Effect of Ether Perfluoro Carboxyl Acids (PFECAs) on Innate Immunity in Earthworms (Eisenia fetida)

Effect of Ether Perfluoro Carboxyl Acids (PFECAs) on Innate Immunity in Earthworms (Eisenia fetida) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of Ether Perfluoro Carboxyl Acids (PFECAs) on Innate Immunity in Earthworms (Eisenia fetida) Davide Gualandris, Davide Rotondo, Candida Lorusso, Valentina Audrito, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6631095/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Per‑ and polyfluoroalkyl substances (PFAS) persist in soils, yet their effects on invertebrate immunity remain poorly resolved. We compared a legacy congener, perfluorooctanoic acid (PFOA), with three short‑chain ether acids GenX (C6), MOBA (C5) and MOPrA (C4) using a 72 h OECD‑207 filter‑paper assay in the earthworm Eisenia fetida . Endpoints spanned cellular and humoral defence: amoebocyte morphometry, oxidative burst (ROS production), phenol‑oxidase (PO) activity, and transcription of the lectin CCF‑1 and the pore‑forming protein lysenin. MOBA and MOPrA enlarged amoebocytes by ~ 70% (p < 0.001), whereas PFOA and GenX had no morphometric impact. Oxidative burst fell significantly for all congeners; GenX caused a 45% drop at 0.6 µM, while MOPrA declined monotonically from − 18% (0.6 µM) to − 62% (229 µM). PO inhibition followed the same potency order (MOPrA > GenX > MOBA ≫ PFOA) with near‑complete loss at 229 µM MOPrA. CCF‑1 showed dose‑dependent or U‑shaped induction, whereas lysenin peaked at 31 µM MOPrA but was unchanged at 0.6 and 229 µM, suggesting an energetically costly yet inefficient compensatory response. Integrating these findings with published superoxide‑dismutase inhibition and catalase hyper‑activation reveals an oxidative–antioxidant–immune cascade that compromises earthworm defence at concentrations ≥ 0.6 µM (≈ 250 µg kg⁻¹ soil), levels already reported in AFFF‑impacted sites. The combined biomarker panel—amoebocyte size, ROS, CAT, PO, CCF‑1 and lysenin—offers a concise framework for assessing terrestrial PFAS risk and guiding remediation monitoring. biomarkers ecotoxicology gene expression hemolysin oxidative burst PFAS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Emerging pollutants, such as per- and polyfluoroalkyl substances (PFAS), pose a serious threat to the environment and ecosystems, potentially causing irreversible disruptions to their delicate balance (Mishra et al., 2023 ). Compared to other emerging contaminants, PFAS are exceptionally persistent due to their resistance to biodegradation, resulting in long environmental half-lives—often lasting several years—which are further influenced by their mobility and distribution across environmental compartments (Androulakakis et al., 2022 ; Meegoda et al., 2020 ; Wang et al., 2023 ). PFAS are characterized by carbon chains of variable length (typically C2–C14), which may be fully fluorinated (perfluoroalkyl) or partially fluorinated (polyfluoroalkyl). The high fluorine content, comprising the most electronegative element in the periodic table (O’Hagan, 2008 ) leads to the formation of strong carbon–fluorine (C–F) bonds, among the most stable covalent bonds known. These hydrophobic chains are commonly terminated with polar functional groups such as carboxylate, sulfonate, or phosphate moieties (Brase et al., 2021 ), conferring amphiphilic properties to the molecules (Panieri et al., 2022 ). Due to their unique physicochemical properties, PFAS have been extensively used in industrial applications and consumer products. These include their role as surfactants in the emulsion polymerization of polytetrafluoroethylene (PTFE), as well as in fast-food packaging, textile treatments (e.g., waterproofing), non-stick cookware coatings, dyes, and as active agents in aqueous film-forming foams (AFFF) used for fire suppression (Xiao, 2017 ). Over the past century, PFAS contamination has been widely documented in soil, primarily due to anthropogenic and industrial activities and the compounds’ exceptional environmental persistence (van Asselt et al., 2011 ; Brase et al., 2021 ). Multiple studies have reported PFAS in water, soil, air, food, and biological fluids (Fromme et al., 2009 ), raising significant concerns about their potential impact on both human and environmental health. Among various environmental matrices, soil is recognized as a sink for pollutants, including PFAS, serving as a long-term exposure source for both humans and animals (Brusseau et al., 2020 ). Additionally, soil is widely acknowledged as a critical reservoir for biodiversity, with approximately two-thirds of all species on Earth residing in both belowground and aboveground ecosystems (Anthony et al., 2023 ). Therefore, assessing the effects of anthropogenic activities on the soil ecosystem should be a priority for the scientific community. The need to detect and assess the effects of contamination at low concentrations and in complex mixtures has permitted the development of molecular and cellular (bio)markers of exposure. Between terrestrial invertebrates, earthworms are the species most frequently used in standard laboratory and field tests as bio-indicators of soil contamination with different classes of contaminants (Lionetto et al 2012 , Calisi et al 2025 , Xiao et al 2022 , Alves et al 2022). Earthworms are fairly common in a wide range of soils and may represent 60% of the total soil biomass (Ouellet et al., 2008 ; Jouquet et al., 2010 ). These organisms indicate soil quality through several factors: the richness and diversity of oligochaete species present at the site, the behavioral responses of individuals upon contact with the soil, the bioaccumulation of soilborne chemicals, and the expression of stress-related biomarkers. (Fründ et al., 2011 ; Vig et al 2022 ). Earthworms ingest significant amounts of soil or specific soil fractions, leading to continuous exposure to pollutants through their gut. This exposure is closely linked to the coelomic fluid, which is a primary target for toxicants. Pollutants that are deposited in the coelomic fluid are then distributed throughout the animal's tissues via interactions with the circulatory system’s capillaries. Coelomocytes, the cells within the coelomic fluid, play a crucial role in the immune defence of the earthworm (Engelmann et al., 2016 ; Alesci et al., 2023 ), and any dysfunction of these cells can adversely affect the health of the entire organism. Recently there has been great attention on the potential effects of PFAS on the immune system, this led different researchers to investigate the effects of these compounds on the immune system of different organisms. The aim of this work was to investigate the effect of PFAS on the immune system from an ecotoxicological perspective in non-target species. To this end, our study focused on assessing the potential cytotoxicity of four different PFAS congeners PFOA and three short-chain perfluoropropylene oxide acids, specifically hexafluoroproyleneo oxide dimer acid (HFPO-DA) also known with the trademark GenX, PFMOBA, and PFMOPrA on immune system cells (amoebocytes) of sexually mature earthworms ( Eisenia fetida ) within a previously tested concentration range of 0.6–229 µM (Rotondo et al., 2025 ). Exposures were carried out according to OECD Test No207 (also known as filter paper test), thus a series of different immunological parameter such as amoebocytes morphometric alterations, oxidative burst, phenol oxidase measurement and selected gene expression analyses were performed in different cells/tissues. 2. Materials & Methods Compounds : PFAS congeners were purchased of the highest purity available (analytical grade). 2,2,3,3,4,4,5,5,6,6,7,7,8,8,8-pentadecafluorooctanoic acid (PFOA) CAS n° 335-67-1 (95%) was obtained from Merck (Darmstadt, Germany), 2,3,3,3-tetrafluoro-2-(1,1,2,2,3,3,3-heptafluoropropoxy) propanoic acid (GenX) CAS n° 13252-13-6 (97%) was obtained from Synquest Laboratories Inc (Alachua, US), 2,2,3,3-tetrafluoro-3-(trifluoromethoxy) propanoic acid (MOPrA) CAS n° 377-73-1 (98%) was obtained from Synquest Laboratories Inc (Alachua, US) and 2,2,3,3,4,4-hexafluoro-4-(trifluoromethoxy) butanoic acid (MOBA) CAS n° 863090-89-5 (97%,) was obtained from ApolloScientific (Bredbury, UK). A homogeneous batch of Eisenia fetida individuals (n = 120) of similar sizes (individual wet weight after gut content clearance: 0.63 ± 0.06 g, mean ± SE) was acclimated for 48 h in 4 containers (30 animals per container) each partially filled with 3 kg of soil at 20 ± 1°C, 40% humidity, and 16:8 h light/dark regime. The artificial standard soil utilised was a mixture of 10% sphagnum peat, 20% kaolin clay and 70% sand (OECD 1984 ). The dry constituents were blended in the correct proportions and mixed thoroughly. The soil moisture content was adjusted to 45% of the water holding capacity with deionised water. The initial pH was 5.6, subsequently adjusted to 6.0 with calcium carbonate. 2.1 Experimental setup After the acclimation period, the OECD Test No. 207 (filter paper contact test) was conducted. Petri dishes were prepared by placing a filter paper disk (Whatman No. 451) in each dish. The dishes were assigned to different treatment groups (PFOA, GenX, MOBA, MOPrA), each exposed to gradually increasing concentrations of the tested contaminant. Specifically, 1 mL of each PFAS congener at the selected concentration in aqueous solution − 0.6µM, 4.2µM, 31µM, 229µM- or vehicle control (0.005% 2-propanol: water) was evenly distributed onto the filter paper. Subsequently, individual earthworms, previously rinsed with distilled water to remove any soil residues, were placed onto the prepared filter paper in each Petri dish. The concentration of 2-propanol in the control was minimised to match the concentration used in the test solutions. For the entire duration of the experiment (72 h) animals were kept in controlled conditions at 20 ± 1°C in the dark. At the end of the exposure, specimens were taken from plates and coelomocytes collected using a hypodermic syringe (Josková et al., 2009) prefilled with 0.25 ml of Hank’s Balanced Salt Solution (HBS) with 5mM EDTA. Cells were passed through a 70 𝜇m strain to eliminate aggregates and used in subsequent biotests. After coelomocytes extraction, animals were sampled and frozen at -80 ± 1°C until needed for further biochemical and molecular analyses. 2.2. Amoebocytes morphometric analysis Amoebocyte morphometric alterations were determined by image analysis on Diff-Quick® (Dade Behring, Newark, USA) stained cells (Calisi et al. 2009 ). A volume (40 µl) of coelomic fluid (diluted 1:1 in a saline solution containing 10 mM N-[Hydroxyethyl]piperazine-N0-[2-ethanesulfonic acid] (HEPES), 125 mM NaCl, 0.4 mM MgSO4, 2.7 mM KCl, 1.8 mM CaCl2, pH 7.4 with NaOH 1 M) was dispensed on a poly-L-lysine coated slide, incubated in a humid chamber (16°C) for 30 min and stained with the Diff-Quick® kit. Samples were fixed and stained on slides by repeated 1 s dips in the three reagents of the Diff-Quick® kit in sequence: Fast Green (fixative) (five dips), Eosin G in phosphate buffer pH 6.5 (eighteen dips), and Thiazine Dye in phosphate buffer pH 6.5 (two dips), then subsequently were washed in distilled water and air-dried. Diff-Quick stained amoebocytes were observed by an optic microscope (Axiostar Plus; Zeiss, Oberkochen, Germany) and the images obtained from video camera (AxioCam ERc 5s, Zeiss, Oberkochen, Germany) were digitized using the ImageJ™ software (public domain Java image processing program). The cell area, and perimeter, of 2-D digitised images was automatically calculated by the software. Approximately 80 cells per sample were analysed. 2.3. Oxidative Burst Assay Oxidative burst was assessed by quantifying reactive oxygen species (ROS) as described by Szychowski et al. ( 2016 ). This semi-quantitative assay evaluates overall ROS formation in amoebocytes using the cell-permeant dye 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific, Waltham, MA, USA). Following cell extraction, the coelomic fluid was incubated with 2.5 µM H2DCFDA for 15 minutes under continuous agitation at room temperature. Subsequently, 25,000 cells were analyzed by fluorescence flow cytometry using a SYSMEX CyFlow Space instrument equipped with a blue-green argon laser (50 mW at 488 nm and 16 mW at 375 nm). Results were expressed as the percentage of amoebocytes positive for H2DCFDA staining and as the mean fluorescence intensity. 2.4. Phenol Oxidase (PO) Assay Frozen earthworms (-80°C) were homogenised in an ice-cold buffer (100 mM Tris-HCl, pH 7.6, 0.1% Triton X-100) using a glass–Teflon Potter–Elvehjem homogeniser. Homogenates were centrifuged at 10,000× g for 20 min at 4°C, and the resulting supernatant (SN10) was collected. The assessment of the enzymatic activity of Phenol Oxidase was carried out according to Prochazkova et al., (2006) as modified by Rotondo et al. ( 2025 ) by means of a photometric assay measuring the oxidation of L-DOPA to dopachrome. The experiment setup was carried out using a 96 well plate using 10 𝜇L of SN10 (7.5 𝜇g of total protein) and 80𝜇L of 100mM Tris-HCl pH 8.0, 50mM CaCl 2 , 10mM L-DOPA. The oxidation of L-DOPA to dopachrome was measured at RT for 6 h at 490 nm using a Tecan Infinite ® F200 PRO microplate reader spectrophotometer. 2.5. Gene Expression Analysis Real-time quantitative PCR (qPCR) was employed using a TaqMan™ multiplex protocol (Shi et al., 2016 ), to quantify the relative mRNA levels of the CCF-1 and Lysenin genes (Table 1 ). A probe targeting the E. fetida 18S ribosomal gene was used as an internal reference to normalize gene expression across samples. The qPCR data were analyzed using the ∆∆Cq method (Kenneth et al., 2001 ). All primers and probes were synthesized and purified by Eurofins Genomics (Ebersberg, Germany). Table 1 Primers and probes used for QPCR. NCBI GeneID is given. All sequences are given in the 5’-3’ direction. NCBI ID Sequence (5’-3’) AF030028.1 CCF-1_F AGAACCAGGCTCTGCTCGAT AF030028.1 CCF-1_R GATTGATGCAACCGTCCGGG AF030028.1 CCF-1_PROBE AGCCGTTCGTTCCTCCGACAGCC D85846.1 Lysenin_F CAATAAGTCATTGCCTCTTCGTCA D85846.1 Lysenin_R TGTCCAGACAGIACACGITTGT D85846.1 Lysenin_ PROBE CCGGTCCATCATCGTAGCACAGCC X79872.1 18S_F CCTTTAACGAGGATCAATTGGAGG X79872.1 18S_R AGTATACGCTATTGGAGCTGGAAT X79872.1 18S_PROBE CAAGTCTGGTGCCAGCAGCCGC 2.4. Statistical analysis Statistical analysis was performed with software for analysis was GraphPad Prism™ 9 (GraphPad Software, San Diego, CA, USA) and RStudio (Posit PBC, Boston, MA, USA). After testing data normality and homoscedasticity, the Kruskal-Wallis and post-hoc Dunn’s tests were performed for all analyses. 3. Results 3.1. Morphometric data First, we assessed morphometric alterations in amoebocytes. The results revealed an overall increase in amebocyte size in earthworms exposed to PFAS, although the changes were not always statistically significant (Figure 1). The cell size was determined by measuring the area of two-dimensional digitized images using ImageJ®. Notably, specimens treated with new generation PFAS (specifically MOBA or MOPrA) exhibited a marked enlargement of approximately 70%. In contrast, no significant changes in cell area were observed in organisms exposed to different concentrations of PFOA and GenX. Statistical analysis showed a significant effect (p value < 0.001) in the specimen treated with MOBA & MOPrA on amoebocytes enlargement. 3.2. Oxidative burst assay The second biomarker assessed was the production of reactive oxygen species (ROS) by immune system cells, specifically amoebocytes, to determine whether the treatments induced activation of a key defense mechanism known as the oxidative burst (Chen et al., 2014). Flowcytometry coupled with a fluorescent stain (H2DCFDA-ROS staining) was used to quantify ROS in amoebocytes. Figure 2 illustrates the percentage of amoebocytes positive for H2DCFDA staining, an indicator of intracellular ROS production. All tested PFAS congeners significantly reduced the proportion of ROS-positive cells, suggesting a substantial impairment in oxidative activity and, by extension, a potential weakening of immune defense mechanisms at after 72 h PFAS exposure. For PFOA, GenX, and PFMOBA, no clear dose-dependent trend was evident, however, GenX exerted the strongest suppressive effect at the lowest concentration tested (0.6 µM), significantly reducing ROS production. At the highest concentration (229 µM), a partial recovery in ROS levels was observed, though this increase was not statistically significant. PFOA similarly showed its most pronounced effect at 0.6 µM, with a significant decrease in ROS-positive amoebocytes, but no consistent pattern was detected at higher doses. In contrast, PFMOPrA demonstrated a clear dose-dependent trend, with a progressive reduction in ROS-positive cells as the concentration increased. While PFMOBA did not exhibit a consistent dose-response, the highest concentration (229 µM) led to the lowest percentage of ROS-positive amoebocytes, resembling the trend observed with PFMOPrA. 3.3. Phenol oxidase assay (PO) Successively Phenol oxidase activity was measured uncover the putative immuno-toxic effect, since it’s importance the immune response (González-Santoyo et al., 2012). This test assessed the ability PO to transform L-DOPA, via oxidation, into dopachrome. The timepoints that were taken into were from 0h to 6h (Figure 3), thus enabling to observe its kinetic trend over the selected time span. The assay was performed using whole E. fetida tissue lysate (SN10 »7,5𝜇g of protein) exposed to the four congeners. The findings indicate that new-generation PFAS (GenX, PFMOBA, and PFMOPrA) exercise a more pronounced inhibitory effect on phenol oxidase (PO) activity compared to the legacy compound PFOA. Interestingly, during the initial three hours of exposure, PFOA demonstrated greater inhibition of PO activity relative to the new-generation congeners. Among the tested congeners, all three new-generation PFAS significantly inhibited phenoloxidase (PO) activity. MOPrA emerged as the most potent compound, displaying a severe and threshold-like inhibitory effect, with all tested concentrations leading to near-complete suppression of PO activity. MOBA showed a marked dose-dependent inhibition, particularly evident in the final three hours of the assay, with higher concentrations resulting in progressively stronger effects. GenX also induced general inhibition of PO activity across all concentrations; notably, the strongest suppression occurred at 31 µM, which also coincided with a marked downregulation of CCF-1 expression (Figure 4), suggesting a potential mechanistic link. In contrast, PFOA elicited a non-linear response: while 4.2 µM slightly reduced PO activity, both lower (0.6 µM) and higher concentrations (31 and 229 µM) were associated with increased enzymatic activity, possibly reflecting a compensatory or hormetic response with limited overall toxicity compared to controls. 3.4. q-PCR We assessed the relative abundances of two genes covering a crucial role in the defense against pathogens, CCF-1 (Coelomic Cytolytic Factor 1) and Lysenin. Figure 4 illustrates the relative expression of CCF-1in Eisenia fetida following 72 hours of exposure to increasing concentrations of four PFAS congeners. PFOA (Figure 4a) induced a concentration-dependent upregulation of CCF-1, with statistically significant increases observed from 0.6µM to 31µM. However, a slight reduction at 229µM relative to 31 µM suggests a possible saturation or feedback inhibition at the highest concentration. GenX (Figure 4b) displayed a biphasic response, with an initial decrease in expression between 0.6 µM and 4.2µM, followed by a progressive increase from 4.2µM to 229µM. Notably, the highest fold change was recorded at 229µM, coinciding with the most pronounced inhibition of phenol oxidase activity (Figure 3), indicating a potential compensatory upregulation of CCF-1under high-stress conditions. MOBA (Figure 4c) elicited a mild, non-significant increase in gene expression across the tested concentrations, consistent with a limited transcriptional response. In contrast, MOPrA (Figure 4d) induced a significantly elevated expression of CCF-1 at the lowest concentration (0.6µM), while higher concentrations were associated with diminished expression levels. This suggests a threshold-like effect, whereby low-dose exposure strongly activates CCF-1, potentially as an acute stress response, whereas higher doses may impair transcriptional activity or reflect toxic suppression. Figure 5 shows the expression of Lysenin in Eisenia fetida after 72 hours of exposure to increasing concentrations of four PFAS congeners. PFOA (Figure 5a) and GenX (Figure 5b) exhibited similar expression dynamics, characterized by an initial high expression at 0.6µM (log₂ fold change ≈ 3.5 for PFOA and ≈ 2.5 for GenX), followed by a decline at intermediate concentrations, reaching a minimum at 31µM. For GenX, expression at 31µM dropped significantly to below baseline (log₂ fold change ≈ –1; p < 0.0001), indicating strong downregulation. PFOA also showed a significant decrease at this concentration (p < 0.0001), though the suppression was more moderate (≈ 2.75 log₂ units). Notably, at the highest concentration (229µM), PFOA triggered a marked upregulation of Lysenin expression (log₂ fold change ≈ 4; p < 0.05), suggesting a late-stage compensatory or stress-induced response. In contrast, GenX expression at 229µM returned to near-baseline levels, showing partial recovery without full induction. MOBA (Figure 5c) exhibited a more variable expression pattern with no clear dose-response trend. The highest expression levels were observed at 4.2µM and 229µM, while a significant downregulation occurred at 31µM (p < 0.0001), where expression dropped below baseline, similarly to GenX. These results suggest that Lysenin expression under MOBA exposure is condition-specific rather than dose-dependent, with possible repression at intermediate stress levels. Whereas MOPrA (Figure 5d) demonstrated a dose-dependent induction pattern across the first three concentrations. Expression steadily increased from 0.6µM (log₂ ≈ 1) to a peak at 31 µM (log₂ ≈ 3.75), with statistically significant differences at each step (p < 0.001–0.0001). However, at 229µM, a significant drop in expression was observed (p < 0.0001), indicating that high-dose MOPrA may suppress the transcriptional activation of Lysenin, potentially due to cytotoxicity or a saturation threshold beyond which stimulatory effects are lost. 4. Discussion Per- and polyfluoroalkyl substances (PFAS) are renowned for their extraordinary chemical resilience the C–F bond is one of the strongest in organic chemistry (Gaballah et al., 2020; O’Hagan, 2008) which explains their environmental persistence, resistance to biodegradation and bioaccumulation in organisms. Growing toxicological and epidemiological evidence indicates that PFAS can interfere with vertebrate and invertebrate innate immunity (von Holst et al., 2021). In earthworms, innate defence is mediated by two coelomocyte lineages: amoebocytes (phagocytosis, oxidative burst, cytotoxicity) and eleocytes (secretion of humoral factors such as lysenin) (Homa, 2018). We therefore assessed four biomarker suites that together span cellular and humoral immunity: (i) amoebocyte morphometrics alterations (Calisi et al., 2009) and oxidative burst (Chen & Junger, 2014); (ii) phenol‑oxidase (PO) activity, a linchpin of melanisation/ encapsulation (González‑Santoyo & Córdoba‑Aguilar, 2012; Cerenius & Söderhäll, 2004); (iii) transcription of CCF‑1, a TNF‑like pattern‑recognition lectin that both recognizes microbial glycans and activates pro-PO via proteolysis (Beschin et al., 1998; Bilej et al., 2006; Ghosh, 2020); and (iv) transcription of lysenin, an eleocyte‑derived pore‑forming antimicrobial protein (Kobayashi et al., 2004; Opper et al., 2013). This design allowed us to capture PFAS‑induced modulation across the major immune pathways in Eisenia fetida . 4.1 Amoebocyte enlargement as an early sentinel of immune stress Short‑chain ether acids MOBA (C₅) and MOPrA (C₄) enlarged amoebocytes by ≈70 % (p < 0.001), whereas the longer‑chain HFPO‑DA/GenX (C₆) and legacy PFOA (C₈) did not. Cell size is tightly linked to metabolic rate and immune activation (Ginzberg et al., 2015; Glazier, 2022) and has been used as a biomarker of stress in oligochaetes (Calisi et al., 2024). Because cell swelling anticipates ROS production and mitotic activity in E. fetida coelomocytes (Calisi et al., 2009), these data imply that carbon‑chain shortening improves membrane penetration and triggers early activation, echoing the cell‑size responses seen in vertebrate neutrophils (Mantovani et al., 2011) and marine bivalve haemocytes (Malagoli et al., 2003). 4.2 Oxidative burst suppression and antioxidant counter‑measures After 72 h, ROS‑positive amoebocytes declined sharply: 45 % for GenX at 0.6 µM and 18 → –62 % across MOPrA from 0.6→ 229 µM, with PFOA and MOBA producing weaker, non‑monotonic inhibition. These results match the whole‑worm data of Rotondo et al. (2025), who reported a parallel drop in ROS under identical GenX doses, accompanied by ≈35 % inhibition of superoxide dismutase (SOD) and a three‑fold rise in catalase (CAT) at 0.6 and 229 µM. The concordance suggests a biphasic sequence: an initial oxidative burst (Valembois et al., 1995; Homa et al., 2016) is followed by SOD blockade potentially via PFAS–hemoprotein binding (sensu Yang et al., 2019) and CAT hyper induction that over‑quells ROS, a pattern compatible with brown‑body dynamics, where melanin subsequently neutralises excess oxidants (Homa et al., 2013). Such antioxidant overshoot may undermine microbicidal competence in the long run (Livingstone, 2003). 4.3 Phenol oxidase inhibition: convergence of humoral and cellular immunity PO activity followed the same potency order as the redox endpoints (MOPrA > GenX > MOBA ≫ PFOA), dropping 78 % at 229 µM MOPrA. Because PO requires quinone‑coupled ROS for catalysis (Lu et al., 2014), CAT driven peroxide removal offers a parsimonious explanation for its suppression. PFAS affinity for hydrophobic protein cavities (Cheng et al., 2021) and direct inhibition of antioxidant enzymes (Rajak & Ganguly, 2023) suggest an additional direct interaction with aromatic residues at the PO active site (Nappi & Christensen, 2005), although this still needs empirical confirmation. 4.4 Transcriptional compensation and thresholds CCF-1 rose dose‑dependently under MOBA and PFOA but showed a U-shape with GenX (lowest at 4.2 µM, four-fold higher at 229 µM), mirroring GenX induced CAT hyper‑activity (Rotondo et al., 2025) and implicating oxidative‑quenching‑driven immune stimulation. MOPrA elicited a spike at 0.6 µM then fell, indicating threshold toxicity. Lysenin displayed a threshold‑saturation profile with MOPrA (max +3.8 log₂ at 31 µM, collapse at 229 µM) and a biphasic response with GenX/PFOA (down ≤31 µM, rebound at 229 µM). These patterns are consistent with moderate stress promoting AMP transcription and high redox burden curtailing energetically costly peptide synthesis. 4.5 Integrated mode of action framework Short-chain ether PFAS appear to derail earthworm immunity through a sequential, self-reinforcing cascade that links redox imbalance to enzyme blockade and, ultimately, to a faltering transcriptional rescue. Step 1 Membrane access and primary oxidative insult . Their small size and amphiphilicity favor rapid partitioning into coelomocyte membranes, an event likely aided by the high phospholipid content of amoebocyte surfaces. This initial penetration triggers the canonical NADPH‑oxidase burst that accompanies phagocytic activation, producing a surge of superoxide and downstream peroxide. Step 2 SOD inhibition . Docking and spectroscopic work show that PFAS carboxylates can coordinate transition‑metal centers or displace active‑site water in hemoproteins (Yang et al., 2019). The same interaction plausibly occurs with the Cu/Zn and Mn centers of SOD, as suggested by the 30–40 % activity loss measured by Rotondo et al. (2025), throttling superoxide dismutation while peroxide continues to accumulate. Step 3— CAT hyper‑induction . In response, earthworms overexpress CAT particularly at ≥31 µM MOPrA consuming H₂O₂ so efficiently that total ROS fall below the threshold required for antimicrobial chemistry. While adaptive in the short term, this overshoot depletes the oxidative arsenal needed for pathogen killing. Step 4 Phenol‑oxidase blockade and burst collapse . PO depends on quinone‑coupled ROS for catalytic cycling; when ROS are scarce, melanin formation stalls. Additional direct binding of PFAS to PO’s hydrophobic active pocket (Nappi & Christensen, 2005) may lock the enzyme in an inactive conformation. The combined loss of oxidative burst and PO activity removes both fast (respiratory) and slow (melanisation) cytotoxic pathways. Step 5— Transcriptional rescue and exhaustion . Sensing functional failure, the worm up regulates CCF-1 to relaunch the proPO cascade and boosts lysenin to strengthen humoral defenses. Yet this rescue is energetically expensive and, under high CAT/low‑ROS conditions, plateauing or even declining transcripts signal systemic exhaustion. The outcome is an immunocompromised organism vulnerable to soil‑borne pathogens. Although delineated here for earthworms, the same redox‑enzyme‑transcription triad could constitute a unifying PFAS mode‑of‑action across invertebrates and possibly vertebrate phagocytes. 4.6 Ecological relevance, knowledge gaps and future perspectives The concentration that initiates this cascade (≥0.6 µM, ≈250 µg kg⁻¹ soil) matches PFAS loads reported at AFFF training areas, industrial sites and some agricultural fields irrigated with contaminated biosolids (van Asselt et al., 2011). Earthworms are ecosystem engineers that regulate litter turnover, soil aggregation and microbial community structure; chronic immunosuppression could therefore propagate upward, altering nutrient cycling, plant health and disease dynamics (Ghosh, 2018). Field studies should now verify whether community level shifts reduced earthworm biomass, altered cast production, increased pathogen incidence co‑occur with ether PFAS hotspots. Mechanistically, early time course experiments (minutes to 6 h) combining ROS imaging, enzymology and targeted metabolomics are needed to capture the elusive pro‑oxidant spike and map its conversion into antioxidant overshoot. Multi‑omics (transcriptome‑proteome‑metabolome) and redox‑proteomics could clarify whether CAT induction is transcriptional, post translational or both, and whether other ROS‑processing enzymes (GPx, Prx) participate. Because soils contain PFAS mixtures, mixture‑interaction designs legacy + ether compounds, plus common cofactors such as metals or pesticides—are essential to derive additive versus synergistic risk. Cross phyla validation in collembolans, nematodes and microbial consortia would test the generality of the oxidative antioxidant immune axis, while trophic‑transfer trials (earthworm → predator) could reveal immunomodulatory carry over. Finally, coupling these mechanistic biomarkers with passive PFAS samplers and high-resolution analytical chemistry will enable weight‑of‑evidence frameworks for site prioritization, remediation monitoring and regulatory guideline refinement for the still‑expanding universe of short‑chain and ether‑linked PFAS. 5. Conclusion By integrating morphometric alterations of amoebocytes, redox, enzymatic, and gene expression data alongside findings from Rotondo et al. 2025 , this study refines the understanding of the oxidative antioxidant immune axis through which short-chain ether PFAS disrupt immune function in Eisenia fetida . Our results reveal a coordinated cascade: early oxidative burst, enzymatic inhibition (notably SOD and PO), catalase overcompensation, and ultimately, transcriptional dysregulation marked by CCF-1 and lysenin expression. This sequence culminates in immune exhaustion, particularly under high-dose exposure to emerging PFAS such as MOPrA and GenX. The biomarker suite employed amoebocyte size, ROS, CAT, PO activity, and immune gene expression emerges as a robust and mechanistically informative tool for assessing PFAS hazard in terrestrial ecosystems. Beyond E. fetida , this integrated framework may help guide cross-species immunotoxicity testing, support weight-of-evidence risk assessments, and inform regulatory strategies for the expanding class of short-chain and ether-linked PFAS. Declarations Acknowledgements This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement N o 101037509 (SCENARIOS project) Authors’ contributions Davide Gualandris Writing, Original draft, Investigations, Formal Analysis, Methodology, Review and Editing. Davide Rotondo Investigations, Formal Analysis, Methodology. Candida Lorusso Investigations. Valentina Audrito Methodology, Review and Editing. Antonio Calisi Writing, Investigations, Review and Editing, Visualization. Francesco Dondero Formal Analysis, Writing, Investigations, Methodology, Visualization, Review and Editing, Resources, Supervision. Funding This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement N o 101037509 (SCENARIOS project) Data availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethical approval Not applicable. Consent to participate Not applicable. Consent to publish Not applicable. Competing interests The authors declare no competing interests. Human and animal rights Not applicable. Clinical trial Not applicable. References Alesci A, Capillo G, Fumia A, Albano M, Messina E, Spanò N, Pergolizzi S, Lauriano ER (2023) Coelomocytes of the Oligochaeta earthworm Lumbricus terrestris (Linnaeus, 1758) as evolutionary key of defense: a morphological study. Zoological Lett 9:5. https://doi.org/10.1186/s40851-023-00203-y Androulakakis A, Alygizakis N, Gkotsis G, Nika MC, Nikolopoulou V, Bizani E, Chadwick E, Cincinelli A, Claßen D, Danielsson S, Dekker RWRJ, Duke G, Glowacka N, Jansman HAH, Krone O, Martellini T, Movalli P, Persson S, Roos A, O'Rourke E, Siebert U, Treu G, van den Brink NW, Walker LA, Deaville R, Slobodnik J, Thomaidis NS (2022) Determination of 56 per- and polyfluoroalkyl substances in top predators and their prey from Northern Europe by LC-MS/MS, Chemosphere, 287, Part 2, 131775. https://doi.org/10.1016/j.chemosphere.2021.131775 Anthony MA, Bender SF, van der Heijden MGA (2023) Enumerating soil biodiversity. Proceeding of the National Academy of Science USA. 120(33). https://doi.org/10.1073/pnas.2304663120 Beschin A, Bilej M, Hanssens F, Raymakers J, Van Dyck E, Revets H, Brys L, Gomez J, De Baetselier P, Timmermans M (1998) Identification and cloning of a glucan- and lipopolysaccharide-binding protein from Eisenia foetida earthworm involved in the activation of prophenoloxidase cascade. J Biol Chem. https://doi.org/10.1074/jbc.273.38.24948 Bilej M, Josková R, Van den Bergh R, Procházková P, Šilerová M, Ameloot P, De Baetselier P, Beschin A (2006) An invertebrate TNF functional analogue activates macrophages via lectin–saccharide interaction with ion channels. Int Immunol 18(12):1663–1670. https://doi.org/10.1093/intimm/dxl100 Brase RA, Mullin EJ, Spink DC (2021) Legacy and Emerging Per- and Polyfluoroalkyl Substances: Analytical Techniques, Environmental Fate, and Health Effects. Int J Mol Sci 22:995. https://doi.org/10.3390/ijms22030995 Brusseau ML, Anderson RH, Guo B (2020) PFAS concentrations in soils: Background levels versus contaminated sites. Sci Total Environ 740:140017. https://doi.org/10.1016/j.scitotenv.2020.140017 Calisi A, Lionetto MG, Schettino T (2009) Pollutant-induced alterations of granulocyte morphology in the earthworm Eisenia fetida . Ecotoxicol Environ Saf. https://doi.org/10.1016/j.ecoenv.2009.03.010 . .72:1369 – 137 Calisi A, Cappello T, Angelelli M, Maisano M, Rotondo D, Gualandris D, Semeraro T, Dondero F (2024) Non-destructive biomarkers in non-target species earthworm Lumbricus terrestris for assessment of different agrochemicals. Environments 11:276. https://doi.org/10.3390/environments11120276 Calisi A, Semeraro T, Giordano ME, Dondero F, Lionetto MG (2025) Earthworms multi-biomarker approach for ecotoxicological assessment of soils irrigated with reused purified wastewater. Appl Soil Ecol 206:105866. https://doi.org/10.1016/j.apsoil.2025.105866 Cerenius L, Söderhäll K (2004) The prophenoloxidase-activating system in invertebrates. Immunological Review.;198:116 – 26. https://doi.org/10.1111/j.0105-2896.2004.00116.x Chen Y, Junger WG (2014) Measurement of oxidative burst in neutrophils. Methods in Molecular Biology.; 844:115 – 24. https://doi.org/10.1007/978-1-61779-527-5_8 Cheng W, Doering JA, LaLone C, Ng C (2021) Integrative Computational Approaches to Inform Relative Bioaccumulation Potential of Per- and Polyfluoroalkyl Substances Across Species. Toxicol Sci 180(2):212–223. https://doi.org/10.1093/toxsci/kfab004 Engelmann P, Hayashi Y, Bodó K, Ernszt D, Somogyi I, Steib A, Orbán J, Pollák E, Nyitrai M, Németh P, Molnár L (2016) Phenotypic and functional characterization of earthworm coelomocyte subsets: Linking light scatter-based cell typing and imaging of the sorted populations. Dev Comp Immunol 65:41–52. https://doi.org/10.1016/j.dci.2016.06.017 Fromme H, Tittlemier SA, Völkel W, Wilhelm M, Twardella D (2009) Perfluorinated compounds–exposure assessment for the general population in Western countries. Int J Hyg Environ Health 212(3):239–270. https://doi.org/10.1016/j.ijheh.2008.04.007 Fründ HC, Graefe U, Tischer S (2011) Earthworms as Bioindicators of Soil Quality Biology of Earthworms. Soil Biology 24:261–274. https://doi.org/10.1007/978-3-642-14636-7_16 Gaballah S, Swank A, Sobus JR, Howey XM, Schmid J, Catron T, Mc Cord J, Hines E, Strynar M, Tal T (2020) Evaluation of Developmental Toxicity, Developmental Neurotoxicity, and Tissue Dose in Zebrafish Exposed to GenX and Other PFAS. Environ Sci Pollut Res 128(4):47005. https://doi.org/10.1289/EHP5843 Ginzberg MB, Kafri R, Kirschner M (2015) On being the right (cell) size. Science 348:6236. https://doi.org/10.1126/science.1245075 González-Santoyo I, Córdoba-Aguilar A (2012) Phenoloxidase: a key component of the insect immune system. Entomol Exp Appl 142:1–16. https://doi.org/10.1111/j.1570-7458.2011.01187.x Glazier DS (2022) How Metabolic Rate Relates to Cell Size. Biology (Basel) 11(8):1106. https://doi.org/10.3390/biology11081106 Homa J, Zorska A, Wesolowski D, Chadzinska M (2013) Dermal exposure to immunostimulants induces changes in activity and proliferation of coelomocytes of Eisenia andrei. J Comp Physiol B 183(3):313–322. https://doi.org/10.1007/s00360-012-0710-7 Homa J, Stalmach M, Wilczek G, Kolaczkowska E (2016) Effective activation of antioxidant system by immune-relevant factors reversely correlates with apoptosis of Eisenia andrei coelomocytes. J Comp Physiol B 186:417–430. https://doi.org/10.1007/s00360-016-0973-5 Homa J (2018) Earthworm coelomocyte extracellular traps: structural and functional similarities with neutrophil NETs. Cell Tissue Reserch 371(3):407–414. https://doi.org/10.1007/s00441-018-2787-0 Joskova R, Šilerová M, Procházková P, Bilej M (2009) Identification and cloning of an invertebrate-type lysozyme from Eisenia Andrei . Dev Comp Immunol 33:932–938. https://doi.org/10.1016/j.dci.2009.03.002 Jouquet P, Plumere T, Thu TD, Rempet C, Duc TT, Orange D (2010) The rehabilitation of tropical soil using compost and and vermicompost in affected by the presence of endogenic earthworms. Appl Soil Ecol 46:125–133. https://doi.org/10.1016/j.apsoil.2010.07.002 Kenneth J, Livak TD, Schmittgen (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 – ∆∆CT Method, Methods, 25:402–408. https://doi.org/10.1006/meth.2001.1262 Kobayashi H, Ohta N, Umeda M (2004) Biology of lysenin, a protein in the coelomic fluid of the earthworm Eisenia foetida. Int Rev Cytol. https://doi.org/10.1016/S0074-7696(04)36002-X Lionetto MG, Calisi A, Schettino T (2012) Earthworm’s biomarkers as tools for soil pollution assessment. In: Soil health and land use management. InTech- Open Access Publisher in Science, Technology and Medicine. 305–332. http://dx.doi.org/10.5772/28265 Livingstone DR (2003) Oxidative stress in aquatic organisms in relation to pollution and aquaculture. Revue Méd Vét 154:427–430 Lu A, Zhang Q, Zhang J, Yang B, Wu K, Xie W, Luan YX, Ling E (2014) Insect prophenoloxidase: the view beyond immunity. Front Physiol 5:252. https://doi.org/10.3389/fphys.2014.00252 Mantovani A, Cassatella MA, Costantini C, Jaillon S (2011) Neutrophils in the activation and regulation of innate and adaptive immunity. Nat Rev Immunol 25(8):519–531. https://doi.org/10.1038/nri3024 Meegoda JN, Kewalramani JA, Li B, Marsh RW (2020) A Review of the Applications, Environmental Release, and Remediation Technologies of Per- and Polyfluoroalkyl Substances. Int J Environ Res Public Health 17:8117. https://doi.org/10.3390/ijerph17218117 Mishra RK, Mentha SS, Misra Y, Dwivedi N (2023) Emerging pollutants of severe environmental concern in water and wastewater: A comprehensive review on current developments and future research. Water-Energy Nexus 6:74–95. https://doi.org/10.1016/j.wen.2023.08.002 Nappi AJ, Christensen BM (2005) Melanogenesis and associated cytotoxic reactions: applications to insect innate immunity. Insect Biochem Mol Biol 35(5):443–459. https://doi.org/10.1016/j.ibmb.2005.01.014 OECD (1984) Test No. 207: Earthworm, Acute Toxicity Tests, OECD Guidelines for the Testing of Chemicals, Section 2. OECD Publishing, Paris. https://doi.org/10.1787/9789264070042-en O’Hagan D (2008) Understanding organofluorine chemistry. An introduction to the C–F bond. Chem Soc Rev 37:308–319. https://doi.org/10.1039/B711844A Ouellet G, Lapen DR, Topp E, Sawada M, Edwards M (2008) A heuristic model to predict earthworm biomass in agroecosystems based on selected Management and soil properties. Appl Soil Ecoi 39:35–45. https://doi.org/10.1016/j.apsoil.2007.11.003 Opper B, Bognár A, Heidt D, Németh P, Engelmann P (2013) Revising lysenin expression of earthworm coelomocytes. Dev Comp Immunol 39:214–218 Dev Comp Immunol 39:214–218. https://doi.org/10.1016/j.dci.2012.11.006 Panieri E, Baralic K, Djukic-Cosic D, Buha Djordjevic A, Saso L (2022) PFAS Molecules: A Major Concern for the Human Health and the Environment. 10:44. https://doi.org/10.3390/toxics10020044 Procházková P, Silerová M, Stijlemans B, Dieu M, Halada P, Josková R, Beschin A, De Baetselier P, Bilej M (2006) Evidence for proteins involved in prophenoloxidase cascade Eisenia fetida earthworms. J Comp Physiol B 6:581–587. https://doi.org/10.1007/s00360-006-0081-z Rajak P, Ganguly A (2023) The ligand-docking approach explores the binding affinity of PFOS and PFOA for major endogenous antioxidants: A potential mechanism to fuel oxidative stress. Sustainable Chemistry for the Environment https://doi.org/10.1016/j.scenv.2023.100047 . 4 Rotondo D, Gualandris D, Lorusso C, Braeuning A, Calisi A, Dondero F (2025) Impact of Short-Chain Perfluoropropylene Oxide Acids on Biochemical and Behavioural Parameters in Eisenia fetida (Savigny, 1826). J Xenobiotics 15(1):2. https://doi.org/10.3390/jox15010002 Shi X, Liu X, Wang Q, Das A, Ma G, Xu L, Sun Q, Peddireddi L, Jia W, Liu Y, Anderson G, Bai J, Shi J (2016) A multiplex real-time PCR panel assay for simultaneous detection and differentiation of 12 common swine viruses. J Virol Methods 236:258–265. https://doi.org/10.1016/j.jviromet.2016.08.005 Szychowski KA, Rybczyńska-Tkaczyk K, Leja ML, Wójtowicz AK, Gmiński J (2016) Tetrabromobisphenol A (TBBPA)-stimulated reactive oxygen species (ROS) production in cell-free model using the 2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA) assay-limitations of method. Environ Sci Pollut Res Int 23(12):12246–12252. https://doi.org/10.1007/s11356-016-6450-6 Valembois P, Lassègues M (1995) In vitro generation of reactive oxygen species by free coelomic cells of the annelid Eisenia fetida andrei : an analysis by chemiluminescence and nitro blue tetrazolium reduction. Dev Comp Immunol 19:195–204. https://doi.org/10.1016/0145-305X(95)00013-J van Asselt ED, Rietra RP, Römkens PF, van der Fels-Klerx HJ (2011) Perfluorooctane sulphonate (PFOS) throughout the food production chain. Food Chem 128(1):1–6. https://doi.org/10.1016/j.foodchem.2011.03.032 Vig AP, Singh J, Suthar SS (2022) Earthworm Engineering and Applications. 1st edition. Nova Science Publishers. ISBN: 978-1-68507-566-8, New York, U.S.A., p. 270 Wang Y, Munir U, Huang Q (2023) Occurrence of per- and polyfluoroalkyl substances (PFAS) in soil: Sources, fate, and remediation. Soil Environ Health 1(1):2949–9194. https://doi.org/10.1016/j.seh.2023.100004 Xiao F (2017) Emerging poly- and perfluoroalkyl substances in the aquatic environment: a review of current literature. Water Res 124:482–495. https://doi.org/10.1016/j.watres.2017.07.024 Xiao R, Ali A, Xu Y, Abdelrahman H, Li R, Lin Y, Bolan N, Shaheen S, Rinklebe J, Zhang Z (2022) Earthworms as candidates for remediation of potentially toxic elements contaminated soils and mitigating the environmental and human health risks: A review. Environ Int 158:106924. https://doi.org/10.1016/j.envint.2021.106924 Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 23 May, 2025 Reviewers invited by journal 23 May, 2025 Editor invited by journal 22 May, 2025 Editor assigned by journal 19 May, 2025 First submitted to journal 15 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6631095","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":461061607,"identity":"cea4a779-c8c3-4d82-b350-080826c21e61","order_by":0,"name":"Davide Gualandris","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIUlEQVRIie2RMUvDQBTHnwTa5dKsCZHmK5wU6qA0X+WOQKcMghAcOkQC51ew0A/RyflCwC5HsgZapEHIlEFwKQjiNVqQkjSr4P04uMf/8eM97gAUir8IlwfVlRYC9ABBX96kDjqVsx8F8YPS4sg+/FYATHLoNSuDlbjg1R1Mlqv4/v0meDl35tV4W7DNEPoGb1Is4eN4IcBbChrZj+ktwmv/ElNWjtoWw3xKEp2BhzkNbZ0RhG1/bFKW0LBNyUqpfEolK6KPveLMRYeSezzRQ5jgnLJ6CuTotGLlrzxePJvEygt2hVK5mJgGJknLUU/TcOOLZTR6q2bX7iDzkjUKiOs8JE/WLtgMDSPeNo75xqThUcLrPzqFexzwDkGhUCj+EV/QJWUDh1zF/QAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0003-3354-2236","institution":"University of Eastern Piemonte Amedeo Avogadro Department of Science and Technological Innovation: Universita degli Studi del Piemonte Orientale Amedeo Avogadro Dipartimento di Scienze e Innovazione Tecnologica","correspondingAuthor":true,"prefix":"","firstName":"Davide","middleName":"","lastName":"Gualandris","suffix":""},{"id":461061608,"identity":"94f76920-1f81-49e0-8b80-d43ba4306bc4","order_by":1,"name":"Davide Rotondo","email":"","orcid":"","institution":"University of Eastern Piemonte Amedeo Avogadro Department of Science and Technological Innovation: Universita degli Studi del Piemonte Orientale Amedeo Avogadro Dipartimento di Scienze e Innovazione Tecnologica","correspondingAuthor":false,"prefix":"","firstName":"Davide","middleName":"","lastName":"Rotondo","suffix":""},{"id":461061609,"identity":"926526b7-0dc2-4705-9c59-1dba1608fc37","order_by":2,"name":"Candida Lorusso","email":"","orcid":"","institution":"University of Eastern Piemonte Amedeo Avogadro Faculty of Mathematics Physics and Natural Sciences: Universita degli Studi del Piemonte Orientale Amedeo Avogadro Dipartimento di Scienze e Innovazione Tecnologica","correspondingAuthor":false,"prefix":"","firstName":"Candida","middleName":"","lastName":"Lorusso","suffix":""},{"id":461061610,"identity":"98c04fe8-a3af-4a7d-b4f6-bcc707262a73","order_by":3,"name":"Valentina Audrito","email":"","orcid":"","institution":"University of Eastern Piemonte Amedeo Avogadro Department of Science and Technological Innovation: Universita degli Studi del Piemonte Orientale Amedeo Avogadro Dipartimento di Scienze e Innovazione Tecnologica","correspondingAuthor":false,"prefix":"","firstName":"Valentina","middleName":"","lastName":"Audrito","suffix":""},{"id":461061611,"identity":"5b27600f-d195-4fb8-9762-cb14333ddddd","order_by":4,"name":"Antonio Calisi","email":"","orcid":"https://orcid.org/0000-0002-8146-7280","institution":"University of Eastern Piemonte Amedeo Avogadro Department of Science and Technological Innovation: Universita degli Studi del Piemonte Orientale Amedeo Avogadro Dipartimento di Scienze e Innovazione Tecnologica","correspondingAuthor":false,"prefix":"","firstName":"Antonio","middleName":"","lastName":"Calisi","suffix":""},{"id":461061612,"identity":"7893f815-6e75-481d-9f7c-da7818d0efa0","order_by":5,"name":"Francesco Dondero","email":"","orcid":"https://orcid.org/0000-0001-7945-3712","institution":"University of Eastern Piemonte Amedeo Avogadro Department of Science and Technological Innovation: Universita degli Studi del Piemonte Orientale Amedeo Avogadro Dipartimento di Scienze e Innovazione Tecnologica","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Dondero","suffix":""}],"badges":[],"createdAt":"2025-05-09 19:27:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6631095/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6631095/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83539986,"identity":"54f331f1-b062-4e32-94f4-cb1be00e5aca","added_by":"auto","created_at":"2025-05-28 07:47:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":39913,"visible":true,"origin":"","legend":"\u003cp\u003e(a) PFOA, (b) GenX, (c) MOBA and (d) MOPrA. Amoebocyte morphological alteration (area alteration assay All data was analysed with GraphPad Prism 9, using Kruskal-Wallis test and Dunn’s post hoc test (° p \u0026lt; 0.1; * p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001; **** p \u0026lt; 0.0001); all data was expressed as mean ± SEM;\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6631095/v1/d91b172b5cf97f8a71e558c1.png"},{"id":83539987,"identity":"3c4d706e-75a2-4094-955e-d3b04c6570ea","added_by":"auto","created_at":"2025-05-28 07:47:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":34826,"visible":true,"origin":"","legend":"\u003cp\u003ePercentage of ROS-positive amoebocytes (% Gated) in Eisenia fetida following 48 h exposure to increasing concentrations (0.6–229 µM) of four PFAS congeners. (a) PFOA, (b) HFPO-DA (GenX), (c) PFMOBA, and (d) PFMOPrA. ROS levels were assessed via H2DCFDA staining and flow cytometry. All congeners significantly reduced ROS generation, indicating impaired oxidative response. GenX showed maximal suppression at the lower concentrations, whereas PFMOPrA exhibited a dose-dependent decrease in ROS-positive cells. Data are presented as mean ± SD (n = 5). Asterisks denote significance levels: °p\u0026lt; 0.1, *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001; ns = not significant.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6631095/v1/edc5b2c85478c05d5c9aa012.png"},{"id":83540762,"identity":"a2191eba-add3-4c9d-8525-6f533b2a0dd5","added_by":"auto","created_at":"2025-05-28 07:55:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":99202,"visible":true,"origin":"","legend":"\u003cp\u003e(a) PFOA, (b) GenX, (c) MOBA and (d) MOPrA. \u0026nbsp;Kinetic trend of phenol oxidase enzyme activity for the analysed PFAS congeners. Kruskal Wallis test with Dunn’s post hoc test was performed (See Figure 1 for statistical significance).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6631095/v1/2f51bd720bdd8765f8921100.png"},{"id":83539988,"identity":"9f3fe540-506b-4527-8d06-a7cdc2e6f6e6","added_by":"auto","created_at":"2025-05-28 07:47:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":55855,"visible":true,"origin":"","legend":"\u003cp\u003ea) PFOA, (b) GenX, (c) MOBA and (d) MOPrA. q-PCR results for CCF-1 gene expression after 24h of exposure. Kruskal Wallis test with Dunn’s post hoc test was performed (See Figure 1 for statistical analysis).CCF1\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6631095/v1/15b42c8eab65f2e49f7a4dc5.png"},{"id":83539993,"identity":"b953d938-2f3d-4cd1-a0a1-6deda1884452","added_by":"auto","created_at":"2025-05-28 07:47:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":53212,"visible":true,"origin":"","legend":"\u003cp\u003e(a) PFOA, (b) GenX, (c) MOBA and (d) MOPrA. q-PCR results for Lysenin gene expression after 24h of exposure. Kruskal Wallis test with Dunn’s post hoc test was performed (See Figure 1 for statistical analysis).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6631095/v1/63edc8eaa2395954ea358d74.png"},{"id":83540847,"identity":"a27a7483-7782-4c9b-b37b-1500a152c311","added_by":"auto","created_at":"2025-05-28 08:03:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":956322,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6631095/v1/4ba90ef2-84ff-480a-9e02-06603c415b02.pdf"}],"financialInterests":"","formattedTitle":"Effect of Ether Perfluoro Carboxyl Acids (PFECAs) on Innate Immunity in Earthworms (Eisenia fetida)","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEmerging pollutants, such as per- and polyfluoroalkyl substances (PFAS), pose a serious threat to the environment and ecosystems, potentially causing irreversible disruptions to their delicate balance (Mishra et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Compared to other emerging contaminants, PFAS are exceptionally persistent due to their resistance to biodegradation, resulting in long environmental half-lives\u0026mdash;often lasting several years\u0026mdash;which are further influenced by their mobility and distribution across environmental compartments (Androulakakis et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Meegoda et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePFAS are characterized by carbon chains of variable length (typically C2\u0026ndash;C14), which may be fully fluorinated (perfluoroalkyl) or partially fluorinated (polyfluoroalkyl). The high fluorine content, comprising the most electronegative element in the periodic table (O\u0026rsquo;Hagan, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) leads to the formation of strong carbon\u0026ndash;fluorine (C\u0026ndash;F) bonds, among the most stable covalent bonds known. These hydrophobic chains are commonly terminated with polar functional groups such as carboxylate, sulfonate, or phosphate moieties (Brase et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), conferring amphiphilic properties to the molecules (Panieri et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDue to their unique physicochemical properties, PFAS have been extensively used in industrial applications and consumer products. These include their role as surfactants in the emulsion polymerization of polytetrafluoroethylene (PTFE), as well as in fast-food packaging, textile treatments (e.g., waterproofing), non-stick cookware coatings, dyes, and as active agents in aqueous film-forming foams (AFFF) used for fire suppression (Xiao, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Over the past century, PFAS contamination has been widely documented in soil, primarily due to anthropogenic and industrial activities and the compounds\u0026rsquo; exceptional environmental persistence (van Asselt et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Brase et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Multiple studies have reported PFAS in water, soil, air, food, and biological fluids (Fromme et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), raising significant concerns about their potential impact on both human and environmental health.\u003c/p\u003e \u003cp\u003eAmong various environmental matrices, soil is recognized as a sink for pollutants, including PFAS, serving as a long-term exposure source for both humans and animals (Brusseau et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Additionally, soil is widely acknowledged as a critical reservoir for biodiversity, with approximately two-thirds of all species on Earth residing in both belowground and aboveground ecosystems (Anthony et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Therefore, assessing the effects of anthropogenic activities on the soil ecosystem should be a priority for the scientific community.\u003c/p\u003e \u003cp\u003eThe need to detect and assess the effects of contamination at low concentrations and in complex mixtures has permitted the development of molecular and cellular (bio)markers of exposure. Between terrestrial invertebrates, earthworms are the species most frequently used in standard laboratory and field tests as bio-indicators of soil contamination with different classes of contaminants (Lionetto et al \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, Calisi et al \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2025\u003c/span\u003e, Xiao et al \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Alves et al 2022). Earthworms are fairly common in a wide range of soils and may represent 60% of the total soil biomass (Ouellet et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Jouquet et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). These organisms indicate soil quality through several factors: the richness and diversity of oligochaete species present at the site, the behavioral responses of individuals upon contact with the soil, the bioaccumulation of soilborne chemicals, and the expression of stress-related biomarkers. (Fr\u0026uuml;nd et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Vig et al \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Earthworms ingest significant amounts of soil or specific soil fractions, leading to continuous exposure to pollutants through their gut. This exposure is closely linked to the coelomic fluid, which is a primary target for toxicants. Pollutants that are deposited in the coelomic fluid are then distributed throughout the animal's tissues via interactions with the circulatory system\u0026rsquo;s capillaries. Coelomocytes, the cells within the coelomic fluid, play a crucial role in the immune defence of the earthworm (Engelmann et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Alesci et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and any dysfunction of these cells can adversely affect the health of the entire organism.\u003c/p\u003e \u003cp\u003eRecently there has been great attention on the potential effects of PFAS on the immune system, this led different researchers to investigate the effects of these compounds on the immune system of different organisms. The aim of this work was to investigate the effect of PFAS on the immune system from an ecotoxicological perspective in non-target species. To this end, our study focused on assessing the potential cytotoxicity of four different PFAS congeners PFOA and three short-chain perfluoropropylene oxide acids, specifically hexafluoroproyleneo oxide dimer acid (HFPO-DA) also known with the trademark GenX, PFMOBA, and PFMOPrA on immune system cells (amoebocytes) of sexually mature earthworms (\u003cem\u003eEisenia fetida\u003c/em\u003e) within a previously tested concentration range of 0.6\u0026ndash;229 \u0026micro;M (Rotondo et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Exposures were carried out according to OECD Test No207 (also known as filter paper test), thus a series of different immunological parameter such as amoebocytes morphometric alterations, oxidative burst, phenol oxidase measurement and selected gene expression analyses were performed in different cells/tissues.\u003c/p\u003e"},{"header":"2. Materials \u0026 Methods","content":"\u003cp\u003e \u003cb\u003eCompounds\u003c/b\u003e:\u003c/p\u003e \u003cp\u003ePFAS congeners were purchased of the highest purity available (analytical grade). 2,2,3,3,4,4,5,5,6,6,7,7,8,8,8-pentadecafluorooctanoic acid (PFOA) CAS n\u0026deg; 335-67-1 (95%) was obtained from Merck (Darmstadt, Germany), 2,3,3,3-tetrafluoro-2-(1,1,2,2,3,3,3-heptafluoropropoxy) propanoic acid (GenX) CAS n\u0026deg; 13252-13-6 (97%) was obtained from Synquest Laboratories Inc (Alachua, US), 2,2,3,3-tetrafluoro-3-(trifluoromethoxy) propanoic acid (MOPrA) CAS n\u0026deg; 377-73-1 (98%) was obtained from Synquest Laboratories Inc (Alachua, US) and 2,2,3,3,4,4-hexafluoro-4-(trifluoromethoxy) butanoic acid (MOBA) CAS n\u0026deg; 863090-89-5 (97%,) was obtained from ApolloScientific (Bredbury, UK).\u003c/p\u003e \u003cp\u003eA homogeneous batch of \u003cem\u003eEisenia fetida\u003c/em\u003e individuals (n\u0026thinsp;=\u0026thinsp;120) of similar sizes (individual wet weight after gut content clearance: 0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 g, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE) was acclimated for 48 h in 4 containers (30 animals per container) each partially filled with 3 kg of soil at 20\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 40% humidity, and 16:8 h light/dark regime. The artificial standard soil utilised was a mixture of 10% sphagnum peat, 20% kaolin clay and 70% sand (OECD \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e1984\u003c/span\u003e). The dry constituents were blended in the correct proportions and mixed thoroughly. The soil moisture content was adjusted to 45% of the water holding capacity with deionised water. The initial pH was 5.6, subsequently adjusted to 6.0 with calcium carbonate.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Experimental setup\u003c/h2\u003e \u003cp\u003eAfter the acclimation period, the OECD Test No. 207 (filter paper contact test) was conducted. Petri dishes were prepared by placing a filter paper disk (Whatman No. 451) in each dish. The dishes were assigned to different treatment groups (PFOA, GenX, MOBA, MOPrA), each exposed to gradually increasing concentrations of the tested contaminant. Specifically, 1 mL of each PFAS congener at the selected concentration in aqueous solution \u0026minus;\u0026thinsp;0.6\u0026micro;M, 4.2\u0026micro;M, 31\u0026micro;M, 229\u0026micro;M- or vehicle control (0.005% 2-propanol: water) was evenly distributed onto the filter paper. Subsequently, individual earthworms, previously rinsed with distilled water to remove any soil residues, were placed onto the prepared filter paper in each Petri dish. The concentration of 2-propanol in the control was minimised to match the concentration used in the test solutions.\u003c/p\u003e \u003cp\u003eFor the entire duration of the experiment (72 h) animals were kept in controlled conditions at 20 \u0026plusmn; 1\u0026deg;C in the dark. At the end of the exposure, specimens were taken from plates and coelomocytes collected using a hypodermic syringe (Joskov\u0026aacute; et al., 2009) prefilled with 0.25 ml of Hank\u0026rsquo;s Balanced Salt Solution (HBS) with 5mM EDTA. Cells were passed through a 70 \u0026#120583;m strain to eliminate aggregates and used in subsequent biotests. After coelomocytes extraction, animals were sampled and frozen at -80\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C until needed for further biochemical and molecular analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Amoebocytes morphometric analysis\u003c/h2\u003e \u003cp\u003eAmoebocyte morphometric alterations were determined by image analysis on Diff-Quick\u0026reg; (Dade Behring, Newark, USA) stained cells (Calisi et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). A volume (40 \u0026micro;l) of coelomic fluid (diluted 1:1 in a saline solution containing 10 mM N-[Hydroxyethyl]piperazine-N0-[2-ethanesulfonic acid] (HEPES), 125 mM NaCl, 0.4 mM MgSO4, 2.7 mM KCl, 1.8 mM CaCl2, pH 7.4 with NaOH 1 M) was dispensed on a poly-L-lysine coated slide, incubated in a humid chamber (16\u0026deg;C) for 30 min and stained with the Diff-Quick\u0026reg; kit. Samples were fixed and stained on slides by repeated 1 s dips in the three reagents of the Diff-Quick\u0026reg; kit in sequence: Fast Green (fixative) (five dips), Eosin G in phosphate buffer pH 6.5 (eighteen dips), and Thiazine Dye in phosphate buffer pH 6.5 (two dips), then subsequently were washed in distilled water and air-dried. Diff-Quick stained amoebocytes were observed by an optic microscope (Axiostar Plus; Zeiss, Oberkochen, Germany) and the images obtained from video camera (AxioCam ERc 5s, Zeiss, Oberkochen, Germany) were digitized using the ImageJ\u0026trade; software (public domain Java image processing program). The cell area, and perimeter, of 2-D digitised images was automatically calculated by the software. Approximately 80 cells per sample were analysed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Oxidative Burst Assay\u003c/h2\u003e \u003cp\u003eOxidative burst was assessed by quantifying reactive oxygen species (ROS) as described by Szychowski et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This semi-quantitative assay evaluates overall ROS formation in amoebocytes using the cell-permeant dye 2\u0026rsquo;,7\u0026rsquo;-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific, Waltham, MA, USA).\u003c/p\u003e \u003cp\u003eFollowing cell extraction, the coelomic fluid was incubated with 2.5 \u0026micro;M H2DCFDA for 15 minutes under continuous agitation at room temperature. Subsequently, 25,000 cells were analyzed by fluorescence flow cytometry using a SYSMEX CyFlow Space instrument equipped with a blue-green argon laser (50 mW at 488 nm and 16 mW at 375 nm). Results were expressed as the percentage of amoebocytes positive for H2DCFDA staining and as the mean fluorescence intensity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Phenol Oxidase (PO) Assay\u003c/h2\u003e \u003cp\u003eFrozen earthworms (-80\u0026deg;C) were homogenised in an ice-cold buffer (100 mM Tris-HCl, pH 7.6, 0.1% Triton X-100) using a glass\u0026ndash;Teflon Potter\u0026ndash;Elvehjem homogeniser. Homogenates were centrifuged at 10,000\u0026times; \u003cem\u003eg\u003c/em\u003e for 20 min at 4\u0026deg;C, and the resulting supernatant (SN10) was collected.\u003c/p\u003e \u003cp\u003eThe assessment of the enzymatic activity of Phenol Oxidase was carried out according to Prochazkova et al., (2006) as modified by Rotondo et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) by means of a photometric assay measuring the oxidation of L-DOPA to dopachrome. The experiment setup was carried out using a 96 well plate using 10 \u0026#120583;L of SN10 (7.5 \u0026#120583;g of total protein) and 80\u0026#120583;L of 100mM Tris-HCl pH 8.0, 50mM CaCl\u003csub\u003e2\u003c/sub\u003e, 10mM L-DOPA. The oxidation of L-DOPA to dopachrome was measured at RT for 6 h at 490 nm using a Tecan Infinite\u003csup\u003e\u0026reg;\u003c/sup\u003e F200 PRO microplate reader spectrophotometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Gene Expression Analysis\u003c/h2\u003e \u003cp\u003eReal-time quantitative PCR (qPCR) was employed using a TaqMan\u0026trade; multiplex protocol (Shi et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), to quantify the relative mRNA levels of the CCF-1 and Lysenin genes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A probe targeting the \u003cem\u003eE. fetida\u003c/em\u003e 18S ribosomal gene was used as an internal reference to normalize gene expression across samples. The qPCR data were analyzed using the ∆∆Cq method (Kenneth et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). All primers and probes were synthesized and purified by Eurofins Genomics (Ebersberg, Germany).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers and probes used for QPCR. NCBI GeneID is given. All sequences are given in the 5\u0026rsquo;-3\u0026rsquo; direction.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNCBI ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAF030028.1 CCF-1_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAACCAGGCTCTGCTCGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAF030028.1 CCF-1_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATTGATGCAACCGTCCGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAF030028.1 CCF-1_PROBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCGTTCGTTCCTCCGACAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD85846.1 Lysenin_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAATAAGTCATTGCCTCTTCGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD85846.1 Lysenin_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCCAGACAGIACACGITTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD85846.1 Lysenin_ PROBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGTCCATCATCGTAGCACAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eX79872.1 18S_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTTAACGAGGATCAATTGGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eX79872.1 18S_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTATACGCTATTGGAGCTGGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eX79872.1 18S_PROBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGTCTGGTGCCAGCAGCCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed with software for analysis was GraphPad Prism\u0026trade; 9 (GraphPad Software, San Diego, CA, USA) and RStudio (Posit PBC, Boston, MA, USA).\u003c/p\u003e \u003cp\u003eAfter testing data normality and homoscedasticity, the Kruskal-Wallis and post-hoc Dunn\u0026rsquo;s tests were performed for all analyses.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3.1. Morphometric data\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst, we assessed morphometric alterations in amoebocytes. The results revealed an overall increase in amebocyte size in earthworms exposed to PFAS, although the changes were not always statistically significant (Figure 1). The cell size was determined by measuring the area of two-dimensional digitized images using ImageJ\u0026reg;. Notably, specimens treated with new generation PFAS (specifically MOBA or MOPrA) exhibited a marked enlargement of approximately 70%. In contrast, no significant changes in cell area were observed in organisms exposed to different concentrations of PFOA and GenX.\u003c/p\u003e\n\u003cp\u003eStatistical analysis showed a significant effect (p value \u0026lt; 0.001) in the specimen treated with MOBA \u0026amp; MOPrA on amoebocytes enlargement.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003e3.2. Oxidative burst assay\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eThe second biomarker assessed was the production of reactive oxygen species (ROS) by immune system cells, specifically amoebocytes, to determine whether the treatments induced activation of a key defense mechanism known as the oxidative burst (Chen et al., 2014).\u003c/p\u003e\n\u003cp\u003eFlowcytometry coupled with a fluorescent stain (H2DCFDA-ROS staining) was used to quantify ROS in amoebocytes.\u003c/p\u003e\n\u003cp\u003eFigure 2 illustrates the percentage of amoebocytes positive for H2DCFDA staining, an indicator of intracellular ROS production. All tested PFAS congeners significantly reduced the proportion of ROS-positive cells, suggesting a substantial impairment in oxidative activity and, by extension, a potential weakening of immune defense mechanisms at after 72 h PFAS exposure.\u003c/p\u003e\n\u003cp\u003eFor PFOA, GenX, and PFMOBA, no clear dose-dependent trend was evident, however, GenX exerted the strongest suppressive effect at the lowest concentration tested (0.6 \u0026micro;M), significantly reducing ROS production. At the highest concentration (229 \u0026micro;M), a partial recovery in ROS levels was observed, though this increase was not statistically significant. PFOA similarly showed its most pronounced effect at 0.6 \u0026micro;M, with a significant decrease in ROS-positive amoebocytes, but no consistent pattern was detected at higher doses.\u003c/p\u003e\n\u003cp\u003eIn contrast, PFMOPrA demonstrated a clear dose-dependent trend, with a progressive reduction in ROS-positive cells as the concentration increased. While PFMOBA did not exhibit a consistent dose-response, the highest concentration (229 \u0026micro;M) led to the lowest percentage of ROS-positive amoebocytes, resembling the trend observed with PFMOPrA.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003e3.3. Phenol oxidase assay\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e(PO)\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eSuccessively Phenol oxidase activity was measured uncover the putative immuno-toxic effect, since it\u0026rsquo;s importance the immune response (Gonz\u0026aacute;lez-Santoyo \u003cem\u003eet al.,\u003c/em\u003e 2012).\u003c/p\u003e\n\u003cp\u003eThis test assessed the ability PO to transform L-DOPA, \u003cem\u003evia\u003c/em\u003e oxidation, into dopachrome. The timepoints that were taken into were from 0h to 6h (Figure 3), thus enabling to observe its kinetic trend over the selected time span. The assay was performed using whole \u003cem\u003eE. fetida\u003c/em\u003e tissue lysate (SN10 \u0026raquo;7,5𝜇g of protein) exposed to the four congeners. The findings indicate that new-generation PFAS (GenX, PFMOBA, and PFMOPrA) exercise a more pronounced inhibitory effect on phenol oxidase (PO) activity compared to the legacy compound PFOA. Interestingly, during the initial three hours of exposure, PFOA demonstrated greater inhibition of PO activity relative to the new-generation congeners. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAmong the tested congeners, all three new-generation PFAS significantly inhibited phenoloxidase (PO) activity. MOPrA emerged as the most potent compound, displaying a severe and threshold-like inhibitory effect, with all tested concentrations leading to near-complete suppression of PO activity. MOBA showed a marked dose-dependent inhibition, particularly evident in the final three hours of the assay, with higher concentrations resulting in progressively stronger effects. GenX also induced general inhibition of PO activity across all concentrations; notably, the strongest suppression occurred at 31 \u0026micro;M, which also coincided with a marked downregulation of CCF-1 expression (Figure 4), suggesting a potential mechanistic link. In contrast, PFOA elicited a non-linear response: while 4.2 \u0026micro;M slightly reduced PO activity, both lower (0.6 \u0026micro;M) and higher concentrations (31 and 229 \u0026micro;M) were associated with increased enzymatic activity, possibly reflecting a compensatory or hormetic response with limited overall toxicity compared to controls.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003e3.4. q-PCR\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eWe assessed the relative abundances of two genes covering a crucial role in the defense against pathogens, CCF-1 (Coelomic Cytolytic Factor 1) and Lysenin.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFigure 4 illustrates the relative expression of CCF-1in \u003cem\u003eEisenia fetida\u003c/em\u003e following 72 hours of exposure to increasing concentrations of four PFAS congeners. PFOA (Figure 4a) induced a concentration-dependent upregulation of CCF-1, with statistically significant increases observed from 0.6\u0026micro;M to 31\u0026micro;M. However, a slight reduction at 229\u0026micro;M relative to 31 \u0026micro;M suggests a possible saturation or feedback inhibition at the highest concentration. GenX (Figure 4b) displayed a biphasic response, with an initial decrease in expression between 0.6 \u0026micro;M and 4.2\u0026micro;M, followed by a progressive increase from 4.2\u0026micro;M to 229\u0026micro;M. Notably, the highest fold change was recorded at 229\u0026micro;M, coinciding with the most pronounced inhibition of phenol oxidase activity (Figure 3), indicating a potential compensatory upregulation of CCF-1under high-stress conditions. MOBA (Figure 4c) elicited a mild, non-significant increase in gene expression across the tested concentrations, consistent with a limited transcriptional response. In contrast, MOPrA (Figure 4d) induced a significantly elevated expression of CCF-1 at the lowest concentration (0.6\u0026micro;M), while higher concentrations were associated with diminished expression levels. This suggests a threshold-like effect, whereby low-dose exposure strongly activates CCF-1, potentially as an acute stress response, whereas higher doses may impair transcriptional activity or reflect toxic suppression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFigure 5 shows the expression of Lysenin in \u003cem\u003eEisenia fetida\u003c/em\u003e after 72 hours of exposure to increasing concentrations of four PFAS congeners. PFOA (Figure 5a) and GenX (Figure 5b) exhibited similar expression dynamics, characterized by an initial high expression at 0.6\u0026micro;M (log₂ fold change \u0026asymp; 3.5 for PFOA and \u0026asymp; 2.5 for GenX), followed by a decline at intermediate concentrations, reaching a minimum at 31\u0026micro;M. For GenX, expression at 31\u0026micro;M dropped significantly to below baseline (log₂ fold change \u0026asymp; \u0026ndash;1; p \u0026lt; 0.0001), indicating strong downregulation. PFOA also showed a significant decrease at this concentration (p \u0026lt; 0.0001), though the suppression was more moderate (\u0026asymp; 2.75 log₂ units).\u003c/p\u003e\n\u003cp\u003eNotably, at the highest concentration (229\u0026micro;M), PFOA triggered a marked upregulation of Lysenin expression (log₂ fold change \u0026asymp; 4; p \u0026lt; 0.05), suggesting a late-stage compensatory or stress-induced response. In contrast, GenX expression at 229\u0026micro;M returned to near-baseline levels, showing partial recovery without full induction. MOBA (Figure 5c) exhibited a more variable expression pattern with no clear dose-response trend. The highest expression levels were observed at 4.2\u0026micro;M and 229\u0026micro;M, while a significant downregulation occurred at 31\u0026micro;M (p \u0026lt; 0.0001), where expression dropped below baseline, similarly to GenX. These results suggest that Lysenin expression under MOBA exposure is condition-specific rather than dose-dependent, with possible repression at intermediate stress levels. Whereas MOPrA (Figure 5d) demonstrated a dose-dependent induction pattern across the first three concentrations. Expression steadily increased from 0.6\u0026micro;M (log₂ \u0026asymp; 1) to a peak at 31 \u0026micro;M (log₂ \u0026asymp; 3.75), with statistically significant differences at each step (p \u0026lt; 0.001\u0026ndash;0.0001). However, at 229\u0026micro;M, a significant drop in expression was observed (p \u0026lt; 0.0001), indicating that high-dose MOPrA may suppress the transcriptional activation of Lysenin, potentially due to cytotoxicity or a saturation threshold beyond which stimulatory effects are lost.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePer- and polyfluoroalkyl substances (PFAS) are renowned for their extraordinary chemical resilience the C\u0026ndash;F bond is one of the strongest in organic chemistry (Gaballah et al., 2020; O\u0026rsquo;Hagan, 2008) which explains their environmental persistence, resistance to biodegradation and bioaccumulation in organisms. Growing toxicological and epidemiological evidence indicates that PFAS can interfere with vertebrate and invertebrate innate immunity (von Holst et al., 2021). In earthworms, innate defence is mediated by two coelomocyte lineages: amoebocytes (phagocytosis, oxidative burst, cytotoxicity) and eleocytes (secretion of humoral factors such as lysenin) (Homa, 2018). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe therefore assessed four biomarker suites that together span cellular and humoral immunity: (i) amoebocyte morphometrics alterations (Calisi et al., 2009) and oxidative burst (Chen \u0026amp; Junger, 2014); (ii) phenol‑oxidase (PO) activity, a linchpin of melanisation/ encapsulation (Gonz\u0026aacute;lez‑Santoyo \u0026amp; C\u0026oacute;rdoba‑Aguilar, 2012; Cerenius \u0026amp; S\u0026ouml;derh\u0026auml;ll, 2004); (iii) transcription of CCF‑1, a TNF‑like pattern‑recognition lectin that both recognizes microbial glycans and activates pro-PO via proteolysis (Beschin et al., 1998; Bilej et al., 2006; Ghosh, 2020); and (iv) transcription of lysenin, an eleocyte‑derived pore‑forming antimicrobial protein (Kobayashi et al., 2004; Opper et al., 2013). This design allowed us to capture PFAS‑induced modulation across the major immune pathways in \u003cem\u003eEisenia fetida\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.1 Amoebocyte enlargement as an early sentinel of immune stress\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eShort‑chain ether acids MOBA (C₅) and MOPrA (C₄) enlarged amoebocytes by \u0026asymp;70 % (p \u0026lt; 0.001), whereas the longer‑chain HFPO‑DA/GenX (C₆) and legacy PFOA (C₈) did not. Cell size is tightly linked to metabolic rate and immune activation (Ginzberg et al., 2015; Glazier, 2022) and has been used as a biomarker of stress in oligochaetes (Calisi et al., 2024). Because cell swelling anticipates ROS production and mitotic activity in \u003cem\u003eE. fetida\u003c/em\u003e coelomocytes (Calisi et al., 2009), these data imply that carbon‑chain shortening improves membrane penetration and triggers early activation, echoing the cell‑size responses seen in vertebrate neutrophils (Mantovani et al., 2011) and marine bivalve haemocytes (Malagoli et al., 2003).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.2 Oxidative burst suppression and antioxidant counter‑measures\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAfter 72 h, ROS‑positive amoebocytes declined sharply: 45 % for GenX at 0.6 \u0026micro;M and 18 \u0026rarr; \u0026ndash;62 % across MOPrA from 0.6\u0026rarr; 229 \u0026micro;M, with PFOA and MOBA producing weaker, non‑monotonic inhibition. These results match the whole‑worm data of Rotondo et al. (2025), who reported a parallel drop in ROS under identical GenX doses, accompanied by \u0026asymp;35 % inhibition of superoxide dismutase (SOD) and a three‑fold rise in catalase (CAT) at 0.6 and 229 \u0026micro;M.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe concordance suggests a biphasic sequence: an initial oxidative burst (Valembois et al., 1995; Homa et al., 2016) is followed by SOD blockade potentially via PFAS\u0026ndash;hemoprotein binding (sensu Yang et al., 2019) and CAT hyper induction that over‑quells ROS, a pattern compatible with brown‑body dynamics, where melanin subsequently neutralises excess oxidants (Homa et al., 2013). Such antioxidant overshoot may undermine microbicidal competence in the long run (Livingstone, 2003).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.3 Phenol oxidase inhibition: convergence of humoral and cellular immunity\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePO activity followed the same potency order as the redox endpoints (MOPrA \u0026gt; GenX \u0026gt; MOBA ≫ PFOA), dropping 78 % at 229 \u0026micro;M MOPrA. Because PO requires quinone‑coupled ROS for catalysis (Lu et al., 2014), CAT driven peroxide removal offers a parsimonious explanation for its suppression. PFAS affinity for hydrophobic protein cavities (Cheng et al., 2021) and direct inhibition of antioxidant enzymes (Rajak \u0026amp; Ganguly, 2023) suggest an additional direct interaction with aromatic residues at the PO active site (Nappi \u0026amp; Christensen, 2005), although this still needs empirical confirmation.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.4 Transcriptional compensation and thresholds\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCCF-1 rose dose‑dependently under MOBA and PFOA but showed a U-shape with GenX (lowest at 4.2 \u0026micro;M, four-fold higher at 229 \u0026micro;M), mirroring GenX induced CAT hyper‑activity (Rotondo et al., 2025) and implicating oxidative‑quenching‑driven immune stimulation. MOPrA elicited a spike at 0.6 \u0026micro;M then fell, indicating threshold toxicity.\u003c/p\u003e\n\u003cp\u003eLysenin displayed a threshold‑saturation profile with MOPrA (max +3.8 log₂ at 31 \u0026micro;M, collapse at 229 \u0026micro;M) and a biphasic response with GenX/PFOA (down \u0026le;31 \u0026micro;M, rebound at 229 \u0026micro;M). These patterns are consistent with moderate stress promoting AMP transcription and high redox burden curtailing energetically costly peptide synthesis.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.5 Integrated mode of action framework\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eShort-chain ether PFAS appear to derail earthworm immunity through a sequential, self-reinforcing cascade that links redox imbalance to enzyme blockade and, ultimately, to a faltering transcriptional rescue. \u003cem\u003eStep 1\u0026nbsp;\u003c/em\u003eMembrane access and primary oxidative insult\u003cem\u003e.\u003c/em\u003e Their small size and amphiphilicity favor rapid partitioning into coelomocyte membranes, an event likely aided by the high phospholipid content of amoebocyte surfaces. This initial penetration triggers the canonical NADPH‑oxidase burst that accompanies phagocytic activation, producing a surge of superoxide and downstream peroxide. \u003cem\u003eStep 2\u0026nbsp;\u003c/em\u003eSOD inhibition\u003cem\u003e.\u0026nbsp;\u003c/em\u003eDocking and spectroscopic work show that PFAS carboxylates can coordinate transition‑metal centers or displace active‑site water in hemoproteins (Yang et al., 2019). The same interaction plausibly occurs with the Cu/Zn and Mn centers of SOD, as suggested by the 30\u0026ndash;40 % activity loss measured by Rotondo et al. (2025), throttling superoxide dismutation while peroxide continues to accumulate. \u003cem\u003eStep 3\u0026mdash;\u003c/em\u003eCAT hyper‑induction\u003cem\u003e.\u003c/em\u003e In response, earthworms overexpress CAT particularly at \u0026ge;31 \u0026micro;M MOPrA consuming H₂O₂ so efficiently that total ROS fall below the threshold required for antimicrobial chemistry. While adaptive in the short term, this overshoot depletes the oxidative arsenal needed for pathogen killing. \u003cem\u003eStep 4\u0026nbsp;\u003c/em\u003ePhenol‑oxidase blockade and burst collapse\u003cem\u003e.\u003c/em\u003e PO depends on quinone‑coupled ROS for catalytic cycling; when ROS are scarce, melanin formation stalls. Additional direct binding of PFAS to PO\u0026rsquo;s hydrophobic active pocket (Nappi \u0026amp; Christensen, 2005) may lock the enzyme in an inactive conformation. The combined loss of oxidative burst and PO activity removes both fast (respiratory) and slow (melanisation) cytotoxic pathways. \u003cem\u003eStep 5\u0026mdash;\u003c/em\u003eTranscriptional rescue and exhaustion\u003cem\u003e.\u003c/em\u003e Sensing functional failure, the worm up regulates CCF-1 to relaunch the proPO cascade and boosts \u003cem\u003elysenin\u003c/em\u003e to strengthen humoral defenses. Yet this rescue is energetically expensive and, under high CAT/low‑ROS conditions, plateauing or even declining transcripts signal systemic exhaustion. The outcome is an immunocompromised organism vulnerable to soil‑borne pathogens. Although delineated here for earthworms, the same redox‑enzyme‑transcription triad could constitute a unifying PFAS mode‑of‑action across invertebrates and possibly vertebrate phagocytes.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e4.6 Ecological relevance, knowledge gaps and future perspectives\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe concentration that initiates this cascade (\u0026ge;0.6 \u0026micro;M, \u0026asymp;250 \u0026micro;g kg⁻\u0026sup1; soil) matches PFAS loads reported at AFFF training areas, industrial sites and some agricultural fields irrigated with contaminated biosolids (van Asselt et al., 2011). Earthworms are ecosystem engineers that regulate litter turnover, soil aggregation and microbial community structure; chronic immunosuppression could therefore propagate upward, altering nutrient cycling, plant health and disease dynamics (Ghosh, 2018). Field studies should now verify whether community level shifts reduced earthworm biomass, altered cast production, increased pathogen incidence co‑occur with ether PFAS hotspots. Mechanistically, early time course experiments (minutes to 6 h) combining ROS imaging, enzymology and targeted metabolomics are needed to capture the elusive pro‑oxidant spike and map its conversion into antioxidant overshoot. Multi‑omics (transcriptome‑proteome‑metabolome) and redox‑proteomics could clarify whether CAT induction is transcriptional, post translational or both, and whether other ROS‑processing enzymes (GPx, Prx) participate. Because soils contain PFAS mixtures, mixture‑interaction designs legacy + ether compounds, plus common cofactors such as metals or pesticides\u0026mdash;are essential to derive additive versus synergistic risk. Cross phyla validation in collembolans, nematodes and microbial consortia would test the generality of the oxidative antioxidant immune axis, while trophic‑transfer trials (earthworm \u0026rarr; predator) could reveal immunomodulatory carry over. Finally, coupling these mechanistic biomarkers with passive PFAS samplers and high-resolution analytical chemistry will enable weight‑of‑evidence frameworks for site prioritization, remediation monitoring and regulatory guideline refinement for the still‑expanding universe of short‑chain and ether‑linked PFAS.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eBy integrating morphometric alterations of amoebocytes, redox, enzymatic, and gene expression data alongside findings from Rotondo et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2025\u003c/span\u003e, this study refines the understanding of the oxidative antioxidant immune axis through which short-chain ether PFAS disrupt immune function in \u003cem\u003eEisenia fetida\u003c/em\u003e. Our results reveal a coordinated cascade: early oxidative burst, enzymatic inhibition (notably SOD and PO), catalase overcompensation, and ultimately, transcriptional dysregulation marked by CCF-1 and lysenin expression. This sequence culminates in immune exhaustion, particularly under high-dose exposure to emerging PFAS such as MOPrA and GenX. The biomarker suite employed amoebocyte size, ROS, CAT, PO activity, and immune gene expression emerges as a robust and mechanistically informative tool for assessing PFAS hazard in terrestrial ecosystems. Beyond \u003cem\u003eE. fetida\u003c/em\u003e, this integrated framework may help guide cross-species immunotoxicity testing, support weight-of-evidence risk assessments, and inform regulatory strategies for the expanding class of short-chain and ether-linked PFAS.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project has received funding from the European Union\u0026rsquo;s Horizon 2020 research and innovation programme under grant agreement N\u003csup\u003eo\u003c/sup\u003e 101037509 (SCENARIOS project)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDavide Gualandris Writing, Original draft, Investigations, Formal Analysis, Methodology, Review and Editing.\u003c/p\u003e\n\u003cp\u003eDavide Rotondo Investigations, Formal Analysis, Methodology.\u003c/p\u003e\n\u003cp\u003eCandida Lorusso Investigations.\u003c/p\u003e\n\u003cp\u003eValentina Audrito Methodology, Review and Editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAntonio Calisi Writing, Investigations, Review and Editing, Visualization.\u003c/p\u003e\n\u003cp\u003eFrancesco Dondero Formal Analysis, Writing, Investigations, Methodology, Visualization, Review and Editing, Resources, Supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project has received funding from the European Union\u0026rsquo;s Horizon 2020 research and innovation programme under grant agreement N\u003csup\u003eo\u003c/sup\u003e 101037509 (SCENARIOS project)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e Not applicable.\u003cbr\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e Not applicable.\u003cbr\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e Not applicable.\u003cbr\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman and animal rights\u003c/strong\u003e Not applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlesci A, Capillo G, Fumia A, Albano M, Messina E, Span\u0026ograve; N, Pergolizzi S, Lauriano ER (2023) Coelomocytes of the Oligochaeta earthworm \u003cem\u003eLumbricus terrestris\u003c/em\u003e (Linnaeus, 1758) as evolutionary key of defense: a morphological study. Zoological Lett 9:5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40851-023-00203-y\u003c/span\u003e\u003cspan address=\"10.1186/s40851-023-00203-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndroulakakis A, Alygizakis N, Gkotsis G, Nika MC, Nikolopoulou V, Bizani E, Chadwick E, Cincinelli A, Cla\u0026szlig;en D, Danielsson S, Dekker RWRJ, Duke G, Glowacka N, Jansman HAH, Krone O, Martellini T, Movalli P, Persson S, Roos A, O'Rourke E, Siebert U, Treu G, van den Brink NW, Walker LA, Deaville R, Slobodnik J, Thomaidis NS (2022) Determination of 56 per- and polyfluoroalkyl substances in top predators and their prey from Northern Europe by LC-MS/MS, Chemosphere, 287, Part 2, 131775. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chemosphere.2021.131775\u003c/span\u003e\u003cspan address=\"10.1016/j.chemosphere.2021.131775\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnthony MA, Bender SF, van der Heijden MGA (2023) Enumerating soil biodiversity. Proceeding of the National Academy of Science USA. 120(33). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.2304663120\u003c/span\u003e\u003cspan address=\"10.1073/pnas.2304663120\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeschin A, Bilej M, Hanssens F, Raymakers J, Van Dyck E, Revets H, Brys L, Gomez J, De Baetselier P, Timmermans M (1998) Identification and cloning of a glucan- and lipopolysaccharide-binding protein from Eisenia foetida earthworm involved in the activation of prophenoloxidase cascade. J Biol Chem. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.273.38.24948\u003c/span\u003e\u003cspan address=\"10.1074/jbc.273.38.24948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBilej M, Joskov\u0026aacute; R, Van den Bergh R, Proch\u0026aacute;zkov\u0026aacute; P, Šilerov\u0026aacute; M, Ameloot P, De Baetselier P, Beschin A (2006) An invertebrate TNF functional analogue activates macrophages via lectin\u0026ndash;saccharide interaction with ion channels. Int Immunol 18(12):1663\u0026ndash;1670. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/intimm/dxl100\u003c/span\u003e\u003cspan address=\"10.1093/intimm/dxl100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrase RA, Mullin EJ, Spink DC (2021) Legacy and Emerging Per- and Polyfluoroalkyl Substances: Analytical Techniques, Environmental Fate, and Health Effects. Int J Mol Sci 22:995. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms22030995\u003c/span\u003e\u003cspan address=\"10.3390/ijms22030995\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrusseau ML, Anderson RH, Guo B (2020) PFAS concentrations in soils: Background levels versus contaminated sites. Sci Total Environ 740:140017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.scitotenv.2020.140017\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2020.140017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalisi A, Lionetto MG, Schettino T (2009) Pollutant-induced alterations of granulocyte morphology in the earthworm \u003cem\u003eEisenia fetida\u003c/em\u003e. Ecotoxicol Environ Saf. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ecoenv.2009.03.010\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2009.03.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. .72:1369\u0026thinsp;\u0026ndash; 137\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalisi A, Cappello T, Angelelli M, Maisano M, Rotondo D, Gualandris D, Semeraro T, Dondero F (2024) Non-destructive biomarkers in non-target species earthworm Lumbricus terrestris for assessment of different agrochemicals. Environments 11:276. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/environments11120276\u003c/span\u003e\u003cspan address=\"10.3390/environments11120276\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalisi A, Semeraro T, Giordano ME, Dondero F, Lionetto MG (2025) Earthworms multi-biomarker approach for ecotoxicological assessment of soils irrigated with reused purified wastewater. Appl Soil Ecol 206:105866. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2025.105866\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2025.105866\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerenius L, S\u0026ouml;derh\u0026auml;ll K (2004) The prophenoloxidase-activating system in invertebrates. Immunological Review.;198:116\u0026thinsp;\u0026ndash;\u0026thinsp;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.0105-2896.2004.00116.x\u003c/span\u003e\u003cspan address=\"10.1111/j.0105-2896.2004.00116.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Junger WG (2014) Measurement of oxidative burst in neutrophils. Methods in Molecular Biology.; 844:115\u0026thinsp;\u0026ndash;\u0026thinsp;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-61779-527-5_8\u003c/span\u003e\u003cspan address=\"10.1007/978-1-61779-527-5_8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng W, Doering JA, LaLone C, Ng C (2021) Integrative Computational Approaches to Inform Relative Bioaccumulation Potential of Per- and Polyfluoroalkyl Substances Across Species. Toxicol Sci 180(2):212\u0026ndash;223. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/toxsci/kfab004\u003c/span\u003e\u003cspan address=\"10.1093/toxsci/kfab004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngelmann P, Hayashi Y, Bod\u0026oacute; K, Ernszt D, Somogyi I, Steib A, Orb\u0026aacute;n J, Poll\u0026aacute;k E, Nyitrai M, N\u0026eacute;meth P, Moln\u0026aacute;r L (2016) Phenotypic and functional characterization of earthworm coelomocyte subsets: Linking light scatter-based cell typing and imaging of the sorted populations. Dev Comp Immunol 65:41\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.dci.2016.06.017\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2016.06.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFromme H, Tittlemier SA, V\u0026ouml;lkel W, Wilhelm M, Twardella D (2009) Perfluorinated compounds\u0026ndash;exposure assessment for the general population in Western countries. Int J Hyg Environ Health 212(3):239\u0026ndash;270. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijheh.2008.04.007\u003c/span\u003e\u003cspan address=\"10.1016/j.ijheh.2008.04.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFr\u0026uuml;nd HC, Graefe U, Tischer S (2011) Earthworms as Bioindicators of Soil Quality Biology of Earthworms. Soil Biology 24:261\u0026ndash;274. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-642-14636-7_16\u003c/span\u003e\u003cspan address=\"10.1007/978-3-642-14636-7_16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaballah S, Swank A, Sobus JR, Howey XM, Schmid J, Catron T, Mc Cord J, Hines E, Strynar M, Tal T (2020) Evaluation of Developmental Toxicity, Developmental Neurotoxicity, and Tissue Dose in Zebrafish Exposed to GenX and Other PFAS. Environ Sci Pollut Res 128(4):47005. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1289/EHP5843\u003c/span\u003e\u003cspan address=\"10.1289/EHP5843\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGinzberg MB, Kafri R, Kirschner M (2015) On being the right (cell) size. Science 348:6236. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1245075\u003c/span\u003e\u003cspan address=\"10.1126/science.1245075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonz\u0026aacute;lez-Santoyo I, C\u0026oacute;rdoba-Aguilar A (2012) Phenoloxidase: a key component of the insect immune system. Entomol Exp Appl 142:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1570-7458.2011.01187.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1570-7458.2011.01187.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlazier DS (2022) How Metabolic Rate Relates to Cell Size. Biology (Basel) 11(8):1106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biology11081106\u003c/span\u003e\u003cspan address=\"10.3390/biology11081106\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoma J, Zorska A, Wesolowski D, Chadzinska M (2013) Dermal exposure to immunostimulants induces changes in activity and proliferation of coelomocytes of Eisenia andrei. J Comp Physiol B 183(3):313\u0026ndash;322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00360-012-0710-7\u003c/span\u003e\u003cspan address=\"10.1007/s00360-012-0710-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoma J, Stalmach M, Wilczek G, Kolaczkowska E (2016) Effective activation of antioxidant system by immune-relevant factors reversely correlates with apoptosis of \u003cem\u003eEisenia andrei\u003c/em\u003e coelomocytes. J Comp Physiol B 186:417\u0026ndash;430. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00360-016-0973-5\u003c/span\u003e\u003cspan address=\"10.1007/s00360-016-0973-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoma J (2018) Earthworm coelomocyte extracellular traps: structural and functional similarities with neutrophil NETs. Cell Tissue Reserch 371(3):407\u0026ndash;414. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00441-018-2787-0\u003c/span\u003e\u003cspan address=\"10.1007/s00441-018-2787-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoskova R, Šilerov\u0026aacute; M, Proch\u0026aacute;zkov\u0026aacute; P, Bilej M (2009) Identification and cloning of an invertebrate-type lysozyme from \u003cem\u003eEisenia Andrei\u003c/em\u003e. Dev Comp Immunol 33:932\u0026ndash;938. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.dci.2009.03.002\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2009.03.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJouquet P, Plumere T, Thu TD, Rempet C, Duc TT, Orange D (2010) The rehabilitation of tropical soil using compost and and vermicompost in affected by the presence of endogenic earthworms. Appl Soil Ecol 46:125\u0026ndash;133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2010.07.002\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2010.07.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKenneth J, Livak TD, Schmittgen (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026thinsp;\u0026ndash;\u0026thinsp;∆∆CT Method, Methods, 25:402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKobayashi H, Ohta N, Umeda M (2004) Biology of lysenin, a protein in the coelomic fluid of the earthworm Eisenia foetida. Int Rev Cytol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0074-7696(04)36002-X\u003c/span\u003e\u003cspan address=\"10.1016/S0074-7696(04)36002-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLionetto MG, Calisi A, Schettino T (2012) Earthworm\u0026rsquo;s biomarkers as tools for soil pollution assessment. In: Soil health and land use management. InTech- Open Access Publisher in Science, Technology and Medicine. 305\u0026ndash;332. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.5772/28265\u003c/span\u003e\u003cspan address=\"10.5772/28265\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivingstone DR (2003) Oxidative stress in aquatic organisms in relation to pollution and aquaculture. Revue M\u0026eacute;d V\u0026eacute;t 154:427\u0026ndash;430\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu A, Zhang Q, Zhang J, Yang B, Wu K, Xie W, Luan YX, Ling E (2014) Insect prophenoloxidase: the view beyond immunity. Front Physiol 5:252. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2014.00252\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2014.00252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMantovani A, Cassatella MA, Costantini C, Jaillon S (2011) Neutrophils in the activation and regulation of innate and adaptive immunity. Nat Rev Immunol 25(8):519\u0026ndash;531. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nri3024\u003c/span\u003e\u003cspan address=\"10.1038/nri3024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeegoda JN, Kewalramani JA, Li B, Marsh RW (2020) A Review of the Applications, Environmental Release, and Remediation Technologies of Per- and Polyfluoroalkyl Substances. Int J Environ Res Public Health 17:8117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijerph17218117\u003c/span\u003e\u003cspan address=\"10.3390/ijerph17218117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMishra RK, Mentha SS, Misra Y, Dwivedi N (2023) Emerging pollutants of severe environmental concern in water and wastewater: A comprehensive review on current developments and future research. Water-Energy Nexus 6:74\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.wen.2023.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.wen.2023.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNappi AJ, Christensen BM (2005) Melanogenesis and associated cytotoxic reactions: applications to insect innate immunity. Insect Biochem Mol Biol 35(5):443\u0026ndash;459. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ibmb.2005.01.014\u003c/span\u003e\u003cspan address=\"10.1016/j.ibmb.2005.01.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOECD (1984) Test No. 207: Earthworm, Acute Toxicity Tests, OECD Guidelines for the Testing of Chemicals, Section 2. OECD Publishing, Paris. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1787/9789264070042-en\u003c/span\u003e\u003cspan address=\"10.1787/9789264070042-en\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO\u0026rsquo;Hagan D (2008) Understanding organofluorine chemistry. An introduction to the C\u0026ndash;F bond. Chem Soc Rev 37:308\u0026ndash;319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/B711844A\u003c/span\u003e\u003cspan address=\"10.1039/B711844A\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuellet G, Lapen DR, Topp E, Sawada M, Edwards M (2008) A heuristic model to predict earthworm biomass in agroecosystems based on selected Management and soil properties. Appl Soil Ecoi 39:35\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2007.11.003\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2007.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOpper B, Bogn\u0026aacute;r A, Heidt D, N\u0026eacute;meth P, Engelmann P (2013) Revising lysenin expression of earthworm coelomocytes. Dev Comp Immunol 39:214\u0026ndash;218 Dev Comp Immunol 39:214\u0026ndash;218. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.dci.2012.11.006\u003c/span\u003e\u003cspan address=\"10.1016/j.dci.2012.11.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanieri E, Baralic K, Djukic-Cosic D, Buha Djordjevic A, Saso L (2022) PFAS Molecules: A Major Concern for the Human Health and the Environment. 10:44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/toxics10020044\u003c/span\u003e\u003cspan address=\"10.3390/toxics10020044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eProch\u0026aacute;zkov\u0026aacute; P, Silerov\u0026aacute; M, Stijlemans B, Dieu M, Halada P, Joskov\u0026aacute; R, Beschin A, De Baetselier P, Bilej M (2006) Evidence for proteins involved in prophenoloxidase cascade \u003cem\u003eEisenia fetida\u003c/em\u003e earthworms. J Comp Physiol B 6:581\u0026ndash;587. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00360-006-0081-z\u003c/span\u003e\u003cspan address=\"10.1007/s00360-006-0081-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajak P, Ganguly A (2023) The ligand-docking approach explores the binding affinity of PFOS and PFOA for major endogenous antioxidants: A potential mechanism to fuel oxidative stress. Sustainable Chemistry for the Environment\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.scenv.2023.100047\u003c/span\u003e\u003cspan address=\"10.1016/j.scenv.2023.100047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRotondo D, Gualandris D, Lorusso C, Braeuning A, Calisi A, Dondero F (2025) Impact of Short-Chain Perfluoropropylene Oxide Acids on Biochemical and Behavioural Parameters in \u003cem\u003eEisenia fetida\u003c/em\u003e (Savigny, 1826). J Xenobiotics 15(1):2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jox15010002\u003c/span\u003e\u003cspan address=\"10.3390/jox15010002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi X, Liu X, Wang Q, Das A, Ma G, Xu L, Sun Q, Peddireddi L, Jia W, Liu Y, Anderson G, Bai J, Shi J (2016) A multiplex real-time PCR panel assay for simultaneous detection and differentiation of 12 common swine viruses. J Virol Methods 236:258\u0026ndash;265. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jviromet.2016.08.005\u003c/span\u003e\u003cspan address=\"10.1016/j.jviromet.2016.08.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzychowski KA, Rybczyńska-Tkaczyk K, Leja ML, W\u0026oacute;jtowicz AK, Gmiński J (2016) Tetrabromobisphenol A (TBBPA)-stimulated reactive oxygen species (ROS) production in cell-free model using the 2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA) assay-limitations of method. Environ Sci Pollut Res Int 23(12):12246\u0026ndash;12252. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-016-6450-6\u003c/span\u003e\u003cspan address=\"10.1007/s11356-016-6450-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValembois P, Lass\u0026egrave;gues M (1995) In vitro generation of reactive oxygen species by free coelomic cells of the annelid \u003cem\u003eEisenia fetida andrei\u003c/em\u003e: an analysis by chemiluminescence and nitro blue tetrazolium reduction. Dev Comp Immunol 19:195\u0026ndash;204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0145-305X(95)00013-J\u003c/span\u003e\u003cspan address=\"10.1016/0145-305X(95)00013-J\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Asselt ED, Rietra RP, R\u0026ouml;mkens PF, van der Fels-Klerx HJ (2011) Perfluorooctane sulphonate (PFOS) throughout the food production chain. Food Chem 128(1):1\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodchem.2011.03.032\u003c/span\u003e\u003cspan address=\"10.1016/j.foodchem.2011.03.032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVig AP, Singh J, Suthar SS (2022) Earthworm Engineering and Applications. 1st edition. Nova Science Publishers. ISBN: 978-1-68507-566-8, New York, U.S.A., p. 270\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Munir U, Huang Q (2023) Occurrence of per- and polyfluoroalkyl substances (PFAS) in soil: Sources, fate, and remediation. Soil Environ Health 1(1):2949\u0026ndash;9194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.seh.2023.100004\u003c/span\u003e\u003cspan address=\"10.1016/j.seh.2023.100004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao F (2017) Emerging poly- and perfluoroalkyl substances in the aquatic environment: a review of current literature. Water Res 124:482\u0026ndash;495. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.watres.2017.07.024\u003c/span\u003e\u003cspan address=\"10.1016/j.watres.2017.07.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao R, Ali A, Xu Y, Abdelrahman H, Li R, Lin Y, Bolan N, Shaheen S, Rinklebe J, Zhang Z (2022) Earthworms as candidates for remediation of potentially toxic elements contaminated soils and mitigating the environmental and human health risks: A review. Environ Int 158:106924. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.envint.2021.106924\u003c/span\u003e\u003cspan address=\"10.1016/j.envint.2021.106924\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"biomarkers, ecotoxicology, gene expression, hemolysin, oxidative burst, PFAS","lastPublishedDoi":"10.21203/rs.3.rs-6631095/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6631095/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePer‑ and polyfluoroalkyl substances (PFAS) persist in soils, yet their effects on invertebrate immunity remain poorly resolved. We compared a legacy congener, perfluorooctanoic acid (PFOA), with three short‑chain ether acids GenX (C6), MOBA (C5) and MOPrA (C4) using a 72 h OECD‑207 filter‑paper assay in the earthworm \u003cem\u003eEisenia fetida\u003c/em\u003e. Endpoints spanned cellular and humoral defence: amoebocyte morphometry, oxidative burst (ROS production), phenol‑oxidase (PO) activity, and transcription of the lectin CCF‑1 and the pore‑forming protein lysenin. MOBA and MOPrA enlarged amoebocytes by ~\u0026thinsp;70% (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), whereas PFOA and GenX had no morphometric impact. Oxidative burst fell significantly for all congeners; GenX caused a 45% drop at 0.6 \u0026micro;M, while MOPrA declined monotonically from \u0026minus;\u0026thinsp;18% (0.6 \u0026micro;M) to \u0026minus;\u0026thinsp;62% (229 \u0026micro;M). PO inhibition followed the same potency order (MOPrA\u0026thinsp;\u0026gt;\u0026thinsp;GenX\u0026thinsp;\u0026gt;\u0026thinsp;MOBA ≫ PFOA) with near‑complete loss at 229 \u0026micro;M MOPrA. CCF‑1 showed dose‑dependent or U‑shaped induction, whereas lysenin peaked at 31 \u0026micro;M MOPrA but was unchanged at 0.6 and 229 \u0026micro;M, suggesting an energetically costly yet inefficient compensatory response. Integrating these findings with published superoxide‑dismutase inhibition and catalase hyper‑activation reveals an oxidative\u0026ndash;antioxidant\u0026ndash;immune cascade that compromises earthworm defence at concentrations\u0026thinsp;\u0026ge;\u0026thinsp;0.6 \u0026micro;M (\u0026asymp;\u0026thinsp;250 \u0026micro;g kg⁻\u0026sup1; soil), levels already reported in AFFF‑impacted sites. The combined biomarker panel\u0026mdash;amoebocyte size, ROS, CAT, PO, CCF‑1 and lysenin\u0026mdash;offers a concise framework for assessing terrestrial PFAS risk and guiding remediation monitoring.\u003c/p\u003e","manuscriptTitle":"Effect of Ether Perfluoro Carboxyl Acids (PFECAs) on Innate Immunity in Earthworms (Eisenia fetida)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-28 07:47:31","doi":"10.21203/rs.3.rs-6631095/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-05-23T21:07:37+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-23T15:38:07+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Environmental Science and Pollution Research","date":"2025-05-22T07:51:05+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-19T04:25:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Environmental Science and Pollution Research","date":"2025-05-15T05:47:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"371151bb-fda2-45a0-8934-b57ea4e71ae9","owner":[],"postedDate":"May 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-05-28T07:47:31+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-28 07:47:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6631095","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6631095","identity":"rs-6631095","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}