cb\u003eCONAHCyT\u003c/b\u003e: CF-2023-I-703 (VNP); \u003cb\u003ePAPIIT- UNAM\u003c/b\u003e: IN210124 (ER).\u003c/p\u003e\u003cp\u003eRMM was financed by a postdoctoral scholarship granted by Consejo T\u0026eacute;cnico de la Investigaci\u0026oacute;n Cient\u0026iacute;fica DGAPA-UNAM CJIC/CTIC1370/2024\u003c/p\u003e\u003cp\u003eFRB (CVU481914) was financed by a postdoctoral scholarship granted by SECIHTY.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eVNP and ER conceived and supervised the study. VNP, ER, FRB, ISD, RMM designed the experiments. FRB, ISD and RMM performed the genetic crosses, immunostainings, confocal imaging, qPCR and TUNEL assays. Data analysis was carried out by VNP, ER, FRB, ISD and RMM. VNP and ER wrote the manuscript with input from all authors. All authors reviewed and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors want to thankM.Sc. Andr\u0026eacute;s Saralegui and Dr. Arturo Pimentel from the Laboratorio Nacional de Microscop\u0026iacute;a Avanzada (LNMA) for technical support. Dr. Paul Gaytan from the Unidad de S\u0026iacute;ntesis de Oligonucle\u0026oacute;tidos (IBT-UNAM) for technical support. Also to Agust\u0026iacute;n Reyes-P\u0026eacute;rez (CIDC-UAEM) and Ren\u0026eacute; Hernandez- Vargas (IBT-UNAM) for technical support.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data and materials are available upon request. For any data or material request from this study contact Dr. Ver\u0026oacute;nica Narv\u0026aacute;ez-Padilla at
[email protected]\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHaynie, J. L. \u0026amp; Bryant, P. J. Development of the eye-antenna imaginal disc and morphogenesis of the adult head inDrosophila melanogaster. \u003cem\u003eJ. Exp. Zool.\u003c/em\u003e \u003cb\u003e237\u003c/b\u003e, 293\u0026ndash;308 (1986).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAplin, A. C. \u0026amp; Kaufman, T. C. Homeotic transformation of legs to mouthparts by proboscipedia expression in Drosophila imaginal discs. \u003cem\u003eMech. Dev.\u003c/em\u003e \u003cb\u003e62\u003c/b\u003e, 51\u0026ndash;60 (1997).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbzhanov, A., Holtzman, S. \u0026amp; Kaufman, T. C. The Drosophila proboscis is specified by two Hox genes, proboscipedia and Sex combs reduced, via repression of leg and antennal appendage genes. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e128\u003c/b\u003e, 2803\u0026ndash;2814 (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMerrill, V. K. L., Diederich, R. J., Turner, F. R. \u0026amp; Kaufman, T. C. A genetic and developmental analysis of mutations in labial, a gene necessary for proper head formation in Drosophila melanogaster. \u003cem\u003eDev. Biol.\u003c/em\u003e \u003cb\u003e135\u003c/b\u003e, 376\u0026ndash;391 (1989).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFuse, N., Hirose, S. \u0026amp; Hayashi, S. Determination of wing cell fate by the escargot and snail genes in Drosophila. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e122\u003c/b\u003e, 1059\u0026ndash;1067 (1996).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHayashi, S., Hirose, S., Metcalfe, T. \u0026amp; Shirras, A. Control of imaginal cell development by the escargot gene of Drosophila. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e118\u003c/b\u003e, 105\u0026ndash;115 (1993).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAffolter, M. \u0026amp; Basler, K. The Decapentaplegic morphogen gradient: from pattern formation to growth regulation. \u003cem\u003eNat. Rev. Genet.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 663\u0026ndash;674 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorimura, S., Maves, L., Chen, Y. \u0026amp; Hoffmann, F. M. decapentaplegic overexpression affects Drosophila wing and leg imaginal disc development and wingless expression. \u003cem\u003eDev. Biol.\u003c/em\u003e \u003cb\u003e177\u003c/b\u003e, 136\u0026ndash;151 (1996).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHayashi, S. et al. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. \u003cem\u003eGenesis\u003c/em\u003e \u003cb\u003e34\u003c/b\u003e, 58\u0026ndash;61 (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoto, S. \u0026amp; Hayashi, S. Proximal to distal cell communication in the Drosophila leg provides a basis for an intercalary mechanism of limb patterning. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e126\u003c/b\u003e, 3407\u0026ndash;3413 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanchez-D\u0026iacute;az, I. et al. The Esg Gene Is Involved in Nicotine Sensitivity in Drosophila melanogaster. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, e0133956 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGibson, M. C. \u0026amp; Schubiger, G. Peripodial Cells Regulate Proliferation and Patterning of Drosophila Imaginal Discs. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e103\u003c/b\u003e, 343\u0026ndash;350 (2000).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFuse, N., Hirose, S. \u0026amp; Hayashi, S. Diploidy of Drosophila imaginal cells is maintained by a transcriptional repressor encoded by escargot. \u003cem\u003eGenes Dev.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 2270\u0026ndash;2281 (1994).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRo\u0026oslash;rth, P. et al. Systematic gain-of-function genetics in Drosophila. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e125\u003c/b\u003e, 1049\u0026ndash;1057 (1998).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYasunaga, K., Saigo, K. \u0026amp; Kojima, T. Fate map of the distal portion of Drosophila proboscis as inferred from the expression and mutations of basic patterning genes. \u003cem\u003eMech. Dev.\u003c/em\u003e \u003cb\u003e123\u003c/b\u003e, 893\u0026ndash;906 (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeasner, B. M. \u0026amp; Kumar, J. P. The timing of cell fate decisions is crucial for initiating pattern formation in the Drosophila eye. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e149\u003c/b\u003e, dev199634 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUpadhyay, A., Moss-Taylor, L., Kim, M. J., Ghosh, A. C. \u0026amp; O\u0026rsquo;Connor, M. B. TGF-β Family Signaling in Drosophila. \u003cem\u003eCold Spring Harb Perspect. Biol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, a022152 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchneider, C. A., Rasband, W. S. \u0026amp; Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. \u003cem\u003eNat. Methods\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e, 671\u0026ndash;675 (2012).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Escargot transcription factor, Peripodial membrane, Decapentaplegic (Dpp) signaling, Head appendage morphogenesis, antennal imaginal disc, labial imaginal disc","lastPublishedDoi":"10.21203/rs.3.rs-7992861/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7992861/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe development of \u003cem\u003eDrosophila\u003c/em\u003e head appendages requires precise coordination between distinct imaginal-disc primordia. While the transcription factor Escargot (Esg) is known to maintain epithelial integrity and progenitor identity in several imaginal tissues, its role in anterior head morphogenesis has remained unclear. Here we show that \u003cem\u003eesg\u003c/em\u003e regulates the growth and patterning of the antennal and labial discs through layer- and tissue-specific mechanisms. Using RNAi knockdown driven by two independent \u003cem\u003eesg\u003c/em\u003e-Gal4 lines and a peripodial-specific driver (c311-Gal4), we demonstrate that \u003cem\u003eesg\u003c/em\u003e depletion causes severe malformations of head appendages, including antennal loss and absence of the distal proboscis. In the antennal disc, \u003cem\u003eesg\u003c/em\u003e activity in the peripodial membrane is necessary and sufficient to maintain compartmental organization, whereas in the labial disc, \u003cem\u003eesg\u003c/em\u003e function within the disc-proper epithelium drives disc growth and normal adult proboscis formation. Moreover, \u003cem\u003edpp\u003c/em\u003e knockdown phenocopies the esg-RNAi phenotype, and \u003cem\u003eesg\u003c/em\u003e loss reduces dpp mRNA levels in labial discs, while ectopic Dpp expression restores labial-disc size. Thus, \u003cem\u003eesg\u003c/em\u003e acts upstream of Dpp signaling during proboscis development. These findings reveal a context-dependent mechanism by which a single transcription factor coordinates morphogenesis across epithelial layers, integrating \u003cem\u003eesg\u003c/em\u003e-dependent transcriptional regulation with morphogen signaling.\u003c/p\u003e","manuscriptTitle":"Differential epithelial requirements for Escargot define Dpp-dependent and Dpp-independent pathways in Drosophila head appendage formation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-28 16:53:50","doi":"10.21203/rs.3.rs-7992861/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-27T15:52:53+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-20T06:07:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"271108243390135287917768947066665302130","date":"2026-02-11T01:30:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-01T03:47:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"189897374477080224272800846367893704204","date":"2025-11-25T18:54:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-25T06:49:32+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-25T06:45:23+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-21T12:07:25+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-18T23:32:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-11-18T23:29:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d7cda064-fdf5-4f71-8b20-8fb3148626b0","owner":[],"postedDate":"November 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":58604460,"name":"Biological sciences/Cell biology"},{"id":58604461,"name":"Biological sciences/Developmental biology"}],"tags":[],"updatedAt":"2026-04-27T16:12:48+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-28 16:53:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7992861","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7992861","identity":"rs-7992861","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.