NR4A1 Modulates Glioblastoma Sensitive to Erastin-Induced Ferroptosis via NCOA4 mediated Autophagy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article NR4A1 Modulates Glioblastoma Sensitive to Erastin-Induced Ferroptosis via NCOA4 mediated Autophagy Baodong Chen, Rikang Wang, Zhi Liang, Sufang Zhong, Weixian Zeng, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8304233/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Autophagy-mediated ferritin degradation (ferritinophagy) is recognized as a critical driver of ferroptosis; however, the molecular circuitry linking selective autophagy to ferroptosis in glioma remains incompletely defined. Here, we demonstrate that the orphan nuclear receptor NR4A1 as an essential orchestrator of autophagy initiation during ferroptosis. Analysis of TCGA data revealed that lower NR4A1 expression correlates with higher glioma grade and worse patient prognosis. Knockdown of NR4A1 confers robust resistance to erastin-induced ferroptosis in human glioma cells.Mechanistically, erastin exposure triggers a rapid NR4A1-dependent cytoplasmic translocation, enabling direct interaction with the cargo receptor NCOA4. This interaction facilitates the autophagic sequestration and lysosomal degradation of ferritin, thereby amplifying the intracellular ferrous iron pool and propagating lipid peroxidation-driven ferroptosis. NR4A1 knockdown disrupts this axis, resulting in ferritin retention, diminished ferrous iron availability, and suppression of reactive oxygen species (ROS) generation. Conversely, Overexpression of NR4A1 up-regulates NCOA4 expression, and accelerates ferritinophagy, culminating in heightened ferroptotic sensitivity. Pharmacological inhibition of autophagy or knockdown of ATG7 substantially mitigates erastin-induced ferroptosis by diminishing NR4A1-mediated accumulation of intracellular ferrous iron and ROS. In vivo orthotopic xenograft models employing U87MG and GL261 glioblastoma cells stably expressing NR4A1-targeting shRNA corroborate these findings: tumors with NR4A1 depletion exhibit diminished autophagic activity, reduced ferritin turnover, and marked resistance to erastin-mediated ferroptosis, leading to accelerated tumor growth. Conversely, pharmacological activation of NR4A1 by the Cytosporone B (Csn-B) restrains malignant progression and significantly prolongs survival in glioma models.Collectively, our data establish NR4A1 as a pivotal molecular switch that couples autophagy induction to ferritinophagy-dependent ferroptosis in glioma cells and position NR4A1 pharmacology as a therapeutic strategy for enhancing ferroptosis in aggressive glioblastoma. Biological sciences/Cell biology/Cell death Biological sciences/Cancer/CNS cancer Glioblastoma NR4A1 NCOA4 Ferroptosis Autophagy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Glioma is the most common intracranial malignant tumor, accounting for approximately 33% of central nervous system (CNS) tumors[ 1 ]. According to the World Health Organization (WHO) grading system, gliomas are classified into four grades based on histologic features, ranging from low-grade (I and II) to high-grade (III and IV) gliomas[ 2 ]. Patients with glioma generally have a poor prognosis, especially those suffering from WHO grade IV glioblastoma (GBM). Studies have shown that it is challenging to inhibit GBM cells using chemical drugs alone[ 3 ]. Therefore, there is a pressing need to develop new therapeutic targets to enhance the effectiveness of GBM treatment. Recent studies have indicated that ferroptosis is one of the major types of programmed cell death in gliomas. Higher levels of free iron have been observed in gliomas compared to other brain tumors[ 4 ]. Thus, elucidating the molecular mechanisms of ferroptosis involved in the progression of GBM may help improve the effectiveness of GBM treatment. Nuclear receptor subfamily 4 group A member 1 (NR4A1) has emerged as a major regulator of cancer cell survival[ 5 ]. NR4A1 is a nuclear receptor that participates in various biological processes, including cell proliferation, differentiation, and apoptosis. NR4A1 can exhibit both tumor suppressive and pro-oncogenic effects, depending on the tumor type and context. Inhibition of nuclear NR4A1 and its nuclear export has been shown to suppress tumor cell proliferation and promote apoptosis[ 6 ]. NR4A1 has also been reported to induce autophagy-dependent cell death[ 7 , 8 ]. The autophagy-mediated degradation of ferritin (ferritinophagy) has been shown to promote glioma cell death through ferroptosis[ 9 ]. NCOA4 acts as a selective cargo receptor for the autophagic turnover of ferritin (ferritinophagy), which is critical for iron homeostasis[ 10 , 11 ]. However, whether NR4A1 regulates ferritinophagy and its role in ferroptosis remains unclear. Erastin can induce ferroptosis by triggering multiple pathways and has demonstrated potential in cancer therapy[ 12 , 13 ]. Inducing ferroptosis in GBM has been shown to achieve good therapeutic effects[ 14 ]. NR4A1 has rarely been studied in the context of gliomas. Recently, master regulator analysis of differentially expressed genes between cerebellar GBM and proneural supratentorial GBM revealed NR4A1 as a potential therapeutic target[ 15 ]. Further research is needed to understand the molecular mechanisms of NR4A1 involved in GBM, which may aid in treating the disease. In this study, we demonstrated that decreased NR4A1 expression in human gliomas correlates with poor prognosis. Genetic inhibition of NR4A1 inhibited ferritin degradation and erastin-induced ferroptosis of glioma cells both in vitro and in vivo. Overexpression of NR4A1 increased ferritin degradation and promoted ferroptosis. Knockdown of autophagy-related 7 (Atg7) limited NR4A1 overexpression-induced ferroptosis, resulting in decreased intracellular ferrous iron levels and lipid peroxidation. Our results suggest that NR4A1 may play a unique role in regulating ferroptosis and erastin-mediated anticancer therapy. We aim to provide a new perspective and therapeutic target for glioma treatment. Materials and Methods TCGA data collection and analysis Transcriptional profiles and clinical information of glioma patients from TCGA-glioma database were downloaded from the UCSC XENA website ( https://xenabrowser.net/ ). Raw count data were transformed to FPKM. Clinical information (age and gender), molecular features of gliomas (IDH status, chromosome 1p/19q co-deletion status, methylation status of MGMT promoter, and subtype), and the expression level of NR4A1 of glioma patients were visualized as a heatmap by using “pheatmap” R package. GSEA enrichment analysis was performed by GSEA v4.4.0 software ( https://www.gsea-msigdb.org ). Cell Culture The patient-derived primary GBM cell line TBD0220 were originally obtained from Tianjin Medical University General Hospital and cultured as described by Kang et al[ 16 ]. Human GBM cell lines U87MG and U251 were cultured in DMEM medium supplemented with 10% fetal bovine serum (Gibco, USA). NSC (neural stem cells) and GSC (glioma stem cells) were cultured in Neurobasal™ Medium (Gibco, Thermo Fisher Scientific) supplemented with 2% B27 Neuro Mix (Thermo Fisher Scientific), 10 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Rocky Hill, NJ, USA), and 20 ng/mL epidermal growth factor (EGF; Thermo Fisher Scientific). The mouse GBM cell line GL261 was cultured in DMEM medium containing 10% fetal bovine serum (Gibco, USA). All cells were maintained at 37°C in a 5% CO₂ humidified incubator with 20% O₂. SiRNA Transfections Gene-specific and negative control siRNAs were synthesized by GenePharma (Shanghai, China) and transfected into U87MG and U251 cells for 48 hours using Lipofectamine 3000 (Thermo Fisher Scientific, USA) according to the manufacturer’s protocol. Detailed protocols are provided in the Supplementary “Materials and Methods.” The following siRNA sequences were used to target the indicated RNAs: NR4A1 #1 (5’-CCUUCAAGUUCGAGGACUUTT-3’) and NR4A1 #2 (5’-GAAGAUGCCGGUGACGUGCAACAAU-3’); ATG5 (5’-CCTTTGGCCTAAGAAGAAA-3’); ATG7 #1 (5’-GGAGTCACAGCTCTTCCTT-3’). Western blotting was used to evaluate siRNA knockdown efficiency. shRNA Transfections Short hairpin RNAs (sh-NR4A1) with sequences 5’-CCUUCAAGUUCGAGGACUUTT-3’ and 5’-GCTTCGGCGTCCTTCAAGTTT-3’ were ligated into the lentiviral vector pLKO.1 containing a puromycin resistance cassette (Genechem Co., Ltd., Shanghai, China). Luciferase-expressing U87MG, U251, and P3#GL261 cells were infected with the shRNA lentiviruses. After 48 hours, the medium was replaced with fresh medium containing 2 µg/mL puromycin (Thermo Fisher Scientific) for selection over an additional 2 weeks to enrich for cells harboring the constructs. Western blotting was performed to assess shRNA knockdown efficiency, and cells were split for different assays. Cell Viability Assay Cell viability in U87MG and U251 cells was assessed using the Cell Counting Kit-8 (CCK-8) assay (Solarbio, China) according to the manufacturer’s protocol. Cells were seeded at 3×10³ cells/well in 96-well plates and treated as indicated. CCK-8 solution (10 µL) was added to each well, and the plates were incubated for 1 hour at 37°C. The optical absorbance in each well was measured at 450 nm (OD450) using a microplate reader (Thermo Fisher Scientific, USA). Immunofluorescence Mouse brains were fixed in 4% paraformaldehyde (P1110, Solarbio) for 24 hours, followed by incubation in a 30% sucrose solution (S112228, Rhawn) for 48 hours. The brains were then snap-frozen and cryosectioned at 8 µm thickness. Sections were permeabilized in 0.5% Triton X-100 (T8200, Solarbio Co., Ltd., Beijing, China) for 30 minutes and blocked with PBS containing 3% goat serum (SL038, Solarbio) for 1 hour at room temperature. Sections were incubated overnight at 4°C with primary antibodies. After three washes with PBS (10 minutes each), sections were incubated with respective secondary antibodies for 2 hours, including goat anti-mouse IgG (ab150113, AlexaFluor-488, Abcam) and goat anti-rabbit IgG (ab150100, AlexaFluor-594, Abcam). Sections were imaged using a fluorescent microscope at 400× magnification. Western Blotting Analysis Cells and brain tissues were lysed in ice-cold RIPA buffer containing protease inhibitors. Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Germany). The membranes were blocked with 5% skim milk (D8340, Solarbio Co., Ltd., Beijing, China) and incubated overnight at 4°C with primary antibodies. The primary antibodies used were as follows: rabbit anti-β-actin (AC026, 1:80,000, Abclonal, China), rabbit anti-GAPDH (A19056, 1:50,000, Abclonal, China), mouse anti-NCOA4 (sc-373739, 1:500, Santa Cruz, USA), mouse anti-ferritin heavy chain (sc-376594, 1:1,000, Santa Cruz), mouse anti-ATG5 (sc-133158, 1:1,000, Santa Cruz), mouse anti-ATG7 (sc-376212, 1:1,000, Santa Cruz), rabbit anti-NR4A1 (3960S, 1:1,000, Cell Signaling Technology, USA), rabbit anti-ACSL4(A6826,1:1000,abclonal,China),mouse anti-GPX4(sc-166570,1:1000, Santa Cruz),rabbit,anti-Beclin1(11306-1-AP,1:1000, Proteintech, China),and rabbit anti-LC3 (14600-1-AP, 1:1,000, Proteintech, China). Co-immunoprecipitation (CO-IP) assay The Co-IP assay was performed with Pierce Classic Magnetic immunoprecipitation (IP)/Co-IP Kit (Absin, China) according to the manufacturer’s instruction. Briefly, the specific primary antibodies were incubated with protein A/G magnetic beads. The cell lysates were collected and incubated with antibody-beads complex. The beads interacting proteins were washed and denatured, thenthe proteins were examined by western blotting. Quantitative Real-Time PCR Total RNA was extracted using TRIzon Reagent (Invitrogen, USA) according to the manufacturer's protocol. Reverse transcription was performed using the First-Strand cDNA Synthesis Kit (18091050, Thermo Fisher Scientific Co., Ltd., USA). Real-time PCR was conducted with SYBR Green PCR Master Mix (Yeasen Biotech Co., Ltd., Shanghai, China) under the following conditions: 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds. Real-time PCR was performed on the ABI 7500 system. Gene expression levels were normalized to β-actin expression. Primer sequences are listed in Table 1 . Table 1 Primer sequences used for qRT-PCR Gene Primer Sequence, 5′ -3′ Gene Primer Sequence, 5′ -3 LC3 F-TTGAGCTGTAAGCGCCTTCTA ATG5 F-AAAGATGTGCTTCGAGATGTGT R-GATGTCCGACTTATTCGAGAGC R-CACTTTGTCAGTTACCAACGTCA GAPDH F-AGAAGGCTGGGGCTCATTTG ATG7 F-CAGTTTGCCCCTTTTAGTAGTGC R-AGGGGCCATCCACAGTCTTC R- CCAGCCGATACTCGTTCAGC FTH1 F- TCCTACGTTTACCTGTCCATGT NCOA4 F- GAGGTAGTGATGCACGGAG R-GTTTGTGCAGTTCCAGTAGTGA R- GACGGCTTATGCAACTGTGAA NR4A1 F- AGGGCTGCAAGGGCTTCT R-GGCAGATGTACTTGGCGTTTTT Human Glioma Samples All patient samples were collected with written informed consent under protocol (Approval No.2022-162A,Oct.27.2022) approved by Peking University Shenzhen Hospital, Shenzhen, China. All glioma specimens were classified by two experienced clinical pathologists according to the WHO Classification of Tumors guidelines. The clinical and pathological characteristics are summarized in the Table 2 . Table 2 Clinical information of patients with glioma No. Gender Age Lesion area Pathologic Grade 1# Female 51 Frontal gyrus WHO II 2# Male 37 Left temporal island WHO II 3# Male 31 Right parietal lobe WHO II 4# Female 31 Right frontotemporal lobe WHO II 5# Male 33 Right front temporal WHO II 6# Female 46 Left temporal lobe WHO II 7# Female 56 Left frontal lobe WHO IV(Glioblastoma) 8# Female 45 Left temporal lobe WHO IV(Glioblastoma) 9# Female 46 Left cerebellar hemisphere WHO IV(Glioblastoma) 10# Male 52 Left temporal lobe WHO IV(Glioblastoma) 11# Female 63 Left parieto-occipital region WHO IV(Glioblastoma) 12# Male 54 Left forehead WHO IV(Glioblastoma) 13# Female 62 Right front temporal WHO IV(Glioblastoma) 14# Female 56 Bilateral frontal corpus callosum WHO IV(Glioblastoma) Immunohistochemistry Assay Mouse brain glioma tissues and human glioma patient samples were fixed in 4% paraformaldehyde, processed into 5-µm-thick sections, and immunostained with specific antibodies. The percentage of positive cells was calculated by counting under high magnification (×400). The primary antibodies used were rabbit anti-NR4A1 (3960S, 1:200, Cell Signaling Technology, USA), mouse anti-NCOA4 (sc-373739, 1:200, Santa Cruz), and rabbit anti-Ki67 (AF0198, 1:200, Affinity, China). Sections were rinsed with PBS (3 × 5 minutes) and incubated with goat anti-rabbit secondary antibody (ZSGB-Bio). Antigens were visualized using the hydrogen peroxide substrate 3,3'-diaminobenzidine (DAB, ZSGB-Bio), and slides were counterstained with hematoxylin (Beyotime, Shanghai, China) at 25°C for 2 minutes. For negative controls, sections were incubated with normal goat serum instead of primary antibody. Cellular and Mitochondrial Ferrous Iron Detection Levels of cellular and mitochondrial ferrous iron were assessed using FerroOrange probes (Dojindo) and Mitotracker™ Deep Red FM (Invitrogen, USA) according to the instructions. Briefly, cells were plated on confocal dishes (2.5 × 10⁵ cells/well) and treated as described. After treatment, cells were washed three times with HBSS, stained with 1 µM FerroOrange and 300 nM Mitotracker™ Deep Red FM for 30 minutes at 37°C in a 5% CO₂ incubator, and then washed three times with HBSS. Images were captured using a Leica STELLARIS5 confocal microscope (Leica, Germany). Iron and MDA Assay Ferrous iron concentration and lipid peroxidation levels were analyzed in mouse brain glioma tissues using ferrous iron assay kits (BC5415, Solarbio, China) and malondialdehyde (MDA) assay kits (BC0025, Solarbio, China), respectively. Tissue samples were analyzed according to the manufacturer's protocols. TUNEL Assay Tissue samples were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) and embedded in paraffin. TUNEL staining was performed using a One-Step TUNEL Apoptosis Assay Kit (Beyotime, C1086, Shanghai, China) according to the manufacturer's protocol. Images were acquired using a Leica DM4B microscope (Leica, Germany). Mitochondrial Membrane Potential Assay Mitochondrial membrane potential in U87MG cells was detected using the JC-1 Assay Kit (Beyotime) according to the manufacturer's protocol. Cells were stained with JC-1 working solution for 20 minutes at 37°C in an incubator and analyzed using confocal microscopy (Leica SP8 confocal microscope; Leica Microsystems). The intensities of red (excitation: 530 nm; emission: 590 nm) and green fluorescence (excitation: 485 nm; emission: 528 nm) were measured. Assays were performed in triplicate, and fluorescence intensities were calculated using ImageJ software. Lipid Peroxidation Measurement To visualize lipid peroxidation, U87MG or U251 cells (2.5 × 10⁵ cells/well) were seeded in confocal dishes (Nest, China). After 24 hours of treatment, cells were stained with 10 µM C11-BODIPY581/591 probe (Invitrogen, USA) according to the manufacturer's instructions. Cells were then washed with PBS and observed using a Leica STELLARIS5 confocal microscope (Leica, Germany). Animal studies Experimental animals were maintained in a specific pathogen-free environment of controlled temperature (21–24℃) and 12-h light/12-h dark cycle. All animal experiments were approved by the Ethics Committee of Shenzhen PKU-HKUST Medical Center. For subcutaneous GBM xenografts, six-week-old male NOD-SCID mice were purchased from GemPharmatech Co., Ltd. U87-shCtrl and U87-shNR4A1 cells were labeled with GFP-expressing lentivirus. For subcutaneous xenografts, 5 × 10⁶ cells in 100 µL of PBS/Matrigel (356231, Corning, USA) were injected into the right armpit of the mice. Tumor diameters were measured using calipers, and tumor volume was calculated using the formula: 4/3π × ( d /2) 2 × ( D /2), where d and D represent the minor and major tumor axes, respectively. For intracranial GBM xenografts, six-week-old male C57BL/6J mice were purchased from GemPharmatech Co., Ltd. GL261-shCtrl and GL261-shNR4A1 cells, lentivirally transduced with firefly luciferase, were implanted into the frontal subdural region. 1.5 × 10⁵ GBM cells in 5 µL of PBS were delivered into the corpus striatum of the right hemisphere via stereotactic injection (coordinates: antero-posterior = -0.14 mm; medio-lateral = + 2.0 mm; dorso-ventral = -3.0 mm). Intracranial tumor growth was monitored by bioluminescence imaging (BLI) using an IVIS Lumina LT system (Perkin Elmer, USA). Each mouse was intraperitoneally injected with 10 mg of D-luciferin (YEASEN, China) before imaging. For NR4A1 agonist treatment in intracranial GBM models, Cytosporone B (Csn-B, HY-N2148, MedChemExpress) was dissolved in DMSO and diluted with normal saline containing 5.0% (V/V) Tween-80 to a final concentration of 0.05 mg/mL. Normal saline with DMSO and 5.0% Tween-80 was used as the vehicle control. Each mouse was intraperitoneally injected with 250 µL of Csn-B every two days for a total of 10 days. Statistical analysis Data are presented as means ± SEM based on 3 to 5 independent experiments. Differences between control and experimental conditions were evaluated using one-way ANOVA followed by Tukey's multiple comparisons test. For analyses involving two factors, a two-way ANOVA with Bonferroni's post hoc test was employed. All statistical analyses were performed using SPSS 24.0 software (IBM Corp.). Kaplan-Meier survival curves were compared using the log-rank test to assess differences in survival between groups. Results are expressed as mean ± SD, and all experiments were repeated at least three times independently. A p-value of less than 0.05 was considered statistically significant. Results NR4A1 expression is decreased in human gliomas and correlates with poor prognosis Firstly, we interrogated the glioma cohort from the Cancer Genome Atlas (TCGA) database to investigate the clinical role of NR4A1 in the malignant progression of gliomas. As shown in Fig. 1 A, GBMs with higher WHO grade had a lower expression level of NR4A1. IDH mutations and chromatin 1p/19q co-deletion are characteristic features of low-grade gliomas, in which high levels of NR4A1 were detected. Furthermore, the expression level of NR4A1 was higher in gliomas with methylated promoter of MGMT and proneural subtype (Supplementary Fig. 1). By performing univariate Cox regression analysis, we identified that NR4A1 was a bona fide protective factor for glioma outcomes, compared with those risk factors including IDH-WT, chromatin 1p/19q non-co-deletion, and unmethylated promoter of MGMT (Fig. 1 B). Kaplan-Meier curve confirmed that significant shortened overall survival time was observed in glioma patients with low level of NR4A1 (Fig. 1 C), especially combined with methylated promoter of MGMT (Fig. 1 D). Western blot analysis also showed decreased NR4A1 protein levels in high-grade glioma specimens compared to low-grade ones (Fig. 1 E-F). qRT-PCR analysis demonstrated significantly reduced NR4A1 mRNA levels in glioma cell lines U87MG, U251, and GSC compared to neural stem cells (NSCs) and normal human astrocytes (NHAs) (Fig. 1 G). Additionally, IHC analysis indicated lower NR4A1 expression in high-grade gliomas than in low-grade gliomas (Fig. 1 H-I). Overall, these findings suggest that NR4A1 plays a key role in glioma progression. Knockdown of NR4A1 enhanced glioma cell resistance to erastin-induced ferroptosis To figure out the functional role of NR4A1 in gliomas, we performed GSEA analysis to enrich the signaling pathways which correlates with NR4A1 expression. The result showed that “ferroptosis” pathway was enriched, indicating that NR4A1 regulated ferroptosis in gliomas (Fig. 2 A). So we utilized U87MG and U251 cells to construct NR4A1 knockdown or overexpressed cells via GV248-NR4A1 shRNA or GV492-NR4A1 lentiviruses transfection. Knockdown and overexpression efficiencies were confirmed via western blot analysis (Supplementary Fig. 2A). We investigated NR4A1’s effect on erastin-induced ferroptosis by treating U87MG and U251 cells with various erastin doses for 24 h. Results showed erastin induced a dose-dependent ferroptotic cell death, which was largely reversed by NR4A1 knockdown, making cells resistant to ferroptosis (Fig. 2 B-C),and representative images showed that loss of NR4A1 reduced erastin-induced cell death (Supplementary Fig. 2B). In contrast, overexpression of NR4A1 significantly increased erastin-induced ferroptosis in U87MG cells(Fig. 2 D). Consistent with previous findings, we found that RSL3 does dependent induced ferroptosis of U251 cells, whereas knockdown of NR4A1 had no effect on RSL3-induced ferroptotic cell death(Fig. 2 E). Using C11-BODIPY581/591 probes to detect lipid peroxidation, we found that green fluorescence (indicating oxidation) increased and red fluorescence (indicating non-oxidation) decreased after NR4A1 knockdown. These results suggest that while erastin induces ROS accumulation, NR4A1 downregulation reverses erastin-induced lipid peroxidation (Fig. 2 F-H). To further investigated the role of NR4A1 on erastin-induced cytotoxic efficacy in glioma cells. EdU assays were performed to evaluate cell proliferation. Erastin notably inhibited cell proliferation, while the cell proliferation of U251 and TBD0220 GBM cells transfected with sh-NR4A1 was also reduced in EdU experiments (Fig. 2 I-L). NR4A1 regulates iron-dependent peroxidation in ferroptosis through NCOA4 pathway To explore whether NR4A1 knockdown reduces iron accumulation during ferroptosis in GBM cells, intracellular iron levels were measured in si-NR4A1-transfected U87MG cells. As shown in supplementary Fig. 1C, the efficiency of knockdown was detected by western blotting analysis. intracellular iron levels decreased by approximately 35% in erastin-treated U87MG cells with NR4A1 loss (Fig. 3 A–B). Given the involvement of mitochondrial iron accumulation and mitochondrial reactive oxygen species (mtROS) in lipid peroxidation, immunofluorescence colocalization techniques were used to detect Fe²⁺ expression in the mitochondria of U87MG cells. Results showed that erastin treatment reduced the number of mitochondria (red), while pronounced green fluorescence was observed in the cytoplasm. Immunofluorescence staining revealed that Fe²⁺ levels in the cytoplasm and mitochondria were significantly increased after erastin treatment, and these effects were reversed by NR4A1 silencing (Fig. 3 A–C). To explore whether NR4A1 downregulation affects mitochondrial activity and confers resistance to erastin-induced ferroptosis, we observed a fragmented mitochondrial phenotype in erastin-treated U87MG cells via confocal- fluorescence microscopy, whereas NR4A1 shRNA cells showed less mitochondrial fragmentation around the nucleus in response to erastin toxicity (Supplementary Fig. 2C-D).We further assessed mitochondrial membrane potential (ΔΨm) by monitoring the red-to-green fluorescence ratio of the JC-1 dye. Under healthy, polarized conditions, JC-1 accumulates as red-fluorescent J-aggregates within mitochondria; upon depolarization it shifts to the green-fluorescent monomeric form. In U87MG cells transfected with shNR4A1, this ratio fell markedly, indicating ΔΨm dissipation and reduced dye aggregation within the organelles (Fig. 3 D-E). We next examined the effect of knocking down or overexpress of NR4A1 on the expressions of ferroptosis-related proteins including Acyl-CoA synthetase long chain family member 4 (ACSL4), nuclear receptor coactivator 4 (NCOA4) and glutathione peroxidase 4 (GPX4) in U87MG cells with erastin or RSL-3 treatment. Western blots results showed much higher NCOA4 protein expression in erastin-treated cells, silencing NR4A1 significantly decreased the basal and erastin-induced expression of NCOA4 as well as RSL3-induced expression of ACSL4, but there was no significant change for ACSL4 and GPX4 expression after erastin treatment(Fig. 3 F). To further investigate whether NR4A1 regulates ACSL4 expression in erastin-treated glioma cells. We transfected U87MG cells with GV248-NR4A1 to down-regulate or GV492-NR4A1 lentiviruses to up-regulate NR4A1, our results confirmed showed NR4A1 had no effect on ACSL4 level in the U87MG cells after the erastin treatment(Fig. 3 G-H). NR4A1 regulates NCOA4 mediating autophagic delivery of ferritin to lysosomes The cargo receptor NCOA4 promotes ferritin degradation through ferritinophagy, which is involved in iron metabolism and ferroptosis. We therefore investigated whether NCOA4 was involved in ferroptosis induced by the NR4A1. Immunofluorescence staining showed increased NR4A1 expression in both the cytoplasm and mitochondria of U87MG cells, and NR4A1(red) was colocalized with NCOA4 (green)-positive puncta in the cytoplasm(Fig. 4 A-B), but no changes in NR4A1 protein expression after erastin treatment(Supplementary Fig. 3A). Confocal images showing colocalization of NR4A1 (red), Hsp60(green), and DAPI (blue) in U87MG cells (Supplementary Fig. 3B). Ferritin heavy polypeptide 1 (FTH1), a substrate of ferritinophagy, is the primary iron storage protein complex in cells. Our results demonstrated that basal FTH1 levels increased in U87MG cells transfected with NR4A1 shRNAs. Moreover, erastin stimulated NCOA4 expression in a dose- dependent manner (Supplementary Fig. 3C). NCOA4 protein levels decreased while FTH1 levels markedly increased in erastin-treated U87MG cells transfected with NR4A1 shRNA1 (Fig. 4 D–E). To further investigate whether NCOA4/FTH1 signaling was involved in ferroptosis induced by the NR4A1, GV492-NR4A1 was used to overexpress NR4A1 in U87MG cells. Our results showed basal NCOA4 level significantly increased while FTH1 level decreasedafter erastin treatment. NCOA4 expression was also enhanced in erastin-treated U87MG cells overexpressing NR4A1 (Fig. 4 F-G). These results suggest that NR4A1 deficiency inhibits NCOA4-induced iron upregulation. Co-immunoprecipitation (Co-IP) was used to validate the interaction between NR4A1 and NCOA4 in U87MG cells. U87MG cells were transfected with sh-NR4A1 or Lv-NR4A1. We found that NCOA4 binding to FTH1 was reduced in sh-NR4A1 cells but induced in Lv-NR4A1 cells (Fig. 4 H-I), suggesting that knockdown of NR4A1 reduced the degradation of FTH1 by NCOA4. The role of NR4A1 in affecting autolysosome formation was further determined by a lentivirus expressing GFP/mCherry-EGFP-LC3B. U87MG cells were first transfected with GFP/mCherry-LC3 for 48 h and then si-NR4A1 for 24 h. The co-localization of green (GFP) and red fluorescence (mCherry) occurs in the formation of autophagosomes displaying yellow. Our results showed erastin treatment significantly increased the autophagosomes formation as exhibited by increase in number of vesicles positive for yellow fluorescence, which was reversed by NR4A1 knockdown (Fig. 4 J-K). This suggested that loss of NR4A1 decreases autophagic flux by diminishing the autophagosome formation. NR4A1 induces autophagy and NCOA4-mediated degradation of ferritin in GBM cells Western blot and quantitative real-time PCR analyses were used to measure the markers of autophagosomes(LC3B-II) and autophagy(ATG5/ATG7). Our results demonstrated that erastin stimulated the protein expression of ATG7. In contrast, NR4A1 knockdown inhibited erastin-induced expression of ATG7 but not ATG5 (Fig. 5 A-B). Additionally, erastin treatment increased Atg5 , Atg7,LC3 and NCOA4 mRNA levels which were also reversed by NR4A1 knockdown (Fig. 5 C–F). We examined whether NR4A1 overexpressing led to changes in ATG7 and LC3B-II levels, the results showed ATG7 and LC3B-II were significantly increased in GV492-NR4A1 transfected U87MG cells, and the expressions of ATG7 and LC3B-II were enhanced after treatment with erastin in the GV492-NR4A1 transfected cells (Fig. 5 G-I). Autophagy-related (Atg) genes play a central role in regulating ferritinophagy. We further investigated whether knockout of Atg5 or Atg7 is involved in NR4A1-regulated ferroptosis. GBM cells (U251 and U87MG) were transfected with lentiviruses GV492-NR4A1 for 36 h to overexpress NR4A1, followed by transfection with specific siRNAs to suppress ATG5/ATG7 expression. As shown in supplementary Fig. 3D-E, ATG5 siRNA and ATG7 siRNA obviously blocked the expression of ATG5 and ATG7 in U87MG cells, respectively. Intracellular iron levels were assessed, and results showed that ATG7 knockout, but not ATG5 knockout, inhibited erastin-induced intracellular iron levels compared to the NC group (Fig. 5 J-K). Western blot analysis revealed that in ATG7-deficient U87MG and U251 cells, FTH1 protein levels markedly increased while NCOA4 levels significantly decreased (Fig. 5 M). This suggests that ATG7-mediated autophagy is essential for ferritin degradation induced by NR4A1. We also explored the effect of autophagy on NR4A1-induced ferroptosis in U87MG cells. GV492-NR4A1 transfected U87MG cells were treated with 3-MA or chloroquine (CQ) for 24 h, and cell viability was examined using the CCK-8 assay. Results indicated that erastin induced ferroptotic cell death, which was largely reversed by 3-MA but not CQ treatment (Fig. 5 L). To investigate autophagic flux in NR4A1-induced ferritinophagy after erastin treatment, NR4A1-overexpressing U87MG cells were treated with 3-MA or CQ for 24 h. Western blot results showed that 3-MA prevented autophagosome assembly and inhibited the conversion of LC3B-I to LC3B-II (Fig. 5 N). In contrast, CQ interfered with autophagy progression by inhibiting autophagosome-lysosome fusion, leading to LC3B-II accumulation (Fig. 5 N). CQ treatment increased NCOA4 levels in both basal and erastin-treated cells, while 3-MA treatment, which blocks autophagosome formation, promoted NCOA4 degradation (Fig. 5 N). Downregulation of NR4A1 inhibits erastin sensitivity and promotes GBM cell growth in vivo To determine if NR4A1 enhances tumor sensitivity to erastin in vivo, we established nude mouse subcutaneous models using U87MG-shNR4A1 and U87MG-shCtrl cells (Fig. 6 A). Mice were intraperitoneally treated with erastin (10 mg/kg) or DMSO (0.3%) every 2 days for 14 days post-implantation. As shown in Fig. 6 B–C, U87MG-shNR4A1 mice showed no significant weight change compared to the shCtrl group until day 6 of erastin treatment. By day 10, erastin-treated U87MG-shNR4A1 mice exhibited notably larger tumor volumes than shCtrl mice (Fig. 6 D-E). Ki67 + cell counts were substantially higher in U87MG-shNR4A1 tumors, indicating increased glioma proliferation upon NR4A1 depletion (Fig. 6 F-G). Immunohistochemistry revealed reduced NCOA4 expression in U87MG-shNR4A1 tumors (Fig. 6 H-I). We next investigated levels of NCOA4–FTH1 pathway proteins in mouse tumors using western blots. Consistent with the in vitro results, knockdown of NR4A1 mitigated GPX-4 and NCOA4 levels while enhanced FTH1 expression (Fig. 6 J-K). Additionally, NR4A1 deficiency in tumors showed decreased beclin-1 levels whereas LC3 level did not change significantly(Fig. 6 L-M). In another experiment, luciferase-expressing GL261-sh-NR4A1 and GL261-sh-Ctrl cells were implanted into C57BL/6 mice brains. Mice received intraperitoneal injections of erastin (10 mg/kg) or DMSO (0.3%) every 2 days starting 14 days post-implantation. Tumor growth was monitored weekly via bioluminescence over 35 days. Results showed significantly higher bioluminescence values in GL261-sh-NR4A1 mice by day 28 (Fig. 7 A), with mean total radiance counts approximately 76% higher than in the shCtrl group (Fig. 7 B-C). GL261-sh-NR4A1 tumors were visibly larger than shCtrl tumors (Fig. 7 D). All GL261-sh-Ctrl mice treated with erastin survived the observation period, while none of the erastin-treated GL261-sh-NR4A1 mice survived beyond 35 days (Fig. 7 E). TUNEL assays indicated that erastin-induced cell death in vivo was significantly inhibited by NR4A1 knockdown (Fig. 7 F-G). Additionally, malondialdehyde (MDA) levels and ferrous iron levels were lower in GL261-sh-NR4A1 tumors compared to GL261-sh-Ctrl tumors (Fig. 7 H-I). Immunostaining for the proliferation marker Ki67 showed increased proliferation in GL261-sh-NR4A1 tumors, accompanied by reduced NCOA4 expression (Fig. 7 J-K, 7 M-N). Transmission electron microscopy revealed characteristic mitochondrial changes, with GL261 tumors lacking NR4A1 exhibiting shrunken mitochondria and increased membrane density (Fig. 7 L). Overall, our findings demonstrate that NR4A1 loss promotes GBM tumor growth and enhances resistance to erastin-induced ferroptosis by downregulating NCOA4-mediated ferritin degradation. This suggests NR4A1 as a potential therapeutic target to enhance erastin’s efficacy. Pharmacological activation of NR4A1 by Csn-B decreases GBM growth in vitro and in vivo To confirm whether NR4A1 stimulation could represses GBM growth, GL261-bearing mice received five intraperitoneal doses of the NR4A1 agonist Cytosporone-B (Csn-B) over 10 days (Fig. 8 A). In-vivo imaging revealed markedly smaller tumors in Csn-B-treated animals relative to vehicle controls (Fig. 8 B-C), and Kaplan–Meier analysis showed a pronounced extension of overall survival (Fig. 8 D). TUNEL staining revealed a modest induction of cell death in vivo (Fig. 8 E-F). Consistent with this, we found that Csn-B triggered dose-dependent cell death in cultured glioma cells (Fig. 8 G). Immunoblotting showed that Csn-B elevated the autophagy- and ferritinophagy-related proteins ATG5, ATG7 and NCOA4 without altering the ferroptosis markers GPX4 or ACSL4 in U87MG cells(Fig. 8 H-I). Collectively, these data position NR4A1 agonists as potential chemopreventive agents for GBM. Discussion GBM often develops chemotherapy resistance during treatment, leading to poor prognosis in glioma patients. [ 17 ]. Thus, identifying new therapeutic targets to combat glioma cells is crucial. Inducing ferroptosis in GBM has shown anti-tumor effects [ 18 ]. As autophagy can enhance ferroptosis during ROS-dependent processes, exploring how autophagy regulates ferroptosis may aid cancer treatment. [ 19 ]. A recent study highlighted NR4A1 agonists as potent inhibitors of GBM growth in vitro[ 20 ]. In this study, we found that low NR4A1 expression in human gliomas correlates with poor prognosis, based on genomic data. NR4A1 expression is also downregulated in GBM cell lines compared to normal human astrocytes. Moreover, NR4A1 knockdown inhibits autophagy and NCOA4-mediated ferritin degradation both in vitro and in vivo . These findings shed new light on the interplay between autophagy and ferroptosis, suggesting that targeting NR4A1 alongside ferroptosis induction could be a novel approach to treat GBM. Autophagy's role in cancer cell ferroptosis varies with context and the tumor microenvironment. For instance, autophagy can remove damaged lipids to inhibit ferroptosis in liver cancer[ 21 ]. Conversely, it can also induce cell death, though the mechanisms are unclear[ 22 ]. Repurposed drugs targeting autophagic pathways in gliomas have shown therapeutic benefits[ 23 ]. High LC3B-II expression is linked to better glioma patient outcomes [ 24 ]. Our results indicate that NR4A1 enhances autophagy, making glioma cells more sensitive to ferroptosis inducers. NR4A1 knockdown impairs the autophagic response and increases ferritin levels in GBM cells, confirming that autophagy-driven ferritinophagy causes GBM cell death via ferroptosis. The roles of NR4A1 are complex and context-dependent [ 25 ]. Under energy stress, NR4A1 moves from the nucleus to mitochondria, forming a complex with TPβ to support melanoma cell survival. [ 26 ]. Other studies show NR4A1 agonists induce autophagic cell death[ 8 , 27 ]. NR4A1 in mitochondria triggers ATG-mediated LC3 conversion[ 8 ]. NCOA4 transports ferritin to autophagosomes for degradation, releasing iron. [ 28 ]. Atg5 and Atg7 are crucial for autophagosome formation[ 29 ]. Knockout of Atg5 (autophagy-related 5) and Atg7 inhibited erastin-induced ferroptosis with decreased intracellular Fe2 + and lipid peroxidation[ 30 ]. Our findings show that Atg7 knockout, but not Atg5, makes NR4A1-overexpressing U87MG cells more resistant to erastin-induced ferroptosis. Erastin also promotes NR4A1 translocation to mitochondria, where it interacts with NCOA4. This interaction may enhance ferritin degradation via the NCOA4 pathway, increasing Fe²⁺ levels. The ensuing Fenton reaction boosts ROS, leading to ferroptosis. Since mitochondria are the primary source of cellular ROS, we first examined whether mitochondria were involved in NR4A1-dependent ferroptosis in glioma cells. Recent studies show cytosolic Fe²⁺ can be transported to mitochondria and stored by ferritin. Mitochondrial proteins like CDGSH iron sulfur domain 1 (CISD1) and Frataxin (FXN) regulate ferroptosis by mediating iron uptake and lipid peroxidation[ 31 , 32 ]. Our study confirms mitochondrial iron accumulation and mtROS involvement in lipid peroxidation. Erastin toxicity caused mitochondrial fragmentation and accumulation around the nucleus, changes alleviated in NR4A1 shRNA-transfected cells. These results indicated NR4A1 participates in mitochondria-associated ferroptosis in glioma cells, which were consistent with the morphology of mitochondria caused by ferroptosis were found in the erastin[ 33 ]. NR4A1 activity is regulated by gene expression, posttranslational modifications, and coregulator interactions[ 34 ]. However, factors causing NR4A1 inactivation in gliomas remain unclear. IDH1 mutants enhance ferritinophagy flux in gliomas by inhibiting the PRMT1-PTX3 axis[ 9 ].PRMT1 increases NR4A1 protein levels through transactivation and delayed degradation[ 35 ]. Thus, PRMT1 may induce NR4A1 upregulation linked to ferritinophagy in gliomas, warranting further study. Ferroptosis inducers like erastin can also enhance GBM sensitivity to TMZ[ 36 ], suggesting that inducing ferroptosis in tumor cells holds great potential for glioma treatment. Csn-B, as a fungal-derived ketone compound was isolated and identified as a specific activator of NR4A1 transcription. Csn-B drives the nuclear export of NR4A1 to mitochondria in tumor cells, provoking the release of cytochrome c into the cytosol and triggering apoptosis, thereby suppressing growth of tumor xenografts in nude mice[ 37 ].Beyond apoptosis, NR4A1 can also elicit autophagy-dependent cell death[ 38 ].NR4A1-mediated mitophagy selectively promotes cell death and restrains melanoma progression[ 8 ]. Thus, pharmacological activation of NR4A1 may overcome long-term drug-evoked resistance to apoptosis and enhance therapeutic efficacy in the clinic. Accumulating evidence links autophagy intimately to ferroptosis [ 30 ]。Using orthotopic GL261 and U87MG patient-derived xenograft (PDX) models, we demonstrated that NR4A1 knockdown strongly blunts the anti-glioma activity of the ferroptosis inducer erastin. Mechanistically, the NR4A1 agonist Csn-B stimulates autophagy and ferritinophagy, elevating cytosolic and mitochondrial Fe²⁺ levels and thereby driving tumor-cell ferroptosis and halting glioma progression. Hence, boosting NR4A1 expression or activity offers a novel therapeutic avenue for glioma. Endoplasmic-reticulum stress (ERS) activates autophagy through multiple pathways. The ERS sensor PERK undergoes autophosphorylation, phosphorylates eIF2α, and activates the transcription factor ATF4, which up-regulates autophagy-related genes[ 39 , 40 ]. Activation of the PERK/ATF4 axis reduces proliferation and increases apoptosis of GBM cells in response to irradiation[ 41 ].Whether NR4A1 modulates ERS-driven autophagy and ferroptosis in GBM remains unknown, and whether NR4A1 activation can overcome temozolomide (TMZ) resistance and radio-resistance in glioma requires further investigation. The proposed project will address these questions and open new perspectives for clinical glioma therapy. Our study reveals that NR4A1 induces ferroptosis in GBM by delivering ferritin to lysosomes via NCOA4. We detail how NR4A1-mediated autophagy contributes to ferroptosis through ferritin degradation in glioma cells. Targeting NR4A1 to induce ferroptosis in tumor cells may be a promising glioma treatment strategy. Declarations Consent for publication Written informed consent was obtained from all the participants. Declaration sections The study was compliant with all relevant ethical regulations regarding research involving human participants and what stated in the Declaration of Helsinki. For this study that use human glioma tissues were procured in line with WHO Guiding Principles on Human Cell, Tissue and Organ Transplantation. Ethics approval and consent to participate Human glioma samples were obtained from Department of Neurosurgery, Peking University Shenzhen Hospital, and the study was granted by the Ethics Committee of Peking University Shenzhen Hospital (No.2022-162A). Written informed consents were obtained from all patients. Registry and the Registration No. ChiCTR2500107124. The animal experiments were performed according to internationally followed ethical standards and approved by the research ethics committee of Shenzhen PKU-HKUST Medical Center. Acknowledgements Not applicable Funding This work was supported by the GuangDong Basic and Applied Basic Research Foundation (2022A1515111077;2023A1515220061;2024A1515220021), Shenzhen Basic Research Projects (JCYJ20220531094202006;JCYJ20240813120113018), and the Scientific Research Foundation of Peking University Shenzhen Hospital (KYQD202100X, KYQD2023254, LCYJ2022029). Data Availability Statement All data generated or analyzed during this study are included in this published article. Author Contributions Zhi Liang and Sufang Zhong performed experiments and drafted the manuscript. Weixian Zeng performed experiments. Wenjing Chen and Peng Huang supported the sample. Qiongye Dong and Xiaoteng Cui analyzed the data. Rikang Wang and Baodong Chen conceived the hypotheses, designed the experiments and supervised the students, Chunsheng Kang and Tao Wu revised the manuscript. All authors have read and approved the final manuscript. Conflict of interest disclosures The authors declare that they have no conflicts of interest. References Khan F, Pang L, Dunterman M, Lesniak MS, Heimberger AB, Chen P. Macrophages and microglia in glioblastoma: heterogeneity, plasticity, and therapy. The Journal of clinical investigation 2023; 133. Zhang Y, Kong Y, Ma Y, Ni S, Wikerholmen T, Xi K et al . Loss of COPZ1 induces NCOA4 mediated autophagy and ferroptosis in glioblastoma cell lines. Oncogene 2021; 40: 1425-1439. Zhao J, Yang S, Cui X, Wang Q, Yang E, Tong F et al . A novel compound EPIC-0412 reverses temozolomide resistance via inhibiting DNA repair/MGMT in glioblastoma. Neuro Oncol 2023; 25: 857-870. Liu T, Zhu C, Chen X, Guan G, Zou C, Shen S et al . Ferroptosis, as the most enriched programmed cell death process in glioma, induces immunosuppression and immunotherapy resistance. Neuro Oncol 2022; 24: 1113-1125. Wilson AJ, Liu AY, Roland J, Adebayo OB, Fletcher SA, Slaughter JC et al . TR3 modulates platinum resistance in ovarian cancer. Cancer research 2013; 73: 4758-4769. Lee SO, Li X, Khan S, Safe S. Targeting NR4A1 (TR3) in cancer cells and tumors. Expert opinion on therapeutic targets 2011; 15: 195-206. Zarraga-Granados G, Mucino-Hernandez G, Sanchez-Carbente MR, Villamizar-Galvez W, Penas-Rincon A, Arredondo C et al . The nuclear receptor NR4A1 is regulated by SUMO modification to induce autophagic cell death. PloS one 2020; 15: e0222072. Wang WJ, Wang Y, Chen HZ, Xing YZ, Li FW, Zhang Q et al . Orphan nuclear receptor TR3 acts in autophagic cell death via mitochondrial signaling pathway. Nature chemical biology 2014; 10: 133-140. Lathoria K, Gowda P, Umdor SB, Patrick S, Suri V, Sen E. PRMT1 driven PTX3 regulates ferritinophagy in glioma. Autophagy 2023; 19: 1997-2014. Mancias JD, Wang X, Gygi SP, Harper JW, Kimmelman AC. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature 2014; 509: 105-109. Dowdle WE, Nyfeler B, Nagel J, Elling RA, Liu S, Triantafellow E et al . Selective VPS34 inhibitor blocks autophagy and uncovers a role for NCOA4 in ferritin degradation and iron homeostasis in vivo. Nat Cell Biol 2014; 16: 1069-1079. Zhao Y, Li Y, Zhang R, Wang F, Wang T, Jiao Y. The Role of Erastin in Ferroptosis and Its Prospects in Cancer Therapy. OncoTargets and therapy 2020; 13: 5429-5441. Xie Y, Hou W, Song X, Yu Y, Huang J, Sun X et al . Ferroptosis: process and function. Cell death and differentiation 2016; 23: 369-379. Zhang Y, Fu X, Jia J, Wikerholmen T, Xi K, Kong Y et al . Glioblastoma Therapy Using Codelivery of Cisplatin and Glutathione Peroxidase Targeting siRNA from Iron Oxide Nanoparticles. ACS applied materials & interfaces 2020; 12: 43408-43421. Cho HJ, Zhao J, Jung SW, Ladewig E, Kong DS, Suh YL et al . Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma. Neuro Oncol 2019; 21: 47-58. Zhao J, Cui X, Zhan Q, Zhang K, Su D, Yang S et al . CRISPR-Cas9 library screening combined with an exosome-targeted delivery system addresses tumorigenesis/TMZ resistance in the mesenchymal subtype of glioblastoma. Theranostics 2024; 14: 2835-2855. Schaff LR, Mellinghoff IK. Glioblastoma and Other Primary Brain Malignancies in Adults: A Review. Jama 2023; 329: 574-587. Lin X, Ping J, Wen Y, Wu Y. The Mechanism of Ferroptosis and Applications in Tumor Treatment. Frontiers in pharmacology 2020; 11: 1061. Lee S, Hwang N, Seok BG, Lee S, Lee SJ, Chung SW. Autophagy mediates an amplification loop during ferroptosis. Cell death & disease 2023; 14: 464. Upadhyay S, Hailemariam AE, Mariyam F, Hafiz Z, Martin G, Kothari J et al . Bis-Indole Derivatives as Dual Nuclear Receptor 4A1 (NR4A1) and NR4A2 Ligands. Biomolecules 2024; 14. Zhang Z, Yao Z, Wang L, Ding H, Shao J, Chen A et al . Activation of ferritinophagy is required for the RNA-binding protein ELAVL1/HuR to regulate ferroptosis in hepatic stellate cells. Autophagy 2018; 14: 2083-2103. Jiang X, Overholtzer M, Thompson CB. Autophagy in cellular metabolism and cancer. The Journal of clinical investigation 2015; 125: 47-54. Shchors K, Massaras A, Hanahan D. Dual Targeting of the Autophagic Regulatory Circuitry in Gliomas with Repurposed Drugs Elicits Cell-Lethal Autophagy and Therapeutic Benefit. Cancer cell 2015; 28: 456-471. Aoki H, Kondo Y, Aldape K, Yamamoto A, Iwado E, Yokoyama T et al . Monitoring autophagy in glioblastoma with antibody against isoform B of human microtubule-associated protein 1 light chain 3. Autophagy 2008; 4: 467-475. Safe S, Karki K. The Paradoxical Roles of Orphan Nuclear Receptor 4A (NR4A) in Cancer. Molecular cancer research : MCR 2021; 19: 180-191. Li XX, Wang ZJ, Zheng Y, Guan YF, Yang PB, Chen X et al . Nuclear Receptor Nur77 Facilitates Melanoma Cell Survival under Metabolic Stress by Protecting Fatty Acid Oxidation. Molecular cell 2018; 69: 480-492 e487. Hu M, Luo Q, Alitongbieke G, Chong S, Xu C, Xie L et al . Celastrol-Induced Nur77 Interaction with TRAF2 Alleviates Inflammation by Promoting Mitochondrial Ubiquitination and Autophagy. Molecular cell 2017; 66: 141-153 e146. Fang Y, Chen X, Tan Q, Zhou H, Xu J, Gu Q. Inhibiting Ferroptosis through Disrupting the NCOA4-FTH1 Interaction: A New Mechanism of Action. ACS Cent Sci 2021; 7: 980-989. Xie Y, Kang R, Sun X, Zhong M, Huang J, Klionsky DJ et al . Posttranslational modification of autophagy-related proteins in macroautophagy. Autophagy 2015; 11: 28-45. Hou W, Xie Y, Song X, Sun X, Lotze MT, Zeh HJ, 3rd et al . Autophagy promotes ferroptosis by degradation of ferritin. Autophagy 2016; 12: 1425-1428. Yuan H, Li X, Zhang X, Kang R, Tang D. CISD1 inhibits ferroptosis by protection against mitochondrial lipid peroxidation. Biochemical and biophysical research communications 2016; 478: 838-844. Mancardi D, Mezzanotte M, Arrigo E, Barinotti A, Roetto A. Iron Overload, Oxidative Stress, and Ferroptosis in the Failing Heart and Liver. Antioxidants 2021; 10. Zhong S, Chen W, Wang B, Gao C, Liu X, Song Y et al . Energy stress modulation of AMPK/FoxO3 signaling inhibits mitochondria-associated ferroptosis. Redox biology 2023; 63: 102760. Zeng H, Qin L, Zhao D, Tan X, Manseau EJ, Van Hoang M et al . Orphan nuclear receptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its transcriptional activity. The Journal of experimental medicine 2006; 203: 719-729. Lei NZ, Zhang XY, Chen HZ, Wang Y, Zhan YY, Zheng ZH et al . A feedback regulatory loop between methyltransferase PRMT1 and orphan receptor TR3. Nucleic acids research 2009; 37: 832-848. Polewski MD, Reveron-Thornton RF, Cherryholmes GA, Marinov GK, Cassady K, Aboody KS. Increased Expression of System xc- in Glioblastoma Confers an Altered Metabolic State and Temozolomide Resistance. Molecular cancer research : MCR 2016; 14: 1229-1242. Zhan Y, Du X, Chen H, Liu J, Zhao B, Huang D et al . Cytosporone B is an agonist for nuclear orphan receptor Nur77. Nature chemical biology 2008; 4: 548-556. Zhang XK. Targeting Nur77 translocation. Expert opinion on therapeutic targets 2007; 11: 69-79. Rashid HO, Yadav RK, Kim HR, Chae HJ. ER stress: Autophagy induction, inhibition and selection. Autophagy 2015; 11: 1956-1977. Bhardwaj M, Leli NM, Koumenis C, Amaravadi RK. Regulation of autophagy by canonical and non-canonical ER stress responses. Seminars in cancer biology 2020; 66: 116-128. Dadey DYA, Kapoor V, Khudanyan A, Thotala D, Hallahan DE. PERK Regulates Glioblastoma Sensitivity to ER Stress Although Promoting Radiation Resistance. Molecular cancer research : MCR 2018; 16: 1447-1453. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SupplementaryFigs.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8304233","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":558500506,"identity":"4b86aaf3-baaa-487c-b215-ec5d6c98261b","order_by":0,"name":"Baodong Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtUlEQVRIiWNgGAWjYBACA4YENiBlwyABJJlJ0ZJGupbDJGgxZ09+9uDjjvN5kjPSH38uYLCT020goMWy55m54cwzt4ulJXIMjGcwJBubHSDksBs5bNK8bbcT50nkMCTzMBxI3EaUlr9t54Ba0h8cJl4LY9uBxNkSCYbNRGkB+sVMsrctuViy540xM48BEX4BhZjEzza7PInjwBDjqbCTI6gFBhKg7iRSOZKWUTAKRsEoGAVYAAAudj8UFrLZrQAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Neurosurgery","correspondingAuthor":true,"prefix":"","firstName":"Baodong","middleName":"","lastName":"Chen","suffix":""},{"id":558500507,"identity":"0292a9af-cef4-4b1d-a134-f64e743fef3c","order_by":1,"name":"Rikang Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Rikang","middleName":"","lastName":"Wang","suffix":""},{"id":558500508,"identity":"560c6110-807e-47be-b587-dbf9be9b0d52","order_by":2,"name":"Zhi Liang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhi","middleName":"","lastName":"Liang","suffix":""},{"id":558500509,"identity":"c503c479-1b1f-49e6-b819-285671be60f2","order_by":3,"name":"Sufang Zhong","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Sufang","middleName":"","lastName":"Zhong","suffix":""},{"id":558500510,"identity":"04d4d4a0-fc18-49d3-a864-3ccd506240e9","order_by":4,"name":"Weixian Zeng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Weixian","middleName":"","lastName":"Zeng","suffix":""},{"id":558500511,"identity":"2b157fab-8a0a-4b2e-b3d2-6a1abba67af8","order_by":5,"name":"Wenjing Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Chen","suffix":""},{"id":558500512,"identity":"c7fa3b79-8ade-4edb-a5dc-e940477a5ebf","order_by":6,"name":"Peng Huang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Huang","suffix":""},{"id":558500513,"identity":"2661b582-5163-453c-8a91-cdf23c29f457","order_by":7,"name":"Qiongye Dong","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Qiongye","middleName":"","lastName":"Dong","suffix":""},{"id":558500514,"identity":"b3ad75e7-21c3-4cd4-b886-7dd7de38149e","order_by":8,"name":"Xiaoteng Cui","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaoteng","middleName":"","lastName":"Cui","suffix":""},{"id":558500515,"identity":"bad86bca-78b6-4268-98b4-7c8756296319","order_by":9,"name":"Tao Wu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Wu","suffix":""},{"id":558500516,"identity":"4f18ee5e-08a0-4e9b-afb9-019a6d2a4426","order_by":10,"name":"Chunsheng Kang","email":"","orcid":"https://orcid.org/0000-0002-3255-3369","institution":"Tianjin Medical University General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Chunsheng","middleName":"","lastName":"Kang","suffix":""}],"badges":[],"createdAt":"2025-12-08 06:35:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8304233/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8304233/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98778807,"identity":"5a7cf329-db74-4529-b96a-cf1135ea161d","added_by":"auto","created_at":"2025-12-22 12:29:40","extension":"doc","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12701696,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.doc","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/384371ec6d882838b0aee6e4.doc"},{"id":98744990,"identity":"4e02a8fd-42bc-4a98-8d8b-43aa93ca48d5","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11978,"visible":true,"origin":"","legend":"","description":"","filename":"ONC202503889.json","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/0b86755ad2786bba2ea49924.json"},{"id":98777083,"identity":"d63e5f9e-3d60-4b18-ac99-d06f18961cba","added_by":"auto","created_at":"2025-12-22 12:25:20","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150999,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025038890enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/224cdfbd3936b4866ef8ab68.xml"},{"id":98777959,"identity":"2ac56d1b-e20b-48de-ac95-409c39fa6fc6","added_by":"auto","created_at":"2025-12-22 12:28:43","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2027441,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/63d89a432afe31f5c304cb05.png"},{"id":98778611,"identity":"00de0be5-296d-4305-9d0e-59d81790c8c0","added_by":"auto","created_at":"2025-12-22 12:29:28","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":568973,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/9c20e559665a50c75b76c696.png"},{"id":98744987,"identity":"4efd4430-7a07-40f7-a307-f4069c2aebd2","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":306718,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/468005924657ad09345f174f.png"},{"id":98744993,"identity":"5dff4cd3-fa7b-4eb4-8f56-495c782e68a0","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3030446,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/5da1f0d616f60d72df422116.png"},{"id":98776996,"identity":"eb2e2361-175b-4317-a73f-8ba6bca39a87","added_by":"auto","created_at":"2025-12-22 12:24:54","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":928435,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/e360dafcde60ad294a544b84.png"},{"id":98777631,"identity":"4291a39b-5e74-4145-a40b-bb41161f85be","added_by":"auto","created_at":"2025-12-22 12:28:14","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1368727,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/3ed7a6ba2c73a0db7549869c.png"},{"id":98745008,"identity":"3f230ce0-1a7a-4661-a4bc-e88a8f0c0b50","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":572333,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/b769548dcb76f964a50710be.png"},{"id":98777014,"identity":"3c8be7c5-ae7b-44d7-8511-2fae997437c1","added_by":"auto","created_at":"2025-12-22 12:25:03","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":925625,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/4771b0925a0cacd2582c5504.png"},{"id":98777107,"identity":"4a4d9a51-fc06-4502-9c86-f2a9b4ee529e","added_by":"auto","created_at":"2025-12-22 12:25:24","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1401157,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/03daddc4bdd632e7bee28b9b.png"},{"id":98745003,"identity":"e4f8325b-45cb-47e4-80b7-fd0be4d05282","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":842897,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/20efae2edfe01a0fb08e6fd1.png"},{"id":98745012,"identity":"af6066b6-4ea9-4eab-ab2f-69178930e8c9","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":295892,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/0439007bd6121aab25dc6cb1.png"},{"id":98777041,"identity":"38a3a1ca-fe1d-4755-a2cd-a3e79fd64591","added_by":"auto","created_at":"2025-12-22 12:25:12","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":351566,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/6d4304d52f082293cd0adca3.png"},{"id":98776717,"identity":"666a220e-78ba-4eac-a96f-450da895ea0b","added_by":"auto","created_at":"2025-12-22 12:23:22","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":117515,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/a35ff53e3eb7334cae136bd5.png"},{"id":98778026,"identity":"55a5526f-cbf6-471e-86f3-e2e19964b73f","added_by":"auto","created_at":"2025-12-22 12:28:49","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41916,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/a284711c9a31f0656f3cabcf.png"},{"id":98779537,"identity":"a692c5b1-d843-41b8-9c4e-b3d77ab3fee3","added_by":"auto","created_at":"2025-12-22 12:30:26","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":424539,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/ce5e448cd2832214a78a496d.png"},{"id":98778719,"identity":"661a514e-8bd6-4e1e-9c97-b224da9122ef","added_by":"auto","created_at":"2025-12-22 12:29:33","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128280,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/dc88917db1c26753a4cb4a56.png"},{"id":98745007,"identity":"d160de98-f5be-4834-b90c-b0f9ae355cbc","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":254596,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/a1d55d0ef6ebd9eb77bf5608.png"},{"id":98744998,"identity":"998380cf-4476-4bb9-8f71-8e95f9f5c3d8","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":94392,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/a164045aefc84551fd72470f.png"},{"id":98779203,"identity":"568ecbef-9ba2-43b7-9ed3-a1902c4c130b","added_by":"auto","created_at":"2025-12-22 12:30:04","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":171508,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/928b323d86efa6f189bca2eb.png"},{"id":98745001,"identity":"21f0372f-8537-4fc8-95bf-45a20de72055","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":240320,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/9c55057cdbb10a95744507ed.png"},{"id":98778934,"identity":"db66823d-5237-4d86-a40f-b21dad3467ee","added_by":"auto","created_at":"2025-12-22 12:29:50","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134304,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/8610b55b18ed8eeb0f06642b.png"},{"id":98745009,"identity":"45cea79f-133e-46b9-bd8d-16c1f47e0311","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":172341,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/de9ec9661785ab494757e1b8.png"},{"id":98745014,"identity":"45ee9dfa-7e41-479d-aabe-58dad64b9f2f","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"xml","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":147582,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025038890structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/7da1f314d0d3cc48f2d1de16.xml"},{"id":98745015,"identity":"f64013fd-0f4e-4126-b0bc-a663ed3e302f","added_by":"auto","created_at":"2025-12-22 08:36:58","extension":"html","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163309,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/bf10a2bfc6a1c794b1cbe404.html"},{"id":98744979,"identity":"c7627b40-24bd-437b-9b63-50553fd10be5","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":164817,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNR4A1 is significantly downregulated in primary human glioma tissues and glioblastoma cell lines.\u003c/strong\u003e(A) Clinical information (age and gender), tumor molecular characteristics (IDH status, chromosome 1p/19q co-deletion status, methylation status of MGMT promoter, and subtype), and the transcriptional profile of NR4A1 in glioma patients from TCGA-glioma database were visualized. (B) Univariate Cox regression analysis was performed using TCGA-glioma database. (C) Glioma patients from TCGA-glioma database were divided into two group based on the expression level of NR4A1. Kaplan-Meier survival plot was analyzed comparing the overall time of patients with NR4A1-high versus low expression. (D) Kaplan-Meier survival plot was performed for comparison between NR4A1-high and low expression glioma patients with methylated promoter of MGMT gene in TCGA-glioma database. (E-F) NR4A1 protein levels in human glioma samples were assessed by western blot (WHO II, n = 6; WHO IV, n = 6). (G) qRT-PCR analysis of NR4A1 in normal human astrocytes (NHA) and human GBM cell lines. (H-I) NR4A1 protein levels in human glioma samples were assessed by IHC staining (Tumor adjacent normal tissue,n=3;WHO II, n = 5; WHO IV, n = 7). Data are presented as mean ± SEM. * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/75e4887ef1c59b62df94c01c.jpg"},{"id":98744983,"identity":"284181af-659c-4af7-8985-0b10ec669547","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":156717,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of NR4A1 inhibits erastin and but not RSL3-induced ferroptosis.\u003c/strong\u003e (A) GSEA enrichment analysis was performed by using TCGA-GBM database to investigate the correlation between the expression of NR4A1 and ferroptosis pathway. (B-C) Cell death ratio in U87MG or U251 cells were transfected with GV248 sh-Ctrl and GV248 sh-NR4A1, then the cells were treated with different concentrations of erastin (0-20μM) for 24h, cell viability were measured by CCK-8 kit. \u0026nbsp;(D) Cell death ratio in vector and GV492 Lv-NR4A1-transfected U87MG cells were treated with different concentration of erastin (0-20μM), cell viability were measured by CCK-8 kit. (E) U87MG cells were transfected with GV248 sh-Ctrl and GV248 sh-NR4A1, then the cells were treated with different doses of RSL3(0-10μM) for 48 h, cell viability were measured by CCK-8 kit. (F) U87MG cells were treated as indicated for 24 h, the accumulation of lipid ROS was assessed by C11-BODIPY581/591 staining. (G-H) Oxidized C11-BODIPY581/591 (Green) and Un-oxidized (red) indicating lipid ROS were imaged by fluorescent microscope. Scale bars: 25 μm. (I) Fluorescence images of EdU assays performed on U251 cells and (K) TBD0220 GBM cells transfected with sh-NR4A1. Nuclei were stained with DAPI (blue). Scale bar, 100μm. Graphic representation of the ratios of EdU positive cells in (J) U251 and (L) TBD0220 GBM cells transfected with sh-NR4A1. Data are presented as mean ± SEM. * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/fb39ae64cbdfd55ebaea0511.jpg"},{"id":98778800,"identity":"4c3788b8-1487-4ed3-b913-374a32ba70d4","added_by":"auto","created_at":"2025-12-22 12:29:40","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":120992,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of NR4A1 inhibits erastin-induced ferroptosis partly through the NCOA4 signaling pathway. \u003c/strong\u003e(A) Immunofluorescence colocalization detection in U87MG cells using Fe²⁺ probe (green) and Mito-tracker (red).(B) Statistical analysis of the images shown in (A). (C) Ferrous iron levels in GV248 sh-NR4A1 transfected U251 cell lines treated with erastin, detected using an iron assay kit.(D) Representative fluorescence images of U87MG cells stained with the JC-1 probe to assess mitochondrial membrane potential. Scale bar, 25μm. (E) U87MG cells infected with lentiviral constructs expressing GV248 sh-NR4A1 were treated with erastin (10μM) or RSL-3 (3μM) for 24h, the protein levels of NR4A1,NCOA4, ACSL4 and GPX4 were determined by western blot analysis. (F-G) Western blot analysis of ACSL4 protein levels in U87MG cells infected with sh-NR4A1 and GV492 Lv-NR4A1. Data are presented as mean ± SEM. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/c206426d6d0109c5e84154ba.jpg"},{"id":98779093,"identity":"f0a49f4e-2965-40b6-903d-572f38d167b4","added_by":"auto","created_at":"2025-12-22 12:29:57","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":119742,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNR4A1 co-localizes with NCOA4 and regulates ferritinophagy. \u003c/strong\u003e(A-B) Immunofluorescence staining and quantification of colocalization of NR4A1 and NCOA4 in U87MG cells exposed to erastin (5μM) or untreated. Scale bars: 10 μm. (C-D) Western blot analysis of NCOA4 and FTH1 protein levels in GV248 sh-NR4A1 transfected U251 cell lines treated with or without erastin(5 μM) for 24 h. (E-F) Quantification of NCOA4/FTH1 expression from gel blot. Data are represented as mean ± SEM. n = 6 per group.*p \u0026lt; 0.05 ,**p \u0026lt; 0.01 compared with the WT-control group; (G–H) The binding mode of NR4A1 and NCOA4 to FTH1 observed by Co-IP experiments in NR4A1-overexpressing (Lv-NR4A1) and NR4A1-Knockdown(sh-NR4A1) \u0026nbsp;U87MG cells. (I) Representative confocal images of U87 MG cells transfected with mCherry-EGFP-LC3B construct showing autophagosome formation. Scale bar: 10 µm. Graph represents the number of yellow puncta (GFP+ mCherry+, autophagosomes) and \u0026nbsp;red puncta (GFP− mCherry+, autolysosomes). (J)Quantification of the number of yellow puncta. Data are presented as mean ± SEM. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/aa0f457557e7b70180821730.jpg"},{"id":98779237,"identity":"6ce7d68b-6f96-421b-b311-57c0944c629e","added_by":"auto","created_at":"2025-12-22 12:30:05","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":109966,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNR4A1 induces autophagy and NCOA4-mediated ferritinophagy in GBM cells \u003c/strong\u003e(A-B) Western blot analysis of ATG5 and ATG7 LC3 protein levels in U87MG cells infected with sh-NR4A1.(C-F) qRT-PCR showing levels of Atg5, Atg7, NCOA4, and LC3B in U87MG-sh-NR4A1 cells treated with erastin (3 μM) for 24 h. (G-I) Western blot analysis of ATG7 and LC3 protein levels in NR4A1-overexpressing U87MG cells (J-K) Knockdown of ATG5/ATG7 by shRNA in NR4A1-overexpressing U87MG cells. Fe²⁺ levels were assayed using commercial kits. (L) Cell death ratio of NR4A1-overexpressing U87MG cells treated with 3-MA or CQ. (M) Knockdown of ATG5/ATG7 by shRNA in NR4A1-overexpressing U87MG cells. Western blots showing levels of NCOA4, FTH1, and LC3. (N)Western blots showing protein levels of LC3B, NCOA4 and FTH1 in NR4A1-overexpressing U87MG cells treated with erastin in the presence or absence of 3-MA (10 mM) and CQ (3 μM) for 24 h. Data are presented as mean ± SEM. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/f3f46f9e4cafc5afd089fb7e.jpg"},{"id":98777570,"identity":"bc144bb1-6513-4460-8bfd-d9adc08ef15b","added_by":"auto","created_at":"2025-12-22 12:28:07","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":163346,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDown-regulation of NR4A1 confers resistance to erastin-induced ferroptosis through the NCOA4-FTH1 pathway \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo.\u003c/strong\u003e\u003c/em\u003e(A) Study design. Nude mice were subcutaneously and intracranially xenografted with U87MG-shNR4A1 cells or U87-shCtrl cells (5 × 10⁶ cells) and treated intraperitoneally with or without erastin (10 mg/kg/day per mouse) every two days.(B) Mouse weight during the experiment. Data are presented as mean ± SD (n = 6 mice per group).(C) Tumor weight of subcutaneous tumors. Data are presented as mean ± SD.(D) Diameter of subcutaneous tumors. Data are presented as mean ± SD (n = 6 mice per group).(E) Image of subcutaneous tumors on days 28 after implantation.(F-G) Immunohistochemical staining for Ki67 and (H-I)NCOA4 in sections from subcutaneous tumors of U87MG-shNR4A1 or U87MG-shCtrl cells. Scale bar: 50 μm.(J-L) Protein levels of GPX-4, NCOA4, FTH1, Beclin-1, and LC3 were determined by western blot. (K-M) Densitometric analysis of the gel blot normalized by its own control. Data are presented as mean ± SD (n = 4 mice per group). Data are presented as mean ± SEM(n = 4 mice per group).. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/a78f31f7ec6049c7789dd12f.jpg"},{"id":98744985,"identity":"2034123e-66ab-4387-addd-db60ee2ec0b1","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":125549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDown-regulation of NR4A1 inhibits erastin sensitivity and promotes orthotopic glioma growth.\u003c/strong\u003e(A) Experimental schema.(B) C57BL/6 mice were intracranially implanted with luciferase-expressing GL261-sh-NR4A1 cells or GL261-shCtrl cells (1.5 × 10⁵ cells). Intracranial tumor growth was monitored at days 7, 14, and 21 after implantation using the IVIS-LuminaLT imaging system to detect bioluminescence.(C) Quantification of bioluminescent signals from intracranial tumors in mice implanted with GL261-sh-NR4A1 or GL261-shCtrl cells at days 14, 21, and 28.(D) Representative images of sections from brains of orthotopic GL261-sh-NR4A1 or GL261-shCtrl tumor-bearing mice.(E) Kaplan-Meier analysis of overall survival of tumor-bearing mice.(F-G) TUNEL assay. Scale bar: 50 μm. Data are presented as mean ± SD (n = 4 mice per group).(H) MDA levels and (I) ferrous iron levels in orthotopic GL261-sh-NR4A1 or GL261-shCtrl tumors. (J-K) IHC analysis of Ki67 in sections from intracranial tumors of C57BL/6 mice in the GL261-sh-NR4A1 and GL261-shCtrl groups. (L) Representative transmission electron microscopy images revealing mitochondrial morphology in intracranial tumors of C57BL/6 mice in the GL261-sh-NR4A1 and GL261-shCtrl groups. Scale bar: 1 μm. (M-N) IHC analysis of NCOA4 in sections from intracranial tumors of C57BL/6 mice in the GL261-sh-NR4A1 and GL261-shCtrl groups. Data are presented as mean ± SD (n = 4 mice per group).Scale bar: 50 μm. Data are presented as mean ± SEM. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/26dfe13bc11f52cc88de257c.jpg"},{"id":98744994,"identity":"dd5bae92-93e7-42bd-bbdf-a7158349d4d7","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":109542,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNR4A1 agonist Csn-B show antitumor effects both \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e (A) Experimental schema. (B) C57BL/6 mice were intracranially implanted with luciferase-expressing GL261 cells (1.5 × 10⁵ cells). Each mouse was intraperitoneally injected with 250 μL of Csn-B (0.05 mg/mL) every two days for a total of 10 days. Intracranial tumor growth was monitored at days 12 and 18 after implantation using the IVIS-LuminaLT imaging system to detect bioluminescence.(C) Quantification of bioluminescent signals from intracranial tumors in mice implanted with GL261-sh-NR4A1 or GL261-shCtrl cells at days 28. (D) Kaplan-Meier analysis of overall survival of tumor-bearing mice. (E-F) TUNEL assays in sections from intracranial tumors of C57BL/6 mice after treatment with or without Csn-B(n = 5 mice per group). (G) U251 cells pretreated with different concentration of Csn-B(0-10μM) for 24h, cell viability were measured by CCK-8 kit. (H-I) U251 cells pretreated with different concentration of Csn-B(0-10μM) for 24h, Representative western blot of NR4A1/ ATG5 / ATG7 NCOA4/ GPX4/ACSL4 proteins . Data are presented as mean ± SD. * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, **\u003cem\u003ep \u0026lt; \u003c/em\u003e0.001\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/0736c22c5f504aaf9da7dcf0.jpg"},{"id":100356311,"identity":"730d36e8-6eea-4382-a6dd-7e2abe17cbc3","added_by":"auto","created_at":"2026-01-16 07:02:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2489591,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/a9b9dcde-08e9-48f9-8345-49d6dc09effc.pdf"},{"id":98744980,"identity":"1ed544eb-cf63-4d9a-926e-f5d74d6cd9a6","added_by":"auto","created_at":"2025-12-22 08:36:57","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1123589,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigs.docx","url":"https://assets-eu.researchsquare.com/files/rs-8304233/v1/9a99311b019a1f50e0f98b84.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"NR4A1 Modulates Glioblastoma Sensitive to\r\nErastin-Induced Ferroptosis via NCOA4 mediated Autophagy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlioma is the most common intracranial malignant tumor, accounting for approximately 33% of central nervous system (CNS) tumors[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. According to the World Health Organization (WHO) grading system, gliomas are classified into four grades based on histologic features, ranging from low-grade (I and II) to high-grade (III and IV) gliomas[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Patients with glioma generally have a poor prognosis, especially those suffering from WHO grade IV glioblastoma (GBM). Studies have shown that it is challenging to inhibit GBM cells using chemical drugs alone[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, there is a pressing need to develop new therapeutic targets to enhance the effectiveness of GBM treatment.\u003c/p\u003e\u003cp\u003eRecent studies have indicated that ferroptosis is one of the major types of programmed cell death in gliomas. Higher levels of free iron have been observed in gliomas compared to other brain tumors[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Thus, elucidating the molecular mechanisms of ferroptosis involved in the progression of GBM may help improve the effectiveness of GBM treatment. Nuclear receptor subfamily 4 group A member 1 (NR4A1) has emerged as a major regulator of cancer cell survival[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. NR4A1 is a nuclear receptor that participates in various biological processes, including cell proliferation, differentiation, and apoptosis. NR4A1 can exhibit both tumor suppressive and pro-oncogenic effects, depending on the tumor type and context. Inhibition of nuclear NR4A1 and its nuclear export has been shown to suppress tumor cell proliferation and promote apoptosis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. NR4A1 has also been reported to induce autophagy-dependent cell death[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The autophagy-mediated degradation of ferritin (ferritinophagy) has been shown to promote glioma cell death through ferroptosis[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. NCOA4 acts as a selective cargo receptor for the autophagic turnover of ferritin (ferritinophagy), which is critical for iron homeostasis[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, whether NR4A1 regulates ferritinophagy and its role in ferroptosis remains unclear.\u003c/p\u003e\u003cp\u003eErastin can induce ferroptosis by triggering multiple pathways and has demonstrated potential in cancer therapy[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Inducing ferroptosis in GBM has been shown to achieve good therapeutic effects[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. NR4A1 has rarely been studied in the context of gliomas. Recently, master regulator analysis of differentially expressed genes between cerebellar GBM and proneural supratentorial GBM revealed NR4A1 as a potential therapeutic target[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Further research is needed to understand the molecular mechanisms of NR4A1 involved in GBM, which may aid in treating the disease.\u003c/p\u003e\u003cp\u003eIn this study, we demonstrated that decreased NR4A1 expression in human gliomas correlates with poor prognosis. Genetic inhibition of NR4A1 inhibited ferritin degradation and erastin-induced ferroptosis of glioma cells both in vitro and in vivo. Overexpression of NR4A1 increased ferritin degradation and promoted ferroptosis. Knockdown of autophagy-related 7 (Atg7) limited NR4A1 overexpression-induced ferroptosis, resulting in decreased intracellular ferrous iron levels and lipid peroxidation. Our results suggest that NR4A1 may play a unique role in regulating ferroptosis and erastin-mediated anticancer therapy. We aim to provide a new perspective and therapeutic target for glioma treatment.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eTCGA data collection and analysis\u003c/h2\u003e\u003cp\u003eTranscriptional profiles and clinical information of glioma patients from TCGA-glioma database were downloaded from the UCSC XENA website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://xenabrowser.net/\u003c/span\u003e\u003cspan address=\"https://xenabrowser.net/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Raw count data were transformed to FPKM. Clinical information (age and gender), molecular features of gliomas (IDH status, chromosome 1p/19q co-deletion status, methylation status of MGMT promoter, and subtype), and the expression level of NR4A1 of glioma patients were visualized as a heatmap by using \u0026ldquo;pheatmap\u0026rdquo; R package. GSEA enrichment analysis was performed by GSEA v4.4.0 software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.gsea-msigdb.org\u003c/span\u003e\u003cspan address=\"https://www.gsea-msigdb.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCell Culture\u003c/h3\u003e\n\u003cp\u003eThe patient-derived primary GBM cell line TBD0220 were originally obtained from Tianjin Medical University General Hospital and cultured as described by Kang et al[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Human GBM cell lines U87MG and U251 were cultured in DMEM medium supplemented with 10% fetal bovine serum (Gibco, USA). NSC (neural stem cells) and GSC (glioma stem cells) were cultured in Neurobasal\u0026trade; Medium (Gibco, Thermo Fisher Scientific) supplemented with 2% B27 Neuro Mix (Thermo Fisher Scientific), 10 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Rocky Hill, NJ, USA), and 20 ng/mL epidermal growth factor (EGF; Thermo Fisher Scientific). The mouse GBM cell line GL261 was cultured in DMEM medium containing 10% fetal bovine serum (Gibco, USA). All cells were maintained at 37\u0026deg;C in a 5% CO₂ humidified incubator with 20% O₂.\u003c/p\u003e\n\u003ch3\u003eSiRNA Transfections\u003c/h3\u003e\n\u003cp\u003e Gene-specific and negative control siRNAs were synthesized by GenePharma (Shanghai, China) and transfected into U87MG and U251 cells for 48 hours using Lipofectamine 3000 (Thermo Fisher Scientific, USA) according to the manufacturer\u0026rsquo;s protocol. Detailed protocols are provided in the Supplementary \u0026ldquo;Materials and Methods.\u0026rdquo; The following siRNA sequences were used to target the indicated RNAs: NR4A1 #1 (5\u0026rsquo;-CCUUCAAGUUCGAGGACUUTT-3\u0026rsquo;) and NR4A1 #2 (5\u0026rsquo;-GAAGAUGCCGGUGACGUGCAACAAU-3\u0026rsquo;); ATG5 (5\u0026rsquo;-CCTTTGGCCTAAGAAGAAA-3\u0026rsquo;); ATG7 #1 (5\u0026rsquo;-GGAGTCACAGCTCTTCCTT-3\u0026rsquo;). Western blotting was used to evaluate siRNA knockdown efficiency.\u003c/p\u003e\n\u003ch3\u003eshRNA Transfections\u003c/h3\u003e\n\u003cp\u003eShort hairpin RNAs (sh-NR4A1) with sequences 5\u0026rsquo;-CCUUCAAGUUCGAGGACUUTT-3\u0026rsquo; and 5\u0026rsquo;-GCTTCGGCGTCCTTCAAGTTT-3\u0026rsquo; were ligated into the lentiviral vector pLKO.1 containing a puromycin resistance cassette (Genechem Co., Ltd., Shanghai, China). Luciferase-expressing U87MG, U251, and P3#GL261 cells were infected with the shRNA lentiviruses. After 48 hours, the medium was replaced with fresh medium containing 2 \u0026micro;g/mL puromycin (Thermo Fisher Scientific) for selection over an additional 2 weeks to enrich for cells harboring the constructs. Western blotting was performed to assess shRNA knockdown efficiency, and cells were split for different assays.\u003c/p\u003e\n\u003ch3\u003eCell Viability Assay\u003c/h3\u003e\n\u003cp\u003eCell viability in U87MG and U251 cells was assessed using the Cell Counting Kit-8 (CCK-8) assay (Solarbio, China) according to the manufacturer\u0026rsquo;s protocol. Cells were seeded at 3\u0026times;10\u0026sup3; cells/well in 96-well plates and treated as indicated. CCK-8 solution (10 \u0026micro;L) was added to each well, and the plates were incubated for 1 hour at 37\u0026deg;C. The optical absorbance in each well was measured at 450 nm (OD450) using a microplate reader (Thermo Fisher Scientific, USA).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence\u003c/h2\u003e\u003cp\u003eMouse brains were fixed in 4% paraformaldehyde (P1110, Solarbio) for 24 hours, followed by incubation in a 30% sucrose solution (S112228, Rhawn) for 48 hours. The brains were then snap-frozen and cryosectioned at 8 \u0026micro;m thickness. Sections were permeabilized in 0.5% Triton X-100 (T8200, Solarbio Co., Ltd., Beijing, China) for 30 minutes and blocked with PBS containing 3% goat serum (SL038, Solarbio) for 1 hour at room temperature. Sections were incubated overnight at 4\u0026deg;C with primary antibodies. After three washes with PBS (10 minutes each), sections were incubated with respective secondary antibodies for 2 hours, including goat anti-mouse IgG (ab150113, AlexaFluor-488, Abcam) and goat anti-rabbit IgG (ab150100, AlexaFluor-594, Abcam). Sections were imaged using a fluorescent microscope at 400\u0026times; magnification.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eWestern Blotting Analysis\u003c/h3\u003e\n\u003cp\u003eCells and brain tissues were lysed in ice-cold RIPA buffer containing protease inhibitors. Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Germany). The membranes were blocked with 5% skim milk (D8340, Solarbio Co., Ltd., Beijing, China) and incubated overnight at 4\u0026deg;C with primary antibodies. The primary antibodies used were as follows: rabbit anti-β-actin (AC026, 1:80,000, Abclonal, China), rabbit anti-GAPDH (A19056, 1:50,000, Abclonal, China), mouse anti-NCOA4 (sc-373739, 1:500, Santa Cruz, USA), mouse anti-ferritin heavy chain (sc-376594, 1:1,000, Santa Cruz), mouse anti-ATG5 (sc-133158, 1:1,000, Santa Cruz), mouse anti-ATG7 (sc-376212, 1:1,000, Santa Cruz), rabbit anti-NR4A1 (3960S, 1:1,000, Cell Signaling Technology, USA), rabbit anti-ACSL4(A6826,1:1000,abclonal,China),mouse anti-GPX4(sc-166570,1:1000, Santa Cruz),rabbit,anti-Beclin1(11306-1-AP,1:1000, Proteintech, China),and rabbit anti-LC3 (14600-1-AP, 1:1,000, Proteintech, China).\u003c/p\u003e\n\u003ch3\u003eCo-immunoprecipitation (CO-IP) assay\u003c/h3\u003e\n\u003cp\u003eThe Co-IP assay was performed with Pierce Classic Magnetic immunoprecipitation (IP)/Co-IP Kit (Absin, China) according to the manufacturer\u0026rsquo;s instruction. Briefly, the specific primary antibodies were incubated with protein A/G magnetic beads. The cell lysates were collected and incubated with antibody-beads complex. The beads interacting proteins were washed and denatured, thenthe proteins were examined by western blotting.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eQuantitative Real-Time PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted using TRIzon Reagent (Invitrogen, USA) according to the manufacturer's protocol. Reverse transcription was performed using the First-Strand cDNA Synthesis Kit (18091050, Thermo Fisher Scientific Co., Ltd., USA). Real-time PCR was conducted with SYBR Green PCR Master Mix (Yeasen Biotech Co., Ltd., Shanghai, China) under the following conditions: 95\u0026deg;C for 5 minutes, followed by 40 cycles of 95\u0026deg;C for 10 seconds and 60\u0026deg;C for 30 seconds. Real-time PCR was performed on the ABI 7500 system. Gene expression levels were normalized to β-actin expression. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for qRT-PCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer Sequence, 5\u0026prime; -3\u0026prime;\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePrimer Sequence, 5\u0026prime; -3\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eLC3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-TTGAGCTGTAAGCGCCTTCTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eATG5\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF-AAAGATGTGCTTCGAGATGTGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GATGTCCGACTTATTCGAGAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eR-CACTTTGTCAGTTACCAACGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-AGAAGGCTGGGGCTCATTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eATG7\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF-CAGTTTGCCCCTTTTAGTAGTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-AGGGGCCATCCACAGTCTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eR- CCAGCCGATACTCGTTCAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eFTH1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF- TCCTACGTTTACCTGTCCATGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eNCOA4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF- GAGGTAGTGATGCACGGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GTTTGTGCAGTTCCAGTAGTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eR- GACGGCTTATGCAACTGTGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eNR4A1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF- AGGGCTGCAAGGGCTTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GGCAGATGTACTTGGCGTTTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eHuman Glioma Samples\u003c/h2\u003e\u003cp\u003eAll patient samples were collected with written informed consent under protocol (Approval No.2022-162A,Oct.27.2022) approved by Peking University Shenzhen Hospital, Shenzhen, China. All glioma specimens were classified by two experienced clinical pathologists according to the WHO Classification of Tumors guidelines. The clinical and pathological characteristics are summarized in the Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eClinical information of patients with glioma\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNo.\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGender\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAge\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLesion area\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePathologic Grade\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e51\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFrontal gyrus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO II\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e37\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft temporal island\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO II\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e31\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRight parietal lobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO II\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e31\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRight frontotemporal lobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO II\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRight front temporal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO II\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft temporal lobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO II\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e7#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft frontal lobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e8#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft temporal lobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e9#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft cerebellar hemisphere\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e52\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft temporal lobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e11#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e63\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft parieto-occipital region\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e12#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLeft forehead\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e13#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRight front temporal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e14#\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFemale\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBilateral frontal corpus callosum\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWHO IV(Glioblastoma)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry Assay\u003c/h2\u003e\u003cp\u003eMouse brain glioma tissues and human glioma patient samples were fixed in 4% paraformaldehyde, processed into 5-\u0026micro;m-thick sections, and immunostained with specific antibodies. The percentage of positive cells was calculated by counting under high magnification (\u0026times;400). The primary antibodies used were rabbit anti-NR4A1 (3960S, 1:200, Cell Signaling Technology, USA), mouse anti-NCOA4 (sc-373739, 1:200, Santa Cruz), and rabbit anti-Ki67 (AF0198, 1:200, Affinity, China). Sections were rinsed with PBS (3 \u0026times; 5 minutes) and incubated with goat anti-rabbit secondary antibody (ZSGB-Bio). Antigens were visualized using the hydrogen peroxide substrate 3,3'-diaminobenzidine (DAB, ZSGB-Bio), and slides were counterstained with hematoxylin (Beyotime, Shanghai, China) at 25\u0026deg;C for 2 minutes. For negative controls, sections were incubated with normal goat serum instead of primary antibody.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eCellular and Mitochondrial Ferrous Iron Detection\u003c/h2\u003e\u003cp\u003eLevels of cellular and mitochondrial ferrous iron were assessed using FerroOrange probes (Dojindo) and Mitotracker\u0026trade; Deep Red FM (Invitrogen, USA) according to the instructions. Briefly, cells were plated on confocal dishes (2.5 \u0026times; 10⁵ cells/well) and treated as described. After treatment, cells were washed three times with HBSS, stained with 1 \u0026micro;M FerroOrange and 300 nM Mitotracker\u0026trade; Deep Red FM for 30 minutes at 37\u0026deg;C in a 5% CO₂ incubator, and then washed three times with HBSS. Images were captured using a Leica STELLARIS5 confocal microscope (Leica, Germany).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eIron and MDA Assay\u003c/h2\u003e\u003cp\u003eFerrous iron concentration and lipid peroxidation levels were analyzed in mouse brain glioma tissues using ferrous iron assay kits (BC5415, Solarbio, China) and malondialdehyde (MDA) assay kits (BC0025, Solarbio, China), respectively. Tissue samples were analyzed according to the manufacturer's protocols.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eTUNEL Assay\u003c/h2\u003e\u003cp\u003eTissue samples were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) and embedded in paraffin. TUNEL staining was performed using a One-Step TUNEL Apoptosis Assay Kit (Beyotime, C1086, Shanghai, China) according to the manufacturer's protocol. Images were acquired using a Leica DM4B microscope (Leica, Germany).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eMitochondrial Membrane Potential Assay\u003c/h2\u003e\u003cp\u003eMitochondrial membrane potential in U87MG cells was detected using the JC-1 Assay Kit (Beyotime) according to the manufacturer's protocol. Cells were stained with JC-1 working solution for 20 minutes at 37\u0026deg;C in an incubator and analyzed using confocal microscopy (Leica SP8 confocal microscope; Leica Microsystems). The intensities of red (excitation: 530 nm; emission: 590 nm) and green fluorescence (excitation: 485 nm; emission: 528 nm) were measured. Assays were performed in triplicate, and fluorescence intensities were calculated using ImageJ software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eLipid Peroxidation Measurement\u003c/h2\u003e\u003cp\u003eTo visualize lipid peroxidation, U87MG or U251 cells (2.5 \u0026times; 10⁵ cells/well) were seeded in confocal dishes (Nest, China). After 24 hours of treatment, cells were stained with 10 \u0026micro;M C11-BODIPY581/591 probe (Invitrogen, USA) according to the manufacturer's instructions. Cells were then washed with PBS and observed using a Leica STELLARIS5 confocal microscope (Leica, Germany).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eAnimal studies\u003c/h2\u003e\u003cp\u003eExperimental animals were maintained in a specific pathogen-free environment of controlled temperature (21\u0026ndash;24℃) and 12-h light/12-h dark cycle. All animal experiments were approved by the Ethics Committee of Shenzhen PKU-HKUST Medical Center. For subcutaneous GBM xenografts, six-week-old male NOD-SCID mice were purchased from GemPharmatech Co., Ltd. U87-shCtrl and U87-shNR4A1 cells were labeled with GFP-expressing lentivirus. For subcutaneous xenografts, 5 \u0026times; 10⁶ cells in 100 \u0026micro;L of PBS/Matrigel (356231, Corning, USA) were injected into the right armpit of the mice. Tumor diameters were measured using calipers, and tumor volume was calculated using the formula: 4/3π \u0026times; (\u003cem\u003ed\u003c/em\u003e/2)\u003csup\u003e2\u003c/sup\u003e \u0026times; (\u003cem\u003eD\u003c/em\u003e/2), where \u003cem\u003ed\u003c/em\u003e and \u003cem\u003eD\u003c/em\u003e represent the minor and major tumor axes, respectively.\u003c/p\u003e\u003cp\u003eFor intracranial GBM xenografts, six-week-old male C57BL/6J mice were purchased from GemPharmatech Co., Ltd. GL261-shCtrl and GL261-shNR4A1 cells, lentivirally transduced with firefly luciferase, were implanted into the frontal subdural region. 1.5 \u0026times; 10⁵ GBM cells in 5 \u0026micro;L of PBS were delivered into the corpus striatum of the right hemisphere via stereotactic injection (coordinates: antero-posterior = -0.14 mm; medio-lateral\u0026thinsp;=\u0026thinsp;+\u0026thinsp;2.0 mm; dorso-ventral = -3.0 mm). Intracranial tumor growth was monitored by bioluminescence imaging (BLI) using an IVIS Lumina LT system (Perkin Elmer, USA). Each mouse was intraperitoneally injected with 10 mg of D-luciferin (YEASEN, China) before imaging.\u003c/p\u003e\u003cp\u003eFor NR4A1 agonist treatment in intracranial GBM models, Cytosporone B (Csn-B, HY-N2148, MedChemExpress) was dissolved in DMSO and diluted with normal saline containing 5.0% (V/V) Tween-80 to a final concentration of 0.05 mg/mL. Normal saline with DMSO and 5.0% Tween-80 was used as the vehicle control. Each mouse was intraperitoneally injected with 250 \u0026micro;L of Csn-B every two days for a total of 10 days.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM based on 3 to 5 independent experiments. Differences between control and experimental conditions were evaluated using one-way ANOVA followed by Tukey's multiple comparisons test. For analyses involving two factors, a two-way ANOVA with Bonferroni's post hoc test was employed. All statistical analyses were performed using SPSS 24.0 software (IBM Corp.). Kaplan-Meier survival curves were compared using the log-rank test to assess differences in survival between groups. Results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, and all experiments were repeated at least three times independently. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eNR4A1 expression is decreased in human gliomas and correlates with poor prognosis\u003c/h2\u003e\u003cp\u003eFirstly, we interrogated the glioma cohort from the Cancer Genome Atlas (TCGA) database to investigate the clinical role of NR4A1 in the malignant progression of gliomas. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, GBMs with higher WHO grade had a lower expression level of NR4A1. IDH mutations and chromatin 1p/19q co-deletion are characteristic features of low-grade gliomas, in which high levels of NR4A1 were detected. Furthermore, the expression level of NR4A1 was higher in gliomas with methylated promoter of MGMT and proneural subtype (Supplementary Fig.\u0026nbsp;1). By performing univariate Cox regression analysis, we identified that NR4A1 was a bona fide protective factor for glioma outcomes, compared with those risk factors including IDH-WT, chromatin 1p/19q non-co-deletion, and unmethylated promoter of MGMT (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Kaplan-Meier curve confirmed that significant shortened overall survival time was observed in glioma patients with low level of NR4A1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), especially combined with methylated promoter of MGMT (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Western blot analysis also showed decreased NR4A1 protein levels in high-grade glioma specimens compared to low-grade ones (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). qRT-PCR analysis demonstrated significantly reduced NR4A1 mRNA levels in glioma cell lines U87MG, U251, and GSC compared to neural stem cells (NSCs) and normal human astrocytes (NHAs) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Additionally, IHC analysis indicated lower NR4A1 expression in high-grade gliomas than in low-grade gliomas (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH-I). Overall, these findings suggest that NR4A1 plays a key role in glioma progression.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eKnockdown of NR4A1 enhanced glioma cell resistance to erastin-induced ferroptosis\u003c/h2\u003e\u003cp\u003eTo figure out the functional role of NR4A1 in gliomas, we performed GSEA analysis to enrich the signaling pathways which correlates with NR4A1 expression. The result showed that \u0026ldquo;ferroptosis\u0026rdquo; pathway was enriched, indicating that NR4A1 regulated ferroptosis in gliomas (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). So we utilized U87MG and U251 cells to construct NR4A1 knockdown or overexpressed cells via GV248-NR4A1 shRNA or GV492-NR4A1 lentiviruses transfection. Knockdown and overexpression efficiencies were confirmed via western blot analysis (Supplementary Fig.\u0026nbsp;2A). We investigated NR4A1\u0026rsquo;s effect on erastin-induced ferroptosis by treating U87MG and U251 cells with various erastin doses for 24 h. Results showed erastin induced a dose-dependent ferroptotic cell death, which was largely reversed by NR4A1 knockdown, making cells resistant to ferroptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-C),and representative images showed that loss of NR4A1 reduced erastin-induced cell death (Supplementary Fig.\u0026nbsp;2B). In contrast, overexpression of NR4A1 significantly increased erastin-induced ferroptosis in U87MG cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Consistent with previous findings, we found that RSL3 does dependent induced ferroptosis of U251 cells, whereas knockdown of NR4A1 had no effect on RSL3-induced ferroptotic cell death(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Using C11-BODIPY581/591 probes to detect lipid peroxidation, we found that green fluorescence (indicating oxidation) increased and red fluorescence (indicating non-oxidation) decreased after NR4A1 knockdown. These results suggest that while erastin induces ROS accumulation, NR4A1 downregulation reverses erastin-induced lipid peroxidation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-H).\u003c/p\u003e\u003cp\u003eTo further investigated the role of NR4A1 on erastin-induced cytotoxic efficacy in glioma cells. EdU assays were performed to evaluate cell proliferation. Erastin notably inhibited cell proliferation, while the cell proliferation of U251 and TBD0220 GBM cells transfected with sh-NR4A1 was also reduced in EdU experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI-L).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eNR4A1 regulates iron-dependent peroxidation in ferroptosis through NCOA4 pathway\u003c/h2\u003e\u003cp\u003eTo explore whether NR4A1 knockdown reduces iron accumulation during ferroptosis in GBM cells, intracellular iron levels were measured in si-NR4A1-transfected U87MG cells. As shown in supplementary Fig.\u0026nbsp;1C, the efficiency of knockdown was detected by western blotting analysis. intracellular iron levels decreased by approximately 35% in erastin-treated U87MG cells with NR4A1 loss (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u0026ndash;B). Given the involvement of mitochondrial iron accumulation and mitochondrial reactive oxygen species (mtROS) in lipid peroxidation, immunofluorescence colocalization techniques were used to detect Fe\u0026sup2;⁺ expression in the mitochondria of U87MG cells. Results showed that erastin treatment reduced the number of mitochondria (red), while pronounced green fluorescence was observed in the cytoplasm. Immunofluorescence staining revealed that Fe\u0026sup2;⁺ levels in the cytoplasm and mitochondria were significantly increased after erastin treatment, and these effects were reversed by NR4A1 silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u0026ndash;C).\u003c/p\u003e\u003cp\u003eTo explore whether NR4A1 downregulation affects mitochondrial activity and confers resistance to erastin-induced ferroptosis, we observed a fragmented mitochondrial phenotype in erastin-treated U87MG cells via confocal- fluorescence microscopy, whereas NR4A1 shRNA cells showed less mitochondrial fragmentation around the nucleus in response to erastin toxicity (Supplementary Fig.\u0026nbsp;2C-D).We further assessed mitochondrial membrane potential (ΔΨm) by monitoring the red-to-green fluorescence ratio of the JC-1 dye. Under healthy, polarized conditions, JC-1 accumulates as red-fluorescent J-aggregates within mitochondria; upon depolarization it shifts to the green-fluorescent monomeric form. In U87MG cells transfected with shNR4A1, this ratio fell markedly, indicating ΔΨm dissipation and reduced dye aggregation within the organelles (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-E).\u003c/p\u003e\u003cp\u003eWe next examined the effect of knocking down or overexpress of NR4A1 on the expressions of ferroptosis-related proteins including Acyl-CoA synthetase long chain family member 4 (ACSL4), nuclear receptor coactivator 4 (NCOA4) and glutathione peroxidase 4 (GPX4) in U87MG cells with erastin or RSL-3 treatment. Western blots results showed much higher NCOA4 protein expression in erastin-treated cells, silencing NR4A1 significantly decreased the basal and erastin-induced expression of NCOA4 as well as RSL3-induced expression of ACSL4, but there was no significant change for ACSL4 and GPX4 expression after erastin treatment(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). To further investigate whether NR4A1 regulates ACSL4 expression in erastin-treated glioma cells. We transfected U87MG cells with GV248-NR4A1 to down-regulate or GV492-NR4A1 lentiviruses to up-regulate NR4A1, our results confirmed showed NR4A1 had no effect on ACSL4 level in the U87MG cells after the erastin treatment(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-H).\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eNR4A1 regulates NCOA4 mediating autophagic delivery of ferritin to lysosomes\u003c/h2\u003e\u003cp\u003eThe cargo receptor NCOA4 promotes ferritin degradation through ferritinophagy, which is involved in iron metabolism and ferroptosis. We therefore investigated whether NCOA4 was involved in ferroptosis induced by the NR4A1. Immunofluorescence staining showed increased NR4A1 expression in both the cytoplasm and mitochondria of U87MG cells, and NR4A1(red) was colocalized with NCOA4 (green)-positive puncta in the cytoplasm(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B), but no changes in NR4A1 protein expression after erastin treatment(Supplementary Fig.\u0026nbsp;3A). Confocal images showing colocalization of NR4A1 (red), Hsp60(green), and DAPI (blue) in U87MG cells (Supplementary Fig.\u0026nbsp;3B).\u003c/p\u003e\u003cp\u003eFerritin heavy polypeptide 1 (FTH1), a substrate of ferritinophagy, is the primary iron storage protein complex in cells. Our results demonstrated that basal FTH1 levels increased in U87MG cells transfected with NR4A1 shRNAs. Moreover, erastin stimulated NCOA4 expression in a dose- dependent manner (Supplementary Fig.\u0026nbsp;3C). NCOA4 protein levels decreased while FTH1 levels markedly increased in erastin-treated U87MG cells transfected with NR4A1 shRNA1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u0026ndash;E). To further investigate whether NCOA4/FTH1 signaling was involved in ferroptosis induced by the NR4A1, GV492-NR4A1 was used to overexpress NR4A1 in U87MG cells. Our results showed basal NCOA4 level significantly increased while FTH1 level decreasedafter erastin treatment. NCOA4 expression was also enhanced in erastin-treated U87MG cells overexpressing NR4A1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-G). These results suggest that NR4A1 deficiency inhibits NCOA4-induced iron upregulation.\u003c/p\u003e\u003cp\u003eCo-immunoprecipitation (Co-IP) was used to validate the interaction between NR4A1 and NCOA4 in U87MG cells. U87MG cells were transfected with sh-NR4A1 or Lv-NR4A1. We found that NCOA4 binding to FTH1 was reduced in sh-NR4A1 cells but induced in Lv-NR4A1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I), suggesting that knockdown of NR4A1 reduced the degradation of FTH1 by NCOA4.\u003c/p\u003e\u003cp\u003eThe role of NR4A1 in affecting autolysosome formation was further determined by a lentivirus expressing GFP/mCherry-EGFP-LC3B. U87MG cells were first transfected with GFP/mCherry-LC3 for 48 h and then si-NR4A1 for 24 h. The co-localization of green (GFP) and red fluorescence (mCherry) occurs in the formation of autophagosomes displaying yellow. Our results showed erastin treatment significantly increased the autophagosomes formation as exhibited by increase in number of vesicles positive for yellow fluorescence, which was reversed by NR4A1 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ-K). This suggested that loss of NR4A1 decreases autophagic flux by diminishing the autophagosome formation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003eNR4A1 induces autophagy and NCOA4-mediated degradation of ferritin in GBM cells\u003c/h2\u003e\u003cp\u003eWestern blot and quantitative real-time PCR analyses were used to measure the markers of autophagosomes(LC3B-II) and autophagy(ATG5/ATG7). Our results demonstrated that erastin stimulated the protein expression of ATG7. In contrast, NR4A1 knockdown inhibited erastin-induced expression of ATG7 but not ATG5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). Additionally, erastin treatment increased \u003cem\u003eAtg5\u003c/em\u003e,\u003cem\u003eAtg7,LC3\u003c/em\u003e and \u003cem\u003eNCOA4\u003c/em\u003e mRNA levels which were also reversed by NR4A1 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC\u0026ndash;F). We examined whether NR4A1 overexpressing led to changes in ATG7 and LC3B-II levels, the results showed ATG7 and LC3B-II were significantly increased in GV492-NR4A1 transfected U87MG cells, and the expressions of ATG7 and LC3B-II were enhanced after treatment with erastin in the GV492-NR4A1 transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-I).\u003c/p\u003e\u003cp\u003eAutophagy-related (Atg) genes play a central role in regulating ferritinophagy. We further investigated whether knockout of Atg5 or Atg7 is involved in NR4A1-regulated ferroptosis. GBM cells (U251 and U87MG) were transfected with lentiviruses GV492-NR4A1 for 36 h to overexpress NR4A1, followed by transfection with specific siRNAs to suppress ATG5/ATG7 expression. As shown in supplementary Fig.\u0026nbsp;3D-E, ATG5 siRNA and ATG7 siRNA obviously blocked the expression of ATG5 and ATG7 in U87MG cells, respectively. Intracellular iron levels were assessed, and results showed that ATG7 knockout, but not ATG5 knockout, inhibited erastin-induced intracellular iron levels compared to the NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ-K). Western blot analysis revealed that in ATG7-deficient U87MG and U251 cells, FTH1 protein levels markedly increased while NCOA4 levels significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eM). This suggests that ATG7-mediated autophagy is essential for ferritin degradation induced by NR4A1.\u003c/p\u003e\u003cp\u003eWe also explored the effect of autophagy on NR4A1-induced ferroptosis in U87MG cells. GV492-NR4A1 transfected U87MG cells were treated with 3-MA or chloroquine (CQ) for 24 h, and cell viability was examined using the CCK-8 assay. Results indicated that erastin induced ferroptotic cell death, which was largely reversed by 3-MA but not CQ treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL). To investigate autophagic flux in NR4A1-induced ferritinophagy after erastin treatment, NR4A1-overexpressing U87MG cells were treated with 3-MA or CQ for 24 h. Western blot results showed that 3-MA prevented autophagosome assembly and inhibited the conversion of LC3B-I to LC3B-II (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eN). In contrast, CQ interfered with autophagy progression by inhibiting autophagosome-lysosome fusion, leading to LC3B-II accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eN). CQ treatment increased NCOA4 levels in both basal and erastin-treated cells, while 3-MA treatment, which blocks autophagosome formation, promoted NCOA4 degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eN).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDownregulation of NR4A1 inhibits erastin sensitivity and promotes GBM cell growth\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo determine if NR4A1 enhances tumor sensitivity to erastin in vivo, we established nude mouse subcutaneous models using U87MG-shNR4A1 and U87MG-shCtrl cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Mice were intraperitoneally treated with erastin (10 mg/kg) or DMSO (0.3%) every 2 days for 14 days post-implantation. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB\u0026ndash;C, U87MG-shNR4A1 mice showed no significant weight change compared to the shCtrl group until day 6 of erastin treatment. By day 10, erastin-treated U87MG-shNR4A1 mice exhibited notably larger tumor volumes than shCtrl mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E). Ki67\u0026thinsp;+\u0026thinsp;cell counts were substantially higher in U87MG-shNR4A1 tumors, indicating increased glioma proliferation upon NR4A1 depletion (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF-G). Immunohistochemistry revealed reduced NCOA4 expression in U87MG-shNR4A1 tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH-I). We next investigated levels of NCOA4\u0026ndash;FTH1 pathway proteins in mouse tumors using western blots. Consistent with the in vitro results, knockdown of NR4A1 mitigated GPX-4 and NCOA4 levels while enhanced FTH1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ-K). Additionally, NR4A1 deficiency in tumors showed decreased beclin-1 levels whereas LC3 level did not change significantly(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eL-M).\u003c/p\u003e\u003cp\u003eIn another experiment, luciferase-expressing GL261-sh-NR4A1 and GL261-sh-Ctrl cells were implanted into C57BL/6 mice brains. Mice received intraperitoneal injections of erastin (10 mg/kg) or DMSO (0.3%) every 2 days starting 14 days post-implantation. Tumor growth was monitored weekly via bioluminescence over 35 days. Results showed significantly higher bioluminescence values in GL261-sh-NR4A1 mice by day 28 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), with mean total radiance counts approximately 76% higher than in the shCtrl group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB-C). GL261-sh-NR4A1 tumors were visibly larger than shCtrl tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). All GL261-sh-Ctrl mice treated with erastin survived the observation period, while none of the erastin-treated GL261-sh-NR4A1 mice survived beyond 35 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). TUNEL assays indicated that erastin-induced cell death in vivo was significantly inhibited by NR4A1 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF-G). Additionally, malondialdehyde (MDA) levels and ferrous iron levels were lower in GL261-sh-NR4A1 tumors compared to GL261-sh-Ctrl tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eH-I).\u003c/p\u003e\u003cp\u003eImmunostaining for the proliferation marker Ki67 showed increased proliferation in GL261-sh-NR4A1 tumors, accompanied by reduced NCOA4 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eJ-K,\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eM-N). Transmission electron microscopy revealed characteristic mitochondrial changes, with GL261 tumors lacking NR4A1 exhibiting shrunken mitochondria and increased membrane density (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eL). Overall, our findings demonstrate that NR4A1 loss promotes GBM tumor growth and enhances resistance to erastin-induced ferroptosis by downregulating NCOA4-mediated ferritin degradation. This suggests NR4A1 as a potential therapeutic target to enhance erastin\u0026rsquo;s efficacy.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePharmacological activation of NR4A1 by Csn-B decreases GBM growth\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo confirm whether NR4A1 stimulation could represses GBM growth, GL261-bearing mice received five intraperitoneal doses of the NR4A1 agonist Cytosporone-B (Csn-B) over 10 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). In-vivo imaging revealed markedly smaller tumors in Csn-B-treated animals relative to vehicle controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB-C), and Kaplan\u0026ndash;Meier analysis showed a pronounced extension of overall survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). TUNEL staining revealed a modest induction of cell death \u003cem\u003ein vivo\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE-F). Consistent with this, we found that Csn-B triggered dose-dependent cell death in cultured glioma cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG). Immunoblotting showed that Csn-B elevated the autophagy- and ferritinophagy-related proteins ATG5, ATG7 and NCOA4 without altering the ferroptosis markers GPX4 or ACSL4 in U87MG cells(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eH-I). Collectively, these data position NR4A1 agonists as potential chemopreventive agents for GBM.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGBM often develops chemotherapy resistance during treatment, leading to poor prognosis in glioma patients. [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Thus, identifying new therapeutic targets to combat glioma cells is crucial. Inducing ferroptosis in GBM has shown anti-tumor effects [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. As autophagy can enhance ferroptosis during ROS-dependent processes, exploring how autophagy regulates ferroptosis may aid cancer treatment. [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. A recent study highlighted NR4A1 agonists as potent inhibitors of GBM growth in vitro[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In this study, we found that low NR4A1 expression in human gliomas correlates with poor prognosis, based on genomic data. NR4A1 expression is also downregulated in GBM cell lines compared to normal human astrocytes. Moreover, NR4A1 knockdown inhibits autophagy and NCOA4-mediated ferritin degradation both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. These findings shed new light on the interplay between autophagy and ferroptosis, suggesting that targeting NR4A1 alongside ferroptosis induction could be a novel approach to treat GBM.\u003c/p\u003e\u003cp\u003eAutophagy's role in cancer cell ferroptosis varies with context and the tumor microenvironment. For instance, autophagy can remove damaged lipids to inhibit ferroptosis in liver cancer[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Conversely, it can also induce cell death, though the mechanisms are unclear[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Repurposed drugs targeting autophagic pathways in gliomas have shown therapeutic benefits[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. High LC3B-II expression is linked to better glioma patient outcomes [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Our results indicate that NR4A1 enhances autophagy, making glioma cells more sensitive to ferroptosis inducers. NR4A1 knockdown impairs the autophagic response and increases ferritin levels in GBM cells, confirming that autophagy-driven ferritinophagy causes GBM cell death via ferroptosis.\u003c/p\u003e\u003cp\u003eThe roles of NR4A1 are complex and context-dependent [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Under energy stress, NR4A1 moves from the nucleus to mitochondria, forming a complex with TPβ to support melanoma cell survival. [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Other studies show NR4A1 agonists induce autophagic cell death[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. NR4A1 in mitochondria triggers ATG-mediated LC3 conversion[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. NCOA4 transports ferritin to autophagosomes for degradation, releasing iron. [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Atg5 and Atg7 are crucial for autophagosome formation[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Knockout of Atg5 (autophagy-related 5) and Atg7 inhibited erastin-induced ferroptosis with decreased intracellular Fe2\u0026thinsp;+\u0026thinsp;and lipid peroxidation[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Our findings show that Atg7 knockout, but not Atg5, makes NR4A1-overexpressing U87MG cells more resistant to erastin-induced ferroptosis. Erastin also promotes NR4A1 translocation to mitochondria, where it interacts with NCOA4. This interaction may enhance ferritin degradation via the NCOA4 pathway, increasing Fe\u0026sup2;⁺ levels. The ensuing Fenton reaction boosts ROS, leading to ferroptosis.\u003c/p\u003e\u003cp\u003eSince mitochondria are the primary source of cellular ROS, we first examined whether mitochondria were involved in NR4A1-dependent ferroptosis in glioma cells. Recent studies show cytosolic Fe\u0026sup2;⁺ can be transported to mitochondria and stored by ferritin. Mitochondrial proteins like CDGSH iron sulfur domain 1 (CISD1) and Frataxin (FXN) regulate ferroptosis by mediating iron uptake and lipid peroxidation[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our study confirms mitochondrial iron accumulation and mtROS involvement in lipid peroxidation. Erastin toxicity caused mitochondrial fragmentation and accumulation around the nucleus, changes alleviated in NR4A1 shRNA-transfected cells. These results indicated NR4A1 participates in mitochondria-associated ferroptosis in glioma cells, which were consistent with the morphology of mitochondria caused by ferroptosis were found in the erastin[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNR4A1 activity is regulated by gene expression, posttranslational modifications, and coregulator interactions[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. However, factors causing NR4A1 inactivation in gliomas remain unclear. IDH1 mutants enhance ferritinophagy flux in gliomas by inhibiting the PRMT1-PTX3 axis[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].PRMT1 increases NR4A1 protein levels through transactivation and delayed degradation[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Thus, PRMT1 may induce NR4A1 upregulation linked to ferritinophagy in gliomas, warranting further study. Ferroptosis inducers like erastin can also enhance GBM sensitivity to TMZ[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], suggesting that inducing ferroptosis in tumor cells holds great potential for glioma treatment.\u003c/p\u003e\u003cp\u003eCsn-B, as a fungal-derived ketone compound was isolated and identified as a specific activator of NR4A1 transcription. Csn-B drives the nuclear export of NR4A1 to mitochondria in tumor cells, provoking the release of cytochrome c into the cytosol and triggering apoptosis, thereby suppressing growth of tumor xenografts in nude mice[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].Beyond apoptosis, NR4A1 can also elicit autophagy-dependent cell death[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].NR4A1-mediated mitophagy selectively promotes cell death and restrains melanoma progression[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Thus, pharmacological activation of NR4A1 may overcome long-term drug-evoked resistance to apoptosis and enhance therapeutic efficacy in the clinic. Accumulating evidence links autophagy intimately to ferroptosis [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]。Using orthotopic GL261 and U87MG patient-derived xenograft (PDX) models, we demonstrated that NR4A1 knockdown strongly blunts the anti-glioma activity of the ferroptosis inducer erastin. Mechanistically, the NR4A1 agonist Csn-B stimulates autophagy and ferritinophagy, elevating cytosolic and mitochondrial Fe\u0026sup2;⁺ levels and thereby driving tumor-cell ferroptosis and halting glioma progression. Hence, boosting NR4A1 expression or activity offers a novel therapeutic avenue for glioma. Endoplasmic-reticulum stress (ERS) activates autophagy through multiple pathways. The ERS sensor PERK undergoes autophosphorylation, phosphorylates eIF2α, and activates the transcription factor ATF4, which up-regulates autophagy-related genes[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Activation of the PERK/ATF4 axis reduces proliferation and increases apoptosis of GBM cells in response to irradiation[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].Whether NR4A1 modulates ERS-driven autophagy and ferroptosis in GBM remains unknown, and whether NR4A1 activation can overcome temozolomide (TMZ) resistance and radio-resistance in glioma requires further investigation. The proposed project will address these questions and open new perspectives for clinical glioma therapy.\u003c/p\u003e\u003cp\u003eOur study reveals that NR4A1 induces ferroptosis in GBM by delivering ferritin to lysosomes via NCOA4. We detail how NR4A1-mediated autophagy contributes to ferroptosis through ferritin degradation in glioma cells. Targeting NR4A1 to induce ferroptosis in tumor cells may be a promising glioma treatment strategy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWritten informed consent was obtained from all the participants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration sections\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was compliant with all relevant ethical regulations regarding research involving human participants and what stated in the Declaration of Helsinki. For this study that use human glioma tissues were procured in line with WHO Guiding Principles on Human Cell, Tissue and Organ Transplantation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman glioma samples were obtained from Department of Neurosurgery, Peking University Shenzhen Hospital, and the study was granted by the Ethics Committee of Peking University Shenzhen Hospital (No.2022-162A). Written informed consents were obtained from all patients.\u003c/p\u003e\n\u003cp\u003eRegistry and the Registration No. ChiCTR2500107124.\u003c/p\u003e\n\u003cp\u003eThe animal experiments were performed according to internationally followed ethical standards and approved by the research ethics committee of Shenzhen PKU-HKUST Medical Center.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the GuangDong Basic and Applied Basic Research Foundation (2022A1515111077;2023A1515220061;2024A1515220021), Shenzhen \u0026nbsp;Basic \u0026nbsp;Research Projects (JCYJ20220531094202006;JCYJ20240813120113018),\u0026nbsp;and the Scientific Research Foundation of Peking University Shenzhen Hospital (KYQD202100X, KYQD2023254, LCYJ2022029).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eZhi Liang\u003c/em\u003e and \u003cem\u003eSufang Zhong\u003c/em\u003e performed experiments and drafted the manuscript. \u003cem\u003eWeixian Zeng\u003c/em\u003e performed experiments. \u003cem\u003eWenjing Chen\u003c/em\u003e and \u003cem\u003ePeng Huang\u003c/em\u003e supported the sample. \u003cem\u003eQiongye Dong\u003c/em\u003e and \u003cem\u003eXiaoteng Cui\u003c/em\u003e analyzed the data. \u003cem\u003eRikang Wang\u003c/em\u003e and \u003cem\u003eBaodong Chen\u003c/em\u003e conceived the hypotheses, designed the experiments and supervised the students, \u003cem\u003eChunsheng Kang\u003c/em\u003e and \u003cem\u003eTao Wu\u003c/em\u003e revised the manuscript. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest disclosures\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKhan F, Pang L, Dunterman M, Lesniak MS, Heimberger AB, Chen P. Macrophages and microglia in glioblastoma: heterogeneity, plasticity, and therapy. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e 2023; 133.\u003c/li\u003e\n\u003cli\u003eZhang Y, Kong Y, Ma Y, Ni S, Wikerholmen T, Xi K\u003cem\u003e et al\u003c/em\u003e. Loss of COPZ1 induces NCOA4 mediated autophagy and ferroptosis in glioblastoma cell lines. \u003cem\u003eOncogene\u003c/em\u003e 2021; 40: 1425-1439.\u003c/li\u003e\n\u003cli\u003eZhao J, Yang S, Cui X, Wang Q, Yang E, Tong F\u003cem\u003e et al\u003c/em\u003e. A novel compound EPIC-0412 reverses temozolomide resistance via inhibiting DNA repair/MGMT in glioblastoma. \u003cem\u003eNeuro Oncol\u003c/em\u003e 2023; 25: 857-870.\u003c/li\u003e\n\u003cli\u003eLiu T, Zhu C, Chen X, Guan G, Zou C, Shen S\u003cem\u003e et al\u003c/em\u003e. Ferroptosis, as the most enriched programmed cell death process in glioma, induces immunosuppression and immunotherapy resistance. \u003cem\u003eNeuro Oncol\u003c/em\u003e 2022; 24: 1113-1125.\u003c/li\u003e\n\u003cli\u003eWilson AJ, Liu AY, Roland J, Adebayo OB, Fletcher SA, Slaughter JC\u003cem\u003e et al\u003c/em\u003e. TR3 modulates platinum resistance in ovarian cancer. \u003cem\u003eCancer research\u003c/em\u003e 2013; 73: 4758-4769.\u003c/li\u003e\n\u003cli\u003eLee SO, Li X, Khan S, Safe S. Targeting NR4A1 (TR3) in cancer cells and tumors. \u003cem\u003eExpert opinion on therapeutic targets\u003c/em\u003e 2011; 15: 195-206.\u003c/li\u003e\n\u003cli\u003eZarraga-Granados G, Mucino-Hernandez G, Sanchez-Carbente MR, Villamizar-Galvez W, Penas-Rincon A, Arredondo C\u003cem\u003e et al\u003c/em\u003e. The nuclear receptor NR4A1 is regulated by SUMO modification to induce autophagic cell death. \u003cem\u003ePloS one\u003c/em\u003e 2020; 15: e0222072.\u003c/li\u003e\n\u003cli\u003eWang WJ, Wang Y, Chen HZ, Xing YZ, Li FW, Zhang Q\u003cem\u003e et al\u003c/em\u003e. Orphan nuclear receptor TR3 acts in autophagic cell death via mitochondrial signaling pathway. \u003cem\u003eNature chemical biology\u003c/em\u003e 2014; 10: 133-140.\u003c/li\u003e\n\u003cli\u003eLathoria K, Gowda P, Umdor SB, Patrick S, Suri V, Sen E. PRMT1 driven PTX3 regulates ferritinophagy in glioma. \u003cem\u003eAutophagy\u003c/em\u003e 2023; 19: 1997-2014.\u003c/li\u003e\n\u003cli\u003eMancias JD, Wang X, Gygi SP, Harper JW, Kimmelman AC. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. \u003cem\u003eNature\u003c/em\u003e 2014; 509: 105-109.\u003c/li\u003e\n\u003cli\u003eDowdle WE, Nyfeler B, Nagel J, Elling RA, Liu S, Triantafellow E\u003cem\u003e et al\u003c/em\u003e. Selective VPS34 inhibitor blocks autophagy and uncovers a role for NCOA4 in ferritin degradation and iron homeostasis in vivo. \u003cem\u003eNat Cell Biol\u003c/em\u003e 2014; 16: 1069-1079.\u003c/li\u003e\n\u003cli\u003eZhao Y, Li Y, Zhang R, Wang F, Wang T, Jiao Y. The Role of Erastin in Ferroptosis and Its Prospects in Cancer Therapy. \u003cem\u003eOncoTargets and therapy\u003c/em\u003e 2020; 13: 5429-5441.\u003c/li\u003e\n\u003cli\u003eXie Y, Hou W, Song X, Yu Y, Huang J, Sun X\u003cem\u003e et al\u003c/em\u003e. Ferroptosis: process and function. \u003cem\u003eCell death and differentiation\u003c/em\u003e 2016; 23: 369-379.\u003c/li\u003e\n\u003cli\u003eZhang Y, Fu X, Jia J, Wikerholmen T, Xi K, Kong Y\u003cem\u003e et al\u003c/em\u003e. Glioblastoma Therapy Using Codelivery of Cisplatin and Glutathione Peroxidase Targeting siRNA from Iron Oxide Nanoparticles. \u003cem\u003eACS applied materials \u0026amp; interfaces\u003c/em\u003e 2020; 12: 43408-43421.\u003c/li\u003e\n\u003cli\u003eCho HJ, Zhao J, Jung SW, Ladewig E, Kong DS, Suh YL\u003cem\u003e et al\u003c/em\u003e. Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma. \u003cem\u003eNeuro Oncol\u003c/em\u003e 2019; 21: 47-58.\u003c/li\u003e\n\u003cli\u003eZhao J, Cui X, Zhan Q, Zhang K, Su D, Yang S\u003cem\u003e et al\u003c/em\u003e. CRISPR-Cas9 library screening combined with an exosome-targeted delivery system addresses tumorigenesis/TMZ resistance in the mesenchymal subtype of glioblastoma. \u003cem\u003eTheranostics\u003c/em\u003e 2024; 14: 2835-2855.\u003c/li\u003e\n\u003cli\u003eSchaff LR, Mellinghoff IK. Glioblastoma and Other Primary Brain Malignancies in Adults: A Review. \u003cem\u003eJama\u003c/em\u003e 2023; 329: 574-587.\u003c/li\u003e\n\u003cli\u003eLin X, Ping J, Wen Y, Wu Y. The Mechanism of Ferroptosis and Applications in Tumor Treatment. \u003cem\u003eFrontiers in pharmacology\u003c/em\u003e 2020; 11: 1061.\u003c/li\u003e\n\u003cli\u003eLee S, Hwang N, Seok BG, Lee S, Lee SJ, Chung SW. Autophagy mediates an amplification loop during ferroptosis. \u003cem\u003eCell death \u0026amp; disease\u003c/em\u003e 2023; 14: 464.\u003c/li\u003e\n\u003cli\u003eUpadhyay S, Hailemariam AE, Mariyam F, Hafiz Z, Martin G, Kothari J\u003cem\u003e et al\u003c/em\u003e. Bis-Indole Derivatives as Dual Nuclear Receptor 4A1 (NR4A1) and NR4A2 Ligands. \u003cem\u003eBiomolecules\u003c/em\u003e 2024; 14.\u003c/li\u003e\n\u003cli\u003eZhang Z, Yao Z, Wang L, Ding H, Shao J, Chen A\u003cem\u003e et al\u003c/em\u003e. Activation of ferritinophagy is required for the RNA-binding protein ELAVL1/HuR to regulate ferroptosis in hepatic stellate cells. \u003cem\u003eAutophagy\u003c/em\u003e 2018; 14: 2083-2103.\u003c/li\u003e\n\u003cli\u003eJiang X, Overholtzer M, Thompson CB. Autophagy in cellular metabolism and cancer. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e 2015; 125: 47-54.\u003c/li\u003e\n\u003cli\u003eShchors K, Massaras A, Hanahan D. Dual Targeting of the Autophagic Regulatory Circuitry in Gliomas with Repurposed Drugs Elicits Cell-Lethal Autophagy and Therapeutic Benefit. \u003cem\u003eCancer cell\u003c/em\u003e 2015; 28: 456-471.\u003c/li\u003e\n\u003cli\u003eAoki H, Kondo Y, Aldape K, Yamamoto A, Iwado E, Yokoyama T\u003cem\u003e et al\u003c/em\u003e. Monitoring autophagy in glioblastoma with antibody against isoform B of human microtubule-associated protein 1 light chain 3. \u003cem\u003eAutophagy\u003c/em\u003e 2008; 4: 467-475.\u003c/li\u003e\n\u003cli\u003eSafe S, Karki K. The Paradoxical Roles of Orphan Nuclear Receptor 4A (NR4A) in Cancer. \u003cem\u003eMolecular cancer research : MCR\u003c/em\u003e 2021; 19: 180-191.\u003c/li\u003e\n\u003cli\u003eLi XX, Wang ZJ, Zheng Y, Guan YF, Yang PB, Chen X\u003cem\u003e et al\u003c/em\u003e. Nuclear Receptor Nur77 Facilitates Melanoma Cell Survival under Metabolic Stress by Protecting Fatty Acid Oxidation. \u003cem\u003eMolecular cell\u003c/em\u003e 2018; 69: 480-492 e487.\u003c/li\u003e\n\u003cli\u003eHu M, Luo Q, Alitongbieke G, Chong S, Xu C, Xie L\u003cem\u003e et al\u003c/em\u003e. Celastrol-Induced Nur77 Interaction with TRAF2 Alleviates Inflammation by Promoting Mitochondrial Ubiquitination and Autophagy. \u003cem\u003eMolecular cell\u003c/em\u003e 2017; 66: 141-153 e146.\u003c/li\u003e\n\u003cli\u003eFang Y, Chen X, Tan Q, Zhou H, Xu J, Gu Q. Inhibiting Ferroptosis through Disrupting the NCOA4-FTH1 Interaction: A New Mechanism of Action. \u003cem\u003eACS Cent Sci\u003c/em\u003e 2021; 7: 980-989.\u003c/li\u003e\n\u003cli\u003eXie Y, Kang R, Sun X, Zhong M, Huang J, Klionsky DJ\u003cem\u003e et al\u003c/em\u003e. Posttranslational modification of autophagy-related proteins in macroautophagy. \u003cem\u003eAutophagy\u003c/em\u003e 2015; 11: 28-45.\u003c/li\u003e\n\u003cli\u003eHou W, Xie Y, Song X, Sun X, Lotze MT, Zeh HJ, 3rd\u003cem\u003e et al\u003c/em\u003e. Autophagy promotes ferroptosis by degradation of ferritin. \u003cem\u003eAutophagy\u003c/em\u003e 2016; 12: 1425-1428.\u003c/li\u003e\n\u003cli\u003eYuan H, Li X, Zhang X, Kang R, Tang D. CISD1 inhibits ferroptosis by protection against mitochondrial lipid peroxidation. \u003cem\u003eBiochemical and biophysical research communications\u003c/em\u003e 2016; 478: 838-844.\u003c/li\u003e\n\u003cli\u003eMancardi D, Mezzanotte M, Arrigo E, Barinotti A, Roetto A. Iron Overload, Oxidative Stress, and Ferroptosis in the Failing Heart and Liver. \u003cem\u003eAntioxidants\u003c/em\u003e 2021; 10.\u003c/li\u003e\n\u003cli\u003eZhong S, Chen W, Wang B, Gao C, Liu X, Song Y\u003cem\u003e et al\u003c/em\u003e. Energy stress modulation of AMPK/FoxO3 signaling inhibits mitochondria-associated ferroptosis. \u003cem\u003eRedox biology\u003c/em\u003e 2023; 63: 102760.\u003c/li\u003e\n\u003cli\u003eZeng H, Qin L, Zhao D, Tan X, Manseau EJ, Van Hoang M\u003cem\u003e et al\u003c/em\u003e. Orphan nuclear receptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its transcriptional activity. \u003cem\u003eThe Journal of experimental medicine\u003c/em\u003e 2006; 203: 719-729.\u003c/li\u003e\n\u003cli\u003eLei NZ, Zhang XY, Chen HZ, Wang Y, Zhan YY, Zheng ZH\u003cem\u003e et al\u003c/em\u003e. A feedback regulatory loop between methyltransferase PRMT1 and orphan receptor TR3. \u003cem\u003eNucleic acids research\u003c/em\u003e 2009; 37: 832-848.\u003c/li\u003e\n\u003cli\u003ePolewski MD, Reveron-Thornton RF, Cherryholmes GA, Marinov GK, Cassady K, Aboody KS. Increased Expression of System xc- in Glioblastoma Confers an Altered Metabolic State and Temozolomide Resistance. \u003cem\u003eMolecular cancer research : MCR\u003c/em\u003e 2016; 14: 1229-1242.\u003c/li\u003e\n\u003cli\u003eZhan Y, Du X, Chen H, Liu J, Zhao B, Huang D\u003cem\u003e et al\u003c/em\u003e. Cytosporone B is an agonist for nuclear orphan receptor Nur77. \u003cem\u003eNature chemical biology\u003c/em\u003e 2008; 4: 548-556.\u003c/li\u003e\n\u003cli\u003eZhang XK. Targeting Nur77 translocation. \u003cem\u003eExpert opinion on therapeutic targets\u003c/em\u003e 2007; 11: 69-79.\u003c/li\u003e\n\u003cli\u003eRashid HO, Yadav RK, Kim HR, Chae HJ. ER stress: Autophagy induction, inhibition and selection. \u003cem\u003eAutophagy\u003c/em\u003e 2015; 11: 1956-1977.\u003c/li\u003e\n\u003cli\u003eBhardwaj M, Leli NM, Koumenis C, Amaravadi RK. Regulation of autophagy by canonical and non-canonical ER stress responses. \u003cem\u003eSeminars in cancer biology\u003c/em\u003e 2020; 66: 116-128.\u003c/li\u003e\n\u003cli\u003eDadey DYA, Kapoor V, Khudanyan A, Thotala D, Hallahan DE. PERK Regulates Glioblastoma Sensitivity to ER Stress Although Promoting Radiation Resistance. \u003cem\u003eMolecular cancer research : MCR\u003c/em\u003e 2018; 16: 1447-1453.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Glioblastoma , NR4A1, NCOA4, Ferroptosis, Autophagy","lastPublishedDoi":"10.21203/rs.3.rs-8304233/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8304233/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAutophagy-mediated ferritin degradation (ferritinophagy) is recognized as a critical driver of ferroptosis; however, the molecular circuitry linking selective autophagy to ferroptosis in glioma remains incompletely defined. Here, we demonstrate that the orphan nuclear receptor NR4A1 as an essential orchestrator of autophagy initiation during ferroptosis. Analysis of TCGA data revealed that lower NR4A1 expression correlates with higher glioma grade and worse patient prognosis. Knockdown of NR4A1 confers robust resistance to erastin-induced ferroptosis in human glioma cells.Mechanistically, erastin exposure triggers a rapid NR4A1-dependent cytoplasmic translocation, enabling direct interaction with the cargo receptor NCOA4. This interaction facilitates the autophagic sequestration and lysosomal degradation of ferritin, thereby amplifying the intracellular ferrous iron pool and propagating lipid peroxidation-driven ferroptosis. NR4A1 knockdown disrupts this axis, resulting in ferritin retention, diminished ferrous iron availability, and suppression of reactive oxygen species (ROS) generation. Conversely, Overexpression of NR4A1 up-regulates NCOA4 expression, and accelerates ferritinophagy, culminating in heightened ferroptotic sensitivity. Pharmacological inhibition of autophagy or knockdown of ATG7 substantially mitigates erastin-induced ferroptosis by diminishing NR4A1-mediated accumulation of intracellular ferrous iron and ROS.\u003cem\u003eIn vivo\u003c/em\u003e orthotopic xenograft models employing U87MG and GL261 glioblastoma cells stably expressing NR4A1-targeting shRNA corroborate these findings: tumors with NR4A1 depletion exhibit diminished autophagic activity, reduced ferritin turnover, and marked resistance to erastin-mediated ferroptosis, leading to accelerated tumor growth. Conversely, pharmacological activation of NR4A1 by the Cytosporone B (Csn-B) restrains malignant progression and significantly prolongs survival in glioma models.Collectively, our data establish NR4A1 as a pivotal molecular switch that couples autophagy induction to ferritinophagy-dependent ferroptosis in glioma cells and position NR4A1 pharmacology as a therapeutic strategy for enhancing ferroptosis in aggressive glioblastoma.\u003c/p\u003e","manuscriptTitle":"NR4A1 Modulates Glioblastoma Sensitive to\nErastin-Induced Ferroptosis via NCOA4 mediated Autophagy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-22 08:36:52","doi":"10.21203/rs.3.rs-8304233/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"50cbbe64-767e-4220-8dbd-b10c3e9a87bb","owner":[],"postedDate":"December 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":59451845,"name":"Biological sciences/Cell biology/Cell death"},{"id":59451846,"name":"Biological sciences/Cancer/CNS cancer"}],"tags":[],"updatedAt":"2026-01-08T15:12:38+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-22 08:36:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8304233","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8304233","identity":"rs-8304233","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.