Characterization and optimization of neurosphere culture as in vitro screening tool against valproic acid-induced neurodevelopmental toxicity

Characterization and optimization of neurosphere culture as in vitro screening tool against valproic acid-induced neurodevelopmental toxicity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Characterization and optimization of neurosphere culture as in vitro screening tool against valproic acid-induced neurodevelopmental toxicity Shubham Dwivedi, Apurva Dusane, Sriharshini Goli, Raghavender Medishetti, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6809301/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Valproic acid (VPA) is an antiepileptic drug known to cause autism when consumed during pregnancy. Autism is a complex neurodevelopmental disorder of early-onset, highly variable in its clinical presentation. In spite of well validated animal model for autism, screening compounds is time consuming, laborious and challenging. In utero VPA exposure in rodents leads to autism-like behavioral defects in their offspring. Therefore, we attempted to establish a VPA-induced neurodevelopmental toxicity model employing neural stem cells/neurospheres (in vitro). In this study, we investigated the defects in neurospheres with direct exposure to VPA. Neuronal precursor cells were collected from time pregnant Sprague Dawley rats and allowed to generate free floating neurospheres. Neurospheres were treated with VPA (0.5mM, 1mM, and 2mM) for 7 days with daily observation and were investigated for cytotoxicity, proliferation, gene expression, and differentiation pattern. Since the marketed drugs available for autism only rescues symptoms with no effect on molecular phenotypes of autism, the model system was validated using two known neuroprotective herbal drugs Withania somnifera and Bacopa monnieri. The VPA exposure in neurospheres did not cause any significant alteration in LDH release, indicating no cytotoxicity of VPA (up to 2mM), however, a decrease in proliferation of neurospheres with significant alteration in the expression level of high-risk genes for autism was observed with VPA treatment. VPA treated neurospheres showed poor differentiation with decreased neurite outgrowth. The neuroprotective herbal drugs were able to rescue the neurospheres against VPA toxicity in terms of proliferation and differentiation. The study was substantiated with an established zebrafish in vivo model. Thus, this study provides insight towards developing an in vitro system for the preliminary drug screening against VPA induced neurodevelopmental toxicity and autism. However, further exploration of the mechanism might be needed to validate the utility of neurospheres for target-specific screening. Valproic acid Neurospheres Neurodevelopmental toxicity Autism Drug screening In vitro model Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Valproic acid (VPA) also known as 2-propylpentanoic acid, is a frequently prescribed anti-convulsant drug or mood stabilizer(Johannessen & Johannessen, 2003 ). Despite being the first-choice drug for epilepsy, VPA has been reported to be a potential risk factor in the pathophysiology of idiopathic autism when consumed during pregnancy(Chomiak et al., 2013 ; Rodier et al., 1997 ; Roullet et al., 2013 ). VPA exposure to pregnant women, not other anti-epileptic treatments, triples the risk of having autistic children(Varghese et al., 2017 ) along with the increased incidence of neural tube defects, developmental delay and cognitive impairments(Markram et al., 2008 ; Nicolini & Fahnestock, 2018 ; Servadio et al., 2016 ). Since VPA can cross the placental barrier, thus prenatal VPA exposure may act directly on fetal neuronal cells. VPA also affects maternal tissues which have an indirect impact on fetal neurodevelopment(Iijima et al., 2016 ). In alignment with the clinical reports, rodent and zebrafish models also suggested that VPA exposure during embryonic development induce autistic-like symptoms in the offspring(Dwivedi et al., 2019a ; Markram et al., 2008 ; Roullet et al., 2010 ). Prenatal VPA exposure in rodents showed behavioral despair similar to autistic patients2,3,12–14 and was used as an established model for screening novel pharmacological interventions for autism. However, the available model for autism are time consuming, costly and requires a large number of animals, thus not an obvious choice for high throughput screening. Therefore, we took efforts to investigate if neural stem cells/neurospheres ( in vitro ) could be used as a screening tool against VPA induced neurodevelopmental toxicity. Neurospheres are the multipotent neural stem cells (NSCs) exhibiting self-renewal property and proliferate as undifferentiated cells(Walker, n.d.). These cells terminally differentiate into neurons, astrocytes, and oligodendrocytes under suitable circumstances(Walker, n.d.). Neurospheres could be either isolated from the fetal/adult brain or can be established from embryonic stem cells(Jensen & Parmar, 2006 ). Since neurosphere comprises of primary cells involved in the developing brain, thus can mimic the brain development process which made them a suitable tool to investigate neurodevelopmental toxicity(Azari & Reynolds, 2016 ; Fritsche et al., 2005 ; Moors et al., 2009 ). These three dimensional systems may be useful in exploring molecular and cellular mechanisms underlying development, plasticity, and regeneration(Xiong et al., 2011 ) and could be a valuable tool for screening chemicals for their abilities to interfere with proliferation, migration, differentiation, and apoptosis(Moors et al., 2009 ). There have been few studies investigating the effect of VPA on primary culture as well as immortal cell culture(Cui et al., 2017 ; Hill et al., 2013 ; Jung et al., 2008 ). A study from Baumann et al. has explored human and rat neurospheres model system to investigate developmental neurotoxicity associated with various chemicals including VPA(Toxicol et al., 2015 ). However, our approach was to search for a reliable and economical tool which can be used for in-vitro screening of candidate molecules against VPA induced neurodevelopmental toxicity. In the present study we have explored the effect of VPA on neurospheres. The free floating neurospheres were exposed to VPA (0.5mM, 1mM, and 2mM) on 3rd day in vitro (DIV3) up to DIV10, and the effect was observed daily for proliferation and cell survival. The VPA treated neurospheres were further investigated for gene expression (4th and 7th day of treatment) and differentiation pattern (7th day of treatment). The chronic VPA exposure leads to defects in proliferation and differentiation of neurospheres, along with dysregulation of strong candidate genes for autism. The rescue of VPA induced neurotoxicity with Withania somnifera (W.S.) and Bacopa monnieri (B.M.) suggest the utility of the neurosphere system in neurodevelopmental toxicity testing. To understand the potential of this model, both neuroprotective herbal extract W.S. and B.M. were also investigated in VPA induced zebrafish larvae model as described in our previous study. Although the proposed model needs further validation and exploration yet could be an approach towards preliminary screening for neurodevelopmental toxicity. 2. Material and methods 2.1. Chemicals and reagents: Sodium valproate was procured from Sigma-Aldrich, USA. Human FGF-2 was purchased from Miltenyi Biotec, USA. Cell culture reagents were purchased from Himedia, India. Antibodies were procured from Cell signalling technology, USA. The cDNA synthesis kit and DyNAmo Flash SYBR Green qPCR Kit was purchased from Thermo Scientific, Waltham, MA. The Herbal extracts of W.S. and B.M. were a kind gift from Natural Remedies, Bangalore, India. All other chemicals used were of analytical grade. 2.2. Animal ethics and husbandry: Timed pregnant Sprague–Dawley rats (gestational age E8 to E10) were procured from National center for laboratory animal sciences (NCLAS), National Institute of Nutrition (NIN) Hyderabad, India. Standard laboratory animal feed and water were provided ad libitum . All the animal experiments were performed in accordance with the committee for the purpose of control and supervision of experiments on animals (CPCSEA), Government of India. The animal experimentation protocols were approved (approval no. BITS-Hyd/IAEC/2017/21) by the institutional animal ethics committee (IAEC), BITS-Pilani Hyderabad campus (CPCSEA Registration No.351, 3/1/2001). 2.3. Preparation of neurosphere cultures from embryonic rat cortex: The rats were sacrificed on gestation age E15 followed by decapitation of embryos and were placed in petri dishes containing Hank's Balanced Salt Solution (HBSS). The heads of the embryos were processed in the sterile condition under hood to carefully isolate the cortex region. HBSS was removed, and tissue was dissociated using 0.25% of trypsin–EDTA (2 ml) for 20 minutes at 37°C with periodic agitation. Enzyme activity was stopped by adding 4 ml of HBSS. The HBSS was removed, followed by the addition of 2 ml of trypsin inhibitor for 1 minute to neutralize trypsin completely. The trypsin inhibitor was discarded and 1ml of freshly prepared proliferation media (consist of 5 µg/ml heparin, 20 ng/ml human FGF-2, 10% Fetal bovine serum and 1% Penicillin/Streptomycin antibiotic solution in DMEM/F12 media) was added. The tissue in solution was manually triturated using a fire-polished Pasteur pipette and the cells containing media was passed through a cell strainer (40 µM) to obtain single cell suspension. All experiments were performed with mycoplasma-free cells. 2.4. Generation of free-floating neurospheres: Single cell suspensions were plated into agarose coated anti-attachment plates and dishes (for plate preparation see supplementary data) according to experimental requirements. The cells were seeded in proliferation medium at a density of 2X10 4 cells per well in 96-well and 1.5 X 10 6 cells in T-25 flask. The cells were incubated in 5% CO2 incubator at 37°C. Fifty percent of the media was replaced every week in the culture system. 2.5 Characterization of neurospheres: The proliferating free floating neurospheres were monitored for day in vitro 15 (DIV10) using brightfield microscopy. The neurosphere were validated for stem cell like property with immunofluorescence on DIV10. The immunofluorescence experiments with neurosphere were done in 1.5 ml centrifuge tube and to avoid loss of neurospheres, centrifugation is required while changing buffers/antibodies. The antibody dilution for primary and secondary antibodies were 1:200. The neurospheres were fixed in 4% paraformaldehyde (PFA). Fixed neurospheres were immunolabeled with nestin (Mouse mAb #4760), β-3 Tubulin (Rabbit mAb #5568), glial fibrillary acidic protein ((GFAP) Rabbit mAb #12389) 2′,3′-cyclic nucleotide 3′-phosphodiesterase ((CNPase) Rabbit mAb #5664) overnight at 4℃. The antibodies are markers for dividing neural and neural stem cell like populations, neural cell differentiation/Neurons, glial cells, oligodendrocytes respectively. Further these neurospheres were incubated with anti-mouse IgG Alexa Fluor® 647 Conjugate (for Nestin) and anti-rabbit IgG Alexa Fluor® 647 Conjugate (for β-3 Tubulin, GFAP and CNPase) secondary antibody for 1h at room temperature. Neurospheres were stained with nuclear stain DAPI (5 µg/ml) for 5 minutes, placed on the cover slip with in-house anti-fading mounting media and examined using confocal microscope. The neurospheres were also allowed to differentiate after DIV10 on adherent plates. 2.6. VPA treatment: Sodium valproate was dissolved directly in proliferation media and was added to free floating neurospheres at three different concentrations (0.5, 1.0 and 2 mM) on DIV3. The cells were kept under VPA treatment for 7 days (DIV10) with daily observation up to 7 days of treatment. 2.7. Proliferation assay: Neurosphere size was used as a parameter for proliferation assay. The neurospheres were observed daily under the Leica fluorescence microscope (Model no. TL LED). However, the images of neurospheres were captured as bright field images on 1st, 4th and 7th day of treatment to observe a noteworthy difference. The diameter of neurospheres were measured using the Leica application suite X software. The diameter of neurospheres was calculated as percentage diameter considering control as 100% using the formula: $$\:\%\:Diameter=\left(\frac{Diameter\:of\:treated}{Average\:diameter\:of\:control}\right)*100$$ The neurospheres were also observed for neurosphere dissociation pattern and the percentage frequency of completely dissociated neurospheres were calculated using the formula $$\:\%\:Frequency\:of\:completely\:dissociated\:neurospheres=\left(\frac{Number\:of\:completely\:dissociated\:neurosphere}{Total\:number\:of\:neurosphere}\right)*100$$ 2.8. Cytotoxicity assay: Cytotoxicity was assessed after every 24 hours from 1–7 days of VPA exposure using Lactate dehydrogenase (LDH) release assay. The quantity of the leaked LDH into the medium by dying cells was used as a measure of cell cytotoxicity(Gottron & Choi, 2000 ). The LDH levels were measured spectrophotometrically using EZcount™ lactate dehydrogenase cell assay kit (Himedia, India). The assay was performed according to the manufacturer’s protocol. Briefly, culture media (50 µl) was collected in 96 well plate, an equal amount of LDH reagent was added and the mixture was incubated in dark for 30 minutes at room temperature. Stop solution (50 µl) was added and absorbance was measured at 450 nm and 620 nm (background), using a Spectra Max 340 microplate spectrophotometer (Molecular Devices, Sunnyvale,CA). After background absorbance subtraction, the percentage cell death was measured using the formula: $$\:\%\:Cytotoxicity=\frac{\left(Absorbance\:of\:treated-Absorbance\:of\:control\right)}{Absorbance\:of\:control}\:\:\times\:100$$ 2.9. Gene expression studies: The neurospheres were collected on 4th and 7th day of treatment for gene expression studies. Total RNA was isolated from the neurospheres cultured in T-25 anti-attachment flask (n = 3) using the TRIzol method following the manufacturer’s instructions. The RNA (1 µg) was converted into cDNA by using Verso cDNA synthesis kit as per the manufacturer’s instructions. Gene expression was quantitatively determined by Real-Time PCR using DyNAmo Flash SYBR Green qPCR Kit and the CFX Connect Real-Time PCR System (Biorad, USA) according to the manufacturer´s instructions. All reactions were performed in triplicate. The results are expressed relative to GAPDH, which is used as an internal control. The primers (IDT, India) were validated for linearity and specificity of amplification and the sequence for primers are mentioned below: Genes Primers NRXN 1 (Forward Primer) GGACTGCTCTGCTCAACTATG NRXN 1 (Reverse Primer) GTACTCTGAATTTCCGCCATCT NGLN 3 (Forward Primer) GGCCTTTGCTGCTCTCTATTA NGLN 3 (Reverse Primer) TCTGGAGCAGTTCCCAATTC SHANK 3a (Forward Primer) GGCAAGTTCCTGGATGAAGA SHANK 3a (Reverse Primer) GGCATAAACTCTCCGCTTGTA GAPDH (Forward Primer) TGATTCTACCCACGGCAAGTT GAPDH (Reverse Primer) TGATGGGTTTCCCATTGATGA 2.10. Neural cell differentiation from neurospheres: The purpose of experiment was to observe the effect of VPA on the differentiation pattern of the neurospheres. Control and VPA treated neurospheres were collected on 7th day of treatment and a single cell suspension was prepared by repeated pipetting using micropipette. The single cell suspension in differentiation media (DMEM/F12 media with 10% FBS, 2% B 27 supplement and 1% antibiotic) was plated on polyethyleneimine coated coverslips and plates (see supplementary data for plate preparation). Cells were allowed to differentiate for 7 days in 5% CO2 incubator at 37°C, later subjected to immunofluorescence labelling. Briefly, the differentiated cells were fixed with 4% PFA. The cells were then incubated overnight at 4°C in primary antibodies (1:200) against GFAP, β-3 Tubulin, and CNPase, followed by 1hour incubation with secondary (1:200) anti-rabbit IgG Alexa Fluor® 647 Conjugate at room temperature. Cells were stained with nuclear stain DAPI (5 µg/ml) for 5 minutes, inhouse anti-fading mounting media was added to the coverslip and examined using Leica fluorescence microscope. 2.11. Herbal drug screening: The pure herbal extract of W.S. and B.M. were dissolved in proliferation media (500µg/ml). The neurospheres were treated with three different concentrations (0.1µg/ml, 1µg/ml and 10µg/ml) of herbal drugs on DIV3, followed by simultaneous treatment of VPA (1mM and 2mM). The co-treated cells were allowed to grow for 7 days and were investigated for proliferation (4th day) and differentiation pattern (7th day). To confirm that neurosphere model can act as first phase screening for molecules, we have explored the effect of the neuroprotective herbal drugs in the zebrafish larvae model as described in our previous study (Dwivedi et al., 2019b ). Briefly, the 4 hours post fertilized (hpf) embryos were treated (single exposure) with 75µM VPA dissolved in media. VPA treatment was continued up to 5 days post fertilization (dpf). The larvae were randomly divided into various group and the safe concentration herbal drugs were given from 5–7 dpf. The groups were as follow: a) Control, b) VPA (75µM), c) VPA + W.S. 3µg/ml, d) VPA + W.S. 10µg/ml, e) VPA + W.S. 30µg/ml, f) VPA + B.M. 3µg/ml, g) VPA + B.M. 10µg/ml, and h) VPA + B.M. 30µg/ml. The behavioral tests were performed at 7-dpf between 10 am to 2 pm. The behavioral test performed includes open field test, inattentive behavior test and circling behavior test. Please see supplementary data for detailed protocol. 2.12. Statistics: All data are the results of at least three replicate independent experiments. Data are presented as mean ± S.E.M. The statistical significance was calculated using one-way ANOVA followed by Dunnett’s post hoc test in GraphPad Prism® 8.0 software. P-value of < 0.05 was considered to be statistically significant. 3. RESULTS 3.1 Characterization of neurospheres: An early sign of free floating neurospheres was observed at DIV2 (Fig. 1 A) as reported in previous study by Huang et al. (Huang & Schneider, 2004 ) The free floating neurosphere were observed to reach maximum proliferation size by DIV10 (Fig. 1 B). The cells here after shows constant sphere size with increased cell death identified by black spots in the centre of neurosphere (Fig. 1 C). This cell death is a result of nutrient deficiency due to compact density of cells, thus, the cells require passaging after every 7–10 DIV. The neurospheres can be maintained for up to 8 weeks in an undifferentiated state, if passaged every 7–10 days under suitable proliferation condition(Huang & Schneider, 2004 ), which in our hand has been maintained for 4–6 weeks to the maximum. The images after first passage of neurospheres has been presented in Fig. 1 D. The neurospheres when dissociated and plated as single cell suspension, under suitable conditions were able to differentiate into different neuronal cells further (Fig. 1 E). However, we observed the poor dissociation of neurospheres into single cells suspension with increasing passage number. The neurospheres starts dissociating into small bunch of cells after 1–2 passage, thus we suggest the use of these cells within 2 passages. Immunofluorescence staining of parent and progeny neurospheres showed marked nestin-positive staining (Fig. 2 A) representing neural stem/progenitor cells, and the absence of cells positive for mature cell markers which includes β-3 tubulin (Fig. 2 B), GFAP (Fig. 2 C) and CNPase (Fig. 2 D). 3.2 Effect of VPA on neurosphere size: The images were captured on 1st, 4th and 7th day of treatment and the representative images are presented as Fig. 3 A. In the first generation neurospheres, VPA shows a significant concentration dependent decrease in percentage diameter of neurospheres on 4th and 7th day of treatment when compared to control (Fig. 3 B). Furthermore, the complete dissociation of neurospheres was observed with VPA treatment in a concentration and time dependent manner. A significantly high dissociation of neurosphere was observed with 1mM and 2mM VPA treatment (Fig. 3 C). The sensitivity of VPA treatment decreases with passaging of neurospheres (Please see figure S1 ), thus we recommend the use of first generation neurospheres for VPA induced neurodevelopmental toxicity study. 3.3 Effect of VPA on Cell Viability: LDH release is presented as percentage cytotoxicity, assessed at 24 hours intervals from day 1 to day 7 of VPA treatment (0.5mM, 1mM, and 2 mM). Chronic (7 days) VPA treatment up to 2mM shows marginal cytotoxicity (3 to 9%) in neurospheres. The cytotoxicity observed fails to reach significance level. To confirm the results, we have also investigated the effect of VPA on primary neuronal culture using MTT cell viability assay and found no significant difference between the control and VPA treatment (data not shown). Thus, cytotoxicity may not be a suitable parameter for screening molecules against VPA in neurosphere culture. 3.4 Effect of VPA on the expression of high risk genes for autism: The gene expression was studied for three strong candidate autism associated genes (NRXN 1, NGLN 3 and SHANK 3). VPA treatment for 4 days results in a significant reduction in gene expression level of NRXN 1 and SHANK 3 as compared to matched control neurospheres (Fig. 3 A). However, a decrease in gene expression level with VPA treatment was not always concentration dependent with 4 days treatment. In 7 days treated neurospheres, VPA at 1mM and 2mM leads to significant reduction in gene expression level of NRXN 1, NGLN 3 and SHANK 3. However, 0.5mM of VPA shows a significant down regulation in gene expression level of NGLN 3 and SHANK 3 (Fig. 3 B). Since similar changes in these genes have been previously reported in multiple models of ASD including our zebrafish approach towards modeling autism(Dwivedi et al., 2019a ), this data serves to increase our confidence for the use of neurospheres for preliminary screening of candidate molecules for VPA induced developmental toxicity. 3.5 Effect of VPA on NSCs differentiation potential: Free floating neurospheres generated from NSCs were plated one neurosphere/well on polyethyleneimine pre-coated coverslips. Cells possess differential ability and develops into neuronal cells with stellate morphology when allowed to grow in differentiation medium (DMEM/F12 + 10% FBS + 2% B-27 supplement + 1% antibiotic solution) for 7 days. However, the immunostaining of differentiated cells suggests an abundance of GFAP protein with expression of β-3 tubulin and little expression of CNPase. Thus, further studies were performed in GFAP and β-3 tubulin labelled cells. Chronic exposure of VPA for 7 days affects the differentiation of neuronal cells in a concentration dependent manner. VPA exposure of 0.5mM shows significant reduction in β-3 Tubulin expression with no significant effect on the GFAP. However, neurospheres exposed to 1mM and 2mM of VPA lead to a decrease in neurite outgrowth with reduced expression of GFAP (Fig. 6 A and 6 B) and β-3 Tubulin (Fig. 6 C and 6 D) suggesting compromised overall growth of differentiated neuronal cells. 3.6 Effect of herbal drugs on VPA induced defects in neurosphere and zebrafish model: Neurosphere proliferation : Based on the previous experiments VPA 1mM and 2mM concentration were used in further studies. Neurospheres, when treated with VPA (1mM and 2mM) for 4 days, shows a significant reduction in percentage diameter and an increase in percentage frequency of complete dissociation of neurospheres as compared to control. W.S. and B.M. shows a concentration dependent rescue against VPA induced impairment in proliferation of neurospheres, measured by diameter and dissociation. W.S. and B.M. (1µg/ml and 10µg/ml) shows a significant improvement in neurosphere diameter against VPA (1mM and 2mM). However, 0.1µg/ml concentration of W.S. and B.M. ameliorates neurosphere diameter against VPA 1mM and 2mM respectively (Fig. 5 A and 5 B). W.S. and B.M. protect VPA induced neurospheres dissociation in a concentration dependent manner. The significant effect of W.S. and B.M. was observed at 10µg/ml against VPA 1mM (Fig. 5 C). In VPA 2mM treated neurosphere, W.S. shows significant rescue at 1µg/ml and 10µg/ml, whereas B.M. was able to significantly rescue dissociation of neurosphere at all tested concentration (Fig. 5 D). Neurosphere differentiation : The neurospheres were allowed to differentiate for 7 days in differentiation media before the experiment. Chronic 7 days VPA (1mM) treatment in neurospheres leads to defect in differentiation pattern of neural stem cells. The defected differentiation pattern can be visibly observed by decreased percent of GFAP and β-3 tubulin positive cells in comparison to control neurospheres. The differentiated cells also present a compromised neurite outgrowth. However, W.S. and B.M. at 10µg/ml concentration recuperates the VPA induced damage to neurosphere differentiation, evident by the recovery of percentage GFAP and β-3 tubulin labelled cells (Fig. 7 E, 7 F, 7 G and 7 H). Moreover, increased neurite outgrowth and neuronal connectivity was also observed with W.S. and B.M. co-treatment against VPA. However, quantification of neurite outgrowth was challenging and not accounted due to dense population of neuronal cells in control and 0.5mM VPA treated groups. Confirming in vitro results with in vivo zebrafish larvae model : Since, W.S. and B.M. rescue VPA induced neurodevelopmental toxicity in neurosphere culture, we have investigated whether the results from these preliminary screening can connect with in vivo (zebrafish larvae model) data. However, the VPA induced zebrafish larvae model(Dwivedi et al., 2019a ) has been incorporated for additional validation and is not in the scope of this study, thus methods for zebrafish larvae model has been provided in supplementary data. Chronic VPA treatment (75µM) in the embryonic stage in zebrafish leads to autism like behavioural assessed by increased anxiety, inattentive behaviour and circling behaviour. The herbal drugs, W.S. and B.M. ameliorates VPA induced behavioural despairs in a concentration dependent manner as presented in Fig. 7 I, 7 J and 7 K. The results all together indicates that neurosphere model can be an approach in preliminary screening for neurodevelopmental toxicity and autism. However, further exploration and validation of associated neurodevelopmental toxicity and rescue with multiple drugs is advised. 4. DISCUSSION In the present study, we report a novel and economical approach to study developmental neurotoxicity of VPA in neurosphere model, intending to develop a high throughput screening model. To the best of our knowledge, this study is the first attempt in characterizing the effects of VPA on embryonically derived cortical neurospheres and its practicality towards developing a developmental neurotoxicity screening tool. The advantages such as imitating features of brain development, reduced animal number (one or two), large sample size and a simple assay for screening make this approach choice for preliminary screening of novel molecules. Although, patient derived induced pluripotent stem cells (iPSCs) have shown successful disease modelling phenotypically and hence help drug discovery based on precise phenotypic changes. The use of iPSCs in neuronal drug discovery is recognised but a very limited number of target genes are known with respect to ASD. The iPSCs advocates to be a better model system in case of personalized therapy, where the phenotypic changes depend on the source (individual) of sample collection. Thus, specific phenotypic modifications and their rescue can be studied efficiently (Farkhondeh et al., 2019 ). On the other hand, neurosphere cell culture provides a 3D approach which has been explored extensively to study neurological disorders. The advantages such as easy modulation with alteration in cellular niche, wide range of associated pathways and reduction in animals used make it a suitable model for medium to high throughput screening (da Silva Siqueira et al., 2021 ). As reported, VPA when consumed during pregnancy, potentially hinder the normal brain development and induce autism(Fukuchi et al., 2009 ). The effective concentration of VPA in plasma level for the treatment of epilepsy is 50–100 µg/ml (0.3–0.6 mM), whereas, the foetal plasma level of VPA is around 0.39–2.76 mM i.e. 1.3–4.6 times higher than the maternal plasma level(Iijima et al., 2016 ). Thus, in the present study, NSCs were exposed to VPA concentrations that are relevant to human exposure especially, foetal plasma level. Cell proliferation, migration, differentiation, synaptogenesis and apoptosis are coordinated steps in brain development, thus, in this study, neurospheres were observed based on cytotoxicity, proliferation, gene expression and differentiation studies. Cell proliferation is one of the key events during embryonic development, which was investigated using neurospheres size. We and others have observed that VPA not only inhibited proliferation of neurospheres but also led to dissociation of neurospheres in a concentration and time dependent manner(Jung et al., 2008 ; Toxicol et al., 2015 ; Zhou et al., 2011 ). For example, Xiaopu et al. suggested a gradual increase in cells moving out of spheres (rat hippocampal NSCs) with an increase in VPA concentration and time, thus leading to decreased neurosphere size. The research results also suggested increased differentiation along with increased number of neuritis branches with longer neuritis in nerve cells as the VPA concentration was increased(Cui et al., 2017 ) which was not observed in our study. This may be due to the anti-adherent flask used in our experiments for neurosphere culture. In spite of cytotoxicity being a simplest and widely accepted parameter for high throughput screening(Rohman & Wingfield, 2016 ), it is not thought to be a predictor for developmental neurotoxicity. In contrast, the specificity of developmental neurotoxicity is assumed when there is no cytotoxicity(Crofton et al., 2011 ). The cytotoxicity data in this study was in line with previous studies suggesting little or no cytotoxicity with VPA treatment. Hill et al . reported 23mM ± 0.004mM as IC 50 value for VPA(Hill et al., 2008) and Zhou et al. suggested a 9.6 ± 4.2% reduction (statistically insignificant) in cell viability with 1mM VPA treatment after 48 hours(Zhou et al., 2011 ). Therefore, we concluded that VPA did not cause significant cytotoxicity at the environmentally perceived concentrations. To validate if in vitro VPA treatment in neurospheres led to alteration in marker genes for autism, we selected 3 potential genes (SHANK 3, NRXN 1 and NGLN 3) which were reported to display altered expression in autism ( https://sfari.org/resources/sfari-gene ). NRXN 1, NLGN 3 and SHANK 3 were the synaptic proteins and were found to be involved in synapse formation(Dwivedi et al., 2019a ). Moreover, alteration in these genes has been identified in our previous article on VPA induced zebrafish larvae model for autism(Dwivedi et al., 2019a ). HDAC inhibition played a critical role in VPA induced congenital disabilities(Fukuchi et al., 2009 ; Phiel et al., 2001 ). Prenatal HDAC inhibition delayed neuronal maturation by alterations in the expression of NRXN, NLGN and SHANK 3(Kawanai et al., 2016 ). Thus, our observations were in alignment with the previous reports suggesting that VPA led to down regulation of the mentioned synaptic genes which were also considered as high-risk genes for autism. However, further exploration of other high confidence genes for autism is needed to endorse the use of VPA treated neurospheres for screening candidate molecules for autism. Ample of in vitro and in vivo studies suggested that VPA boosted up the differentiation of neuronal cells with prominent neurite outgrowth(Cho et al., 2013 ; Long et al., 2015 ). Furthermore, VPA treatment was suggested to increase GFAP expression in rodent model of autism, describing the event as a pathological increase in GFAP level with prenatal VPA treatment(Choi et al., 2018 ; Gottfried et al., 2013 ). In contrast to the above claims, under our experimental conditions, chronic VPA treatment restricted the adherence and differentiation potential of neurospheres which signals towards the role of VPA in poor neurogenesis at early brain development. The mechanisms behind these findings are unknown and requires further exploration. Autism being a multifactorial disorder, only symptomatic treatments are available with limited knowledge on molecular aspects of disease(DeFilippis & Wagner, 2010 ). Thus, to validate the neurosphere model system for drug screening, we have tested two known neuroprotective herbal drugs W.S. and B.M. against VPA induced neurodevelopmental toxicity. Literature suggests that B.M. rescue behavioral and histopathological symptoms against VPA induced rodent model of autism via oxidative stress and serotonin profile(Sandhya et al., 2012 ). B.M. is also reported to alleviate clinical symptoms of autism and related disorders(Aguiar & Borowski, 2013 ; J. Kean et al., 2017 ; J. D. Kean et al., 2015 ). Although, there are no direct clinical evidence for the use of W.S. in autism, it has been reported to have substantial therapeutic role in CNS related disorders like Alzheimer’s, Parkinson’s, anxiety, depression etc(Gupta & Kaur, 2016 ; Vandita Singh, Hakikulla H. Shah, 2017). The scientific evidence suggests anti-inflammatory and anti-oxidative effect of W.S. in CNS related disease models. The overlap of symptoms with autism encouraged us to screen W.S. in our model. In our experiment W.S. and B.M. rescued VPA induced defects in the neurosphere model in terms of proliferation and differentiation. Moreover, this model has ability to distinguish between efficacy of test drugs as observed between B.M and W.S. The in vitro protective effect of these herbal drugs against VPA was verified in already published zebrafish larvae model(Dwivedi et al., 2019a ) which indicates the translational value of neurosphere model. Thus, we advocate that neurosphere model could be an approach for preliminary screening against neurodevelopmental toxicity. However, the findings are preliminary and warrants further exploration. 5. CONCLUSIONS The data from our study suggested that VPA at the concentration present in the environment did not lead to cell death but may have a strong impact on proliferation and differentiation of neurospheres/NSCs with decrease in gene expression of autism high risk genes. However, there is every need to explore the expression level of other high risk genes and proteins for autism in VPA treated neurospheres. Since there were only symptomatic treatments available for autism and no standard drug act on the pathophysiology of autism, thus, we were unable to explore the effect of standard drugs on VPA induced neurodevelopmental toxicity in neurospheres. Nevertheless, we tested herbal drugs known for neuroprotective action and these drugs rescued VPA induced defects in neurospheres proliferation and differentiation. Altogether, we conclude that chronic VPA 1mM treatment in neurospheres could induce neurodevelopmental toxicity. We recommend using 1st generation neurospheres, with VPA induction of 4 days for proliferation and 7 days for differentiation studies. The candidate molecules could be co-treated for preliminary screening against VPA induced neurodevelopmental toxicity. Nevertheless, the model demands validating the other extensive features of neurodevelopmental toxicity. Furthermore, our neurosphere model could be an approach to study the other marker genes and proteins in neurodevelopmental disorders including autism. Declarations Conflict of interest statement: The authors have no conflict of interest (commercial or otherwise) to disclose. Funding & acknowledgements Authors are grateful to Birla Institute of Technology and Science (BITS)–Pilani,Hyderabad Campus (India) for infrastructural facilities and research resources. This work was supported by internal funding from the institution. Authors are thankful to Indian Council of Medical Education and Research (ICMR) for supporting lead author with Senior Research Fellowship. Author Contribution SD: performed the experiments and wrote the manuscriptAD: Helped in experiments and imaging of neurospheresSG: Helped in experiments and imaging of neurospheresRM: Helped with Zebrafish experiments and editing the manuscriptPK: Zebrafish Resources and Guidance YP: Lab resources and overall supervision Acknowledgement Authors are grateful to Birla Institute of Technology and Science (BITS)–Pilani,Hyderabad Campus (India) for infrastructural facilities and research resources. This work was supported by internal funding from the institution. Authors are thankful to Indian Council of Medical Education and Research (ICMR) for supporting lead author with Senior Research Fellowship. References Aguiar, S., & Borowski, T. (2013). Neuropharmacological Review of the Nootropic Herb Bacopa monnieri . 16 (4). https://doi.org/10.1089/rej.2013.1431 Azari, H., & Reynolds, B. A. (2016). In Vitro Models for Neurogenesis . Cho, K. S., Kwon, K. J., Choi, C. S., Jeon, S. J., Kim, K. C., Park, J. H., Ko, H. M., Lee, S. H., Cheong, J. H., Ryu, J. H., Han, S. H., & Shin, C. Y. (2013). Valproic Acid Induces Astrocyte-Dependent Neurite Outgrowth from Cultured Rat Primary Cortical Neuron Via Modulation of tPA / PAI-1 Activity . https://doi.org/10.1002/glia.22463 Choi, J., Lee, S., Won, J., Jin, Y., Hong, Y., Hur, T., Kim, J., Lee, S., & Hong, Y. (2018). Pathophysiological and neurobehavioral characteristics of a propionic acid-mediated autism-like rat model . 1–17. Chomiak, T., Turner, N., & Hu, B. (2013). What we have learned about autism spectrum disorder from valproic acid. Pathology Research International , 2013 . https://doi.org/10.1155/2013/712758 Crofton, K. M., Mundy, W. R., Lein, P. J., Bal-Price, A., Coecke, S., Seiler, A. E. M., Knaut, H., Buzanska, L., & Goldberg, A. (2011). Developmental neurotoxicity testing: Recommendations for developing alternative methods for the screening and prioritization of chemicals. Altex , 28 (1), 9–15. https://doi.org/10.14573/altex.2011.1.009 Cui, X., Hong, S., Huang, D., Hu, Y., Wu, P., & Jiang, L. (2017). Effects of valproic acid on the differentiation of endogenous neural stem cells of the hippocampus in rats . 10 (3), 4732–4739. da Silva Siqueira, L., Majolo, F., da Silva, A. P. B., da Costa, J. C., & Marinowic, D. R. (2021). Neurospheres: a potential in vitro model for the study of central nervous system disorders. In Molecular Biology Reports (Vol. 48, Issue 4, pp. 3649–3663). Springer Science and Business Media B.V. https://doi.org/10.1007/s11033-021-06301-4 DeFilippis, M., & Wagner, K. D. (2010). Treatment of Autism Spectrum Disorder in Children and Adolescents. Journal of Autism and Developmental Disorders , 40 (1), 18–41. https://doi.org/10.1007/s10803-009-0834-0 Differentiating human NT2 D1 neurospheres as a versatile in vitro 3 D model system for developmental toxicity.pdf . (n.d.). Dwivedi, S., Medishetti, R., Rani, R., Sevilimedu, A., Kulkarni, P., & Yogeeswari, P. (2019a). Larval zebrafish model for studying the effects of valproic acid on neurodevelopment: An approach towards modeling autism. Journal of Pharmacological and Toxicological Methods , 95 (November 2018), 56–65. https://doi.org/10.1016/j.vascn.2018.11.006 Dwivedi, S., Medishetti, R., Rani, R., Sevilimedu, A., Kulkarni, P., & Yogeeswari, P. (2019b). Larval zebrafish model for studying the effects of valproic acid on neurodevelopment: An approach towards modeling autism. Journal of Pharmacological and Toxicological Methods , 95 (April 2018), 56–65. https://doi.org/10.1016/j.vascn.2018.11.006 Farkhondeh, A., Li, R., Gorshkov, K., Chen, K. G., Might, M., Rodems, S., Lo, D. C., & Zheng, W. (2019). Induced pluripotent stem cells for neural drug discovery. In Drug Discovery Today (Vol. 24, Issue 4, pp. 992–999). Elsevier Ltd. https://doi.org/10.1016/j.drudis.2019.01.007 Fritsche, E., Cline, J. E., Nguyen, N., Scanlan, T. S., & Abel, J. (2005). Polychlorinated Biphenyls Disturb Differentiation of Normal Human Neural Progenitor Cells : Clue for Involvement of Thyroid Hormone Receptors . 113 (7), 871–876. https://doi.org/10.1289/ehp.7793 Fukuchi, M., Nii, T., Ishimaru, N., Minamino, A., Hara, D., Takasaki, I., Tabuchi, A., & Tsuda, M. (2009). Valproic acid induces up- or down-regulation of gene expression responsible for the neuronal excitation and inhibition in rat cortical neurons through its epigenetic actions. Neuroscience Research , 65 (1), 35–43. https://doi.org/10.1016/j.neures.2009.05.002 Gottfried, C., Bambini-junior, V., Baronio, D., Zanatta, G., Silvestrin, R. B., & Vaccaro, T. (2013). Valproic Acid in Autism Spectrum Disorder : From an Environmental Risk Factor to a Reliable Animal Model. Recent Advances in Autism Spectrum Disorders - Volume I , 143–163. https://doi.org/43452 Gottron, F. J., & Choi, D. W. (2000). Assessment of Cell Viability in Primary Neuronal Cultures . 1–17. Gupta, M., & Kaur, G. (2016). Aqueous extract from the Withania somnifera leaves as a potential anti- neuroinflammatory agent : a mechanistic study. Journal of Neuroinflammation , 1–17. https://doi.org/10.1186/s12974-016-0650-3 Hill, E. J., Nagel, D. A., O’Neil, J. D., Torr, E., Woehrling, E. K., Devitt, A., & Coleman, M. D. (2013). Effects of Lithium and Valproic Acid on Gene Expression and Phenotypic Markers in an NT2 Neurosphere Model of Neural Development. PLoS ONE , 8 (3). https://doi.org/10.1371/journal.pone.0058822 Huang, F., & Schneider, J. S. (2004). Effects of Lead Exposure on Proliferation and Differentiation of Neural Stem Cells Derived from Different Regions of Embryonic Rat Brain . 25 , 1001–1012. https://doi.org/10.1016/j.neuro.2004.03.010 Iijima, Y., Behr, K., Iijima, T., Biemans, B., & Bischofberger, J. (2016). Distinct Defects in Synaptic Differentiation of Neocortical Neurons in Response to Prenatal Valproate Exposure. Nature Publishing Group , June , 1–14. https://doi.org/10.1038/srep27400 Ingram JL1, Peckham SM, Tisdale B, Rodier PM., C. S. (2000). Prenatal exposure of rats to valproic acid reproduces the cerebellar anomalies associated with autism. Neurotoxicology and Teratology , 22 (3), 213–224. https://doi.org/10.1016/S0892-0362(99)00083-5 Jensen, J. B., & Parmar, M. (2006). . 34 (3), 153–161. https://doi.org/10.1385/MN:34:3:153 Johannessen, C. U., & Johannessen, S. I. (2003). Valproate : Past , Present , and Future Mechanisms of Action . 9 (2), 199–216. Jung, G. A., Yoon, J. Y., Moon, B. S., Yang, D. H., Kim, H. Y., Lee, S. H., Bryja, V., Arenas, E., & Choi, K. Y. (2008). Valproic acid induces differentiation and inhibition of proliferation in neural progenitor cells via the beta-catenin-Ras-ERK- p21 Cip/WAF1 pathway. BMC Cell Biology , 9 , 1–12. https://doi.org/10.1186/1471-2121-9-66 Kawanai, T., Ago, Y., Watanabe, R., Inoue, A., Taruta, A., Onaka, Y., Hasebe, S., Hashimoto, H., Matsuda, T., & Takuma, K. (2016). Prenatal Exposure to Histone Deacetylase Inhibitors Affects Gene Expression of Autism-Related Molecules and Delays Neuronal Maturation. Neurochemical Research , 41 (10), 2574–2584. https://doi.org/10.1007/s11064-016-1969-y Kean, J. D., Kaufman, J., Lomas, J., Goh, A., White, D., Simpson, D., Scholey, A., Singh, H., Sarris, J., Zangara, A., & Stough, C. (2015). A Randomized Controlled Trial Investigating the Effects of a Special Extract of Bacopa monnieri ( CDRI 08 ) on Hyperactivity and Inattention in Male Children and Adolescents : BACHI Study Protocol ( ANZCTRN12612000827831 ) . Cdri 08 , 9931–9945. https://doi.org/10.3390/nu7125507 Kean, J., Downey, L., & Stough, C. (2017). Systematic Overview of Bacopa monnieri (L.) Wettst. Dominant Poly-Herbal Formulas in Children and Adolescents. Medicines , 4 (4), 86. https://doi.org/10.3390/medicines4040086 Long, Z.-M., Zhao, L., Jiang, R., Wang, K.-J., Luo, S.-F., Zheng, M., Li, X.-F., & He, G.-Q. (2015). Valproic Acid Modifies Synaptic Structure and Accelerates Neurite Outgrowth Via the Glycogen Synthase Kinase-3β Signaling Pathway in an Alzheimer’s Disease Model. CNS Neuroscience & Therapeutics , 21 (11), 887–897. https://doi.org/10.1111/cns.12445 Markram, K., Rinaldi, T., Mendola, D. La, Sandi, C., & Markram, H. (2008). Abnormal fear conditioning and amygdala processing in an animal model of autism. Neuropsychopharmacology , 33 (4), 901–912. https://doi.org/10.1038/sj.npp.1301453 Moors, M., Rockel, T. D., Abel, J., Cline, J. E., Gassmann, K., Schreiber, T., Schuwald, J., Weinmann, N., & Fritsche, E. (2009). Human Neurospheres as Three-Dimensional Cellular Systems for Developmental Neurotoxicity Testing . 117 (7), 1131–1138. https://doi.org/10.1289/ehp.0800207 Nicolini, C., & Fahnestock, M. (2018). The valproic acid-induced rodent model of autism. Experimental Neurology , 299 , 217–227. https://doi.org/10.1016/j.expneurol.2017.04.017 Phiel, C. J., Zhang, F., Huang, E. Y., Guenther, M. G., Lazar, M. A., & Klein, P. S. (2001). Histone Deacetylase is a Direct Target of Valproic Acid, a Potent Anticonvulsant, Mood Stabilizer, and Teratogen. Journal of Biological Chemistry , 276 (39), 36734–36741. https://doi.org/10.1074/jbc.M101287200 Rodier, P. M., Ingram, J. L., Tisdale, B., & Croog, V. J. (1997). Linking etiologies in humans and animal models: Studies of autism. Reproductive Toxicology , 11 (2–3), 417–422. https://doi.org/10.1016/S0890-6238(97)80001-U Rohman, M., & Wingfield, J. (2016). Chapter 3 within Drug Discovery. New York , 1439 , 47–63. https://doi.org/10.1007/978-1-4939-3673-1 Roullet, F. I., Lai, J. K. Y., & Foster, J. A. (2013). In utero exposure to valproic acid and autism - A current review of clinical and animal studies. Neurotoxicology and Teratology , 36 , 47–56. https://doi.org/10.1016/j.ntt.2013.01.004 Roullet, F. I., Wollaston, L., deCatanzaro, D., & Foster, J. A. (2010). Behavioral and molecular changes in the mouse in response to prenatal exposure to the anti-epileptic drug valproic acid. Neuroscience . https://doi.org/10.1016/j.neuroscience.2010.06.069 Sandhya, T., Sowjanya, J., & Veeresh, B. (2012). Bacopa monniera (L.) Wettst ameliorates behavioral alterations and oxidative markers in sodium valproate induced autism in rats. Neurochemical Research , 37 (5), 1121–1131. https://doi.org/10.1007/s11064-012-0717-1 Servadio, M., Melancia, F., Manduca, A., Di Masi, A., Schiavi, S., Cartocci, V., Pallottini, V., Campolongo, P., Ascenzi, P., & Trezza, V. (2016). Targeting anandamide metabolism rescues core and associated autistic-like symptoms in rats prenatally exposed to valproic acid. Translational Psychiatry , 6 (9), 1–11. https://doi.org/10.1038/tp.2016.182 Toxicol, A., Baumann, J., Gassmann, K., Masjosthusmann, S., Deboer, D., Bendt, F., Giersiefer, S., & Fritsche, E. (2015). Comparative human and rat neurospheres reveal species differences in chemical effects on neurodevelopmental key events. Archives of Toxicology . https://doi.org/10.1007/s00204-015-1568-8 Vandita Singh, Hakikulla H. Shah, G. J. G. (2017). Neuroprotective Effect of Ashwagandha (roots of Withania somnifera): The Rejuvenator. The Canadian Journal of Clinical Nutrition , 5 (2), 34–51. https://doi.org/10.14206/canad.j.clin.nutr.2017.02.04 Varghese, M., Keshav, N., Descombes, S. J., Warda, T., Wicinski, B., Dickstein, D. L., Nicolas, H. H., Rubeis, S. De, Drapeau, E., Buxbaum, J. D., Hof, P. R., & Knock-in, K. I. (2017). Autism spectrum disorder : neuropathology and animal models. Acta Neuropathologica , 134 (4), 537–566. https://doi.org/10.1007/s00401-017-1736-4 Wagner, G. C., Reuhl, K. R., Cheh, M., McRae, P., & Halladay, A. K. (2006). A new neurobehavioral model of autism in mice: Pre- and postnatal exposure to sodium valproate. Journal of Autism and Developmental Disorders , 36 (6), 779–793. https://doi.org/10.1007/s10803-006-0117-y Walker, J. M. (n.d.). In Vitro Neurotoxicology . Xiong, F., Gao, H., Zhen, Y., Chen, X., Lin, W., Shen, J., Yan, Y., Wang, X., Liu, M., & Gao, Y. (2011). Optimal time for passaging neurospheres based on primary neural stem cell cultures. Cytotechnology , 63 (6), 621–631. https://doi.org/10.1007/s10616-011-9379-0 Zhou, Q., Dalgard, C. L., Wynder, C., & Doughty, M. L. (2011). Neuroscience Letters Valproic acid inhibits neurosphere formation by adult subventricular cells by a lithium-sensitive mechanism. Neuroscience Letters , 500 (3), 202–206. https://doi.org/10.1016/j.neulet.2011.06.037 Additional Declarations No competing interests reported. Supplementary Files Supplementarydata.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6809301","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":482967345,"identity":"b2e8b94f-6b9d-4e71-935d-98c7ffdeef5a","order_by":0,"name":"Shubham Dwivedi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLElEQVRIie2RPUvDQBiA3xKISz7WC4XmL1wJVAcxfyVHIF0ScKqLSIpwU+mcgv4Hp5IxUjDL0fkggwkBp1acRAc/+hHEmhQdHe4Zjnu5e3i/AASCf4gZgSxtbkkrBJBRBxLn27tTVzD/oVi/K+hLWR8ykDBp+LajtEe98vR8Chp3KXoaHPXHaZBIanxsw8EshyKu93LFDq3oLgODE2pEcxRM2KMjqcwjoeJhIKyehvu9tiJngDNyaakUBTfcx5JKZ6vyfABC9yjvlfJGUR9vlQ8b9MV+RaUbZVi2KHIqZTVA1JwFc+/MUseZYtwXw2I0R90JW+Dba+YSih5w0qCYkTstleeso7E0T14GF6aW+t18GZ/Yuu4WxWtDYRXKTrRdK1TL+htrRSAQCAQVn11FccyUpaHtAAAAAElFTkSuQmCC","orcid":"","institution":"University of Petroleum and Energy Studies","correspondingAuthor":true,"prefix":"","firstName":"Shubham","middleName":"","lastName":"Dwivedi","suffix":""},{"id":482967346,"identity":"b75d5360-5718-4558-8829-b927987cde60","order_by":1,"name":"Apurva Dusane","email":"","orcid":"","institution":"Birla Institute of Technology \u0026 Science-Pilani","correspondingAuthor":false,"prefix":"","firstName":"Apurva","middleName":"","lastName":"Dusane","suffix":""},{"id":482967347,"identity":"25891cf1-01f8-4b21-98e2-cfb4c027e1ce","order_by":2,"name":"Sriharshini Goli","email":"","orcid":"","institution":"Birla Institute of Technology \u0026 Science-Pilani","correspondingAuthor":false,"prefix":"","firstName":"Sriharshini","middleName":"","lastName":"Goli","suffix":""},{"id":482967348,"identity":"74f8b78f-4521-4f80-ae40-e40116faa24d","order_by":3,"name":"Raghavender Medishetti","email":"","orcid":"","institution":"Dr. Reddy's Institute of Life Sciences","correspondingAuthor":false,"prefix":"","firstName":"Raghavender","middleName":"","lastName":"Medishetti","suffix":""},{"id":482967349,"identity":"fcad7c48-163a-4fcb-b3ca-036c1d4a58bd","order_by":4,"name":"Pushkar Kulkarni","email":"","orcid":"","institution":"Dr. Reddy's Laboratories (India)","correspondingAuthor":false,"prefix":"","firstName":"Pushkar","middleName":"","lastName":"Kulkarni","suffix":""},{"id":482967350,"identity":"fa623e6c-cb2e-424b-a29f-de72518c098d","order_by":5,"name":"Yogeeswari Perumal","email":"","orcid":"","institution":"Birla Institute of Technology \u0026 Science-Pilani","correspondingAuthor":false,"prefix":"","firstName":"Yogeeswari","middleName":"","lastName":"Perumal","suffix":""}],"badges":[],"createdAt":"2025-06-03 09:08:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6809301/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6809301/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86385796,"identity":"5b96e69f-be2c-42ac-8ffe-7bba033490b4","added_by":"auto","created_at":"2025-07-10 05:45:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5026281,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of free floating neurospheres. A)\u003c/strong\u003e Neural progenitor cells at DIV2, \u003cstrong\u003eB)\u003c/strong\u003e Free floating neurospheres at DIV10 \u003cstrong\u003eC)\u003c/strong\u003e Neurosphere representing dead and compact cells. \u003cstrong\u003eD)\u003c/strong\u003e\u0026nbsp; Free floating neurospheres after 1\u003csup\u003est\u003c/sup\u003e passage \u003cstrong\u003eE)\u003c/strong\u003e Differentiated neuronal cells (7\u003csup\u003eth\u003c/sup\u003e day) seeded from DIV10 neurospheres. Images were captured using Leica microscope. Magnification: 20X, scale bar-100 µm.\u003c/p\u003e","description":"","filename":"DwivediFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/1b1083017486c3c719663566.png"},{"id":86385794,"identity":"5a4c868f-e770-4f8f-bd58-6b8245b91e2d","added_by":"auto","created_at":"2025-07-10 05:45:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1125084,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of free-floating neurosphere (DIV10) fixed with 4% formalin. Dual staining of neurosphere showed cells with DAPI-positive nuclei (blue) and were also positive for the NSC-specific marker, nestin (red). However cells in neurospheres were found to be negative (no stain) for differentiated neuronal cell types i.e. β-3 Tubulin (for neurons), GFAP ( for glial cells and astrocytes) and CNPase (for oligodendriocytes). Images were captured using Leica confocal microscope. Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"DwivediFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/7597bd45b6ee2a8888bd6b1e.png"},{"id":86386700,"identity":"985ca65a-094d-497e-a0fb-5c64cf57ad71","added_by":"auto","created_at":"2025-07-10 06:01:50","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6500057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of VPA on neurosphere size. A)\u003c/strong\u003e Representative images of the neurosphere at a different time point, treated with VPA (0.5mM, 1mM and 2mM) on DIV3. The treatment was given for 7 days and images were captured on 1\u003csup\u003est\u003c/sup\u003e, 4\u003csup\u003eth\u003c/sup\u003e,\u003csup\u003e \u003c/sup\u003eand 7\u003csup\u003eth\u003c/sup\u003e day of treatment.\u0026nbsp; Magnification: 20X, scale bar-100 µm. \u003cstrong\u003eB)\u003c/strong\u003e Representative graph of percentage neurosphere diameter with concentration and time. \u003cstrong\u003eC)\u003c/strong\u003e Representative graph of percentage frequency of completely dissociated neurospheres with concentration and time. The results are expressed as mean ± SEM, p\u0026lt;0.05 was considered significant, where ns is non-significant, **p\u0026lt;0.01, ***p\u0026lt;0.001 and ****p\u0026lt;0.0001 as compared to control group.\u003c/p\u003e","description":"","filename":"DwivediFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/2c0c0c88002232b4d850ee36.png"},{"id":86385795,"identity":"3bc0d7e5-a40d-4725-be8a-08951a0439ad","added_by":"auto","created_at":"2025-07-10 05:45:50","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":175842,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of VPA on NSCs survival. \u003c/strong\u003eLDH release assay\u003cstrong\u003e \u003c/strong\u003eshows a marginal cell death in free floating neurosphere culture when exposed to chronic\u003cstrong\u003e \u003c/strong\u003eVPA treatment (up to 2 mM).\u003cstrong\u003e \u003c/strong\u003eThe data presented are the results of three replicate independent experiments (n=6 each) and are presented as mean ± SEM of percentage cytotoxicity. p\u0026lt;0.05 was considered significant. The control and VPA treated samples were statistically compared after every 24 hours interval.\u003c/p\u003e","description":"","filename":"DwivediFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/8ff54edccfc9ef2b8f89200f.png"},{"id":86386371,"identity":"76fad0bd-d4e1-4e01-9842-42ece0875271","added_by":"auto","created_at":"2025-07-10 05:53:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":833775,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression level of high-risk genes (NRXN 1, NGLN 3 and SHANK 3) for autism from 2 replication of study (n = 3) on 4\u003csup\u003eth\u003c/sup\u003e day of VPA treatment \u003cstrong\u003e(A)\u003c/strong\u003e and 7\u003csup\u003eth\u003c/sup\u003e day of VPA treatment \u003cstrong\u003e(B)\u003c/strong\u003e. Data is reported as mean ± S.E.M., p\u0026lt;0.05 was considered significant, where ns is nonsignificant *p\u0026lt;0.05 **p\u0026lt;0.01 and ***p\u0026lt;0.001 as compared to control group.\u003c/p\u003e","description":"","filename":"DwivediFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/5bfc9f3890809da00dc8731a.png"},{"id":86385813,"identity":"78651606-db4d-45fb-afff-0f7862cd8438","added_by":"auto","created_at":"2025-07-10 05:45:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4362145,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRepresentative images of differentiated neurospheres: \u003c/strong\u003eDifferentiation pattern of free floating neurospheres. The cells were allowed to grow for 7 days. These cells possess differential ability and develop into neuronal cells. The cells were fixed with 4% formalin and were labelled using the antibody against GFAP and β-3 tubulin (red) along with a nuclear dye DAPI (blue). Images represent \u003cstrong\u003eA)\u003c/strong\u003e bright field, DAPI, GFAP labelled and merged (DAPI + GFAP) images of control cells and different concentration of VPA treated cells, \u003cstrong\u003eB) \u003c/strong\u003egraphical representation of percent GFAP positive neuronal cells. C) bright field, DAPI, β-3 tubulin labelled and merged (DAPI + β-3 tubulin) images of control cells and different concentration of VPA treated cells, \u003cstrong\u003eD)\u003c/strong\u003e graphical representation of percent β-3 tubulin positive neuronal cells. Images were captured using Leica fluorescence microscope. Magnification: 20X, scale bar = 100 µm. Data is reported as mean ± S.E.M., p\u0026lt;0.05 was considered significant, where ns is nonsignificant *p\u0026lt;0.05 **p\u0026lt;0.01 and ****p\u0026lt;0.0001 as compared to control group.\u003c/p\u003e","description":"","filename":"DwivediFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/8eb5bba969927be27479d95e.png"},{"id":86386701,"identity":"45c1f8aa-c1ed-4914-9362-01e34a58c7a5","added_by":"auto","created_at":"2025-07-10 06:01:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":5331360,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of neuroprotective herbal drugs against VPA induced defects in neurosphere and zebrafish model: Neurospheres were co-treated with VPA and herbal drugs on DIV 3. The images were captured on 4\u003csup\u003eth\u003c/sup\u003e day of treatment. Figure A and B represents W.S. and B.M. (0.1µg/ml, 1µg/ml and 10µg/ml) improves diameter (%) of neurosphere against VPA 1mM \u003cstrong\u003e(A)\u003c/strong\u003e and 2mM \u003cstrong\u003e(B)\u003c/strong\u003e. Figure C and D represents W.S. and B.M. (0.1µg/ml, 1µg/ml and 10µg/ml) ameliorates neurosphere dissociation against VPA 1mM \u003cstrong\u003e(C)\u003c/strong\u003e and VPA 2mM \u003cstrong\u003e(D)\u003c/strong\u003e. (n=48 replicates (4 Experiments X 12 wells/experiment)) Figure E, F, G and H represents the effect of neuroprotective herbal drugs against VPA induced alteration in differentiation pattern of neurosphere. Neurospheres were co-treated with VPA 1mM and herbal drugs on DIV 3. The cells from treated neurospheres were allowed to differentiate for 7 days. The cells were fixed with 4% formalin and were labelled using the antibody against GFAP and β-3 tubulin (red) along with a nuclear dye DAPI (blue). \u003cstrong\u003eE)\u003c/strong\u003e Bright field, DAPI, GFAP labelled and merged (DAPI + GFAP) images of control, VPA 1mM, 10µg/ml of W.S. and B.M. co-treated with VPA 1mM. \u003cstrong\u003eF) \u003c/strong\u003egraphical representation of percent GFAP positive neuronal cells. \u003cstrong\u003eG)\u003c/strong\u003e Bright field, DAPI, β-3 tubulin labelled and merged (DAPI + β-3 tubulin) images of control, VPA 1mM, 10µg/ml of W.S. and B.M. co-treated with VPA 1mM. \u003cstrong\u003eH)\u003c/strong\u003e graphical representation of percent β-3 tubulin positive neuronal cells. Images were captured using Leica fluorescence microscope. Magnification: 20X, scale bar = 100 µm. Figure I, J and K represents effect of herbal drugs (3µg/ml, 10µg/ml and 30µg/ml) against 75 µM VPA induced behavioural despair in zebrafish larvae: wall sticking behaviour in open field test \u003cstrong\u003e(I),\u003c/strong\u003e inattentive behavior test \u003cstrong\u003e(J) \u003c/strong\u003ecircling behaviour test \u003cstrong\u003e(K)\u003c/strong\u003e, (n=9 replicates (3 Experiments X 3 plates/experiment)). Results are represented as mean ± S.E.M., p\u0026lt;0.05 was considered significant, where ns is non-significant, ****p\u0026lt;0.0001, ***p\u0026lt;0.001 and **p\u0026lt;0.01 when compared to control and ####p\u0026lt;0.0001, ###p\u0026lt;0.001, ##p\u0026lt;0.01 and #p\u0026lt;0.05 when compared to VPA treated group.\u003c/p\u003e","description":"","filename":"DwivediFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/a999a85ff30d2086755077ee.png"},{"id":86387702,"identity":"defbb010-44fb-42f1-ab66-9c457da716c0","added_by":"auto","created_at":"2025-07-10 06:10:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":22544969,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/29e049de-7b24-4975-b4e2-1e88c9b972e2.pdf"},{"id":86386370,"identity":"007742c7-ab21-4d19-ba37-8583f279b233","added_by":"auto","created_at":"2025-07-10 05:53:50","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1354493,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarydata.docx","url":"https://assets-eu.researchsquare.com/files/rs-6809301/v1/a4b5f5ae5a3a06103ad65aba.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Characterization and optimization of neurosphere culture as in vitro screening tool against valproic acid-induced neurodevelopmental toxicity","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eValproic acid (VPA) also known as 2-propylpentanoic acid, is a frequently prescribed anti-convulsant drug or mood stabilizer(Johannessen \u0026amp; Johannessen, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Despite being the first-choice drug for epilepsy, VPA has been reported to be a potential risk factor in the pathophysiology of idiopathic autism when consumed during pregnancy(Chomiak et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Rodier et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Roullet et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). VPA exposure to pregnant women, not other anti-epileptic treatments, triples the risk of having autistic children(Varghese et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) along with the increased incidence of neural tube defects, developmental delay and cognitive impairments(Markram et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Nicolini \u0026amp; Fahnestock, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Servadio et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Since VPA can cross the placental barrier, thus prenatal VPA exposure may act directly on fetal neuronal cells. VPA also affects maternal tissues which have an indirect impact on fetal neurodevelopment(Iijima et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn alignment with the clinical reports, rodent and zebrafish models also suggested that VPA exposure during embryonic development induce autistic-like symptoms in the offspring(Dwivedi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e; Markram et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Roullet et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Prenatal VPA exposure in rodents showed behavioral despair similar to autistic patients2,3,12\u0026ndash;14 and was used as an established model for screening novel pharmacological interventions for autism. However, the available model for autism are time consuming, costly and requires a large number of animals, thus not an obvious choice for high throughput screening. Therefore, we took efforts to investigate if neural stem cells/neurospheres (\u003cem\u003ein vitro\u003c/em\u003e) could be used as a screening tool against VPA induced neurodevelopmental toxicity.\u003c/p\u003e \u003cp\u003eNeurospheres are the multipotent neural stem cells (NSCs) exhibiting self-renewal property and proliferate as undifferentiated cells(Walker, n.d.). These cells terminally differentiate into neurons, astrocytes, and oligodendrocytes under suitable circumstances(Walker, n.d.). Neurospheres could be either isolated from the fetal/adult brain or can be established from embryonic stem cells(Jensen \u0026amp; Parmar, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Since neurosphere comprises of primary cells involved in the developing brain, thus can mimic the brain development process which made them a suitable tool to investigate neurodevelopmental toxicity(Azari \u0026amp; Reynolds, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Fritsche et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Moors et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). These three dimensional systems may be useful in exploring molecular and cellular mechanisms underlying development, plasticity, and regeneration(Xiong et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and could be a valuable tool for screening chemicals for their abilities to interfere with proliferation, migration, differentiation, and apoptosis(Moors et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThere have been few studies investigating the effect of VPA on primary culture as well as immortal cell culture(Cui et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Hill et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Jung et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). A study from \u003cem\u003eBaumann et al.\u003c/em\u003e has explored human and rat neurospheres model system to investigate developmental neurotoxicity associated with various chemicals including VPA(Toxicol et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, our approach was to search for a reliable and economical tool which can be used for in-vitro screening of candidate molecules against VPA induced neurodevelopmental toxicity.\u003c/p\u003e \u003cp\u003eIn the present study we have explored the effect of VPA on neurospheres. The free floating neurospheres were exposed to VPA (0.5mM, 1mM, and 2mM) on 3rd day \u003cem\u003ein vitro\u003c/em\u003e (DIV3) up to DIV10, and the effect was observed daily for proliferation and cell survival. The VPA treated neurospheres were further investigated for gene expression (4th and 7th day of treatment) and differentiation pattern (7th day of treatment). The chronic VPA exposure leads to defects in proliferation and differentiation of neurospheres, along with dysregulation of strong candidate genes for autism. The rescue of VPA induced neurotoxicity with \u003cem\u003eWithania somnifera\u003c/em\u003e (W.S.) and \u003cem\u003eBacopa monnieri\u003c/em\u003e (B.M.) suggest the utility of the neurosphere system in neurodevelopmental toxicity testing. To understand the potential of this model, both neuroprotective herbal extract W.S. and B.M. were also investigated in VPA induced zebrafish larvae model as described in our previous study. Although the proposed model needs further validation and exploration yet could be an approach towards preliminary screening for neurodevelopmental toxicity.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Chemicals and reagents:\u003c/h2\u003e \u003cp\u003eSodium valproate was procured from Sigma-Aldrich, USA. Human FGF-2 was purchased from Miltenyi Biotec, USA. Cell culture reagents were purchased from Himedia, India. Antibodies were procured from Cell signalling technology, USA. The cDNA synthesis kit and DyNAmo Flash SYBR Green qPCR Kit was purchased from Thermo Scientific, Waltham, MA. The Herbal extracts of W.S. and B.M. were a kind gift from Natural Remedies, Bangalore, India. All other chemicals used were of analytical grade.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Animal ethics and husbandry:\u003c/h2\u003e \u003cp\u003eTimed pregnant Sprague\u0026ndash;Dawley rats (gestational age E8 to E10) were procured from National center for laboratory animal sciences (NCLAS), National Institute of Nutrition (NIN) Hyderabad, India. Standard laboratory animal feed and water were provided \u003cem\u003ead libitum\u003c/em\u003e. All the animal experiments were performed in accordance with the committee for the purpose of control and supervision of experiments on animals (CPCSEA), Government of India. The animal experimentation protocols were approved (approval no. BITS-Hyd/IAEC/2017/21) by the institutional animal ethics committee (IAEC), BITS-Pilani Hyderabad campus (CPCSEA Registration No.351, 3/1/2001).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Preparation of neurosphere cultures from embryonic rat cortex:\u003c/h2\u003e \u003cp\u003eThe rats were sacrificed on gestation age E15 followed by decapitation of embryos and were placed in petri dishes containing Hank's Balanced Salt Solution (HBSS). The heads of the embryos were processed in the sterile condition under hood to carefully isolate the cortex region. HBSS was removed, and tissue was dissociated using 0.25% of trypsin\u0026ndash;EDTA (2 ml) for 20 minutes at 37\u0026deg;C with periodic agitation. Enzyme activity was stopped by adding 4 ml of HBSS. The HBSS was removed, followed by the addition of 2 ml of trypsin inhibitor for 1 minute to neutralize trypsin completely. The trypsin inhibitor was discarded and 1ml of freshly prepared proliferation media (consist of 5 \u0026micro;g/ml heparin, 20 ng/ml human FGF-2, 10% Fetal bovine serum and 1% Penicillin/Streptomycin antibiotic solution in DMEM/F12 media) was added. The tissue in solution was manually triturated using a fire-polished Pasteur pipette and the cells containing media was passed through a cell strainer (40 \u0026micro;M) to obtain single cell suspension. All experiments were performed with mycoplasma-free cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Generation of free-floating neurospheres:\u003c/h2\u003e \u003cp\u003eSingle cell suspensions were plated into agarose coated anti-attachment plates and dishes (for plate preparation see supplementary data) according to experimental requirements. The cells were seeded in proliferation medium at a density of 2X10\u003csup\u003e4\u003c/sup\u003e cells per well in 96-well and 1.5 X 10\u003csup\u003e6\u003c/sup\u003e cells in T-25 flask. The cells were incubated in 5% CO2 incubator at 37\u0026deg;C. Fifty percent of the media was replaced every week in the culture system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Characterization of neurospheres:\u003c/h2\u003e \u003cp\u003eThe proliferating free floating neurospheres were monitored for day \u003cem\u003ein vitro\u003c/em\u003e 15 (DIV10) using brightfield microscopy. The neurosphere were validated for stem cell like property with immunofluorescence on DIV10. The immunofluorescence experiments with neurosphere were done in 1.5 ml centrifuge tube and to avoid loss of neurospheres, centrifugation is required while changing buffers/antibodies. The antibody dilution for primary and secondary antibodies were 1:200. The neurospheres were fixed in 4% paraformaldehyde (PFA). Fixed neurospheres were immunolabeled with nestin (Mouse mAb #4760), β-3 Tubulin (Rabbit mAb #5568), glial fibrillary acidic protein ((GFAP) Rabbit mAb #12389) 2\u0026prime;,3\u0026prime;-cyclic nucleotide 3\u0026prime;-phosphodiesterase ((CNPase) Rabbit mAb #5664) overnight at 4℃. The antibodies are markers for dividing neural and neural stem cell like populations, neural cell differentiation/Neurons, glial cells, oligodendrocytes respectively. Further these neurospheres were incubated with anti-mouse IgG Alexa Fluor\u0026reg; 647 Conjugate (for Nestin) and anti-rabbit IgG Alexa Fluor\u0026reg; 647 Conjugate (for β-3 Tubulin, GFAP and CNPase) secondary antibody for 1h at room temperature. Neurospheres were stained with nuclear stain DAPI (5 \u0026micro;g/ml) for 5 minutes, placed on the cover slip with in-house anti-fading mounting media and examined using confocal microscope. The neurospheres were also allowed to differentiate after DIV10 on adherent plates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. VPA treatment:\u003c/h2\u003e \u003cp\u003eSodium valproate was dissolved directly in proliferation media and was added to free floating neurospheres at three different concentrations (0.5, 1.0 and 2 mM) on DIV3. The cells were kept under VPA treatment for 7 days (DIV10) with daily observation up to 7 days of treatment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Proliferation assay:\u003c/h2\u003e \u003cp\u003eNeurosphere size was used as a parameter for proliferation assay. The neurospheres were observed daily under the Leica fluorescence microscope (Model no. TL LED). However, the images of neurospheres were captured as bright field images on 1st, 4th and 7th day of treatment to observe a noteworthy difference. The diameter of neurospheres were measured using the Leica application suite X software. The diameter of neurospheres was calculated as percentage diameter considering control as 100% using the formula:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:\\%\\:Diameter=\\left(\\frac{Diameter\\:of\\:treated}{Average\\:diameter\\:of\\:control}\\right)*100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eThe neurospheres were also observed for neurosphere dissociation pattern and the percentage frequency of completely dissociated neurospheres were calculated using the formula\u003cdiv id=\"Equb\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e\n$$\\:\\%\\:Frequency\\:of\\:completely\\:dissociated\\:neurospheres=\\left(\\frac{Number\\:of\\:completely\\:dissociated\\:neurosphere}{Total\\:number\\:of\\:neurosphere}\\right)*100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Cytotoxicity assay:\u003c/h2\u003e \u003cp\u003eCytotoxicity was assessed after every 24 hours from 1\u0026ndash;7 days of VPA exposure using Lactate dehydrogenase (LDH) release assay. The quantity of the leaked LDH into the medium by dying cells was used as a measure of cell cytotoxicity(Gottron \u0026amp; Choi, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). The LDH levels were measured spectrophotometrically using EZcount\u0026trade; lactate dehydrogenase cell assay kit (Himedia, India). The assay was performed according to the manufacturer\u0026rsquo;s protocol. Briefly, culture media (50 \u0026micro;l) was collected in 96 well plate, an equal amount of LDH reagent was added and the mixture was incubated in dark for 30 minutes at room temperature. Stop solution (50 \u0026micro;l) was added and absorbance was measured at 450 nm and 620 nm (background), using a Spectra Max 340 microplate spectrophotometer (Molecular Devices, Sunnyvale,CA). After background absorbance subtraction, the percentage cell death was measured using the formula:\u003cdiv id=\"Equc\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equc\" name=\"EquationSource\"\u003e\n$$\\:\\%\\:Cytotoxicity=\\frac{\\left(Absorbance\\:of\\:treated-Absorbance\\:of\\:control\\right)}{Absorbance\\:of\\:control}\\:\\:\\times\\:100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Gene expression studies:\u003c/h2\u003e \u003cp\u003eThe neurospheres were collected on 4th and 7th day of treatment for gene expression studies. Total RNA was isolated from the neurospheres cultured in T-25 anti-attachment flask (n\u0026thinsp;=\u0026thinsp;3) using the TRIzol method following the manufacturer\u0026rsquo;s instructions. The RNA (1 \u0026micro;g) was converted into cDNA by using Verso cDNA synthesis kit as per the manufacturer\u0026rsquo;s instructions. Gene expression was quantitatively determined by Real-Time PCR using DyNAmo Flash SYBR Green qPCR Kit and the CFX Connect Real-Time PCR System (Biorad, USA) according to the manufacturer\u0026acute;s instructions. All reactions were performed in triplicate. The results are expressed relative to GAPDH, which is used as an internal control. The primers (IDT, India) were validated for linearity and specificity of amplification and the sequence for primers are mentioned below:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eNRXN 1 (Forward Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACTGCTCTGCTCAACTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRXN 1 (Reverse Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTACTCTGAATTTCCGCCATCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c3\" namest=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eNGLN 3 (Forward Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCTTTGCTGCTCTCTATTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eNGLN 3 (Reverse Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTGGAGCAGTTCCCAATTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eSHANK 3a (Forward Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCAAGTTCCTGGATGAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eSHANK 3a (Reverse Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCATAAACTCTCCGCTTGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGAPDH (Forward Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATTCTACCCACGGCAAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGAPDH (Reverse Primer)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATGGGTTTCCCATTGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Neural cell differentiation from neurospheres:\u003c/h2\u003e \u003cp\u003eThe purpose of experiment was to observe the effect of VPA on the differentiation pattern of the neurospheres. Control and VPA treated neurospheres were collected on 7th day of treatment and a single cell suspension was prepared by repeated pipetting using micropipette. The single cell suspension in differentiation media (DMEM/F12 media with 10% FBS, 2% B 27 supplement and 1% antibiotic) was plated on polyethyleneimine coated coverslips and plates (see supplementary data for plate preparation). Cells were allowed to differentiate for 7 days in 5% CO2 incubator at 37\u0026deg;C, later subjected to immunofluorescence labelling. Briefly, the differentiated cells were fixed with 4% PFA. The cells were then incubated overnight at 4\u0026deg;C in primary antibodies (1:200) against GFAP, β-3 Tubulin, and CNPase, followed by 1hour incubation with secondary (1:200) anti-rabbit IgG Alexa Fluor\u0026reg; 647 Conjugate at room temperature. Cells were stained with nuclear stain DAPI (5 \u0026micro;g/ml) for 5 minutes, inhouse anti-fading mounting media was added to the coverslip and examined using Leica fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Herbal drug screening:\u003c/h2\u003e \u003cp\u003eThe pure herbal extract of W.S. and B.M. were dissolved in proliferation media (500\u0026micro;g/ml). The neurospheres were treated with three different concentrations (0.1\u0026micro;g/ml, 1\u0026micro;g/ml and 10\u0026micro;g/ml) of herbal drugs on DIV3, followed by simultaneous treatment of VPA (1mM and 2mM). The co-treated cells were allowed to grow for 7 days and were investigated for proliferation (4th day) and differentiation pattern (7th day).\u003c/p\u003e \u003cp\u003eTo confirm that neurosphere model can act as first phase screening for molecules, we have explored the effect of the neuroprotective herbal drugs in the zebrafish larvae model as described in our previous study (Dwivedi et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e). Briefly, the 4 hours post fertilized (hpf) embryos were treated (single exposure) with 75\u0026micro;M VPA dissolved in media. VPA treatment was continued up to 5 days post fertilization (dpf). The larvae were randomly divided into various group and the safe concentration herbal drugs were given from 5\u0026ndash;7 dpf. The groups were as follow: a) Control, b) VPA (75\u0026micro;M), c) VPA\u0026thinsp;+\u0026thinsp;W.S. 3\u0026micro;g/ml, d) VPA\u0026thinsp;+\u0026thinsp;W.S. 10\u0026micro;g/ml, e) VPA\u0026thinsp;+\u0026thinsp;W.S. 30\u0026micro;g/ml, f) VPA\u0026thinsp;+\u0026thinsp;B.M. 3\u0026micro;g/ml, g) VPA\u0026thinsp;+\u0026thinsp;B.M. 10\u0026micro;g/ml, and h) VPA\u0026thinsp;+\u0026thinsp;B.M. 30\u0026micro;g/ml. The behavioral tests were performed at 7-dpf between 10 am to 2 pm. The behavioral test performed includes open field test, inattentive behavior test and circling behavior test. Please see supplementary data for detailed protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Statistics:\u003c/h2\u003e \u003cp\u003eAll data are the results of at least three replicate independent experiments. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;S.E.M. The statistical significance was calculated using one-way ANOVA followed by Dunnett\u0026rsquo;s post hoc test in GraphPad Prism\u0026reg; 8.0 software. P-value of \u0026lt;\u0026thinsp;0.05 was considered to be statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. RESULTS","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Characterization of neurospheres:\u003c/h2\u003e \u003cp\u003eAn early sign of free floating neurospheres was observed at DIV2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) as reported in previous study by \u003cem\u003eHuang et al.\u003c/em\u003e(Huang \u0026amp; Schneider, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) The free floating neurosphere were observed to reach maximum proliferation size by DIV10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The cells here after shows constant sphere size with increased cell death identified by black spots in the centre of neurosphere (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). This cell death is a result of nutrient deficiency due to compact density of cells, thus, the cells require passaging after every 7\u0026ndash;10 DIV. The neurospheres can be maintained for up to 8 weeks in an undifferentiated state, if passaged every 7\u0026ndash;10 days under suitable proliferation condition(Huang \u0026amp; Schneider, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), which in our hand has been maintained for 4\u0026ndash;6 weeks to the maximum. The images after first passage of neurospheres has been presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD. The neurospheres when dissociated and plated as single cell suspension, under suitable conditions were able to differentiate into different neuronal cells further (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). However, we observed the poor dissociation of neurospheres into single cells suspension with increasing passage number. The neurospheres starts dissociating into small bunch of cells after 1\u0026ndash;2 passage, thus we suggest the use of these cells within 2 passages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eImmunofluorescence staining of parent and progeny neurospheres showed marked nestin-positive staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) representing neural stem/progenitor cells, and the absence of cells positive for mature cell markers which includes β-3 tubulin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), GFAP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) and CNPase (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Effect of VPA on neurosphere size:\u003c/h2\u003e \u003cp\u003eThe images were captured on 1st, 4th and 7th day of treatment and the representative images are presented as Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. In the first generation neurospheres, VPA shows a significant concentration dependent decrease in percentage diameter of neurospheres on 4th and 7th day of treatment when compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Furthermore, the complete dissociation of neurospheres was observed with VPA treatment in a concentration and time dependent manner. A significantly high dissociation of neurosphere was observed with 1mM and 2mM VPA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The sensitivity of VPA treatment decreases with passaging of neurospheres (Please see figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), thus we recommend the use of first generation neurospheres for VPA induced neurodevelopmental toxicity study.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effect of VPA on Cell Viability:\u003c/h2\u003e \u003cp\u003eLDH release is presented as percentage cytotoxicity, assessed at 24 hours intervals from day 1 to day 7 of VPA treatment (0.5mM, 1mM, and 2 mM). Chronic (7 days) VPA treatment up to 2mM shows marginal cytotoxicity (3 to 9%) in neurospheres. The cytotoxicity observed fails to reach significance level. To confirm the results, we have also investigated the effect of VPA on primary neuronal culture using MTT cell viability assay and found no significant difference between the control and VPA treatment (data not shown). Thus, cytotoxicity may not be a suitable parameter for screening molecules against VPA in neurosphere culture.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effect of VPA on the expression of high risk genes for autism:\u003c/h2\u003e \u003cp\u003eThe gene expression was studied for three strong candidate autism associated genes (NRXN 1, NGLN 3 and SHANK 3). VPA treatment for 4 days results in a significant reduction in gene expression level of NRXN 1 and SHANK 3 as compared to matched control neurospheres (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). However, a decrease in gene expression level with VPA treatment was not always concentration dependent with 4 days treatment. In 7 days treated neurospheres, VPA at 1mM and 2mM leads to significant reduction in gene expression level of NRXN 1, NGLN 3 and SHANK 3. However, 0.5mM of VPA shows a significant down regulation in gene expression level of NGLN 3 and SHANK 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Since similar changes in these genes have been previously reported in multiple models of ASD including our zebrafish approach towards modeling autism(Dwivedi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e), this data serves to increase our confidence for the use of neurospheres for preliminary screening of candidate molecules for VPA induced developmental toxicity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effect of VPA on NSCs differentiation potential:\u003c/h2\u003e \u003cp\u003eFree floating neurospheres generated from NSCs were plated one neurosphere/well on polyethyleneimine pre-coated coverslips. Cells possess differential ability and develops into neuronal cells with stellate morphology when allowed to grow in differentiation medium (DMEM/F12\u0026thinsp;+\u0026thinsp;10% FBS\u0026thinsp;+\u0026thinsp;2% B-27 supplement\u0026thinsp;+\u0026thinsp;1% antibiotic solution) for 7 days. However, the immunostaining of differentiated cells suggests an abundance of GFAP protein with expression of β-3 tubulin and little expression of CNPase. Thus, further studies were performed in GFAP and β-3 tubulin labelled cells. Chronic exposure of VPA for 7 days affects the differentiation of neuronal cells in a concentration dependent manner. VPA exposure of 0.5mM shows significant reduction in β-3 Tubulin expression with no significant effect on the GFAP. However, neurospheres exposed to 1mM and 2mM of VPA lead to a decrease in neurite outgrowth with reduced expression of GFAP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eB) and β-3 Tubulin (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) suggesting compromised overall growth of differentiated neuronal cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Effect of herbal drugs on VPA induced defects in neurosphere and zebrafish model:\u003c/h2\u003e \u003cp\u003e \u003cb\u003eNeurosphere proliferation\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eBased on the previous experiments VPA 1mM and 2mM concentration were used in further studies. Neurospheres, when treated with VPA (1mM and 2mM) for 4 days, shows a significant reduction in percentage diameter and an increase in percentage frequency of complete dissociation of neurospheres as compared to control. W.S. and B.M. shows a concentration dependent rescue against VPA induced impairment in proliferation of neurospheres, measured by diameter and dissociation. W.S. and B.M. (1\u0026micro;g/ml and 10\u0026micro;g/ml) shows a significant improvement in neurosphere diameter against VPA (1mM and 2mM). However, 0.1\u0026micro;g/ml concentration of W.S. and B.M. ameliorates neurosphere diameter against VPA 1mM and 2mM respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). W.S. and B.M. protect VPA induced neurospheres dissociation in a concentration dependent manner. The significant effect of W.S. and B.M. was observed at 10\u0026micro;g/ml against VPA 1mM (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In VPA 2mM treated neurosphere, W.S. shows significant rescue at 1\u0026micro;g/ml and 10\u0026micro;g/ml, whereas B.M. was able to significantly rescue dissociation of neurosphere at all tested concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNeurosphere differentiation\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eThe neurospheres were allowed to differentiate for 7 days in differentiation media before the experiment. Chronic 7 days VPA (1mM) treatment in neurospheres leads to defect in differentiation pattern of neural stem cells. The defected differentiation pattern can be visibly observed by decreased percent of GFAP and β-3 tubulin positive cells in comparison to control neurospheres. The differentiated cells also present a compromised neurite outgrowth. However, W.S. and B.M. at 10\u0026micro;g/ml concentration recuperates the VPA induced damage to neurosphere differentiation, evident by the recovery of percentage GFAP and β-3 tubulin labelled cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eH). Moreover, increased neurite outgrowth and neuronal connectivity was also observed with W.S. and B.M. co-treatment against VPA. However, quantification of neurite outgrowth was challenging and not accounted due to dense population of neuronal cells in control and 0.5mM VPA treated groups.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eConfirming\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eresults with\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003ezebrafish larvae model\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eSince, W.S. and B.M. rescue VPA induced neurodevelopmental toxicity in neurosphere culture, we have investigated whether the results from these preliminary screening can connect with \u003cem\u003ein vivo\u003c/em\u003e (zebrafish larvae model) data. However, the VPA induced zebrafish larvae model(Dwivedi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e) has been incorporated for additional validation and is not in the scope of this study, thus methods for zebrafish larvae model has been provided in supplementary data. Chronic VPA treatment (75\u0026micro;M) in the embryonic stage in zebrafish leads to autism like behavioural assessed by increased anxiety, inattentive behaviour and circling behaviour. The herbal drugs, W.S. and B.M. ameliorates VPA induced behavioural despairs in a concentration dependent manner as presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eI, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eJ and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eK. The results all together indicates that neurosphere model can be an approach in preliminary screening for neurodevelopmental toxicity and autism. However, further exploration and validation of associated neurodevelopmental toxicity and rescue with multiple drugs is advised.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. DISCUSSION","content":"\u003cp\u003eIn the present study, we report a novel and economical approach to study developmental neurotoxicity of VPA in neurosphere model, intending to develop a high throughput screening model. To the best of our knowledge, this study is the first attempt in characterizing the effects of VPA on embryonically derived cortical neurospheres and its practicality towards developing a developmental neurotoxicity screening tool. The advantages such as imitating features of brain development, reduced animal number (one or two), large sample size and a simple assay for screening make this approach choice for preliminary screening of novel molecules.\u003c/p\u003e \u003cp\u003eAlthough, patient derived induced pluripotent stem cells (iPSCs) have shown successful disease modelling phenotypically and hence help drug discovery based on precise phenotypic changes. The use of iPSCs in neuronal drug discovery is recognised but a very limited number of target genes are known with respect to ASD. The iPSCs advocates to be a better model system in case of personalized therapy, where the phenotypic changes depend on the source (individual) of sample collection. Thus, specific phenotypic modifications and their rescue can be studied efficiently (Farkhondeh et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). On the other hand, neurosphere cell culture provides a 3D approach which has been explored extensively to study neurological disorders. The advantages such as easy modulation with alteration in cellular niche, wide range of associated pathways and reduction in animals used make it a suitable model for medium to high throughput screening (da Silva Siqueira et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs reported, VPA when consumed during pregnancy, potentially hinder the normal brain development and induce autism(Fukuchi et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The effective concentration of VPA in plasma level for the treatment of epilepsy is 50\u0026ndash;100 \u0026micro;g/ml (0.3\u0026ndash;0.6 mM), whereas, the foetal plasma level of VPA is around 0.39\u0026ndash;2.76 mM i.e. 1.3\u0026ndash;4.6 times higher than the maternal plasma level(Iijima et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Thus, in the present study, NSCs were exposed to VPA concentrations that are relevant to human exposure especially, foetal plasma level. Cell proliferation, migration, differentiation, synaptogenesis and apoptosis are coordinated steps in brain development, thus, in this study, neurospheres were observed based on cytotoxicity, proliferation, gene expression and differentiation studies.\u003c/p\u003e \u003cp\u003eCell proliferation is one of the key events during embryonic development, which was investigated using neurospheres size. We and others have observed that VPA not only inhibited proliferation of neurospheres but also led to dissociation of neurospheres in a concentration and time dependent manner(Jung et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Toxicol et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhou et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). For example, Xiaopu \u003cem\u003eet al.\u003c/em\u003e suggested a gradual increase in cells moving out of spheres (rat hippocampal NSCs) with an increase in VPA concentration and time, thus leading to decreased neurosphere size. The research results also suggested increased differentiation along with increased number of neuritis branches with longer neuritis in nerve cells as the VPA concentration was increased(Cui et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) which was not observed in our study. This may be due to the anti-adherent flask used in our experiments for neurosphere culture.\u003c/p\u003e \u003cp\u003eIn spite of cytotoxicity being a simplest and widely accepted parameter for high throughput screening(Rohman \u0026amp; Wingfield, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), it is not thought to be a predictor for developmental neurotoxicity. In contrast, the specificity of developmental neurotoxicity is assumed when there is no cytotoxicity(Crofton et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The cytotoxicity data in this study was in line with previous studies suggesting little or no cytotoxicity with VPA treatment. Hill \u003cem\u003eet al\u003c/em\u003e. reported 23mM\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004mM as IC\u003csub\u003e50\u003c/sub\u003e value for VPA(Hill et al., 2008) and Zhou \u003cem\u003eet al.\u003c/em\u003e suggested a 9.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.2% reduction (statistically insignificant) in cell viability with 1mM VPA treatment after 48 hours(Zhou et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Therefore, we concluded that VPA did not cause significant cytotoxicity at the environmentally perceived concentrations.\u003c/p\u003e \u003cp\u003eTo validate if \u003cem\u003ein vitro\u003c/em\u003e VPA treatment in neurospheres led to alteration in marker genes for autism, we selected 3 potential genes (SHANK 3, NRXN 1 and NGLN 3) which were reported to display altered expression in autism (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://sfari.org/resources/sfari-gene\u003c/span\u003e\u003cspan address=\"https://sfari.org/resources/sfari-gene\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). NRXN 1, NLGN 3 and SHANK 3 were the synaptic proteins and were found to be involved in synapse formation(Dwivedi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e). Moreover, alteration in these genes has been identified in our previous article on VPA induced zebrafish larvae model for autism(Dwivedi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e). HDAC inhibition played a critical role in VPA induced congenital disabilities(Fukuchi et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Phiel et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Prenatal HDAC inhibition delayed neuronal maturation by alterations in the expression of NRXN, NLGN and SHANK 3(Kawanai et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Thus, our observations were in alignment with the previous reports suggesting that VPA led to down regulation of the mentioned synaptic genes which were also considered as high-risk genes for autism. However, further exploration of other high confidence genes for autism is needed to endorse the use of VPA treated neurospheres for screening candidate molecules for autism.\u003c/p\u003e \u003cp\u003eAmple of \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies suggested that VPA boosted up the differentiation of neuronal cells with prominent neurite outgrowth(Cho et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Long et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Furthermore, VPA treatment was suggested to increase GFAP expression in rodent model of autism, describing the event as a pathological increase in GFAP level with prenatal VPA treatment(Choi et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Gottfried et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In contrast to the above claims, under our experimental conditions, chronic VPA treatment restricted the adherence and differentiation potential of neurospheres which signals towards the role of VPA in poor neurogenesis at early brain development. The mechanisms behind these findings are unknown and requires further exploration.\u003c/p\u003e \u003cp\u003eAutism being a multifactorial disorder, only symptomatic treatments are available with limited knowledge on molecular aspects of disease(DeFilippis \u0026amp; Wagner, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Thus, to validate the neurosphere model system for drug screening, we have tested two known neuroprotective herbal drugs W.S. and B.M. against VPA induced neurodevelopmental toxicity. Literature suggests that B.M. rescue behavioral and histopathological symptoms against VPA induced rodent model of autism via oxidative stress and serotonin profile(Sandhya et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). B.M. is also reported to alleviate clinical symptoms of autism and related disorders(Aguiar \u0026amp; Borowski, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; J. Kean et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; J. D. Kean et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Although, there are no direct clinical evidence for the use of W.S. in autism, it has been reported to have substantial therapeutic role in CNS related disorders like Alzheimer\u0026rsquo;s, Parkinson\u0026rsquo;s, anxiety, depression etc(Gupta \u0026amp; Kaur, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Vandita Singh, Hakikulla H. Shah, 2017). The scientific evidence suggests anti-inflammatory and anti-oxidative effect of W.S. in CNS related disease models. The overlap of symptoms with autism encouraged us to screen W.S. in our model. In our experiment W.S. and B.M. rescued VPA induced defects in the neurosphere model in terms of proliferation and differentiation. Moreover, this model has ability to distinguish between efficacy of test drugs as observed between B.M and W.S. The \u003cem\u003ein vitro\u003c/em\u003e protective effect of these herbal drugs against VPA was verified in already published zebrafish larvae model(Dwivedi et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e) which indicates the translational value of neurosphere model. Thus, we advocate that neurosphere model could be an approach for preliminary screening against neurodevelopmental toxicity. However, the findings are preliminary and warrants further exploration.\u003c/p\u003e"},{"header":"5. CONCLUSIONS","content":"\u003cp\u003eThe data from our study suggested that VPA at the concentration present in the environment did not lead to cell death but may have a strong impact on proliferation and differentiation of neurospheres/NSCs with decrease in gene expression of autism high risk genes. However, there is every need to explore the expression level of other high risk genes and proteins for autism in VPA treated neurospheres. Since there were only symptomatic treatments available for autism and no standard drug act on the pathophysiology of autism, thus, we were unable to explore the effect of standard drugs on VPA induced neurodevelopmental toxicity in neurospheres. Nevertheless, we tested herbal drugs known for neuroprotective action and these drugs rescued VPA induced defects in neurospheres proliferation and differentiation. Altogether, we conclude that chronic VPA 1mM treatment in neurospheres could induce neurodevelopmental toxicity. We recommend using 1st generation neurospheres, with VPA induction of 4 days for proliferation and 7 days for differentiation studies. The candidate molecules could be co-treated for preliminary screening against VPA induced neurodevelopmental toxicity. Nevertheless, the model demands validating the other extensive features of neurodevelopmental toxicity. Furthermore, our neurosphere model could be an approach to study the other marker genes and proteins in neurodevelopmental disorders including autism.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest statement:\u003c/h2\u003e\n\u003cp\u003eThe authors have no conflict of interest (commercial or otherwise) to disclose.\u003c/p\u003e\n\u003ch2\u003eFunding \u0026amp; acknowledgements\u003c/h2\u003e\n\u003cp\u003eAuthors are grateful to Birla Institute of Technology and Science (BITS)\u0026ndash;Pilani,Hyderabad Campus (India) for infrastructural facilities and research resources. This work was supported by internal funding from the institution. Authors are thankful to Indian Council of Medical Education and Research (ICMR) for supporting lead author with Senior Research Fellowship.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eSD: performed the experiments and wrote the manuscriptAD: Helped in experiments and imaging of neurospheresSG: Helped in experiments and imaging of neurospheresRM: Helped with Zebrafish experiments and editing the manuscriptPK: Zebrafish Resources and Guidance YP: Lab resources and overall supervision\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eAuthors are grateful to Birla Institute of Technology and Science (BITS)\u0026ndash;Pilani,Hyderabad Campus (India) for infrastructural facilities and research resources. This work was supported by internal funding from the institution. Authors are thankful to Indian Council of Medical Education and Research (ICMR) for supporting lead author with Senior Research Fellowship.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAguiar, S., \u0026amp; Borowski, T. (2013). \u003cem\u003eNeuropharmacological Review of the Nootropic Herb Bacopa monnieri\u003c/em\u003e. \u003cem\u003e16\u003c/em\u003e(4). https://doi.org/10.1089/rej.2013.1431\u003c/li\u003e\n \u003cli\u003eAzari, H., \u0026amp; Reynolds, B. A. (2016). \u003cem\u003eIn Vitro Models for Neurogenesis\u003c/em\u003e.\u003c/li\u003e\n \u003cli\u003eCho, K. S., Kwon, K. J., Choi, C. S., Jeon, S. J., Kim, K. C., Park, J. H., Ko, H. M., Lee, S. H., Cheong, J. H., Ryu, J. H., Han, S. H., \u0026amp; Shin, C. Y. (2013). \u003cem\u003eValproic Acid Induces Astrocyte-Dependent Neurite Outgrowth from Cultured Rat Primary Cortical Neuron Via Modulation of tPA / PAI-1 Activity\u003c/em\u003e. https://doi.org/10.1002/glia.22463\u003c/li\u003e\n \u003cli\u003eChoi, J., Lee, S., Won, J., Jin, Y., Hong, Y., Hur, T., Kim, J., Lee, S., \u0026amp; Hong, Y. (2018). \u003cem\u003ePathophysiological and neurobehavioral characteristics of a propionic acid-mediated autism-like rat model\u003c/em\u003e. 1\u0026ndash;17.\u003c/li\u003e\n \u003cli\u003eChomiak, T., Turner, N., \u0026amp; Hu, B. (2013). What we have learned about autism spectrum disorder from valproic acid. \u003cem\u003ePathology Research International\u003c/em\u003e, \u003cem\u003e2013\u003c/em\u003e. https://doi.org/10.1155/2013/712758\u003c/li\u003e\n \u003cli\u003eCrofton, K. M., Mundy, W. R., Lein, P. J., Bal-Price, A., Coecke, S., Seiler, A. E. M., Knaut, H., Buzanska, L., \u0026amp; Goldberg, A. (2011). Developmental neurotoxicity testing: Recommendations for developing alternative methods for the screening and prioritization of chemicals. \u003cem\u003eAltex\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e(1), 9\u0026ndash;15. https://doi.org/10.14573/altex.2011.1.009\u003c/li\u003e\n \u003cli\u003eCui, X., Hong, S., Huang, D., Hu, Y., Wu, P., \u0026amp; Jiang, L. (2017). \u003cem\u003eEffects of valproic acid on the differentiation of endogenous neural stem cells of the hippocampus in rats\u003c/em\u003e. \u003cem\u003e10\u003c/em\u003e(3), 4732\u0026ndash;4739.\u003c/li\u003e\n \u003cli\u003eda Silva Siqueira, L., Majolo, F., da Silva, A. P. B., da Costa, J. C., \u0026amp; Marinowic, D. R. (2021). Neurospheres: a potential in vitro model for the study of central nervous system disorders. In \u003cem\u003eMolecular Biology Reports\u003c/em\u003e (Vol. 48, Issue 4, pp. 3649\u0026ndash;3663). Springer Science and Business Media B.V. https://doi.org/10.1007/s11033-021-06301-4\u003c/li\u003e\n \u003cli\u003eDeFilippis, M., \u0026amp; Wagner, K. D. (2010). Treatment of Autism Spectrum Disorder in Children and Adolescents. \u003cem\u003eJournal of Autism and Developmental Disorders\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(1), 18\u0026ndash;41. https://doi.org/10.1007/s10803-009-0834-0\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eDifferentiating human NT2 D1 neurospheres as a versatile in vitro 3 D model system for developmental toxicity.pdf\u003c/em\u003e. (n.d.).\u003c/li\u003e\n \u003cli\u003eDwivedi, S., Medishetti, R., Rani, R., Sevilimedu, A., Kulkarni, P., \u0026amp; Yogeeswari, P. (2019a). Larval zebrafish model for studying the effects of valproic acid on neurodevelopment: An approach towards modeling autism. \u003cem\u003eJournal of Pharmacological and Toxicological Methods\u003c/em\u003e, \u003cem\u003e95\u003c/em\u003e(November 2018), 56\u0026ndash;65. https://doi.org/10.1016/j.vascn.2018.11.006\u003c/li\u003e\n \u003cli\u003eDwivedi, S., Medishetti, R., Rani, R., Sevilimedu, A., Kulkarni, P., \u0026amp; Yogeeswari, P. (2019b). Larval zebrafish model for studying the effects of valproic acid on neurodevelopment: An approach towards modeling autism. \u003cem\u003eJournal of Pharmacological and Toxicological Methods\u003c/em\u003e, \u003cem\u003e95\u003c/em\u003e(April 2018), 56\u0026ndash;65. https://doi.org/10.1016/j.vascn.2018.11.006\u003c/li\u003e\n \u003cli\u003eFarkhondeh, A., Li, R., Gorshkov, K., Chen, K. G., Might, M., Rodems, S., Lo, D. C., \u0026amp; Zheng, W. (2019). Induced pluripotent stem cells for neural drug discovery. In \u003cem\u003eDrug Discovery Today\u003c/em\u003e (Vol. 24, Issue 4, pp. 992\u0026ndash;999). Elsevier Ltd. https://doi.org/10.1016/j.drudis.2019.01.007\u003c/li\u003e\n \u003cli\u003eFritsche, E., Cline, J. E., Nguyen, N., Scanlan, T. S., \u0026amp; Abel, J. (2005). \u003cem\u003ePolychlorinated Biphenyls Disturb Differentiation of Normal Human Neural Progenitor Cells : Clue for Involvement of Thyroid Hormone Receptors\u003c/em\u003e. \u003cem\u003e113\u003c/em\u003e(7), 871\u0026ndash;876. https://doi.org/10.1289/ehp.7793\u003c/li\u003e\n \u003cli\u003eFukuchi, M., Nii, T., Ishimaru, N., Minamino, A., Hara, D., Takasaki, I., Tabuchi, A., \u0026amp; Tsuda, M. (2009). Valproic acid induces up- or down-regulation of gene expression responsible for the neuronal excitation and inhibition in rat cortical neurons through its epigenetic actions. \u003cem\u003eNeuroscience Research\u003c/em\u003e, \u003cem\u003e65\u003c/em\u003e(1), 35\u0026ndash;43. https://doi.org/10.1016/j.neures.2009.05.002\u003c/li\u003e\n \u003cli\u003eGottfried, C., Bambini-junior, V., Baronio, D., Zanatta, G., Silvestrin, R. B., \u0026amp; Vaccaro, T. (2013). Valproic Acid in Autism Spectrum Disorder : From an Environmental Risk Factor to a Reliable Animal Model. \u003cem\u003eRecent Advances in Autism Spectrum Disorders - Volume I\u003c/em\u003e, 143\u0026ndash;163. https://doi.org/43452\u003c/li\u003e\n \u003cli\u003eGottron, F. J., \u0026amp; Choi, D. W. (2000). \u003cem\u003eAssessment of Cell Viability in Primary Neuronal Cultures\u003c/em\u003e. 1\u0026ndash;17.\u003c/li\u003e\n \u003cli\u003eGupta, M., \u0026amp; Kaur, G. (2016). Aqueous extract from the Withania somnifera leaves as a potential anti- neuroinflammatory agent : a mechanistic study. \u003cem\u003eJournal of Neuroinflammation\u003c/em\u003e, 1\u0026ndash;17. https://doi.org/10.1186/s12974-016-0650-3\u003c/li\u003e\n \u003cli\u003eHill, E. J., Nagel, D. A., O\u0026rsquo;Neil, J. D., Torr, E., Woehrling, E. K., Devitt, A., \u0026amp; Coleman, M. D. (2013). Effects of Lithium and Valproic Acid on Gene Expression and Phenotypic Markers in an NT2 Neurosphere Model of Neural Development. \u003cem\u003ePLoS ONE\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(3). https://doi.org/10.1371/journal.pone.0058822\u003c/li\u003e\n \u003cli\u003eHuang, F., \u0026amp; Schneider, J. S. (2004). \u003cem\u003eEffects of Lead Exposure on Proliferation and Differentiation of Neural Stem Cells Derived from Different Regions of Embryonic Rat Brain\u003c/em\u003e. \u003cem\u003e25\u003c/em\u003e, 1001\u0026ndash;1012. https://doi.org/10.1016/j.neuro.2004.03.010\u003c/li\u003e\n \u003cli\u003eIijima, Y., Behr, K., Iijima, T., Biemans, B., \u0026amp; Bischofberger, J. (2016). Distinct Defects in Synaptic Differentiation of Neocortical Neurons in Response to Prenatal Valproate Exposure. \u003cem\u003eNature Publishing Group\u003c/em\u003e, \u003cem\u003eJune\u003c/em\u003e, 1\u0026ndash;14. https://doi.org/10.1038/srep27400\u003c/li\u003e\n \u003cli\u003eIngram JL1, Peckham SM, Tisdale B, Rodier PM., C. S. (2000). Prenatal exposure of rats to valproic acid reproduces the cerebellar anomalies associated with autism. \u003cem\u003eNeurotoxicology and Teratology\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(3), 213\u0026ndash;224. https://doi.org/10.1016/S0892-0362(99)00083-5\u003c/li\u003e\n \u003cli\u003eJensen, J. B., \u0026amp; Parmar, M. (2006). \u003cem\u003e\u0026lt;Jensen and Parmar Mol Neurobiol 2006.pdf\u0026gt;\u003c/em\u003e. \u003cem\u003e34\u003c/em\u003e(3), 153\u0026ndash;161. https://doi.org/10.1385/MN:34:3:153\u003c/li\u003e\n \u003cli\u003eJohannessen, C. U., \u0026amp; Johannessen, S. I. (2003). \u003cem\u003eValproate : Past , Present , and Future Mechanisms of Action\u003c/em\u003e. \u003cem\u003e9\u003c/em\u003e(2), 199\u0026ndash;216.\u003c/li\u003e\n \u003cli\u003eJung, G. A., Yoon, J. Y., Moon, B. S., Yang, D. H., Kim, H. Y., Lee, S. H., Bryja, V., Arenas, E., \u0026amp; Choi, K. Y. (2008). Valproic acid induces differentiation and inhibition of proliferation in neural progenitor cells via the beta-catenin-Ras-ERK- p21 Cip/WAF1 pathway. \u003cem\u003eBMC Cell Biology\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e, 1\u0026ndash;12. https://doi.org/10.1186/1471-2121-9-66\u003c/li\u003e\n \u003cli\u003eKawanai, T., Ago, Y., Watanabe, R., Inoue, A., Taruta, A., Onaka, Y., Hasebe, S., Hashimoto, H., Matsuda, T., \u0026amp; Takuma, K. (2016). Prenatal Exposure to Histone Deacetylase Inhibitors Affects Gene Expression of Autism-Related Molecules and Delays Neuronal Maturation. \u003cem\u003eNeurochemical Research\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e(10), 2574\u0026ndash;2584. https://doi.org/10.1007/s11064-016-1969-y\u003c/li\u003e\n \u003cli\u003eKean, J. D., Kaufman, J., Lomas, J., Goh, A., White, D., Simpson, D., Scholey, A., Singh, H., Sarris, J., Zangara, A., \u0026amp; Stough, C. (2015). \u003cem\u003eA Randomized Controlled Trial Investigating the Effects of a Special Extract of Bacopa monnieri ( CDRI 08 ) on Hyperactivity and Inattention in Male Children and Adolescents : BACHI Study Protocol ( ANZCTRN12612000827831 )\u003c/em\u003e. \u003cem\u003eCdri 08\u003c/em\u003e, 9931\u0026ndash;9945. https://doi.org/10.3390/nu7125507\u003c/li\u003e\n \u003cli\u003eKean, J., Downey, L., \u0026amp; Stough, C. (2017). Systematic Overview of Bacopa monnieri (L.) Wettst. Dominant Poly-Herbal Formulas in Children and Adolescents. \u003cem\u003eMedicines\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(4), 86. https://doi.org/10.3390/medicines4040086\u003c/li\u003e\n \u003cli\u003eLong, Z.-M., Zhao, L., Jiang, R., Wang, K.-J., Luo, S.-F., Zheng, M., Li, X.-F., \u0026amp; He, G.-Q. (2015). Valproic Acid Modifies Synaptic Structure and Accelerates Neurite Outgrowth Via the Glycogen Synthase Kinase-3\u0026beta; Signaling Pathway in an Alzheimer\u0026rsquo;s Disease Model. \u003cem\u003eCNS Neuroscience \u0026amp; Therapeutics\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(11), 887\u0026ndash;897. https://doi.org/10.1111/cns.12445\u003c/li\u003e\n \u003cli\u003eMarkram, K., Rinaldi, T., Mendola, D. La, Sandi, C., \u0026amp; Markram, H. (2008). Abnormal fear conditioning and amygdala processing in an animal model of autism. \u003cem\u003eNeuropsychopharmacology\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(4), 901\u0026ndash;912. https://doi.org/10.1038/sj.npp.1301453\u003c/li\u003e\n \u003cli\u003eMoors, M., Rockel, T. D., Abel, J., Cline, J. E., Gassmann, K., Schreiber, T., Schuwald, J., Weinmann, N., \u0026amp; Fritsche, E. (2009). \u003cem\u003eHuman Neurospheres as Three-Dimensional Cellular Systems for Developmental Neurotoxicity Testing\u003c/em\u003e. \u003cem\u003e117\u003c/em\u003e(7), 1131\u0026ndash;1138. https://doi.org/10.1289/ehp.0800207\u003c/li\u003e\n \u003cli\u003eNicolini, C., \u0026amp; Fahnestock, M. (2018). The valproic acid-induced rodent model of autism. \u003cem\u003eExperimental Neurology\u003c/em\u003e, \u003cem\u003e299\u003c/em\u003e, 217\u0026ndash;227. https://doi.org/10.1016/j.expneurol.2017.04.017\u003c/li\u003e\n \u003cli\u003ePhiel, C. J., Zhang, F., Huang, E. Y., Guenther, M. G., Lazar, M. A., \u0026amp; Klein, P. S. (2001). Histone Deacetylase is a Direct Target of Valproic Acid, a Potent Anticonvulsant, Mood Stabilizer, and Teratogen. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e276\u003c/em\u003e(39), 36734\u0026ndash;36741. https://doi.org/10.1074/jbc.M101287200\u003c/li\u003e\n \u003cli\u003eRodier, P. M., Ingram, J. L., Tisdale, B., \u0026amp; Croog, V. J. (1997). Linking etiologies in humans and animal models: Studies of autism. \u003cem\u003eReproductive Toxicology\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(2\u0026ndash;3), 417\u0026ndash;422. https://doi.org/10.1016/S0890-6238(97)80001-U\u003c/li\u003e\n \u003cli\u003eRohman, M., \u0026amp; Wingfield, J. (2016). Chapter 3 within Drug Discovery. \u003cem\u003eNew York\u003c/em\u003e, \u003cem\u003e1439\u003c/em\u003e, 47\u0026ndash;63. https://doi.org/10.1007/978-1-4939-3673-1\u003c/li\u003e\n \u003cli\u003eRoullet, F. I., Lai, J. K. Y., \u0026amp; Foster, J. A. (2013). In utero exposure to valproic acid and autism - A current review of clinical and animal studies. \u003cem\u003eNeurotoxicology and Teratology\u003c/em\u003e, \u003cem\u003e36\u003c/em\u003e, 47\u0026ndash;56. https://doi.org/10.1016/j.ntt.2013.01.004\u003c/li\u003e\n \u003cli\u003eRoullet, F. I., Wollaston, L., deCatanzaro, D., \u0026amp; Foster, J. A. (2010). Behavioral and molecular changes in the mouse in response to prenatal exposure to the anti-epileptic drug valproic acid. \u003cem\u003eNeuroscience\u003c/em\u003e. https://doi.org/10.1016/j.neuroscience.2010.06.069\u003c/li\u003e\n \u003cli\u003eSandhya, T., Sowjanya, J., \u0026amp; Veeresh, B. (2012). Bacopa monniera (L.) Wettst ameliorates behavioral alterations and oxidative markers in sodium valproate induced autism in rats. \u003cem\u003eNeurochemical Research\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e(5), 1121\u0026ndash;1131. https://doi.org/10.1007/s11064-012-0717-1\u003c/li\u003e\n \u003cli\u003eServadio, M., Melancia, F., Manduca, A., Di Masi, A., Schiavi, S., Cartocci, V., Pallottini, V., Campolongo, P., Ascenzi, P., \u0026amp; Trezza, V. (2016). Targeting anandamide metabolism rescues core and associated autistic-like symptoms in rats prenatally exposed to valproic acid. \u003cem\u003eTranslational Psychiatry\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(9), 1\u0026ndash;11. https://doi.org/10.1038/tp.2016.182\u003c/li\u003e\n \u003cli\u003eToxicol, A., Baumann, J., Gassmann, K., Masjosthusmann, S., Deboer, D., Bendt, F., Giersiefer, S., \u0026amp; Fritsche, E. (2015). Comparative human and rat neurospheres reveal species differences in chemical effects on neurodevelopmental key events. \u003cem\u003eArchives of Toxicology\u003c/em\u003e. https://doi.org/10.1007/s00204-015-1568-8\u003c/li\u003e\n \u003cli\u003eVandita Singh, Hakikulla H. Shah, G. J. G. (2017). Neuroprotective Effect of Ashwagandha (roots of Withania somnifera): The Rejuvenator. \u003cem\u003eThe Canadian Journal of Clinical Nutrition\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(2), 34\u0026ndash;51. https://doi.org/10.14206/canad.j.clin.nutr.2017.02.04\u003c/li\u003e\n \u003cli\u003eVarghese, M., Keshav, N., Descombes, S. J., Warda, T., Wicinski, B., Dickstein, D. L., Nicolas, H. H., Rubeis, S. De, Drapeau, E., Buxbaum, J. D., Hof, P. R., \u0026amp; Knock-in, K. I. (2017). Autism spectrum disorder : neuropathology and animal models. \u003cem\u003eActa Neuropathologica\u003c/em\u003e, \u003cem\u003e134\u003c/em\u003e(4), 537\u0026ndash;566. https://doi.org/10.1007/s00401-017-1736-4\u003c/li\u003e\n \u003cli\u003eWagner, G. C., Reuhl, K. R., Cheh, M., McRae, P., \u0026amp; Halladay, A. K. (2006). A new neurobehavioral model of autism in mice: Pre- and postnatal exposure to sodium valproate. \u003cem\u003eJournal of Autism and Developmental Disorders\u003c/em\u003e, \u003cem\u003e36\u003c/em\u003e(6), 779\u0026ndash;793. https://doi.org/10.1007/s10803-006-0117-y\u003c/li\u003e\n \u003cli\u003eWalker, J. M. (n.d.). \u003cem\u003eIn Vitro Neurotoxicology\u003c/em\u003e.\u003c/li\u003e\n \u003cli\u003eXiong, F., Gao, H., Zhen, Y., Chen, X., Lin, W., Shen, J., Yan, Y., Wang, X., Liu, M., \u0026amp; Gao, Y. (2011). Optimal time for passaging neurospheres based on primary neural stem cell cultures. \u003cem\u003eCytotechnology\u003c/em\u003e, \u003cem\u003e63\u003c/em\u003e(6), 621\u0026ndash;631. https://doi.org/10.1007/s10616-011-9379-0\u003c/li\u003e\n \u003cli\u003eZhou, Q., Dalgard, C. L., Wynder, C., \u0026amp; Doughty, M. L. (2011). Neuroscience Letters Valproic acid inhibits neurosphere formation by adult subventricular cells by a lithium-sensitive mechanism. \u003cem\u003eNeuroscience Letters\u003c/em\u003e, \u003cem\u003e500\u003c/em\u003e(3), 202\u0026ndash;206. https://doi.org/10.1016/j.neulet.2011.06.037\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Valproic acid, Neurospheres, Neurodevelopmental toxicity, Autism, Drug screening, In vitro model","lastPublishedDoi":"10.21203/rs.3.rs-6809301/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6809301/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eValproic acid (VPA) is an antiepileptic drug known to cause autism when consumed during pregnancy. Autism is a complex neurodevelopmental disorder of early-onset, highly variable in its clinical presentation. In spite of well validated animal model for autism, screening compounds is time consuming, laborious and challenging. In utero VPA exposure in rodents leads to autism-like behavioral defects in their offspring. Therefore, we attempted to establish a VPA-induced neurodevelopmental toxicity model employing neural stem cells/neurospheres (in vitro). In this study, we investigated the defects in neurospheres with direct exposure to VPA. Neuronal precursor cells were collected from time pregnant Sprague Dawley rats and allowed to generate free floating neurospheres. Neurospheres were treated with VPA (0.5mM, 1mM, and 2mM) for 7 days with daily observation and were investigated for cytotoxicity, proliferation, gene expression, and differentiation pattern. Since the marketed drugs available for autism only rescues symptoms with no effect on molecular phenotypes of autism, the model system was validated using two known neuroprotective herbal drugs Withania somnifera and Bacopa monnieri. The VPA exposure in neurospheres did not cause any significant alteration in LDH release, indicating no cytotoxicity of VPA (up to 2mM), however, a decrease in proliferation of neurospheres with significant alteration in the expression level of high-risk genes for autism was observed with VPA treatment. VPA treated neurospheres showed poor differentiation with decreased neurite outgrowth. The neuroprotective herbal drugs were able to rescue the neurospheres against VPA toxicity in terms of proliferation and differentiation. The study was substantiated with an established zebrafish in vivo model. Thus, this study provides insight towards developing an in vitro system for the preliminary drug screening against VPA induced neurodevelopmental toxicity and autism. However, further exploration of the mechanism might be needed to validate the utility of neurospheres for target-specific screening.\u003c/p\u003e","manuscriptTitle":"Characterization and optimization of neurosphere culture as in vitro screening tool against valproic acid-induced neurodevelopmental toxicity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-10 05:45:45","doi":"10.21203/rs.3.rs-6809301/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"901530bc-da4e-48a5-818f-f5ee30f70bdd","owner":[],"postedDate":"July 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-10T05:45:46+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-10 05:45:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6809301","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6809301","identity":"rs-6809301","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}