Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism

Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism Hideyuki Iwamoto, Junpei Sanada, Tomohiko Kimura, Masashi Shimoda, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5196163/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Mar, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Aims: Endothelial damage mediated by mineralocorticoid receptor (MR) is an important factor in the development of atherosclerosis. Esaxerenone is a highly selective drug that can specifically block MR activity. The aim of this study is to examine whether specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the progression of atherosclerosis. Methods: ApoE KO mice were used as a model of atherosclerosis. In addition to a non-diabetic model, we created a diabetic model using streptozotocin. These were divided into a control group and an esaxerenone group. Esaxerenone-containing diet was provided for 8 weeks starting at 10 weeks of age. Various metabolic markers and abdominal aortic mRNA expression were evaluated, and histological examination of the aortic arch and thoracic aorta was performed. Results: In diabetic mice, plaque area in the aortic arch was significantly smaller in esaxerenone group compared to control group, although there were no differences in blood pressure, serum lipid levels between the two group. Inflammation-related genes, macrophage marker, cell adhesion factors and oxidative stress marker were all significantly lower in esaxerenone group. Conclusions: Specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the progression of atherosclerosis without influencing blood pressure and glucolipid metabolism. Health sciences/Cardiology Health sciences/Endocrinology esaxerenone oxidative stress atherosclerosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Atherosclerotic cardiovascular disease is a chronic inflammatory disease of intima of the aorta and medium-sized arteries, and it accounts for one third of all deaths worldwide [ 1 ]. An important risk factor for atherosclerosis is the dysfunction of vascular endothelial cells due to chronic inflammation, which is often observed in subjects with metabolic syndrome or diabetes mellitus [ 2 – 9 ]. Chronic inflammation is mainly caused by the infiltration and accumulation of inflammatory cells such as macrophages and lymphocytes, and these cells release inflammatory cytokines [ 10 – 14 ]. On the other hand, it has been reported that the renin-angiotensin system (RAS) is activated in blood vessels with atherosclerosis, and mineralocorticoid receptor (MR)-mediated vascular endothelial dysfunction also contributes to the development of atherosclerosis [ 15 ]. In subjects with obesity, hyperglycemia and excessive salt intake, aldosterone activates MR signaling, which finally provokes oxidative stress through the activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. MR is also expressed in vascular endothelial cells, vascular smooth muscle cells and macrophages [ 16 ], and it has been thought that its activation leads to the progression of atherosclerosis independently of hypertension. It has been also reported that primary aldosteronism increases the incidence of cardiovascular disease independently of blood pressure compared to essential hypertension [ 17 ]. Therefore, we hypothesized that the progression of atherosclerosis could be inhibited by suppressing MR activity using an MR blocker. In this study, we blocked mineralocorticoid signaling with esaxerenone, an MR blocker that is widely used in clinical practice. There are several reports on basic research using esaxerenone. For example, it has been reported that esaxerenone shows renoprotective effect independently of blood pressure in type 2 diabetes model mice and cardioprotective effect using hypertension model rats [ 18 , 19 ]. However, there has been no report at all showing the possible effects of MR blocking on the progression of atherosclerosis. The purpose of this study was to examine whether blocking of mineralocorticoid signaling with esaxerenone exerts anti-atherosclerotic effects and to elucidate the molecular mechanisms of the possible anti-atherosclerotic effects of blocking mineralocorticoid signaling under diabetic and non-diabetic conditions. Methods Animals and diets ApoE knockout mice (C57BL/6J-ApoEtm1Unc) were purchased from Charles River Laboratories and reared under controlled environmental conditions on a 12-hour light/dark cycle (2 mice per cage in all experiments). Mice were fed water and standard diet (MF; Oriental Yeast Co.) were fed ad libitum until 8 weeks of age, and the room temperature was maintained at 25°C. We set diabetes model and non-diabetes model. For making diabetes model, at 8 weeks of age, we used streptozotocin (STZ) to induce hyperglycemia based on our previous report [ 16 ]. Mice were injected intraperitoneally with STZ (50 mg/kg/day) (Fujifilm Wako Pure Chemicals) for 5 consecutive days. Mice that showed obvious hyperglycemia of 300 mg/dL or more under feeding conditions were designated as a diabetic model. At the age of 10 weeks, the diabetic and non-diabetic models were respectively divided into a standard diet group and an esaxerenone-containing diet group (Provided by Daiichi Sankyo Co., LTD.) (3 mg/kg/day) for intervention. Mice in the four groups were observed from 10 to 18 weeks of age, and body weight, blood glucose, and food intake were measured throughout the experimental period. The mice used in the study were subjected to dissection under isoflurane anesthesia and subsequently euthanized. This study was approved by the Animal Use Committee of Kawasaki Medical School (No. 23–037) and was conducted in accordance with the Kawasaki Medical School Animal Use Guidelines. In addition, this study was conducted in accordance with the Animal Research: Reporting of In Vivo Experiment (ARRIVE) guidelines. Measurement of biochemical markers Blood samples were collected from tail vein. Blood glucose levels were measured using a glucometer (Glutest Mint; Sanwa Kagaku Kenkyusho Co, Ltd, Japan). Plasma total cholesterol and triglyceride levels were measured enzymatically using the Wako LabAssay, L type Wako (Wako Pure Chemical Industries, Japan). Urine was collected using metabolic cage at 18 weeks of age, and urinary 8-OHdG levels were measured using ELISA kit (Japan Institute for the Control of Aging, NIKKEN SEIL Co, Ltd, Japan). RNA isolation and real time PCR Total RNA extraction was performed using a RNeasy lipid tissue mini kit (QIAGEN, Valencia, CA) according to the manufacturers’ instructions. cDNA was produced from mRNA using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was conducted using a Step One Plus Real-Time PCR system (Applied Biosystems). To quantify gene expression, the 2 −ΔCT was calculated using β-actin as an internal control. Primer sequences used for real time PCR are presented in Table 1 . Table 1 Primer sequences of forward and reverse primers for real-time PCR Genes Forward Reverse β-actin CGTGAAAAGATGACCCAGATCA CACAGCCTGGATGGCTACGTA MCP-1 CTTCCTCCACCACCATGCA CCAGCCGGCAACTGTGA IL-1β TGGTGTGTGACGTTCCCATTA CGACAGCACGAGGCTTTTTT IL-6 ACAACCACGGCCTTCCCTA CATGTGTAATTAAGCCTCCGACTTG TIMP-1 GCATGGACATTTATTCTCCACTGT TCTCTAGGAGCCCCGATCTG PAI-1 TGCATCGCCTGCCATTG CTTGAGATAGGACAGTGCTTTTTCC VCAM-1 GATCTCCCCTGAATACAAAACGAT GCCCGTAGTGCTGCAAGTG ICAM-1 TCGGAAGGGAGCCAAGTAACT CGACGCCGCTCAGAAGAA MMP-2 CCCTCAAGAAGATGCAGAAGTTC TCTTGGCTTCCGCATGGT F4/80 TGCATCTAGCAATGGACAGC GCCTTCTGGATCCATTTGAA CD68 TTTCTCCAGCTGTTCACCTTGA CCCGAAGTGTCCCTTGTCA Histological and immunohistological analyses Under anesthesia, PBS was perfused from left ventricle and then mouses were killed and heart and aorta were dissected. Sudan IV (Wako: 192–04392) staining was conducted for aortic arch. Adventitial fat tissue was removed and aorta was dissected longitudinally. The image analysis software NIH Image (version 1.61; http://rsbweb.nih.gov/ij/ ) was used to calculate the ratio of the plaque lesion to the total aortic arch area. Statistical analysis All data were analyzed and expressed as the mean ± standard error of the mean. Differences between two groups were tested for statistical significance using Student’s t-test. p values less than 0.05 were considered to indicate a statistically significant difference. Results There was no significant difference in factors related to atherosclerosis between control and esaxerenone group It is well known that blood glucose, lipid and blood pressure control greatly affect the progression of atherosclerosis. Therefore, we measured blood glucose levels, lipid levels, body weights and blood pressure. In non-diabetic mice, there was no significant difference in non-fasting blood glucose levels between control and esaxerenone group (Fig. 1 A). Body weights and food intake were also not different between control and esaxerenone group (Fig. 1 C, E). In diabetic mice, there was also no significant difference in non-fasting blood glucose levels, body weights and food intake between the two groups (Fig. 1 B, D, F). In fasting conditions, there was also no difference in blood glucose levels, body weights, and lipid levels such as triglyceride and total cholesterol between control and esaxerenone group in non-diabetic and diabetic mice (Table 2 , 3 ). Esaxerenone is used as an anti-hypertensive drug in clinical practice. However, esaxerenone did not lower blood pressure and heart rate in both non-diabetic and diabetic mice in this strain (Table 2 , 3 ). Furthermore, esaxerenone did not affect body composition such as organ weights in both non-diabetic and diabetic models (Supplementary Table 1, 2). Therefore, in this study, treatment with esaxerenone did not change any factors that can influence the progression of atherosclerosis. Table 2 Biochemical data, body weights, and blood pressure in non-diabetic mice Before treatment (10 weeks) After treatment (18 weeks) control Esaxerenone control Esaxerenone p value Fasting blood glucose (mg/dl) 62.7 ± 2.7 65.2 ± 3.0 103.5 ± 13.1 87.3 ± 6.8 n.s. Total cholesterol (mg/dl) N/A N/A 142.2 ± 12.5 152.0 ± 14.4 n.s. Triglyceride (mg/dl) N/A N/A 94.2 ± 9.6 93.1 ± 12.7 n.s. Fasting body weights (g) 22.9 ± 0.7 22.8 ± 1.1 26.3 ± 0.6 26.5 ± 1.3 n.s. Systolic BP (mmHg) 103.8 ± 2.6 98.1 ± 3.8 96.1 ± 2.5 98.8 ± 4.5 n.s. Diastolic BP (mmHg) 55.5 ± 2.6 51.1 ± 2.5 50.0 ± 4.3 41.1 ± 5.3 n.s. Heart rate (beats/min) 703.8 ± 10.3 662.9 ± 18.3 711.1 ± 12.7 694.0 ± 13.7 n.s. p value between with and without esaxerenone treatment at 18 weeks. n.s.: not significant; N/A, not applicable. Table 3 Biochemical data, body weights, and blood pressure in diabetic mice Before treatment (10 weeks) After treatment (18 weeks) control Esaxerenone control Esaxerenone p value Fasting blood glucose (mg/dl) 120.6 ± 13.5 160.3 ± 12.7 154.1 ± 20.5 138.1 ± 14.8 n.s. Total cholesterol (mg/dl) N/A N/A 176.8 ± 19.0 174.3 ± 41.0 n.s. Triglyceride (mg/dl) N/A N/A 123.5 ± 12.7 153.6 ± 11.4 n.s. Fasting body weights (g) 21.1 ± 0.55 19.6 ± 1.38 23.6 ± 0.82 26.1 ± 0.72 n.s. Systolic BP (mmHg) 97.1 ± 2.5 104.0 ± 3.0 105.4 ± 3.2 104.1 ± 8.3 n.s. Diastolic BP (mmHg) 47.6 ± 4.2 50.6 ± 3.5 49.5 ± 5.8 50.4 ± 4.8 n.s. Heart rate (beats/min) 660.9 ± 17.2 648.2 ± 14.5 711.1 ± 12.7 694 ± 13.7 n.s. p value between with and without esaxerenone treatment at 18 weeks. n.s.: not significant; N/A, not applicable. Plaque formation in the aortic arch was significantly reduced in esaxerenone group compared to control group in diabetic mice. Next, to investigate the effect of esaxerenone on the progression of atherosclerosis, plaque formation in the aortic arch was evaluated. The area of plaque stained with Sudan IV was measured and compared between with and without esaxerenone treatment. In the non-diabetic mice, there was no significant difference between control and esaxerenone group (Fig. 2 A, B, E). However, esaxerenone treatment significantly reduced plaque area compared to control group in diabetic mice (Fig. 2 C, D, E). Esaxerenone treatment reduced oxidative stress and inflammatory cytokines in diabetic mice Next, we examined the possible effects of esaxerenone on the progression of atherosclerosis. It is known that activation of the RAS stimulates NADPH oxidase and increase reactive oxygen species (ROS) [ 17 ]. Therefore, we evaluated urinary 8-OHdG levels as oxidative stress marker. Urinary 8-OHdG levels were significantly lower in esaxerenone group compared to control group in diabetic mice (Fig. 3 A). Expression levels of inflammatory cytokines such as Il-6 , Il-1β and Mcp-1 were higher in diabetic mice compared to non-diabetic mice. In non-diabetic mice, expression levels of Il-6 , Il-1β and Mcp-1 tended to be lower in esaxerenone group, although it did not reach a statistical significance. In diabetic mice, however, expression levels of Il-1β and Mcp-1 were significantly lower in esaxerenone group compared to control (Fig. 3 B, C, D). Taken together, specific locking of mineralocorticoid signaling with esaxerenone reduced ROS production and decreased expression levels of inflammatory cytokines in abdominal aorta under diabetic conditions. Esaxerenone reduced expression levels of factors associated with cell adhesion, macrophage infiltration, and plaque stability in the aorta of diabetic mice. Finally, to examine other factors associated with atherosclerosis, we evaluated expression levels of cell adhesion, macrophage and plaque stability markers in the abdominal aorta. In non-diabetic mice, there were no differences in expression levels of cell adhesion, macrophage and plaque stability markers. Expression levels related with thrombus formation or cell adhesion such as Pai-1 , Vcam-1 , Icam-1 were significantly lower in esaxerenone group in diabetic mice (Fig. 4 A, B, C). There was no difference in macrophage marker such as F4/80 , but expression levels of Cd68 were significantly lower in esaxerenone group compared to control in diabetic mice (Fig. 4 D, E). Regarding plaque stability, there was no difference in expression levels of Timp-1 (Fig. 4 F). Mmp-2 expression level was significantly lower in esaxerenone group in diabetic mice (Fig. 4 G). Discussion In this study, we demonstrated that specific blocking of mineralocorticoid signaling with esaxerenone exerted favorable anti-atherosclerotic effects in the aorta of STZ-induced hyperglycemic ApoE KO mice. Furthermore, interestingly, such anti-atherosclerotic effects were obtained without influencing blood pressure and glucolipid metabolism. Other MR blockers, such as spironolactone [ 18 ] and eplerenone [ 19 , 20 ] showed anti-atherosclerotic effects, but both drugs decreased blood pressure and improved lipid profile both of which are well known to reduce the progression of atherosclerosis. Therefore, while mineralocorticoid signaling has been drawing much attention recently, this is the first report which clearly demonstrates that blocking of mineralocorticoid signaling exerts favorable anti-atherosclerotic effects, independently of blood pressure and glucolipid metabolism. In clinical studies, finerenone has been shown to reduce cardiovascular events in patients with chronic kidney disease and type 2 diabetes mellitus [ 21 ], but basic studies have only examined cardioprotection and renoprotection [ 18 , 19 ]. There is no report examining its possible effects on atherosclerosis. It is thought that esaxerenone suppresses the progression of atherosclerosis by suppressing mineralocorticoid signaling and reducing oxidative stress and inflammation. In this study, urinary 8-OHdG, an oxidative stress marker, was lower in esaxerenone group compared to control group. Expression levels of inflammatory markers such as Il-1β and Mcp-1 were significantly lower in esaxerenone group in diabetic mice. Furthermore, expression levels of Pai-1 , Cd68 , Vcam-1 and Icam-1 may have decreased due to the improvement of inflammation. It has been reported that MR-mediated NADPH oxidase and Rac1 activation induces the production of ROS and are involved in vascular injury [ 24 , 25 ]. We think that esaxerenone blocked MR and decreased ROS production. It is also known that MR activation promotes leukocyte adhesion through increased Icam-1 expression [ 26 ] and production of inflammatory cytokines and chemokines such as Il-1β , Mcp-1 , and Pai-1 [ 27 ]. In this study, inflammatory cytokines and cell adhesion factors were increased under diabetic conditions, and these were significantly improved by esaxerenone treatment. On the other hand, there were no significant differences in blood pressure, lipid profile, and blood glucose levels between esaxerenone and control group. Esaxerenone is a drug used clinically for hypertension, but the selected dosage did not affect blood pressure as previously reported [ 28 – 30 ]. There was no difference in blood pressure in these reports, but esaxerenone showed beneficial effects on vascular dysfunction. We thought the possibility that esaxerenone directly exerts favorable anti-atherosclerotic effects by reducing oxidative stress and inflammation. There is limitation in this study. First, there was significant improvement in plaque area and mRNA levels in diabetic mice, however no significant improvement was observed in non-diabetic mice. In non-diabetic mice, plaque formation was significantly less compared to diabetic mice, which may explain the lack of significant differences. Although there was no significant difference in expression levels of mRNA, inflammatory cytokines showed a decreasing trend. Therefore, if the intervention period is extended, significant differences may occur even under non-diabetic conditions. In conclusion, specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the development of plaque formation and progression of atherosclerosis, which was independent of blood pressure and glucolipid metabolism. To the best of our knowledge, this is the first report showing that MR blocking per se exerts favorable anti-atherosclerotic effects presumably due to reduction of oxidative stress and/or inflammation, independently of blood pressure and glucolipid metabolism. Therefore, we think that the data obtained in this study would be informative and useful in atherosclerosis research area as well as from the clinical point of view. Abbreviations ApoE apolipoprotein E STZ streptozotocin TG triglyceride LDL-C low density lipoprotein cholesterol HDL-C high density lipoprotein cholesterol ROS reactive oxygen species 8-OHdG 8-hydroxy-2’-deoxyguanosine Il-1β interleukin 1β Mcp-1 monocyte chemotactic protein-1 iNos inducible nitric oxide synthase Vcam-1 vascular cell adhesion molecule Icam-1 intracellular adhesion molecule Timp-1 tissue inhibitor metalloproteinase 1 Mmp-2 matrix metalloproteinase 2 Declarations Ethics approval and consent to participate: The study was approved by the animal use committee of Kawasaki Medical School (No. 23-037) and conducted in compliance with the animal use guidelines of Kawasaki Medical School. Consent for publication: Not applicable. Availability of data and materials: The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests: H.K. has received honoraria for lectures, received scholarship grants, and received research grant from Novo Nordisk Pharma, Sanofi, Eli Lilly, Boehringer Ingelheim, Taisho Pharma, Sumitomo Pharma, Takeda Pharma, Ono Pharma, Daiichi Sankyo, Mitsubishi Tanabe Pharma, Kissei Pharma, MSD, AstraZeneca, Astellas, Novartis, Kowa, Abbott. K.K. has been an advisor to, received honoraria for lectures from, and received scholarship grants from Novo Nordisk Pharma, Sanwa Kagaku, Takeda, Taisho Pharma, MSD, Kowa, Sumitomo Pharma, Novartis, Mitsubishi Tanabe Pharma, AstraZeneca, Boehringer Ingelheim, Chugai, Daiichi Sankyo, Sanofi. All other authors have no conflict of interests. Funding: This work was supported by Research Project Grant from Kawasaki Medical School (No. R05-002 to Y.F.). Authors’ contributions: H.I., J.S., T.K. and H.K. designed the experiments. H.I. performed the experiments and wrote the manuscript. J.S. and T.K. performed guidance and supervision of the experiments. J.S., T.K., M.S., Y.I., K.D., Y.F., Y.K., Y.N., Y.S., Y.Y., S.N., T.M. and K.K. participated in discussion. H.K. participated in discussion and reviewed the manuscript. All authors reviewed the manuscript and approved the submission of the final version of this manuscript. Acknowledgements: We greatly thank Tomoko Ikeda for excellent technical assistance. We also thank central research institute of Kawasaki Medical School for technical supports of experiments. References Björkegren, JLM., Lusis, AJ. Atherosclerosis: Recent developments. Cell . 185 , 1630-45 (2022) Brownlee, M. Biochemistry and molecular cell biology of diabetic complications. Nature . 414 , 813-20. DOI: 10.1038/414813a (2001) Lee, J. et al. Interaction of IL-6 and TNF-α contributes to endothelial dysfunction in type 2 diabetic mouse hearts. PLoS One . 12 , e0187189 (2017) Kassan, M. et al. Enhanced NF-kappaB activity impairs vascular function through PARP-1-, SP-1-, and COX-2-dependent mechanisms in type 2 diabetes. Diabetes . 62 , 2078-87. DOI: 10.2337/db12-1374 (2013) Belmadani, S., Palen, DI., Gonzalez-Villalobos, RA., Boulares, HA., Matrougui, K. Elevated epidermal growth factor receptor phosphorylation induces resistance artery dysfunction in diabetic db/db mice. Diabetes . 57 , 1629-37. DOI: 10.2337/db07-0739 (2008) Zhang, H., Dellsperger, KC., Zhang C. The link between metabolic abnormalities and endothelial dysfunction in type 2 diabetes: an update. Basic Res Cardiol . 107 , 237. DOI: 10.1007/s00395-011-0237-1 (2012) Sena, CM., Pereira, AM., Seiça, R. Endothelial dysfunction - a major mediator of diabetic vascular disease. Biochim Biophys Acta . 1832 , 2216-31. DOI: 10.1016/j.bbadis.2013.08.006 (2013) Huynh, DTN., Heo, KS. Therapeutic targets for endothelial dysfunction in vascular diseases. Arch Pharm Res . 42 , 848-861. DOI: 10.1007/s12272-019-01180-7 (2019) Odegaard, AO. et al. Oxidative stress, inflammation, endothelial dysfunction and incidence of type 2 Diabetes. Cardiovasc Diabetol. 15 , 51. DOI: 10.1186/s12933-016-0369-6 (2016) Gisterå, A., Hansson, GK. The immunology of atherosclerosis. Nat Rev Nephrol . 13 , 368-80. DOI: 10.1038/nrneph.2017.51 (2017) Spitz, C. et al. Regulatory T cells in atherosclerosis: critical immune regulatory function and therapeutic potential. Cell Mol Life Sci . 73 , 901-22. DOI: 10.1007/s00018-015-2080-2 (2016) Ammirati, E., Moroni, F., Magnoni, M., Camici, PG. The role of T and B cells in human atherosclerosis and atherothrombosis. Clin Exp Immunol . 179 , 173-187. DOI: 10.1111/cei.12477 (2015) Ohashi, R., Mu, H., Yao, Q., Chen, C. Cellular and molecular mechanisms of atherosclerosis with mouse models. Trends Cardiovasc Med . 14 , 187-190. DOI: 10.1016/j.tcm.2004.04.002 (2004) Lusis, AJ. Atherosclerosis. Nature . 407 , 233-241. DOI: 10.1038/35025203 (2000) Schiffrin, EL., Effects of aldosterone on the vasculature. Hypertension . 47 , 312–318. doi: 10.1161/01.HYP.0000201443.63240.a7 (2006) Ana Paula, D., Iris Z, J., Rita C, Tostes., Frederic, J. New roles of aldosterone and mineralocorticoid receptors in cardiovascular disease: translational and sex-specific effects. Eric J Belin de Chantemele. Am J Physiol Heart Circ Physiol. 315 , H989-H999. DOI: 10.1152/ajpheart.00073.2018. Epub 2018 Jun 29 (2018) Adam P, M.et al. Aldosterone increases early atherosclerosis and promotes plaque inflammation through a placental growth factor-dependent mechanism. J Am Heart Assoc. 2 , e000018. doi: 10.1161/JAHA.112.000018. (2013) Bonnard, B. et al. Mineralocorticoid receptor antagonism improves diastolic dysfunction in chronic kidney disease in mice. J Mol Cell Cardiol . 121 , 124-133. DOI: 10.1016/j.yjmcc.2018.06.008 (2018) Kolkhof, P. et al. Finerenone, a novel selective nonsteroidal mineralocorticoid receptor blocker protects from rat cardiorenal injury. J Cardiovasc Pharmacol . 64 , 69-78. DOI: 10.1097/FJC.0000000000000091 (2014) Sanada, J. et al. Dulaglutide exerts beneficial anti atherosclerotic effects in ApoE knockout mice with diabetes: the earlier, the better. Sci Rep . 11 , 1425. DOI: 10.1038/s41598-020-80894-x (2021) Nguyen Dinh Cat, A., Montezano, AC., Burger, D., Touyz, RM. Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxid Redox Signal . 19 , 1110-1120. DOI: 10.1089/ars.2012.4641 (2013) Li, W. et al. Long-term spironolactone treatment reduces coronary TRPC expression, vasoconstriction, and atherosclerosis in metabolic syndrome pigs. Basic Res Cardiol . 112 , 54. DOI: 10.1007/s00395-017-0643-0 (2017) Kratz, MT., Schirmer, SH., Baumhäkel, M., Böhm, M. Atherosclerosis. Improvement of endothelial function in a murine model of mild cholesterol-induced atherosclerosis by mineralocorticoid antagonism. Atherosclerosis . 251 , 291-298. DOI: 10.1016/j.atherosclerosis.2016.06.018 (2016) Raz-Pasteur, A., Gamliel-Lazarovich, A., Gantman, A., Coleman, R., Keidar, S. Mineralocorticoid receptor blockade inhibits accelerated atherosclerosis induced by a low sodium diet in apolipoprotein E-deficient mice. J Renin Angiotensin Aldosterone Syst . 15 , 228-35. DOI: 10.1177/1470320312467558 (2014) Pitt, B. et al. Cardiovascular Events with Finerenone in Kidney Disease and Type 2 Diabetes. N Engl J Med . 385 , 2252-2263. DOI: 10.1056/NEJMoa2110956 (2021) Bonnard, B. et al. Mineralocorticoid receptor antagonism improves diastolic dysfunction in chronic kidney disease in mice. J Mol Cell Cardiol . 121 , 124-133. DOI: 10.1016/j.yjmcc.2018.06.008 (2018) Kolkhof, P. et al. Finerenone, a novel selective nonsteroidal mineralocorticoid receptor blocker protects from rat cardiorenal injury. J Cardiovasc Pharmacol . 64 , 69-78. DOI: 10.1097/FJC.0000000000000091 (2014) Iwashima, F. et al. Aldosterone induces superoxide generation via Rac1 activation in endothelial cells. Endocrinology . 149 , 1009-1014. DOI: 10.1210/en.2007-0864 (2008) Newfell, BG. et al. Aldosterone regulates vascular gene transcription via oxidative stress-dependent and -independent pathways. Arterioscler Thromb Vasc Biol . 31 , 1871-1880. DOI: 10.1161/ATVBAHA.111.229070 (2011) Caprio, M. et al. Functional mineralocorticoid receptors in human vascular endothelial cells regulate intercellular adhesion molecule-1 expression and promote leukocyte adhesion. Circ Res . 102 , 1359-1367. DOI: 10.1161/CIRCRESAHA.108.174235 (2008) Muñoz-Durango, N. et al. Modulation of Immunity and Inflammation by the Mineralocorticoid Receptor and Aldosterone. Biomed Res Int . 652738 . DOI: 10.1155/2015/652738 (2015) Matsumoto, T., Kudo, M., Taguchi, K., Kobayashi, T. Effect of Nonsteroidal Mineralocorticoid Receptor Blocker Esaxerenone on Vasoreactivity to an Endothelial Stimulator in Superior Mesenteric Arteries of Type 2 Diabetic Goto-Kakizaki Rat. Biol Pharm Bull . 45 , 1825-31. DOI: 10.1248/bpb.b22-00616 (2022) Munkhjargal, U. et al. A Selective Mineralocorticoid Receptor Blocker, Esaxerenone, Attenuates Vascular Dysfunction in Diabetic C57BL/6 Mice. J Atheroscler Thromb , 30 , 326-334. DOI: 10.5551/jat.63382 (2023) Bavuu, O. et al. Esaxerenone, a selective mineralocorticoid receptor blocker, improves insulin sensitivity in mice consuming high-fat diet. Eur J Pharmacol . 931 , 175190. DOI: 10.1016/j.ejphar.2022.175190 (2022) Additional Declarations Competing interest reported. H.K. has received honoraria for lectures, received scholarship grants, and received research grant from Novo Nordisk Pharma, Sanofi, Eli Lilly, Boehringer Ingelheim, Taisho Pharma, Sumitomo Pharma, Takeda Pharma, Ono Pharma, Daiichi Sankyo, Mitsubishi Tanabe Pharma, Kissei Pharma, MSD, AstraZeneca, Astellas, Novartis, Kowa, Abbott. K.K. has been an advisor to, received honoraria for lectures from, and received scholarship grants from Novo Nordisk Pharma, Sanwa Kagaku, Takeda, Taisho Pharma, MSD, Kowa, Sumitomo Pharma, Novartis, Mitsubishi Tanabe Pharma, AstraZeneca, Boehringer Ingelheim, Chugai, Daiichi Sankyo, Sanofi. All other authors have no conflict of interests. Supplementary Files SupTableScientificReports.docx Cite Share Download PDF Status: Published Journal Publication published 29 Mar, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 12 Nov, 2024 Reviews received at journal 04 Nov, 2024 Reviews received at journal 24 Oct, 2024 Reviewers agreed at journal 20 Oct, 2024 Reviewers agreed at journal 16 Oct, 2024 Reviewers invited by journal 15 Oct, 2024 Editor assigned by journal 15 Oct, 2024 Editor invited by journal 13 Oct, 2024 Submission checks completed at journal 10 Oct, 2024 First submitted to journal 03 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5196163","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":365358313,"identity":"975c6b31-d677-4b8c-969d-1f187ca1f71b","order_by":0,"name":"Hideyuki Iwamoto","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Hideyuki","middleName":"","lastName":"Iwamoto","suffix":""},{"id":365358314,"identity":"3d7b237a-97dc-44da-b7a1-39341afb8d9a","order_by":1,"name":"Junpei Sanada","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Junpei","middleName":"","lastName":"Sanada","suffix":""},{"id":365358315,"identity":"9dd1870e-369c-486f-962f-b658b6df95da","order_by":2,"name":"Tomohiko Kimura","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABH0lEQVRIie2QMUvDQBTHnwTscpD1SiF+hZMHpZN+lTsCmS4Y6CI4NJMdpHQNdPArtAQynwSaJdJNDm5R8gUKgjhIMWKFimmkm8j9puPe+/F/7wFYLH8UBxgHt35QUNsPvi2xhnbypXTjw5S6haldpY3zzo2ooijw8CG/01Ceiek0r9gjZOCOFQyjhhRyn2LCJPZN4A9A+yLRAXIOBmjJAZMGhYZZj7BLkRnZp7B2wlgDKrExABoASYuSzi5eamUU3q6KZ/WRctKuSDHvyWMKOg/nSn4OxvYpZb0LYQFSE+CAl8VooeWwProhp6WIm3bpjCeLirz5njvzn/R6eYXeqki7r2A8r8iX2HCx7/DdfICja/zN+IFTHaxYLBbLP+Qdvu1nhiz6xHQAAAAASUVORK5CYII=","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":true,"prefix":"","firstName":"Tomohiko","middleName":"","lastName":"Kimura","suffix":""},{"id":365358316,"identity":"ceaae2a7-e03c-4ff2-98d9-870d89a6b4db","order_by":3,"name":"Masashi Shimoda","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Masashi","middleName":"","lastName":"Shimoda","suffix":""},{"id":365358317,"identity":"c87ab393-9c08-4d84-9455-0ca63152e70b","order_by":4,"name":"Yuichiro Iwamoto","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yuichiro","middleName":"","lastName":"Iwamoto","suffix":""},{"id":365358318,"identity":"2032ba7c-f005-4d1a-a4c3-1c22ee1c3eb7","order_by":5,"name":"Kazunori Dan","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Kazunori","middleName":"","lastName":"Dan","suffix":""},{"id":365358319,"identity":"ee66db3c-26bb-4450-8e96-4291f53aea0e","order_by":6,"name":"Yoshiro Fushimi","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yoshiro","middleName":"","lastName":"Fushimi","suffix":""},{"id":365358320,"identity":"81dc6c53-f168-4495-a525-339aaad3214d","order_by":7,"name":"Yukino Katakura","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yukino","middleName":"","lastName":"Katakura","suffix":""},{"id":365358321,"identity":"c759276b-048d-4398-a620-3f1cc0460ed8","order_by":8,"name":"Yuka Nogami","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yuka","middleName":"","lastName":"Nogami","suffix":""},{"id":365358323,"identity":"aee64ddd-0833-4775-975a-9d13a4650436","order_by":9,"name":"Yoshiko Shirakiya","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yoshiko","middleName":"","lastName":"Shirakiya","suffix":""},{"id":365358325,"identity":"77e10534-f5a2-4a17-9463-d35120e4d063","order_by":10,"name":"Yuki Yamasaki","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Yuki","middleName":"","lastName":"Yamasaki","suffix":""},{"id":365358327,"identity":"b5e46e3a-998b-4d6c-b5de-1892a0c1e44e","order_by":11,"name":"Shuhei Nakanishi","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Shuhei","middleName":"","lastName":"Nakanishi","suffix":""},{"id":365358328,"identity":"e8cd4179-57a6-4e6d-a25e-531ee4962c52","order_by":12,"name":"Tomoatsu Mune","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Tomoatsu","middleName":"","lastName":"Mune","suffix":""},{"id":365358330,"identity":"655de82a-e773-408b-9635-4bfb7fc641d5","order_by":13,"name":"Kohei Kaku","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Kohei","middleName":"","lastName":"Kaku","suffix":""},{"id":365358331,"identity":"ab5c038c-9bf0-409d-ad3e-0bc348c524aa","order_by":14,"name":"Hideaki Kaneto","email":"","orcid":"","institution":"Kawasaki Medical School","correspondingAuthor":false,"prefix":"","firstName":"Hideaki","middleName":"","lastName":"Kaneto","suffix":""}],"badges":[],"createdAt":"2024-10-03 06:23:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5196163/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5196163/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-95324-z","type":"published","date":"2025-03-29T15:58:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":66523872,"identity":"fd20c2cd-4f1e-4437-a4c4-c2fb0499035b","added_by":"auto","created_at":"2024-10-14 04:36:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":66713,"visible":true,"origin":"","legend":"\u003cp\u003eThere was no significant difference between esaxerenone and control group in (A, B) non-fasting blood glucose levels (A, B), body weights (C, D), and food intake in non-diabetic and diabetic mice (E, F) (n=9-16). Black, control group; white, esaxerenone group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5196163/v1/c95d722e671d35edb5cc9287.png"},{"id":66523873,"identity":"d8fb1008-0508-4eb9-a83b-512366ab24cf","added_by":"auto","created_at":"2024-10-14 04:36:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":481237,"visible":true,"origin":"","legend":"\u003cp\u003eAtherosclerotic lesion in aortic arch in non-DM Control (A), non-DM Esaxerenone (B), DM Control (C) and DM Esaxerenone (D). (E) Esaxerenone treatment significantly reduced plaque area compared to control group in diabetic mice. n=8. *: p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5196163/v1/286b47da1268f492c444994e.png"},{"id":66524688,"identity":"f48b82bf-8a1d-4368-b6d9-90be91492104","added_by":"auto","created_at":"2024-10-14 04:44:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":48347,"visible":true,"origin":"","legend":"\u003cp\u003e(A) In esaxerenone group, urinary 8-OHdG levels were significantly lower compared to control in diabetic mice. n=8. (B-D) mRNA expression levels of inflammatory markers in the abdominal aorta were lower in esaxerenone group compared to control in diabetic mice. n=12. *: p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5196163/v1/2cb28718b863cc857b46e88f.png"},{"id":66523877,"identity":"de4a4567-e18d-448e-8e40-070542ad8ad2","added_by":"auto","created_at":"2024-10-14 04:36:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":72627,"visible":true,"origin":"","legend":"\u003cp\u003e(A-C) mRNA expression levels related to coagulation such as PAI-1, cell adhesion molecules such as V-CAM and I-CAM were significantly lower in esaxerenone group compared to control in diabetic mice. (D) Expression level of a macrophage marker F4/80 was not different between control and esaxerenone group. (E) Expression level of CD68 was significantly lower in esaxerenone group compared to control in diabetic mice. (F) Expression level of a plaque stability marker TIMP-1 was not different between the control and esaxerenone group. (G) Expression levels MMP-2 was significantly lower in esaxerenone group compared to control in diabetic mice. n=12. *: p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5196163/v1/18f92ae7452bbc684893a3c8.png"},{"id":79604939,"identity":"0a3f972b-ffbe-49f4-aff8-36d03378f493","added_by":"auto","created_at":"2025-03-31 16:09:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1757301,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5196163/v1/a84c6ed4-3913-4a5a-83ac-7a7d25cde771.pdf"},{"id":66523875,"identity":"84d652c8-4bd9-4936-834d-dbb708999e9b","added_by":"auto","created_at":"2024-10-14 04:36:20","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22065,"visible":true,"origin":"","legend":"","description":"","filename":"SupTableScientificReports.docx","url":"https://assets-eu.researchsquare.com/files/rs-5196163/v1/e7ab2b25e11c694c04e3c115.docx"}],"financialInterests":"Competing interest reported. H.K. has received honoraria for lectures, received scholarship grants, and received research grant from Novo Nordisk Pharma, Sanofi, Eli Lilly, Boehringer Ingelheim, Taisho Pharma, Sumitomo Pharma, Takeda Pharma, Ono Pharma, Daiichi Sankyo, Mitsubishi Tanabe Pharma, Kissei Pharma, MSD, AstraZeneca, Astellas, Novartis, Kowa, Abbott. K.K. has been an advisor to, received honoraria for lectures from, and received scholarship grants from Novo Nordisk Pharma, Sanwa Kagaku, Takeda, Taisho Pharma, MSD, Kowa, Sumitomo Pharma, Novartis, Mitsubishi Tanabe Pharma, AstraZeneca, Boehringer Ingelheim, Chugai, Daiichi Sankyo, Sanofi. All other authors have no conflict of interests.","formattedTitle":"Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAtherosclerotic cardiovascular disease is a chronic inflammatory disease of intima of the aorta and medium-sized arteries, and it accounts for one third of all deaths worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. An important risk factor for atherosclerosis is the dysfunction of vascular endothelial cells due to chronic inflammation, which is often observed in subjects with metabolic syndrome or diabetes mellitus [\u003cspan additionalcitationids=\"CR3 CR4 CR5 CR6 CR7 CR8\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Chronic inflammation is mainly caused by the infiltration and accumulation of inflammatory cells such as macrophages and lymphocytes, and these cells release inflammatory cytokines [\u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. On the other hand, it has been reported that the renin-angiotensin system (RAS) is activated in blood vessels with atherosclerosis, and mineralocorticoid receptor (MR)-mediated vascular endothelial dysfunction also contributes to the development of atherosclerosis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In subjects with obesity, hyperglycemia and excessive salt intake, aldosterone activates MR signaling, which finally provokes oxidative stress through the activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. MR is also expressed in vascular endothelial cells, vascular smooth muscle cells and macrophages [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], and it has been thought that its activation leads to the progression of atherosclerosis independently of hypertension. It has been also reported that primary aldosteronism increases the incidence of cardiovascular disease independently of blood pressure compared to essential hypertension [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTherefore, we hypothesized that the progression of atherosclerosis could be inhibited by suppressing MR activity using an MR blocker. In this study, we blocked mineralocorticoid signaling with esaxerenone, an MR blocker that is widely used in clinical practice. There are several reports on basic research using esaxerenone. For example, it has been reported that esaxerenone shows renoprotective effect independently of blood pressure in type 2 diabetes model mice and cardioprotective effect using hypertension model rats [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, there has been no report at all showing the possible effects of MR blocking on the progression of atherosclerosis. The purpose of this study was to examine whether blocking of mineralocorticoid signaling with esaxerenone exerts anti-atherosclerotic effects and to elucidate the molecular mechanisms of the possible anti-atherosclerotic effects of blocking mineralocorticoid signaling under diabetic and non-diabetic conditions.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and diets\u003c/h2\u003e \u003cp\u003eApoE knockout mice (C57BL/6J-ApoEtm1Unc) were purchased from Charles River Laboratories and reared under controlled environmental conditions on a 12-hour light/dark cycle (2 mice per cage in all experiments). Mice were fed water and standard diet (MF; Oriental Yeast Co.) were fed ad libitum until 8 weeks of age, and the room temperature was maintained at 25\u0026deg;C.\u003c/p\u003e \u003cp\u003eWe set diabetes model and non-diabetes model. For making diabetes model, at 8 weeks of age, we used streptozotocin (STZ) to induce hyperglycemia based on our previous report [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Mice were injected intraperitoneally with STZ (50 mg/kg/day) (Fujifilm Wako Pure Chemicals) for 5 consecutive days. Mice that showed obvious hyperglycemia of 300 mg/dL or more under feeding conditions were designated as a diabetic model. At the age of 10 weeks, the diabetic and non-diabetic models were respectively divided into a standard diet group and an esaxerenone-containing diet group (Provided by Daiichi Sankyo Co., LTD.) (3 mg/kg/day) for intervention. Mice in the four groups were observed from 10 to 18 weeks of age, and body weight, blood glucose, and food intake were measured throughout the experimental period. The mice used in the study were subjected to dissection under isoflurane anesthesia and subsequently euthanized. This study was approved by the Animal Use Committee of Kawasaki Medical School (No. 23\u0026ndash;037) and was conducted in accordance with the Kawasaki Medical School Animal Use Guidelines. In addition, this study was conducted in accordance with the Animal Research: Reporting of In Vivo Experiment (ARRIVE) guidelines.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMeasurement of biochemical markers\u003c/h3\u003e\n\u003cp\u003eBlood samples were collected from tail vein. Blood glucose levels were measured using a glucometer (Glutest Mint; Sanwa Kagaku Kenkyusho Co, Ltd, Japan). Plasma total cholesterol and triglyceride levels were measured enzymatically using the Wako LabAssay, L type Wako (Wako Pure Chemical Industries, Japan). Urine was collected using metabolic cage at 18 weeks of age, and urinary 8-OHdG levels were measured using ELISA kit (Japan Institute for the Control of Aging, NIKKEN SEIL Co, Ltd, Japan).\u003c/p\u003e\n\u003ch3\u003eRNA isolation and real time PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA extraction was performed using a RNeasy lipid tissue mini kit (QIAGEN, Valencia, CA) according to the manufacturers\u0026rsquo; instructions. cDNA was produced from mRNA using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was conducted using a Step One Plus Real-Time PCR system (Applied Biosystems). To quantify gene expression, the 2\u003csup\u003e\u0026minus;ΔCT\u003c/sup\u003e was calculated using β-actin as an internal control. Primer sequences used for real time PCR are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences of forward and reverse primers for real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTGAAAAGATGACCCAGATCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACAGCCTGGATGGCTACGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCCTCCACCACCATGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGCCGGCAACTGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTGTGTGACGTTCCCATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGACAGCACGAGGCTTTTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAACCACGGCCTTCCCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATGTGTAATTAAGCCTCCGACTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTIMP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATGGACATTTATTCTCCACTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCTAGGAGCCCCGATCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePAI-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCATCGCCTGCCATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGAGATAGGACAGTGCTTTTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVCAM-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCTCCCCTGAATACAAAACGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCCGTAGTGCTGCAAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eICAM-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGGAAGGGAGCCAAGTAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGACGCCGCTCAGAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCTCAAGAAGATGCAGAAGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTTGGCTTCCGCATGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF4/80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCATCTAGCAATGGACAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTTCTGGATCCATTTGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTCTCCAGCTGTTCACCTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCGAAGTGTCCCTTGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eHistological and immunohistological analyses\u003c/h3\u003e\n\u003cp\u003eUnder anesthesia, PBS was perfused from left ventricle and then mouses were killed and heart and aorta were dissected. Sudan IV (Wako: 192\u0026ndash;04392) staining was conducted for aortic arch. Adventitial fat tissue was removed and aorta was dissected longitudinally. The image analysis software NIH Image (version 1.61; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://rsbweb.nih.gov/ij/\u003c/span\u003e\u003cspan address=\"http://rsbweb.nih.gov/ij/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to calculate the ratio of the plaque lesion to the total aortic arch area.\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data were analyzed and expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean. Differences between two groups were tested for statistical significance using Student\u0026rsquo;s t-test. p values less than 0.05 were considered to indicate a statistically significant difference.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eThere was no significant difference in factors related to atherosclerosis between control and esaxerenone group\u003c/h2\u003e \u003cp\u003eIt is well known that blood glucose, lipid and blood pressure control greatly affect the progression of atherosclerosis. Therefore, we measured blood glucose levels, lipid levels, body weights and blood pressure. In non-diabetic mice, there was no significant difference in non-fasting blood glucose levels between control and esaxerenone group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Body weights and food intake were also not different between control and esaxerenone group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, E). In diabetic mice, there was also no significant difference in non-fasting blood glucose levels, body weights and food intake between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, D, F). In fasting conditions, there was also no difference in blood glucose levels, body weights, and lipid levels such as triglyceride and total cholesterol between control and esaxerenone group in non-diabetic and diabetic mice (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Esaxerenone is used as an anti-hypertensive drug in clinical practice. However, esaxerenone did not lower blood pressure and heart rate in both non-diabetic and diabetic mice in this strain (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Furthermore, esaxerenone did not affect body composition such as organ weights in both non-diabetic and diabetic models (Supplementary Table\u0026nbsp;1, 2). Therefore, in this study, treatment with esaxerenone did not change any factors that can influence the progression of atherosclerosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBiochemical data, body weights, and blood pressure in non-diabetic mice\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eBefore treatment (10 weeks)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eAfter treatment (18 weeks)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003econtrol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEsaxerenone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003econtrol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEsaxerenone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFasting blood glucose (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e62.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65.2\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e103.5\u0026thinsp;\u0026plusmn;\u0026thinsp;13.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e87.3\u0026thinsp;\u0026plusmn;\u0026thinsp;6.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal cholesterol (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e142.2\u0026thinsp;\u0026plusmn;\u0026thinsp;12.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e152.0\u0026thinsp;\u0026plusmn;\u0026thinsp;14.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTriglyceride (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e94.2\u0026thinsp;\u0026plusmn;\u0026thinsp;9.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e93.1\u0026thinsp;\u0026plusmn;\u0026thinsp;12.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFasting body weights (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e22.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e26.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e26.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSystolic BP (mmHg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e103.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98.1\u0026thinsp;\u0026plusmn;\u0026thinsp;3.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e96.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e98.8\u0026thinsp;\u0026plusmn;\u0026thinsp;4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiastolic BP (mmHg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e55.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e51.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e50.0\u0026thinsp;\u0026plusmn;\u0026thinsp;4.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e41.1\u0026thinsp;\u0026plusmn;\u0026thinsp;5.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeart rate (beats/min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e703.8\u0026thinsp;\u0026plusmn;\u0026thinsp;10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e662.9\u0026thinsp;\u0026plusmn;\u0026thinsp;18.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e711.1\u0026thinsp;\u0026plusmn;\u0026thinsp;12.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e694.0\u0026thinsp;\u0026plusmn;\u0026thinsp;13.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003cem\u003ep\u003c/em\u003e value between with and without esaxerenone treatment at 18 weeks. n.s.: not significant;\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eN/A, not applicable.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBiochemical data, body weights, and blood pressure in diabetic mice\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eBefore treatment (10 weeks)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eAfter treatment (18 weeks)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003econtrol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEsaxerenone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003econtrol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEsaxerenone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFasting blood glucose (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e120.6\u0026thinsp;\u0026plusmn;\u0026thinsp;13.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e160.3\u0026thinsp;\u0026plusmn;\u0026thinsp;12.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e154.1\u0026thinsp;\u0026plusmn;\u0026thinsp;20.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e138.1\u0026thinsp;\u0026plusmn;\u0026thinsp;14.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal cholesterol (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e176.8\u0026thinsp;\u0026plusmn;\u0026thinsp;19.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e174.3\u0026thinsp;\u0026plusmn;\u0026thinsp;41.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTriglyceride (mg/dl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e123.5\u0026thinsp;\u0026plusmn;\u0026thinsp;12.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e153.6\u0026thinsp;\u0026plusmn;\u0026thinsp;11.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFasting body weights (g)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e23.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e26.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSystolic BP (mmHg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e97.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e104.0\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e105.4\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e104.1\u0026thinsp;\u0026plusmn;\u0026thinsp;8.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiastolic BP (mmHg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50.6\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e49.5\u0026thinsp;\u0026plusmn;\u0026thinsp;5.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e50.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeart rate (beats/min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e660.9\u0026thinsp;\u0026plusmn;\u0026thinsp;17.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e648.2\u0026thinsp;\u0026plusmn;\u0026thinsp;14.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e711.1\u0026thinsp;\u0026plusmn;\u0026thinsp;12.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e694\u0026thinsp;\u0026plusmn;\u0026thinsp;13.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003en.s.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003cem\u003ep\u003c/em\u003e value between with and without esaxerenone treatment at 18 weeks. n.s.: not significant;\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eN/A, not applicable.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePlaque formation in the aortic arch was significantly reduced in esaxerenone group compared to control group in diabetic mice.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNext, to investigate the effect of esaxerenone on the progression of atherosclerosis, plaque formation in the aortic arch was evaluated. The area of plaque stained with Sudan IV was measured and compared between with and without esaxerenone treatment. In the non-diabetic mice, there was no significant difference between control and esaxerenone group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B, E). However, esaxerenone treatment significantly reduced plaque area compared to control group in diabetic mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, D, E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEsaxerenone treatment reduced oxidative stress and inflammatory cytokines in diabetic mice\u003c/h3\u003e\n\u003cp\u003eNext, we examined the possible effects of esaxerenone on the progression of atherosclerosis. It is known that activation of the RAS stimulates NADPH oxidase and increase reactive oxygen species (ROS) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Therefore, we evaluated urinary 8-OHdG levels as oxidative stress marker. Urinary 8-OHdG levels were significantly lower in esaxerenone group compared to control group in diabetic mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Expression levels of inflammatory cytokines such as \u003cem\u003eIl-6\u003c/em\u003e, \u003cem\u003eIl-1β\u003c/em\u003e and \u003cem\u003eMcp-1\u003c/em\u003e were higher in diabetic mice compared to non-diabetic mice. In non-diabetic mice, expression levels of \u003cem\u003eIl-6\u003c/em\u003e, \u003cem\u003eIl-1β\u003c/em\u003e and \u003cem\u003eMcp-1\u003c/em\u003e tended to be lower in esaxerenone group, although it did not reach a statistical significance. In diabetic mice, however, expression levels of \u003cem\u003eIl-1β\u003c/em\u003e and \u003cem\u003eMcp-1\u003c/em\u003e were significantly lower in esaxerenone group compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C, D). Taken together, specific locking of mineralocorticoid signaling with esaxerenone reduced ROS production and decreased expression levels of inflammatory cytokines in abdominal aorta under diabetic conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEsaxerenone reduced expression levels of factors associated with cell adhesion, macrophage infiltration, and plaque stability in the aorta of diabetic mice.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFinally, to examine other factors associated with atherosclerosis, we evaluated expression levels of cell adhesion, macrophage and plaque stability markers in the abdominal aorta. In non-diabetic mice, there were no differences in expression levels of cell adhesion, macrophage and plaque stability markers. Expression levels related with thrombus formation or cell adhesion such as \u003cem\u003ePai-1\u003c/em\u003e, \u003cem\u003eVcam-1\u003c/em\u003e, \u003cem\u003eIcam-1\u003c/em\u003e were significantly lower in esaxerenone group in diabetic mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, C). There was no difference in macrophage marker such as \u003cem\u003eF4/80\u003c/em\u003e, but expression levels of \u003cem\u003eCd68\u003c/em\u003e were significantly lower in esaxerenone group compared to control in diabetic mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, E). Regarding plaque stability, there was no difference in expression levels of Timp-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Mmp-2 expression level was significantly lower in esaxerenone group in diabetic mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we demonstrated that specific blocking of mineralocorticoid signaling with esaxerenone exerted favorable anti-atherosclerotic effects in the aorta of STZ-induced hyperglycemic ApoE KO mice. Furthermore, interestingly, such anti-atherosclerotic effects were obtained without influencing blood pressure and glucolipid metabolism. Other MR blockers, such as spironolactone [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and eplerenone [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] showed anti-atherosclerotic effects, but both drugs decreased blood pressure and improved lipid profile both of which are well known to reduce the progression of atherosclerosis. Therefore, while mineralocorticoid signaling has been drawing much attention recently, this is the first report which clearly demonstrates that blocking of mineralocorticoid signaling exerts favorable anti-atherosclerotic effects, independently of blood pressure and glucolipid metabolism.\u003c/p\u003e \u003cp\u003eIn clinical studies, finerenone has been shown to reduce cardiovascular events in patients with chronic kidney disease and type 2 diabetes mellitus [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], but basic studies have only examined cardioprotection and renoprotection [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. There is no report examining its possible effects on atherosclerosis. It is thought that esaxerenone suppresses the progression of atherosclerosis by suppressing mineralocorticoid signaling and reducing oxidative stress and inflammation. In this study, urinary 8-OHdG, an oxidative stress marker, was lower in esaxerenone group compared to control group. Expression levels of inflammatory markers such as \u003cem\u003eIl-1β\u003c/em\u003e and \u003cem\u003eMcp-1\u003c/em\u003e were significantly lower in esaxerenone group in diabetic mice. Furthermore, expression levels of \u003cem\u003ePai-1\u003c/em\u003e, \u003cem\u003eCd68\u003c/em\u003e, \u003cem\u003eVcam-1\u003c/em\u003e and \u003cem\u003eIcam-1\u003c/em\u003e may have decreased due to the improvement of inflammation. It has been reported that MR-mediated NADPH oxidase and Rac1 activation induces the production of ROS and are involved in vascular injury [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. We think that esaxerenone blocked MR and decreased ROS production. It is also known that MR activation promotes leukocyte adhesion through increased \u003cem\u003eIcam-1\u003c/em\u003e expression [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] and production of inflammatory cytokines and chemokines such as \u003cem\u003eIl-1β\u003c/em\u003e, \u003cem\u003eMcp-1\u003c/em\u003e, and \u003cem\u003ePai-1\u003c/em\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In this study, inflammatory cytokines and cell adhesion factors were increased under diabetic conditions, and these were significantly improved by esaxerenone treatment.\u003c/p\u003e \u003cp\u003eOn the other hand, there were no significant differences in blood pressure, lipid profile, and blood glucose levels between esaxerenone and control group. Esaxerenone is a drug used clinically for hypertension, but the selected dosage did not affect blood pressure as previously reported [\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. There was no difference in blood pressure in these reports, but esaxerenone showed beneficial effects on vascular dysfunction. We thought the possibility that esaxerenone directly exerts favorable anti-atherosclerotic effects by reducing oxidative stress and inflammation.\u003c/p\u003e \u003cp\u003eThere is limitation in this study. First, there was significant improvement in plaque area and mRNA levels in diabetic mice, however no significant improvement was observed in non-diabetic mice. In non-diabetic mice, plaque formation was significantly less compared to diabetic mice, which may explain the lack of significant differences. Although there was no significant difference in expression levels of mRNA, inflammatory cytokines showed a decreasing trend. Therefore, if the intervention period is extended, significant differences may occur even under non-diabetic conditions.\u003c/p\u003e \u003cp\u003eIn conclusion, specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the development of plaque formation and progression of atherosclerosis, which was independent of blood pressure and glucolipid metabolism. To the best of our knowledge, this is the first report showing that MR blocking \u003cem\u003eper se\u003c/em\u003e exerts favorable anti-atherosclerotic effects presumably due to reduction of oxidative stress and/or inflammation, independently of blood pressure and glucolipid metabolism. Therefore, we think that the data obtained in this study would be informative and useful in atherosclerosis research area as well as from the clinical point of view.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eApoE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eapolipoprotein E\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSTZ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003estreptozotocin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etriglyceride\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLDL-C\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elow density lipoprotein cholesterol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHDL-C\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehigh density lipoprotein cholesterol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e8-OHdG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e8-hydroxy-2\u0026rsquo;-deoxyguanosine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eIl-1β\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einterleukin 1β\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eMcp-1\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emonocyte chemotactic protein-1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eiNos\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einducible nitric oxide synthase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eVcam-1\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evascular cell adhesion molecule\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eIcam-1\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eintracellular adhesion molecule\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eTimp-1\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etissue inhibitor metalloproteinase 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eMmp-2\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ematrix metalloproteinase 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthics approval and consent to participate: The study was approved by the animal use committee of Kawasaki Medical School (No. 23-037) and conducted in compliance with the animal use guidelines of Kawasaki Medical School.\u003c/p\u003e\n\u003cp\u003eConsent for publication: Not applicable.\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials:\u0026nbsp;The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003eCompeting interests: H.K. has received honoraria for lectures, received scholarship grants, and received research grant from Novo Nordisk Pharma, Sanofi, Eli Lilly, Boehringer Ingelheim, Taisho Pharma, Sumitomo Pharma, Takeda Pharma, Ono Pharma, Daiichi Sankyo, Mitsubishi Tanabe Pharma, Kissei Pharma, MSD, AstraZeneca, Astellas, Novartis, Kowa, Abbott. K.K. has been an advisor to, received honoraria for lectures from, and received scholarship grants from Novo Nordisk Pharma, Sanwa Kagaku, Takeda, Taisho Pharma, MSD, Kowa, Sumitomo Pharma, Novartis, Mitsubishi Tanabe Pharma, AstraZeneca, Boehringer Ingelheim, Chugai, Daiichi Sankyo, Sanofi. All other authors have no conflict of interests.\u003c/p\u003e\n\u003cp\u003eFunding:\u0026nbsp;This work was supported by Research Project Grant from Kawasaki Medical School (No. R05-002 to Y.F.).\u003c/p\u003e\n\u003cp\u003eAuthors\u0026rsquo; contributions: H.I., J.S., T.K. and H.K. designed the experiments. H.I. performed the experiments and wrote the manuscript. J.S. and T.K. performed guidance and supervision of the experiments. J.S., T.K., M.S., Y.I., K.D., Y.F., Y.K., Y.N., Y.S., Y.Y., S.N., T.M. and K.K. participated in discussion. H.K. participated in discussion and reviewed the manuscript. All authors reviewed the manuscript and approved the submission of the final version of this manuscript.\u003c/p\u003e\n\u003cp\u003eAcknowledgements: We greatly thank Tomoko Ikeda for excellent technical assistance. We also thank central research institute of Kawasaki Medical School for technical supports of experiments.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBj\u0026ouml;rkegren, JLM., Lusis, AJ. Atherosclerosis: Recent developments. \u003cem\u003eCell\u003c/em\u003e. \u003cstrong\u003e185\u003c/strong\u003e, 1630-45 (2022)\u003c/li\u003e\n\u003cli\u003eBrownlee, M. Biochemistry and molecular cell biology of diabetic complications. \u003cem\u003eNature\u003c/em\u003e. \u003cstrong\u003e414\u003c/strong\u003e, 813-20. DOI: 10.1038/414813a (2001)\u003c/li\u003e\n\u003cli\u003eLee, J. et al. Interaction of IL-6 and TNF-\u0026alpha; contributes to endothelial dysfunction in type 2 diabetic mouse hearts. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e, e0187189 (2017)\u003c/li\u003e\n\u003cli\u003eKassan, M. et al. Enhanced NF-kappaB activity impairs vascular function through PARP-1-, SP-1-, and COX-2-dependent mechanisms in type 2 diabetes. \u003cem\u003eDiabetes\u003c/em\u003e. \u003cstrong\u003e62\u003c/strong\u003e, 2078-87. DOI: 10.2337/db12-1374 (2013)\u003c/li\u003e\n\u003cli\u003eBelmadani, S., Palen, DI., Gonzalez-Villalobos, RA., Boulares, HA., Matrougui, K. Elevated epidermal growth factor receptor phosphorylation induces resistance artery dysfunction in diabetic db/db mice. \u003cem\u003eDiabetes\u003c/em\u003e. \u003cstrong\u003e57\u003c/strong\u003e, 1629-37. DOI: 10.2337/db07-0739 (2008)\u003c/li\u003e\n\u003cli\u003eZhang, H., Dellsperger, KC., Zhang C. The link between metabolic abnormalities and endothelial dysfunction in type 2 diabetes: an update. \u003cem\u003eBasic Res Cardiol\u003c/em\u003e. \u003cstrong\u003e107\u003c/strong\u003e, 237. DOI: 10.1007/s00395-011-0237-1 (2012) \u003c/li\u003e\n\u003cli\u003eSena, CM., Pereira, AM., Sei\u0026ccedil;a, R. Endothelial dysfunction - a major mediator of diabetic vascular disease. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e.\u003cstrong\u003e 1832\u003c/strong\u003e, 2216-31. DOI: 10.1016/j.bbadis.2013.08.006 (2013) \u003c/li\u003e\n\u003cli\u003eHuynh, DTN., Heo, KS. Therapeutic targets for endothelial dysfunction in vascular diseases.\u003cstrong\u003e\u003cem\u003e \u003c/em\u003e\u003c/strong\u003e\u003cem\u003eArch Pharm Res\u003c/em\u003e. \u003cstrong\u003e42\u003c/strong\u003e, 848-861. DOI: 10.1007/s12272-019-01180-7 (2019)\u003c/li\u003e\n\u003cli\u003eOdegaard, AO. et al. Oxidative stress, inflammation, endothelial dysfunction and incidence of type 2 Diabetes. \u003cstrong\u003e\u003cem\u003eCardiovasc \u003c/em\u003e\u003c/strong\u003e\u003cem\u003eDiabetol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 51. DOI: 10.1186/s12933-016-0369-6 (2016)\u003c/li\u003e\n\u003cli\u003eGister\u0026aring;, A., Hansson, GK. The immunology of atherosclerosis. \u003cem\u003eNat Rev Nephrol\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 368-80. DOI: 10.1038/nrneph.2017.51 (2017)\u003c/li\u003e\n\u003cli\u003eSpitz, C. et al. Regulatory T cells in atherosclerosis: critical immune regulatory function and therapeutic potential. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e. \u003cstrong\u003e73\u003c/strong\u003e, 901-22. DOI: 10.1007/s00018-015-2080-2 (2016)\u003c/li\u003e\n\u003cli\u003eAmmirati, E., Moroni, F., Magnoni, M., Camici, PG. The role of T and B cells in human atherosclerosis and atherothrombosis. \u003cem\u003eClin Exp Immunol\u003c/em\u003e.\u003cstrong\u003e 179\u003c/strong\u003e, 173-187. DOI: 10.1111/cei.12477 (2015)\u003c/li\u003e\n\u003cli\u003eOhashi, R., Mu, H., Yao, Q., Chen, C. Cellular and molecular mechanisms of atherosclerosis with mouse models. \u003cem\u003eTrends Cardiovasc Med\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e, 187-190. DOI: 10.1016/j.tcm.2004.04.002 (2004)\u003c/li\u003e\n\u003cli\u003eLusis, AJ. Atherosclerosis. \u003cem\u003eNature\u003c/em\u003e. \u003cstrong\u003e407\u003c/strong\u003e, 233-241. DOI: 10.1038/35025203 (2000)\u003c/li\u003e\n\u003cli\u003eSchiffrin, EL., Effects of aldosterone on the vasculature.\u003cstrong\u003e\u003cem\u003e \u003c/em\u003e\u003c/strong\u003e\u003cem\u003eHypertension\u003c/em\u003e. \u003cstrong\u003e47\u003c/strong\u003e, 312\u0026ndash;318. doi: 10.1161/01.HYP.0000201443.63240.a7 (2006)\u003c/li\u003e\n\u003cli\u003eAna Paula, D., Iris Z, J., Rita C, Tostes., Frederic, J. New roles of aldosterone and mineralocorticoid receptors in cardiovascular disease: translational and sex-specific effects. \u003cem\u003eEric J Belin de Chantemele. Am J Physiol Heart Circ Physiol.\u003c/em\u003e \u003cstrong\u003e315\u003c/strong\u003e, H989-H999. DOI: 10.1152/ajpheart.00073.2018. Epub 2018 Jun 29 (2018)\u003c/li\u003e\n\u003cli\u003eAdam P, M.et al. Aldosterone increases early atherosclerosis and promotes plaque inflammation through a placental growth factor-dependent mechanism. \u003cem\u003eJ Am Heart Assoc.\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, e000018. doi: 10.1161/JAHA.112.000018. (2013)\u003c/li\u003e\n\u003cli\u003eBonnard, B. et al. Mineralocorticoid receptor antagonism improves diastolic dysfunction in chronic kidney disease in mice. \u003cem\u003eJ Mol Cell Cardiol\u003c/em\u003e. \u003cstrong\u003e121\u003c/strong\u003e, 124-133. DOI: 10.1016/j.yjmcc.2018.06.008 (2018)\u003c/li\u003e\n\u003cli\u003eKolkhof, P. et al. Finerenone, a novel selective nonsteroidal mineralocorticoid receptor blocker protects from rat cardiorenal injury. \u003cem\u003eJ Cardiovasc Pharmacol\u003c/em\u003e.\u003cstrong\u003e 64\u003c/strong\u003e, 69-78. DOI: 10.1097/FJC.0000000000000091 (2014)\u003c/li\u003e\n\u003cli\u003eSanada, J. et al. Dulaglutide exerts beneficial anti atherosclerotic effects in ApoE knockout mice with diabetes: the earlier, the better. \u003cem\u003eSci Rep\u003c/em\u003e. \u003cstrong\u003e11\u003c/strong\u003e, 1425. DOI: 10.1038/s41598-020-80894-x (2021)\u003c/li\u003e\n\u003cli\u003eNguyen Dinh Cat, A., Montezano, AC., Burger, D., Touyz, RM. Angiotensin II, NADPH oxidase, and redox signaling in the vasculature.\u003cstrong\u003e\u003cem\u003e \u003c/em\u003e\u003c/strong\u003e\u003cem\u003eAntioxid Redox Signal\u003c/em\u003e. \u003cstrong\u003e19\u003c/strong\u003e, 1110-1120. DOI: 10.1089/ars.2012.4641 (2013)\u003c/li\u003e\n\u003cli\u003eLi, W. et al. Long-term spironolactone treatment reduces coronary TRPC expression, vasoconstriction, and atherosclerosis in metabolic syndrome pigs. \u003cem\u003eBasic Res Cardiol\u003c/em\u003e. \u003cstrong\u003e112\u003c/strong\u003e, 54. DOI: 10.1007/s00395-017-0643-0 (2017)\u003c/li\u003e\n\u003cli\u003eKratz, MT., Schirmer, SH., Baumh\u0026auml;kel, M., B\u0026ouml;hm, M. Atherosclerosis. Improvement of endothelial function in a murine model of mild cholesterol-induced atherosclerosis by mineralocorticoid antagonism. \u003cem\u003eAtherosclerosis\u003c/em\u003e. \u003cstrong\u003e251\u003c/strong\u003e, 291-298. DOI: 10.1016/j.atherosclerosis.2016.06.018 (2016)\u003c/li\u003e\n\u003cli\u003eRaz-Pasteur, A., Gamliel-Lazarovich, A., Gantman, A., Coleman, R., Keidar, S. Mineralocorticoid receptor blockade inhibits accelerated atherosclerosis induced by a low sodium diet in apolipoprotein E-deficient mice. \u003cem\u003eJ Renin Angiotensin Aldosterone Syst\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, 228-35. DOI: 10.1177/1470320312467558 (2014)\u003c/li\u003e\n\u003cli\u003ePitt, B. et al. Cardiovascular Events with Finerenone in Kidney Disease and Type 2 Diabetes. \u003cem\u003eN Engl J Med\u003c/em\u003e. \u003cstrong\u003e385\u003c/strong\u003e, 2252-2263. DOI: 10.1056/NEJMoa2110956 (2021)\u003c/li\u003e\n\u003cli\u003eBonnard, B. et al. Mineralocorticoid receptor antagonism improves diastolic dysfunction in chronic kidney disease in mice. \u003cem\u003eJ Mol Cell Cardiol\u003c/em\u003e. \u003cstrong\u003e121\u003c/strong\u003e, 124-133. DOI: 10.1016/j.yjmcc.2018.06.008 (2018)\u003c/li\u003e\n\u003cli\u003eKolkhof, P. et al. Finerenone, a novel selective nonsteroidal mineralocorticoid receptor blocker protects from rat cardiorenal injury. \u003cem\u003eJ Cardiovasc Pharmacol\u003c/em\u003e. \u003cstrong\u003e64\u003c/strong\u003e, 69-78. DOI: 10.1097/FJC.0000000000000091 (2014)\u003c/li\u003e\n\u003cli\u003eIwashima, F. et al. Aldosterone induces superoxide generation via Rac1 activation in endothelial cells. \u003cem\u003eEndocrinology\u003c/em\u003e. \u003cstrong\u003e149\u003c/strong\u003e, 1009-1014. DOI: 10.1210/en.2007-0864 (2008) \u003c/li\u003e\n\u003cli\u003eNewfell, BG. et al. Aldosterone regulates vascular gene transcription via oxidative stress-dependent and -independent pathways. \u003cem\u003eArterioscler Thromb Vasc Biol\u003c/em\u003e. \u003cstrong\u003e31\u003c/strong\u003e, 1871-1880. DOI: 10.1161/ATVBAHA.111.229070 (2011)\u003c/li\u003e\n\u003cli\u003eCaprio, M. et al. Functional mineralocorticoid receptors in human vascular endothelial cells regulate intercellular adhesion molecule-1 expression and promote leukocyte adhesion. \u003cem\u003eCirc Res\u003c/em\u003e. \u003cstrong\u003e102\u003c/strong\u003e, 1359-1367. DOI: 10.1161/CIRCRESAHA.108.174235 (2008)\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz-Durango, N. et al. Modulation of Immunity and Inflammation by the Mineralocorticoid Receptor and Aldosterone. \u003cem\u003eBiomed Res Int\u003c/em\u003e. \u003cstrong\u003e652738\u003c/strong\u003e. DOI: 10.1155/2015/652738 (2015)\u003c/li\u003e\n\u003cli\u003eMatsumoto, T., Kudo, M., Taguchi, K., Kobayashi, T. Effect of Nonsteroidal Mineralocorticoid Receptor Blocker Esaxerenone on Vasoreactivity to an Endothelial Stimulator in Superior Mesenteric Arteries of Type 2 Diabetic Goto-Kakizaki Rat. \u003cem\u003eBiol Pharm Bull\u003c/em\u003e. \u003cstrong\u003e45\u003c/strong\u003e, 1825-31. DOI: 10.1248/bpb.b22-00616 (2022)\u003c/li\u003e\n\u003cli\u003eMunkhjargal, U. et al. A Selective Mineralocorticoid Receptor Blocker, Esaxerenone, Attenuates Vascular Dysfunction in Diabetic C57BL/6 Mice. \u003cem\u003eJ Atheroscler Thromb\u003c/em\u003e, \u003cstrong\u003e30\u003c/strong\u003e, 326-334. DOI: 10.5551/jat.63382 (2023)\u003c/li\u003e\n\u003cli\u003eBavuu, O. et al. Esaxerenone, a selective mineralocorticoid receptor blocker, improves insulin sensitivity in mice consuming high-fat diet. \u003cem\u003eEur J Pharmacol\u003c/em\u003e. \u003cstrong\u003e931\u003c/strong\u003e, 175190. DOI: 10.1016/j.ejphar.2022.175190 (2022)\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"esaxerenone, oxidative stress, atherosclerosis","lastPublishedDoi":"10.21203/rs.3.rs-5196163/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5196163/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eAims:\u003c/strong\u003e Endothelial damage mediated by mineralocorticoid receptor (MR) is an important factor in the development of atherosclerosis. Esaxerenone is a highly selective drug that can specifically block MR activity. The aim of this study is to examine whether specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the progression of atherosclerosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eApoE KO mice were used as a model of atherosclerosis. In addition to a non-diabetic model, we created a diabetic model using streptozotocin. These were divided into a control group and an esaxerenone group. Esaxerenone-containing diet was provided for 8 weeks starting at 10 weeks of age. Various metabolic markers and abdominal aortic mRNA expression were evaluated, and histological examination of the aortic arch and thoracic aorta was performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e In diabetic mice, plaque area in the aortic arch was significantly smaller in esaxerenone group compared to control group, although there were no differences in blood pressure, serum lipid levels between the two group. Inflammation-related genes, macrophage marker, cell adhesion factors and oxidative stress marker were all significantly lower in esaxerenone group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e Specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the progression of atherosclerosis without influencing blood pressure and glucolipid metabolism.\u003c/p\u003e","manuscriptTitle":"Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-14 04:36:15","doi":"10.21203/rs.3.rs-5196163/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-13T02:20:22+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-04T11:39:11+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-25T02:03:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"97935088492716221624750172431606093253","date":"2024-10-20T22:26:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"281530930551154877480988579631901907760","date":"2024-10-16T05:13:58+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-15T09:48:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-15T09:45:22+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-10-13T05:42:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-10T11:46:50+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-10-03T06:07:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ee38687b-91ed-4997-b5d8-162b9bb776f8","owner":[],"postedDate":"October 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":38871258,"name":"Health sciences/Cardiology"},{"id":38871259,"name":"Health sciences/Endocrinology"}],"tags":[],"updatedAt":"2025-03-31T16:04:02+00:00","versionOfRecord":{"articleIdentity":"rs-5196163","link":"https://doi.org/10.1038/s41598-025-95324-z","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-03-29 15:58:00","publishedOnDateReadable":"March 29th, 2025"},"versionCreatedAt":"2024-10-14 04:36:15","video":"","vorDoi":"10.1038/s41598-025-95324-z","vorDoiUrl":"https://doi.org/10.1038/s41598-025-95324-z","workflowStages":[]},"version":"v1","identity":"rs-5196163","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5196163","identity":"rs-5196163","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}