Astaxanthin Therapy in Women with Advanced Endometriosis: A Randomized Controlled Trial with Exploratory Analysis of Endometrial Wnt/β-Catenin Signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Astaxanthin Therapy in Women with Advanced Endometriosis: A Randomized Controlled Trial with Exploratory Analysis of Endometrial Wnt/β-Catenin Signaling Sahar Rostami, Ashraf Aleyasin, Saeid Nekoonam, Anahid Shafie, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8971122/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Background Endometriosis is a chronic gynecological disorder associated with pelvic pain and infertility, characterized by molecular and cellular dysregulation in the eutopic endometrium. Aberrant Wnt/β-catenin signaling has been implicated in disease pathophysiology. Astaxanthin (AST), a potent antioxidant, may influence cellular signaling pathways relevant to female reproductive health. This study investigated the effects of AST on Wnt/β-catenin signaling in the eutopic endometrium of women with advanced endometriosis. Methods In this randomized, triple-blind, placebo-controlled trial, 50 women with advanced-stage endometriosis received either AST (6 mg/day) or placebo for 12 weeks. Endometrial samples were collected during the mid-secretory phase before and after the intervention. Wnt/β-catenin pathway gene expression was quantified using real-time PCR, and protein levels were assessed by Western blotting. Results AST supplementation was associated with reduced β-catenin expression (P = 0.041) and increased GSK-3β (P = 0.009) and DKK-1 (P = 0.042) levels. CD44 expression was also lower post-intervention (P = 0.021). These findings suggest that AST may promote a shift toward normalization of Wnt/β-catenin signaling in the eutopic endometrium. Conclusions In women with advanced endometriosis, AST supplementation was associated with modulation of Wnt/β-catenin pathway components in the eutopic endometrium. While these results are exploratory, they highlight the potential of AST to influence endometrial signaling pathways, supporting further investigation of its role in reproductive health. Trial Registration Iranian Registry of Clinical Trials (IRCT) IRCT20220625055274N1. Registered on 03 September 2022. Endometriosis Astaxanthin Wnt/β-Catenin Signaling Eutopic Endometrium Female Reproductive Health Randomized Controlled Trial Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Endometriosis, the presence of functional endometrial tissue (glands and stroma) outside the uterine cavity, is a multifaceted, estrogen-dependent disease commonly associated with dysmenorrhea and infertility, with significant impact on women’s reproductive health and quality of life [ 1 ]. Chronic inflammation and hormonal dysregulation are key drivers of its pathophysiology, yet the mechanisms linking endometriosis to impaired fertility remain insufficiently understood [ 2 ]. Recent studies indicate that complex molecular, cellular, and hormonal interactions may underlie the reduced reproductive success observed in affected women [ 3 ]. Additionally, pelvic anatomical abnormalities, alterations in the peritoneal fluid environment, irregular ovulation with diminished ovarian reserve, impaired endometrial receptivity, and dyspareunia limiting regular intercourse can further decrease the likelihood of natural conception [ 4 – 6 ]. Even women with minimal endometriosis exhibit a noticeable decline in implantation rates during natural cycles or assisted reproductive technology (ART) treatments [ 7 ]. These patients also display molecular and functional abnormalities in the eutopic endometrium during the window of implantation [ 8 – 11 ]. Several signaling pathways are disrupted in endometriosis, creating an unfavorable environment at the maternal–embryo interface [ 12 – 16 ]. Among these, the Wnt/β-catenin pathway plays a key role in immune regulation, endometrial remodeling, and implantation [ 17 ]. It also coordinates essential uterine–embryo interactions required for implantation [ 18 ] and serves as a major reproductive regulator in mammals [ 19 ]. During early pregnancy, several Wnt genes (Wnt2, 3, 4, 5a, 7a, 7b, 10b) support the survival, proliferation, and differentiation of endometrial stromal cells [ 20 ]. Bioinformatics analyses further highlight Wnt/β-catenin, NOTCH, and immune pathways as top processes linked to RIF, with Wnt and NOTCH also modulating immune cell activity [ 21 , 22 ]. Dysregulated Wnt/β-catenin signaling contributes to infertility, endometriosis, endometrial cancer, and gestational disorders such as complete mole and choriocarcinoma [ 23 ]. Experimental evidence shows that Wnt/β-catenin activity is temporally regulated in the uterus and depends on the presence of the blastocyst, and its disruption impairs implantation [ 24 ]. Unsuccessful implantation in endometriosis patients is associated with a non-receptive endometrium during the mid-luteal phase, primarily due to progesterone resistance [ 25 , 26 ]. Estrogen and progesterone regulate endometrial proliferation, embryo implantation, placentation, decidualization, and folliculogenesis partly through modulation of the Wnt/β-catenin signaling pathway [ 27 , 28 ]. During the proliferative phase, estrogen activates Wnt/β-catenin signaling, promoting β-catenin translocation to the nucleus [ 29 ]. In contrast, the mid-luteal increase in progesterone inhibits Wnt/β-catenin signaling via dickkopf Wnt signaling pathway inhibitor 1 (DKK1) and Forkhead box protein O1 (FOXO1), thereby triggering cellular differentiation and preparing the endometrium for embryo implantation [ 30 – 32 ]. In the absence of Wnt ligands, β-catenin is phosphorylated and ubiquitinated by the destruction complex, which includes Axin, glycogen synthase kinase 3 beta (GSK3-β), and adenomatous polyposis coli (APC). Binding of Wnt ligands to Frizzled (Fz) receptors disrupts this complex and stabilizes β-catenin [ 33 ]. In endometriosis patients, resistance to progesterone leads to abnormal activation of the Wnt/β-catenin signaling pathway during the mid-luteal phase, resulting in the overexpression of Wnt target genes involved in endometrial receptivity [ 34 ], such as Hoxa10 [ 35 ], certain matrix metalloproteinases (MMP-9 and MMP-2) [ 36 ], and Cyclin D1 [ 37 ]. These molecular events contribute to a persistent proliferative phenotype and impaired decidualization in the endometrium during the implantation window [ 26 ]. Consequently, targeting the Wnt/β-catenin pathway may represent a promising strategy for the treatment and prevention of endometriosis [ 17 ]. Ongoing research is exploring the potential benefits of antioxidant supplementation in reducing symptoms and improving outcomes for patients with endometriosis [ 38 – 40 ]. Antioxidants have been extensively studied for their ability to enhance pregnancy outcomes in women experiencing infertility [ 41 , 42 ]. Astaxanthin (AST) is a red-orange, lipid-soluble xanthophyll photo-pigmented ketocarotenoid derived from the alga Haematococcus pluvialis . It possesses antioxidant activity that is ten times stronger than other natural carotenoids [ 43 ]. Apart from its potent capacity to neutralize singlet oxygen, this dietary bioactive compound has demonstrated significant immunomodulatory, anti-inflammatory, anti-proliferative, anti-apoptotic, anti-diabetic, and neuroprotective properties [ 44 ]. AST targets multiple signaling pathways, including PI3K/Akt, JAK2/STAT3, NF-κB, MAPKs, Nrf2/HO-1, and PPARγ, and has been shown to help maintain the balance between oxidants and antioxidants [ 44 ]. Studies have reported that AST can inhibit cell proliferation and induce apoptosis by reducing the p-Akt/Akt ratio, thereby modulating downstream pathways such as NF-κB, Wnt/β-catenin, and JAK/STAT3 in different cancer cell types [ 45 – 47 ]. In a previous clinical investigation, we observed that 12 weeks of AST supplementation reduced oxidative stress and inflammation and improved certain initial ART outcomes in patients with endometriosis. Despite these promising findings, the specific effects of AST on endometrial function and implantation remain unclear [ 48 ]. Although preclinical studies have suggested that AST can modulate Wnt/β-catenin signaling [ 45 , 46 , 49 ], clinical evidence evaluating its effects on endometrial signaling or implantation-related pathways in women with endometriosis is lacking. To address this gap, we conducted a randomized, placebo-controlled trial to explore the impact of AST supplementation on Wnt/β-catenin pathway components in the eutopic endometrium of women with advanced endometriosis undergoing ART. Our aim was to investigate whether AST may influence key mediators of Wnt/β-catenin signaling and provide preliminary insights into its potential effects on the endometrial molecular environment. We hypothesized that AST supplementation could help normalize aberrant pathway activity, offering a foundation for future studies on endometrial receptivity and reproductive outcomes. Materials and methods Study population The study design, randomization, blinding, and trial procedures have been described in detail previously [ 56 ]. Briefly, this randomized, triple-blind, placebo-controlled trial with a 1:1 allocation ratio was conducted at Omid Fertility Clinic. A total of 50 women with moderate to severe endometriosis, diagnosed according to the criteria of the American Society of Reproductive Medicine (ASRM) [ 50 ], were enrolled. Eligible participants were between 20 and 40 years of age, had infertility associated with stage III/IV endometriosis confirmed by laparoscopy and histopathological evaluation, a BMI of 18.5–30 kg/m², and regular menstrual cycles (defined as cycle lengths between 26 and 32 days). Exclusion criteria were pregnancy, breastfeeding, recent use of hormones or intrauterine device (IUD), ongoing medications or antioxidant therapy, and a history of endometriosis surgery. Block randomization with a block size of 4 was applied to allocate participants into the AST or placebo group. The random allocation sequence was generated by an independent researcher not involved in participant enrollment or clinical procedures, and assignment was secured using sequentially numbered, opaque, sealed envelopes. Triple blinding ensured that patients, clinicians, embryologists, statisticians, and laboratory personnel remained unaware of the group assignments. Before and alongside the routine ovarian stimulation protocol, participants received 6 mg daily of oral astaxanthin (AstaReal®; AstaReal Co., Ltd., Tokyo, Japan) or matching placebo capsules for 12 weeks. AST capsules were indistinguishable from placebo capsules in size, shape, color, taste, and packaging, ensuring adequate blinding. This ensured that blinding was robust not only in allocation and labeling but also in capsule appearance and packaging. Supplementation started on day 1 of the menstrual cycle two months before controlled ovarian stimulation (COS) and continued until the day of oocyte pick-up, ensuring no washout period or treatment overlap ambiguities. Adherence and adverse effects were monitored through regular phone calls and clinical visits. The Consolidated Standards of Reporting Trials (CONSORT) diagram ( Fig. 1 ) shows the distribution of participants through the trial [ 48 ]. No significant changes to the trial methods, including eligibility criteria, interventions, or outcome assessments, or to the trial outcomes, including primary and secondary endpoints, were made after the study commenced. No interim analyses or stopping guidelines were applied in this trial. Eutopic endometrium sample collection Sample collection followed the World Endometriosis Research Foundation EPHect standard operating procedures for the collection, processing, and storage of eutopic endometrial tissue [ 51 ]. Endometrial biopsies were obtained on day LH + 7, corresponding to the mid-luteal phase, as determined by urinary LH surge testing, using a Pipelle curette (Medbar Ltd., Izmir, Turkey). All biopsies were performed by the same experienced gynecologist to avoid inter-operator variability. Each biopsy sample was divided into three portions. The first portion was rinsed with sterile cold phosphate-buffered saline (PBS) and promptly snap-frozen in liquid nitrogen within 2–3 minutes after biopsy for Western blot (WB) analysis. The second portion was placed in RNAlater (QIAGEN) and stored at − 80°C for RNA extraction. The third portion was fixed in formalin for histological dating and confirmation of endometriotic features. Histological evaluation according to Noyes’ criteria [ 52 ] confirmed mid-luteal phase morphology, characterized by coiled and dilated glands with subnuclear vacuolization in the epithelium. The stroma was densely cellular with inflammatory cell infiltration, consistent with advanced-stage endometriosis, and all slides were independently reviewed in a blinded manner by two experienced pathologists to minimize inter-observer bias/variability. COS protocol The protocol for ovulation induction has been described previously [ 48 ]. In summary, all patients underwent a flexible GnRH antagonist regimen. Recombinant follicle-stimulating hormone (rFSH; 150–300 IU/day, Gonal-F®, Merck Serono SA, Switzerland) was administered daily from the beginning of the cycle until final oocyte maturation was triggered with 10,000 IU of human chorionic gonadotropin (hCG; Ovitrelle®, Merck Serono SA, Switzerland). Follicular development was monitored by transvaginal ultrasonography. Once ≥ 2 follicles reached 14 mm, Cetrorelix acetate (Cetrotide) was initiated and discontinued when ≥ 2 follicles reached 18 mm. Final oocyte maturation was induced with hCG, and oocyte retrieval was performed 36 hours later under ultrasound guidance. All participants underwent intracytoplasmic sperm injection (ICSI). Embryos were cryopreserved on day 3 or day 5, and 2–3 embryos were transferred in subsequent frozen cycles, in accordance with ASEBIR guidelines [ 53 ]. If only one embryo was available, single embryo transfer (SET) was performed. Quantitative Real-time PCR Total RNA was extracted from 30–50 mg of endometrial tissue using RNX-Plus solution (SinaClon, Iran), following the manufacturer’s instructions. RNA concentration and purity were assessed with a WPA spectrophotometer (Biochrom). Samples with A260/280 ratio between 1.8–2.0 and RNA Integrity Number (RIN) ≥ 7 were considered acceptable for downstream analysis. cDNA synthesis was performed using the AddScript cDNA Synthesis Kit (AddBio Inc., South Korea) with random hexamer and oligo dT primers. Primers were designed using AlleleID 6.0 software and synthesized by Pishgam Biotechnology (Iran). Sequences are provided in Table 1 . Each 25 µl PCR reaction contained 12.5 µl RealQ Plus 2x Master Mix Green High ROX™ (Ampliqon, Denmark), 0.5 µl of each primer, 1 µl cDNA template (diluted 1:6), and 10.5 µl nuclease-free water. Table 1 Primer sequences used for quantitative real-time polymerase chain reaction (qRT-PCR) Gene Primer sequence CTB1-F GAGGACAAGCCACAAGATTACAAG CTB1-R TCAGCAGTCTCATTCCAAGCC GSK3-F ACCCTCCTCATTGCCACCTTAG GSK3-R CAACAGACTCCACTTCCGAACC DKK1-F GCGTTGTTACTGTGGAGAAG DKK1-R AGAAGAATTACTGGCTTGATGG WNT-F ACTGTGGTGGGTGGTCATCG WNT-R CAGGACACGCAGGCAATGG APC-F AGCACTCCACAACATCATTCAC APC-R CCCAACAGGTTTCACAGTAAGC CD44-F GAACGAATCCTGAAGACATCTACC CD44-R AACCTCCTGAAGTGCTGCTC GAPDH-F AGTCCACTGGCGTCTTCAC GAPDH-R ATCTTGAGGCTGTTGTCATACTTC CTB1: β-catenin; GSK3: glycogen synthase kinase-3β; DKK1: dickkopf-1; WNT: wingless/integrated; APC: adenomatous polyposis coli; CD44: cluster of differentiation 44; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; F: forward; R: reverse. Thermocycling conditions were as follows: initial enzyme activation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15–30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s using an ABI 5400 thermal cycler (Applied Biosystems, USA). Fluorescence was recorded during the annealing/extension step of each cycle. Primer efficiency was validated to fall within the acceptable range of 90–110%, and specificity of amplification was confirmed by melt curve analysis, which demonstrated single sharp peaks without evidence of primer-dimer formation. All reactions were performed in technical duplicates to ensure reproducibility. Gene expression levels were normalized to GAPDH, and relative expression was calculated using the 2 −∆Ct method. Western blot analysis of total and phosphorylated β-catenin For Western blot analysis of total and phosphorylated β-catenin, the endometrial samples were lysed with RIPA lysis buffer containing protease and phosphatase inhibitors. Endometrial tissue lysates were prepared in RIPA buffer supplemented with protease and phosphatase inhibitors. Protein concentrations were quantified using the BCA Protein Assay (Beyotime, China). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, MA, USA). Membranes were blocked with 5% BSA and incubated overnight at 4°C with primary antibodies against phosphorylated β-catenin (p-β-catenin (BC-22): sc-57535), total β-catenin (β-catenin (E-5): sc-7963), and β-actin (C4: sc-47778) (all Santa Cruz Biotechnology, CA, USA; 1:300 dilution). After washing, membranes were incubated with HRP-conjugated secondary antibodies (anti-rabbit: sc-2357, anti-mouse: sc-516102; Santa Cruz Biotechnology; 1:1000 dilution) for 1 h at room temperature. Protein band intensities were quantified by densitometry, and all values were normalized to β-actin as the internal loading control to ensure accurate quantification. Outcome measures, Sample size and statistical analysis The primary outcome of this trial was β-catenin mRNA expression in the eutopic endometrium, which was assessed using quantitative real-time PCR before and after 12 weeks of AST or placebo supplementation. Secondary outcomes included total and phosphorylated β-catenin protein levels, assessed by Western blot analysis, and implantation rate in subsequent ART cycles. All molecular analyses were performed on endometrial biopsies collected in the mid-luteal phase, and implantation outcomes were recorded during the first frozen embryo transfer cycle following the intervention. Based on Pazhohan et al. [ 54 ], the calculated sample size (n = 50; 25 per group) provided 90% power at α = 0.05 to detect intergroup differences, accounting for a 15% dropout rate. Normality of distribution was tested using the Shapiro–Wilk test. For parametric data, Student’s t-test was used. Paired t-tests compared pre- and post-intervention data within groups, and independent t-tests compared post-intervention data between groups. Non-parametric variables were analyzed with the Mann–Whitney U test. Data are presented as mean ± standard deviation (SD), with P < 0.05 considered statistically significant. Analyses were performed with SPSS v22.0 (SPSS Inc., Chicago, IL, USA), and figures were prepared with GraphPad software. Comparison of Implantation Rates Between Groups The implantation rate (the number of sacs seen on ultrasound/ number of embryos transferred × 100) was compared between the two groups. Ethics approval and consent to participate The study was approved by the Ethics Committee of Tehran University of Medical Sciences (approval code: IR.TUMS.MEDICINE.REC.1400.1085; December 19, 2021) and conducted in accordance with the Declaration of Helsinki. The trial was registered with the Iranian Registry of Clinical Trials (IRCT20220625055274N1; 2022-09-03). This paper presents only a part of the IRCT registered clinical trial outcomes. Written informed consent was obtained from all participants prior to enrollment, including consent for the use of endometrial samples before and after the intervention and for publication of the study findings and associated data. All data were processed confidentially and fully anonymized to protect participant privacy. Results Baseline characteristics All participants completed the trial. Demographic and clinical characteristics of the study population have been reported previously [48]. Throughout the trial, no adverse effects or signs of toxicity related to AST supplementation were clinically observed, and participants demonstrated good compliance with the intervention protocol. Compliance was evaluated at each follow-up visit by pill count, complemented with patient self-reports during scheduled phone calls, and adherence ≥80% was considered acceptable. As described in the earlier report, the two groups did not differ significantly with respect to age, BMI, or other baseline characteristics. Based on pill counts of returned bottles, the adherence rates were 91% in the AST group and 94% in the placebo group. No adverse events or side effects related to AST or placebo supplementation were observed during the trial. mRNA expression of Wnt signaling pathway genes The expression of Wnt signaling pathway genes in endometrial tissue was assessed using qPCR (Fig. 2) . Before the intervention, no significant differences were observed between the AST and placebo groups (all P > 0.05). Following the intervention, β-catenin expression was significantly lower in the AST group compared with the placebo group (P = 0.005). In contrast, GSK-3β (P = 0.019) and DKK-1 (P = 0.023) expression levels were significantly higher in the AST group than in the placebo group. No significant differences were detected between the groups in the expression of WNT-7a (P = 0.218), APC (P = 0.149), or CD44 (P = 0.607). In the AST group, β-catenin expression decreased significantly after the intervention compared with baseline (P = 0.041). These changes were accompanied by significant increases in GSK-3β (P = 0.009) and DKK-1 (P = 0.042) expression levels. In addition, CD44 expression was significantly reduced following the intervention compared with baseline (P = 0.021). No significant changes were observed in WNT-7a (P = 0.248) or APC (P = 0.689) expression in the AST group. Protein expression level of total and phosphorylated β-catenin Protein expression of total and phosphorylated β-catenin was assessed to compare the AST and placebo groups following the intervention. As shown in Fig. 3 , no significant difference was detected in total β-catenin protein levels between the two groups (P = 0.626). In contrast, phosphorylated (inactive) β-catenin expression was significantly higher in the AST group compared with the placebo group (P = 0.042). In the AST group, total β-catenin protein levels remained unchanged after the intervention (P = 0.962), whereas phosphorylated β-catenin levels increased significantly compared with baseline (P = 0.006). In the placebo group, no significant change in phosphorylated β-catenin expression was observed before and after the intervention (P = 0.080). The Effect of AST on Implantation Rate The implantation rate (the number of sacs seen on ultrasound/ number of embryos transferred × 100) was compared between the two groups (Table 2) . The results showed no statistically significant difference in the implantation rate between the treatment group and the placebo group (P = 0.441). Table 2. Effect of AST supplementation on implantation outcomes in the AST and placebo group P values Placebo AST 0.394 0.7600±0.8306 0.9200±0.7023 Number of sacs seen on ultrasound 0.424 2.0400±0.7348 2.2400±0.4358 Number of embryos transferred 0.441 0.4200±0.0674 0.3333±0.0726 *Implantation rate (%) Data are presented as mean ± SD or percentage, as appropriate. Implantation rate (%) was calculated as: (number of gestational sacs observed on ultrasound 2 weeks after embryo transfer ÷ number of transferred embryos) × 100. AST, Astaxanthin group; SD, standard deviation. The Graphical Abstract summarizes the main findings of this study (Fig. 4) . Discussion In this randomized, triple-blind, placebo-controlled trial, we investigated the impact of AST supplementation on Wnt/β-catenin signaling in the eutopic endometrium of infertile women with endometriosis undergoing ART. Our findings demonstrated that 12 weeks of AST supplementation (6 mg/day) significantly downregulated β-catenin mRNA expression while upregulating GSK-3β and DKK-1 expression. At the protein level, phosphorylated (inactive) β-catenin was elevated, whereas total β-catenin remained unchanged. Additionally, CD44 expression was significantly reduced. Collectively, these results suggest that AST modulates Wnt/β-catenin signaling toward an inhibitory profile, potentially improving endometrial receptivity. Progesterone resistance in endometriosis patients leads to aberrant activation of the Wnt/β-catenin signaling pathway, contributing to the over-expression of genes responsible for regulating the receptivity of the endometrium [34]. In a case-control study, Pazhohan et al. [30] reported that the abnormal activation of the Wnt/β-catenin signaling pathway in the secretory phase of the menstrual cycle in endometriosis patients is characterized by excessive inactivation of GSK-3β and suppression of DKK-1 expression. In another prospective study [54], the same team reported that the expression of the active form of β-catenin in the endometrial cells of endometriosis patients reduced significantly after 12-14 weeks of vitamin D supplementation. In our study, AST administration could significantly decrease the expression level of β-catenin. However, the inactive form of β-catenin significantly increased in the treatment group after the intervention. A significant increase in the expression levels of GSK-3β and DKK-1 was also observed in the treatment group. The expression level of CD44 showed a significant decrease after intervention as well. To date, no studies have directly examined the effects of AST on endometriosis or endometrial tissue; thus, much of the available evidence regarding its role in Wnt/β-catenin signaling is derived from cancer and other pathological models. AST has been found to hinder the growth of cancer cells and promote cell death in various types of carcinoma cells [45, 46]. It achieves this by reducing the ratio of phosphorylated Akt to total Akt, thereby suppressing the downstream signaling pathways of Akt, including NF-κB, Wnt, and STAT3. In a study on human hepatocellular carcinoma cells, Li et al [45] showed that AST could cause apoptosis of tumor cells and inhibit cell proliferation by decreasing the mRNA and protein levels of GSK-3β and β-catenin in a dose-dependent manner. The levels of inactive GSK-3β were consistently decreased, indicating a reduction in the nuclear transfer of β-catenin. In a study involving a hamster model of oral cancer, Kavitha et al. [46] found that AST could exert chemopreventive effects by inhibiting Wnt signaling. This inhibition was achieved by blocking the phosphorylation of GSK-3β, the key signaling kinase. The researchers also proposed that AST may deactivate the upstream signaling kinases Erk/Akt, thereby mediating the inhibition of these pathways. Although cancer-model studies reported decreases in both GSK-3β and β-catenin after AST treatment, the opposite pattern observed in our endometrial samples likely reflects context-dependent effects related to tissue type, experimental design, and molecular endpoints measured. AST treatment is also capable of suppressing H. pylori -induced activation of the oncogenic Wnt/β-catenin pathway in human gastric epithelial cells by increasing the β-catenin entry into the nucleus [55]. These discrepancies highlight the importance of tissue-specific regulatory mechanisms when interpreting AST’s effects on Wnt/β-catenin signaling. In the current and previous study [48], AST supplementation showed notable regulatory effects on oxidative stress, inflammatory markers, gene expression, and several ART outcomes, including the number and maturity of oocytes and embryo quality. However, no significant differences were observed between the groups in implantation rate or in chemical and clinical pregnancy rates, which are considered key ART outcomes. Compatible with our results, in an RCT carried out by Gharaei et al. [56], no significant differences were reported regarding pregnancy outcomes after AST treatment. This is also in agreement with Lu et al. [57] who demonstrated no significant differences in implantation rate after a 3-month Vitamin C therapy on infertile endometriosis patients. Mier-Cabrera et al. [58] also showed no remarkable changes in pregnancy rates among endometriosis patients who took vitamins C and E supplementation for 6 months. These findings suggest that successful implantation reflects the efficiency of the whole culture system in an ART setting and requires a complex sequence of signaling events, involving the acquisition of adhesive ligands and loss of inhibitory components that are crucial for initiating pregnancy [59]. This process also relies on a receptive endometrium, a viable embryo, and a coordinated dialogue between maternal tissues and the embryo during the blastocyst stage [60]. The quality of the embryos, the age of the woman, the presence of any underlying fertility issues, and the specific protocols and techniques used during the ART procedure can also affect the chance of successful implantation [18]. Several other variables affect pregnancy outcomes. Male gamete status, embryologist and clinician skills in embryo transfer (ET), and effects of cryopreservation in frozen ET cycles can have crucial impacts on ART outcomes. Additional research involving a larger number of participants may be necessary to compare the outcomes between fresh and frozen cycles. To the best of our knowledge, this is the first randomized controlled trial evaluating the effects of AST supplementation on the eutopic endometrium and implantation in infertile patients with endometriosis. The randomized, triple-blind design minimized bias, ensured comparability between groups, reduced potential confounding factors, and strengthened the overall validity of the study. The trial included participants from across the country, all of whom received standardized treatment protocols. Adherence and potential side effects were closely monitored through regular phone calls and clinical visits, ensuring protocol compliance and providing important safety and tolerability data. Nevertheless, several limitations should be acknowledged. The relatively small sample size may have limited our ability to detect subtle changes in response to AST, and a larger cohort is needed to fully evaluate ART outcomes. The study population was restricted to patients with moderate-to-severe endometriosis, which may limit the generalizability of the findings to other stages or broader patient populations. Additionally, live birth rate (LBR), the most relevant ART success endpoint, was not analyzed. Future studies should consider measuring serum or plasma AST levels and its oxidation products, as well as performing kinase activity assays and detailed analyses of phosphorylated protein forms to clarify mechanistic effects. Although we did not directly assess TCF/LEF transcriptional activity or nuclear translocation of β-catenin, the coordinated changes in β-catenin phosphorylation status and upstream regulatory components strongly support functional attenuation of canonical Wnt signaling. Furthermore, our analysis was restricted to frozen ICSI cycles and did not include outcomes from fresh cycles . Ultimately, these findings may not be generalizable to all patients with endometriosis, but they are relevant to infertile individuals with moderate-to-severe disease undergoing assisted reproduction. Conclusions Our findings demonstrate that astaxanthin (AST) modulates Wnt/β-catenin signaling in the eutopic endometrium of women with advanced endometriosis, suggesting a potential role in restoring endometrial molecular balance. Although clinical reproductive outcomes were not assessed in this study, AST may represent a promising dietary adjunct for correcting endometrial signaling abnormalities associated with endometriosis. Further research is warranted to evaluate its long-term molecular effects and potential implications for fertility. Abbreviations Wnt Wingless-related integration site β-catenin Beta-catenin ART Assisted Reproductive Techniques / Technologies AST Astaxanthin PCR Polymerase Chain Reaction GSK-3β Glycogen Synthase Kinase 3 Beta DKK-1 Dickkopf Wnt Signaling Pathway Inhibitor 1 CD44 Cluster of Differentiation 44 RIF Recurrent Implantation Failure FOXO1 Forkhead Box Protein O1 Axin Axis Inhibition Protein APC Adenomatous Polyposis Coli Fz Frizzled NF-κB Nuclear Factor Kappa-light-chain-enhancer of Activated B Cells RCT Randomized Controlled Trial IUD Intrauterine Device COS Controlled Ovarian Stimulation CONSORT Consolidated Standards of Reporting Trials LH Luteinizing Hormone PBS Phosphate-Buffered Saline WB Western Blot rFSH Recombinant Follicle-Stimulating Hormone hCG Human Chorionic Gonadotropin ICSI Intracytoplasmic Sperm Injection ASEBIR Asociación para el Estudio de la Biología de la Reproducción RIN RNA Integrity Number cDNA Complementary DNA GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase RIPA Radioimmunoprecipitation Assay BCA Bicinchoninic Acid SDS-PAGE Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis PVDF Polyvinylidene Difluoride BSA Bovine Serum Albumin HRP Horseradish Peroxidase ICH-GCP International Council for Harmonisation – Good Clinical Practice Declarations Acknowledgements The authors are deeply grateful to Dr. Joerg Schnackenberg, Senior Researcher at Astareal, for his invaluable support throughout this research and his collaborative spirit. Author Contribution F.A. and A.A. designed the research; S.R. performed the research; S.N. analyzed the data; A.SH. and M.S. contributed new reagents/analytical tools; S.R. wrote the manuscript. All authors read and approved the final manuscript. Funding This study was supported by the Medical Research Council of Tehran University of Medical Sciences (grant number 9811113002). Data Availability The datasets generated and/or analyzed during the current study are available in the Supplementary Files accompanying this article. Conflict of interest The authors declare that they have no competing interests. Ethical Approval This study was approved by the Ethics Committee of Tehran University of Medical Sciences (approval code: IR.TUMS.MEDICINE.REC.1400.636; August 15, 2021). Consent to Participate Informed consent was obtained from all individual participants included in the study. Consent for publication Not applicable. References Smolarz B, Szyłło K, Romanowicz H. Endometriosis: epidemiology, classification, pathogenesis, treatment and genetics (review of literature). Int J Mol Sci. 2021;22(19):10554. Bonavina G, Taylor HS. Endometriosis-associated infertility: From pathophysiology to tailored treatment. Front Endocrinol (Lausanne). 2022;13:1020827. Yland J, Carvalho LFP, Beste M, Bailey A, Thomas C, Abrão MS et al. Endometrioma, the follicular fluid inflammatory network and its association with oocyte and embryo characteristics. 2020;40(3):399–408. De Ziegler D, Borghese B, Chapron CJTL. Endometriosis and infertility: pathophysiology and management. 2010;376(9742):730–8. Gupta S, Goldberg JM, Aziz N, Goldberg E, Krajcir N, Agarwal AJF et al. Pathogenic mechanisms in endometriosis-associated infertility. 2008;90(2):247–57. Bulletti C, Coccia ME, Battistoni S. Borini AJJoar, genetics. Endometr infertility. 2010;27(8):441–7. Horton J, Sterrenburg M, Lane S, Maheshwari A, Li TC, Cheong Y. Reproductive, obstetric, and perinatal outcomes of women with adenomyosis and endometriosis: a systematic review and meta-analysis. Hum Reprod Update. 2019;25(5):592–632. May KE, Villar J, Kirtley S, Kennedy SH, Becker CM. Endometrial alterations in endometriosis: a systematic review of putative biomarkers. Hum Reprod Update. 2011;17(5):637–53. Igarashi TM, Bruner-Tran KL, Yeaman GR, Lessey BA, Edwards DP, Eisenberg E, et al. Reduced expression of progesterone receptor-B in the endometrium of women with endometriosis and in cocultures of endometrial cells exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Fertil Steril. 2005;84(1):67–74. Park JS, Lee JH, Kim M, Chang HJ, Hwang KJ, Chang KH. Endometrium from women with endometriosis shows increased proliferation activity. Fertil Steril. 2009;92(4):1246–9. Brosens I, Brosens JJ, Benagiano G. The eutopic endometrium in endometriosis: are the changes of clinical significance? Reprod Biomed Online. 2012;24(5):496–502. Su RW, Strug MR, Joshi NR, Jeong JW, Miele L, Lessey BA, et al. Decreased Notch pathway signaling in the endometrium of women with endometriosis impairs decidualization. J Clin Endocrinol Metab. 2015;100(3):E433–42. Aghajanova L, Hamilton A, Kwintkiewicz J, Vo KC, Giudice LC. Steroidogenic enzyme and key decidualization marker dysregulation in endometrial stromal cells from women with versus without endometriosis. Biol Reprod. 2009;80(1):105–14. Ahn JI, Yoo JY, Kim TH, Kim YI, Ferguson SD, Fazleabas AT, et al. cAMP-Response Element-Binding 3-Like Protein 1 (CREB3L1) is Required for Decidualization and its Expression is Decreased in Women with Endometriosis. Curr Mol Med. 2016;16(3):276–87. Osteen KG, Bruner-Tran KL, Eisenberg E. Reduced progesterone action during endometrial maturation: a potential risk factor for the development of endometriosis. Fertil Steril. 2005;83(3):529–37. Klemmt PA, Carver JG, Kennedy SH, Koninckx PR, Mardon HJ. Stromal cells from endometriotic lesions and endometrium from women with endometriosis have reduced decidualization capacity. Fertil Steril. 2006;85(3):564–72. Matsuzaki S, Botchorishvili R, Pouly JL, Canis MJM. therapies c. Targeting the Wnt/β-catenin pathway in endometriosis: a potentially effective approach for treatment and prevention. 2014;2(1):1–7. Bashiri A, Halper KI, Orvieto RJRB. Endocrinology. Recurrent Implantation Failure-update overview on etiology, diagnosis, treatment and future directions. 2018;16:1–18. Vainio S, Heikkilä M, Kispert A, Chin N, McMahon APJN. Female development in mammals is regulated by Wnt-4 signalling. 1999;397(6718):405–9. Bui T, Zhang L, Rees M, Bicknell R, Harris, AJBjoc. Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in normal human endometrium and endometrial carcinoma. 1997;75(8):1131–6. Lai Z-Z, Zhang J, Zhou W-J, Shi J-W, Yang H-L, Yang S-L et al. Identification of potential biomarkers and immune infiltration characteristics in recurrent implantation failure using bioinformatics analysis. 2023;14:992765. Suryawanshi A, Tadagavadi RK, Swafford D, Manicassamy, SJFii. Modulation of inflammatory responses by Wnt/β-catenin signaling in dendritic cells: a novel immunotherapy target for autoimmunity and cancer. 2016;7:460. Sonderegger S, Pollheimer J, Knöfler MJP. Wnt signalling in implantation, decidualisation and placental differentiation–review. 2010;31(10):839–47. Mohamed OA, Jonnaert M, Labelle-Dumais C, Kuroda K, Clarke HJ. Dufort DJPotNAoS. Uterine Wnt/β-catenin signaling is required for implantation. 2005;102(24):8579–84. Arici A, Oral E, Bukulmez O, Duleba A, Olive DL, Jones EEJF et al. The effect of endometriosis on implantation: results from the Yale University in vitro fertilization and embryo transfer program. 1996;65(3):603–7. Burney RO, Talbi S, Hamilton AE, Vo KC, Nyegaard M, Nezhat CR et al. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis. 2007;148(8):3814–26. van der Horst PH, Wang Y, van der Zee M, Burger CW, Blok LJJM. endocrinology c. Interaction between sex hormones and WNT/β-catenin signal transduction in endometrial physiology and disease. 2012;358(2):176 – 84. Mehdinejadiani S, Amidi F, Mehdizadeh M, Barati M, Pazhohan A, Alyasin A et al. Effects of letrozole and clomiphene citrate on Wnt signaling pathway in endometrium of polycystic ovarian syndrome and healthy women. 2019;100(3):641–8. Nei H, Saito T, Yamasaki H, Mizumoto H, Ito E. Kudo RJMCPicwtUoTMACC. Nuclear localization of β-catenin in normal and carcinogenic endometrium. 1999;25(3):207–18. Pazhohan A, Amidi F, Akbari-Asbagh F, Seyedrezazadeh E, Farzadi L, Khodarahmin M et al. The Wnt/β-catenin signaling in endometriosis, the expression of total and active forms of β-catenin, total and inactive forms of glycogen synthase kinase-3β, WNT7a and DICKKOPF-1. 2018;220:1–5. Tulac S, Overgaard MT, Hamilton AE, Jumbe NL, Suchanek E, Giudice LCJTJCE et al. Dickkopf-1, an inhibitor of Wnt signaling, is regulated by progesterone in human endometrial stromal cells. 2006;91(4):1453–61. Wang Y, Hanifi-Moghaddam P, Hanekamp EE, Kloosterboer HJ, Franken P, Veldscholte J et al. Progesterone inhibition of Wnt/β-catenin signaling in normal endometrium and endometrial cancer. 2009;15(18):5784–93. Liu C, Li Y, Semenov M, Han C, Baeg G-H, Tan Y et al. Control of β-catenin phosphorylation/degradation by a dual-kinase mechanism. 2002;108(6):837–47. Osteen KG, Bruner-Tran KL, Eisenberg EJF. sterility. Reduced progesterone action during endometrial maturation: a potential risk factor for the development of endometriosis. 2005;83(3):529–37. Zanatta A, Rocha AM, Carvalho FM, Pereira RM, Taylor HS, Motta EL et al. The role of the Hoxa10/HOXA10 gene in the etiology of endometriosis and its related infertility: a review. 2010;27:701–10. Matsuzaki S. Darcha CJPo. In vitro effects of a small-molecule antagonist of the Tcf/ß-catenin complex on endometrial and endometriotic cells of patients with endometriosis. 2013;8(4):e61690. Velarde MC, Aghajanova L, Nezhat CR, Giudice LCJE. Increased mitogen-activated protein kinase kinase/extracellularly regulated kinase activity in human endometrial stromal fibroblasts of women with endometriosis reduces 3′, 5′-cyclic adenosine 5′-monophosphate inhibition of cyclin D1. 2009;150(10):4701–12. Santanam N, Kavtaradze N, Murphy A, Dominguez C, Parthasarathy SJTR. Antioxidant supplementation reduces endometriosis-related pelvic pain in humans. 2013;161(3):189–95. Cacciottola L, Donnez J, Dolmans M-MJIJMS. targets? Can endometriosis-related oxidative stress pave the way for new treatment 2021;22(13):7138. Sukan B, Akdevelioğlu Y, Sukan VNJCNR. Effect of antioxidant supplementation on endometriosis-related pain: A systematic review. 2022;11(4):753–64. Tesarik JJB. Towards personalized antioxidant use in female infertility: Need for more molecular and clinical studies. 2021;9(12):1933. Maleki-Hajiagha A, Shafie A, Maajani K, Amidi F. Effect of astaxanthin supplementation on female fertility and reproductive outcomes: a systematic review and meta-analysis of clinical and animal studies. J ovarian Res. 2024;17(1):163. Yousry MJJA, Chemistry F. Antioxidant activities of astaxanthin and related carotenoids. 2000;48(4):1150–4. Kohandel Z, Farkhondeh T, Aschner M, Pourbagher-Shahri AM, Samarghandian SJB. Pharmacotherapy. Anti-inflammatory action of astaxanthin and its use in the treatment of various diseases. 2022;145:112179. Li J, Dai W, Xia Y, Chen K, Li S, Liu T et al. Astaxanthin inhibits proliferation and induces apoptosis of human hepatocellular carcinoma cells via Inhibition of NF-κB P65 and Wnt/β-catenin in vitro. 2015;13(10):6064–81. Kavitha K, Kowshik J, Kishore TKK, Baba AB. Nagini SJBeBA-GS. Astaxanthin inhibits NF-κB and Wnt/β-catenin signaling pathways via inactivation of Erk/MAPK and PI3K/Akt to induce intrinsic apoptosis in a hamster model of oral cancer. 2013;1830(10):4433–44. Kowshik J, Nivetha R, Ranjani S, Venkatesan P, Selvamuthukumar S, Veeravarmal V et al. Astaxanthin inhibits hallmarks of cancer by targeting the PI3K/NF-κΒ/STAT3 signalling axis in oral squamous cell carcinoma models. 2019;71(10):1595–610. Rostami S, Alyasin A, Saedi M, Nekoonam S, Khodarahmian M, Moeini A et al. Astaxanthin ameliorates inflammation, oxidative stress, and reproductive outcomes in endometriosis patients undergoing assisted reproduction: A randomized, triple-blind placebo-controlled clinical trial. 2023;14:1144323. Faraone I, Sinisgalli C, Ostuni A, Armentano MF, Carmosino M, Milella L et al. Astaxanthin anticancer effects are mediated through multiple molecular mechanisms: A systematic review. 2020;155:104689. Canis M, Donnez JG, Guzick DS, Halme JK, Rock JA, Schenken RS et al. Revised american society for reproductive medicine classification of endometriosis: 1996. 1997;67(5):817–21. Fassbender A, Rahmioglu N, Vitonis AF, Vigano P, Giudice LC, D’Hooghe TM et al. World endometriosis research foundation endometriosis phenome and biobanking harmonisation project: IV. Tissue collection, processing, and storage in endometriosis research. 2014;102(5):1244–53. Noyes R, Hertig A, Rock JJO, Survey G. Dating endometrial biopsy. 1950;5(4):561–4. The Istanbul consensus workshop on embryo assessment: proceedings of an expert meeting. Human reproduction (Oxford, England). 2011;26(6):1270-83. Pazhohan A, Danaei-Mehrabad S, Mohamad-Rezaeii Z, Amidi F, Khodarahmian M, Shabani Nashtaei M et al. The modulating effects of vitamin D on the activity of β-catenin in the endometrium of women with endometriosis: a randomized exploratory trial. 2021;37(3):278–82. Kim SH, Kim HJN. Inhibitory effect of astaxanthin on gene expression changes in Helicobacter pylori-infected human gastric epithelial cells. 2021;13(12):4281. Gharaei R, Alyasin A, Mahdavinezhad F, Samadian E, Ashrafnezhad Z, Amidi FJJAR et al. Randomized controlled trial of astaxanthin impacts on antioxidant status and assisted reproductive technology outcomes in women with polycystic ovarian syndrome. 2022;39(4):995–1008. Lu X, Wu Z, Wang M, Cheng WJJIMR. Effects of vitamin C on the outcome of in vitro fertilization–embryo transfer in endometriosis: A randomized controlled study. 2018;46(11):4624–33. Mier-Cabrera J, Genera-García M, De la Jara-Díaz J, Perichart-Perera O, Vadillo-Ortega F, Hernández-Guerrero CJIJG et al. Effect of vitamins C and E supplementation on peripheral oxidative stress markers and pregnancy rate in women with endometriosis. 2008;100(3):252–6. Achache H, Revel AJH. Endometrial receptivity markers, the journey to successful embryo implantation. 2006;12(6):731–46. Teklenburg G, Salker M, Molokhia M, Lavery S, Trew G, Aojanepong T et al. Natural selection of human embryos: decidualizing endometrial stromal cells serve as sensors of embryo quality upon implantation. 2010;5(4):e10258. Additional Declarations No competing interests reported. Supplementary Files WesternBlotOriginalImagesFig3Uncropped.zip Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 26 Mar, 2026 Editor assigned by journal 23 Mar, 2026 Editor invited by journal 02 Mar, 2026 Submission checks completed at journal 27 Feb, 2026 First submitted to journal 27 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8971122","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":612928080,"identity":"bcbf336f-a643-4cb1-bb46-6f6aedae1deb","order_by":0,"name":"Sahar Rostami","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sahar","middleName":"","lastName":"Rostami","suffix":""},{"id":612928082,"identity":"3b8ff090-70c6-4a03-8a1a-1300e97f06f4","order_by":1,"name":"Ashraf Aleyasin","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ashraf","middleName":"","lastName":"Aleyasin","suffix":""},{"id":612928086,"identity":"dfd7112a-abe5-4560-9df2-2330a506461e","order_by":2,"name":"Saeid Nekoonam","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Saeid","middleName":"","lastName":"Nekoonam","suffix":""},{"id":612928087,"identity":"7a1ea72c-c86e-4313-a204-7fee1f18a9bb","order_by":3,"name":"Anahid Shafie","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Anahid","middleName":"","lastName":"Shafie","suffix":""},{"id":612928088,"identity":"7428aa73-60ac-41a1-bfaa-b24a4be67f8d","order_by":4,"name":"Mojtaba Saedi","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mojtaba","middleName":"","lastName":"Saedi","suffix":""},{"id":612928094,"identity":"e7121b96-a846-469d-846b-a498ca2d9c00","order_by":5,"name":"Fardin Amidi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYBAC9gYGhgM8BjYMbCjCCXi08BwAa0mDaDlArBYGHobDEN4BPCoRWthPJx54U3Denk+6+QHzx7Zt9gzshx8wPNyDRwtP7oaDcwxuJ7bJHDNgONh2O7GBJ82AIeEZbi32DLkbDvMY3E5gk0gAawH6IgfoFzxO5OF/C9Jyzp5NIv0DSIs9A/8bAlokwLYcYGyTyAHbwtggQcgWibcgvyQnArUUHDhzDugpiWcGB/A7LHfzhzd/7OzlZ6RvfFBRdtuenz/54cMfeLSgALA6NgYi42cUjIJRMApGAW4AACvjVAgpzeC8AAAAAElFTkSuQmCC","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Fardin","middleName":"","lastName":"Amidi","suffix":""}],"badges":[],"createdAt":"2026-02-25 20:38:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8971122/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8971122/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105807583,"identity":"b42e13a1-2561-4798-acfa-36a77c5d2fbb","added_by":"auto","created_at":"2026-03-31 10:43:00","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":94472,"visible":true,"origin":"","legend":"\u003cp\u003eCONSORT flow diagram of the RCT in infertile women with endometriosis\u003c/p\u003e\n\u003cp\u003eFlow of participants through the study. Of 73 patients assessed for eligibility, 57 were randomized to receive Astaxanthin (AST, n = 28) or placebo (n = 29). During follow-up, some conceived naturally (n = 2 per group) or were excluded due to COVID-19 infection (AST: n = 1; placebo: n = 2). A total of 25 participants per group were included in the final analysis. AST, Astaxanthin group.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8971122/v1/02431eb2515664e63a24dc6d.jpg"},{"id":105807584,"identity":"b875d2d3-24b6-4bf3-9838-ab1c397fd05f","added_by":"auto","created_at":"2026-03-31 10:43:00","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":134806,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression of Wnt/β-catenin pathway components in infertile women with endometriosis receiving AST or placebo before and after intervention\u003c/p\u003e\n\u003cp\u003eExpression levels of CTB (β-catenin), GSK (GSK-3β), DKK (DKK-1), and WNT (WNT-7a) were measured by qRT-PCR. Values are normalized to GAPDH and presented as mean ± SD. Comparisons were made between baseline and post-intervention within each group and between AST (n = 25) and placebo (n = 25) groups. *p \u0026lt; 0.05 indicates statistically significant difference. AST, Astaxanthin group; CTB, β-catenin; GSK, GSK-3β; DKK, DKK-1; WNT, WNT-7a; SD, standard deviation.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8971122/v1/8c95854651bcb3464f080e02.jpg"},{"id":105904708,"identity":"e4f53531-2e1d-48b9-a5c9-7549c7a5640b","added_by":"auto","created_at":"2026-04-01 10:10:21","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":75912,"visible":true,"origin":"","legend":"\u003cp\u003eProtein expression of total β-catenin (92 kDa) and inactive β-catenin (phosphorylated at Ser33/Ser37/Thr41 residues, a degradation-associated form) in the endometrium of infertile women with endometriosis receiving AST or placebo before and after supplementation\u003c/p\u003e\n\u003cp\u003e(A) Representative Western blot images of total β-catenin (CTB), phosphorylated β-catenin (p-CTB), and β-actin (43 kDa) as an internal control. (B) Quantitative analysis of protein levels normalized to β-actin. Data are presented as mean ± SD. Comparisons were made between pre- and post-supplementation within each group and between AST (n = 25) and placebo (n = 25) groups. *p \u0026lt; 0.05 indicates statistically significant differences. AST, Astaxanthin group; CTB, Total β-catenin; p-CTB, Phosphorylated β-catenin (inactive, Ser33/Ser37/Thr41); β-actin, Loading control; SD, standard deviation. Full-length uncropped blots are provided in Supplementary File “WB_Fig1-4_Uncropped.”\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8971122/v1/fd77265f4a10315a4b59d8f0.jpg"},{"id":105807585,"identity":"37a02ddd-1f63-46cb-a693-fe21e22bc1a6","added_by":"auto","created_at":"2026-03-31 10:43:00","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":93775,"visible":true,"origin":"","legend":"\u003cp\u003eOverview of the main findings\u003c/p\u003e\n\u003cp\u003eThis schematic summarizes the key effects observed in the study: Astaxanthin (AST) supplementation modulated Wnt/β-catenin signaling in the eutopic endometrium, leading to decreased total and inactive β-catenin levels compared to placebo. Molecular changes are illustrated, highlighting the potential therapeutic role of AST in endometriosis-related infertility. Detailed values and statistical analyses are presented in Figures 2 and 3. AST, Astaxanthin group.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8971122/v1/13f86c88bf66b5c27fb427cd.jpg"},{"id":105908418,"identity":"0a2dfa38-0bb5-4b50-941b-1926f287ebfd","added_by":"auto","created_at":"2026-04-01 10:37:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1276513,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8971122/v1/6f87bb11-238f-407d-bf0c-4b1f6ee6c5d8.pdf"},{"id":105807536,"identity":"be558821-5b54-4771-8db0-1c98c6b5af9c","added_by":"auto","created_at":"2026-03-31 10:42:52","extension":"zip","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":442505,"visible":true,"origin":"","legend":"","description":"","filename":"WesternBlotOriginalImagesFig3Uncropped.zip","url":"https://assets-eu.researchsquare.com/files/rs-8971122/v1/18a2ff5583cbef2ca3045eff.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Astaxanthin Therapy in Women with Advanced Endometriosis: A Randomized Controlled Trial with Exploratory Analysis of Endometrial Wnt/β-Catenin Signaling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEndometriosis, the presence of functional endometrial tissue (glands and stroma) outside the uterine cavity, is a multifaceted, estrogen-dependent disease commonly associated with dysmenorrhea and infertility, with significant impact on women\u0026rsquo;s reproductive health and quality of life [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Chronic inflammation and hormonal dysregulation are key drivers of its pathophysiology, yet the mechanisms linking endometriosis to impaired fertility remain insufficiently understood [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Recent studies indicate that complex molecular, cellular, and hormonal interactions may underlie the reduced reproductive success observed in affected women [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Additionally, pelvic anatomical abnormalities, alterations in the peritoneal fluid environment, irregular ovulation with diminished ovarian reserve, impaired endometrial receptivity, and dyspareunia limiting regular intercourse can further decrease the likelihood of natural conception [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEven women with minimal endometriosis exhibit a noticeable decline in implantation rates during natural cycles or assisted reproductive technology (ART) treatments [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. These patients also display molecular and functional abnormalities in the eutopic endometrium during the window of implantation [\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Several signaling pathways are disrupted in endometriosis, creating an unfavorable environment at the maternal\u0026ndash;embryo interface [\u003cspan additionalcitationids=\"CR13 CR14 CR15\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAmong these, the Wnt/β-catenin pathway plays a key role in immune regulation, endometrial remodeling, and implantation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. It also coordinates essential uterine\u0026ndash;embryo interactions required for implantation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and serves as a major reproductive regulator in mammals [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. During early pregnancy, several Wnt genes (Wnt2, 3, 4, 5a, 7a, 7b, 10b) support the survival, proliferation, and differentiation of endometrial stromal cells [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Bioinformatics analyses further highlight Wnt/β-catenin, NOTCH, and immune pathways as top processes linked to RIF, with Wnt and NOTCH also modulating immune cell activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Dysregulated Wnt/β-catenin signaling contributes to infertility, endometriosis, endometrial cancer, and gestational disorders such as complete mole and choriocarcinoma [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Experimental evidence shows that Wnt/β-catenin activity is temporally regulated in the uterus and depends on the presence of the blastocyst, and its disruption impairs implantation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUnsuccessful implantation in endometriosis patients is associated with a non-receptive endometrium during the mid-luteal phase, primarily due to progesterone resistance [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Estrogen and progesterone regulate endometrial proliferation, embryo implantation, placentation, decidualization, and folliculogenesis partly through modulation of the Wnt/β-catenin signaling pathway [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. During the proliferative phase, estrogen activates Wnt/β-catenin signaling, promoting β-catenin translocation to the nucleus [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In contrast, the mid-luteal increase in progesterone inhibits Wnt/β-catenin signaling via dickkopf Wnt signaling pathway inhibitor 1 (DKK1) and Forkhead box protein O1 (FOXO1), thereby triggering cellular differentiation and preparing the endometrium for embryo implantation [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In the absence of Wnt ligands, β-catenin is phosphorylated and ubiquitinated by the destruction complex, which includes Axin, glycogen synthase kinase 3 beta (GSK3-β), and adenomatous polyposis coli (APC). Binding of Wnt ligands to Frizzled (Fz) receptors disrupts this complex and stabilizes β-catenin [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In endometriosis patients, resistance to progesterone leads to abnormal activation of the Wnt/β-catenin signaling pathway during the mid-luteal phase, resulting in the overexpression of Wnt target genes involved in endometrial receptivity [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], such as Hoxa10 [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], certain matrix metalloproteinases (MMP-9 and MMP-2) [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], and Cyclin D1 [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. These molecular events contribute to a persistent proliferative phenotype and impaired decidualization in the endometrium during the implantation window [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Consequently, targeting the Wnt/β-catenin pathway may represent a promising strategy for the treatment and prevention of endometriosis [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOngoing research is exploring the potential benefits of antioxidant supplementation in reducing symptoms and improving outcomes for patients with endometriosis [\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Antioxidants have been extensively studied for their ability to enhance pregnancy outcomes in women experiencing infertility [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Astaxanthin (AST) is a red-orange, lipid-soluble xanthophyll photo-pigmented ketocarotenoid derived from the alga \u003cem\u003eHaematococcus pluvialis\u003c/em\u003e. It possesses antioxidant activity that is ten times stronger than other natural carotenoids [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Apart from its potent capacity to neutralize singlet oxygen, this dietary bioactive compound has demonstrated significant immunomodulatory, anti-inflammatory, anti-proliferative, anti-apoptotic, anti-diabetic, and neuroprotective properties [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAST targets multiple signaling pathways, including PI3K/Akt, JAK2/STAT3, NF-κB, MAPKs, Nrf2/HO-1, and PPARγ, and has been shown to help maintain the balance between oxidants and antioxidants [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Studies have reported that AST can inhibit cell proliferation and induce apoptosis by reducing the p-Akt/Akt ratio, thereby modulating downstream pathways such as NF-κB, Wnt/β-catenin, and JAK/STAT3 in different cancer cell types [\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In a previous clinical investigation, we observed that 12 weeks of AST supplementation reduced oxidative stress and inflammation and improved certain initial ART outcomes in patients with endometriosis. Despite these promising findings, the specific effects of AST on endometrial function and implantation remain unclear [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlthough preclinical studies have suggested that AST can modulate Wnt/β-catenin signaling [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], clinical evidence evaluating its effects on endometrial signaling or implantation-related pathways in women with endometriosis is lacking. To address this gap, we conducted a randomized, placebo-controlled trial to explore the impact of AST supplementation on Wnt/β-catenin pathway components in the eutopic endometrium of women with advanced endometriosis undergoing ART. Our aim was to investigate whether AST may influence key mediators of Wnt/β-catenin signaling and provide preliminary insights into its potential effects on the endometrial molecular environment. We hypothesized that AST supplementation could help normalize aberrant pathway activity, offering a foundation for future studies on endometrial receptivity and reproductive outcomes.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy population\u003c/h2\u003e \u003cp\u003eThe study design, randomization, blinding, and trial procedures have been described in detail previously [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Briefly, this randomized, triple-blind, placebo-controlled trial with a 1:1 allocation ratio was conducted at Omid Fertility Clinic. A total of 50 women with moderate to severe endometriosis, diagnosed according to the criteria of the American Society of Reproductive Medicine (ASRM) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], were enrolled. Eligible participants were between 20 and 40 years of age, had infertility associated with stage III/IV endometriosis confirmed by laparoscopy and histopathological evaluation, a BMI of 18.5\u0026ndash;30 kg/m\u0026sup2;, and regular menstrual cycles (defined as cycle lengths between 26 and 32 days).\u003c/p\u003e \u003cp\u003eExclusion criteria were pregnancy, breastfeeding, recent use of hormones or intrauterine device (IUD), ongoing medications or antioxidant therapy, and a history of endometriosis surgery. Block randomization with a block size of 4 was applied to allocate participants into the AST or placebo group. The random allocation sequence was generated by an independent researcher not involved in participant enrollment or clinical procedures, and assignment was secured using sequentially numbered, opaque, sealed envelopes. Triple blinding ensured that patients, clinicians, embryologists, statisticians, and laboratory personnel remained unaware of the group assignments.\u003c/p\u003e \u003cp\u003eBefore and alongside the routine ovarian stimulation protocol, participants received 6 mg daily of oral astaxanthin (AstaReal\u0026reg;; AstaReal Co., Ltd., Tokyo, Japan) or matching placebo capsules for 12 weeks. AST capsules were indistinguishable from placebo capsules in size, shape, color, taste, and packaging, ensuring adequate blinding. This ensured that blinding was robust not only in allocation and labeling but also in capsule appearance and packaging.\u003c/p\u003e \u003cp\u003eSupplementation started on day 1 of the menstrual cycle two months before controlled ovarian stimulation (COS) and continued until the day of oocyte pick-up, ensuring no washout period or treatment overlap ambiguities. Adherence and adverse effects were monitored through regular phone calls and clinical visits.\u003c/p\u003e \u003cp\u003eThe Consolidated Standards of Reporting Trials (CONSORT) diagram \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e shows the distribution of participants through the trial [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. No significant changes to the trial methods, including eligibility criteria, interventions, or outcome assessments, or to the trial outcomes, including primary and secondary endpoints, were made after the study commenced. No interim analyses or stopping guidelines were applied in this trial.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEutopic endometrium sample collection\u003c/h3\u003e\n\u003cp\u003eSample collection followed the World Endometriosis Research Foundation EPHect standard operating procedures for the collection, processing, and storage of eutopic endometrial tissue [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Endometrial biopsies were obtained on day LH\u0026thinsp;+\u0026thinsp;7, corresponding to the mid-luteal phase, as determined by urinary LH surge testing, using a Pipelle curette (Medbar Ltd., Izmir, Turkey). All biopsies were performed by the same experienced gynecologist to avoid inter-operator variability.\u003c/p\u003e \u003cp\u003eEach biopsy sample was divided into three portions. The first portion was rinsed with sterile cold phosphate-buffered saline (PBS) and promptly snap-frozen in liquid nitrogen within 2\u0026ndash;3 minutes after biopsy for Western blot (WB) analysis. The second portion was placed in RNAlater (QIAGEN) and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for RNA extraction. The third portion was fixed in formalin for histological dating and confirmation of endometriotic features. Histological evaluation according to Noyes\u0026rsquo; criteria [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] confirmed mid-luteal phase morphology, characterized by coiled and dilated glands with subnuclear vacuolization in the epithelium. The stroma was densely cellular with inflammatory cell infiltration, consistent with advanced-stage endometriosis, and all slides were independently reviewed in a blinded manner by two experienced pathologists to minimize inter-observer bias/variability.\u003c/p\u003e\n\u003ch3\u003eCOS protocol\u003c/h3\u003e\n\u003cp\u003eThe protocol for ovulation induction has been described previously [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. In summary, all patients underwent a flexible GnRH antagonist regimen. Recombinant follicle-stimulating hormone (rFSH; 150\u0026ndash;300 IU/day, Gonal-F\u0026reg;, Merck Serono SA, Switzerland) was administered daily from the beginning of the cycle until final oocyte maturation was triggered with 10,000 IU of human chorionic gonadotropin (hCG; Ovitrelle\u0026reg;, Merck Serono SA, Switzerland). Follicular development was monitored by transvaginal ultrasonography. Once \u0026ge;\u0026thinsp;2 follicles reached 14 mm, Cetrorelix acetate (Cetrotide) was initiated and discontinued when \u0026ge;\u0026thinsp;2 follicles reached 18 mm. Final oocyte maturation was induced with hCG, and oocyte retrieval was performed 36 hours later under ultrasound guidance. All participants underwent intracytoplasmic sperm injection (ICSI). Embryos were cryopreserved on day 3 or day 5, and 2\u0026ndash;3 embryos were transferred in subsequent frozen cycles, in accordance with ASEBIR guidelines [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. If only one embryo was available, single embryo transfer (SET) was performed.\u003c/p\u003e\n\u003ch3\u003eQuantitative Real-time PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from 30\u0026ndash;50 mg of endometrial tissue using RNX-Plus solution (SinaClon, Iran), following the manufacturer\u0026rsquo;s instructions. RNA concentration and purity were assessed with a WPA spectrophotometer (Biochrom). Samples with A260/280 ratio between 1.8\u0026ndash;2.0 and RNA Integrity Number (RIN)\u0026thinsp;\u0026ge;\u0026thinsp;7 were considered acceptable for downstream analysis. cDNA synthesis was performed using the AddScript cDNA Synthesis Kit (AddBio Inc., South Korea) with random hexamer and oligo dT primers.\u003c/p\u003e \u003cp\u003ePrimers were designed using AlleleID 6.0 software and synthesized by Pishgam Biotechnology (Iran). Sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each 25 \u0026micro;l PCR reaction contained 12.5 \u0026micro;l RealQ Plus 2x Master Mix Green High ROX\u0026trade; (Ampliqon, Denmark), 0.5 \u0026micro;l of each primer, 1 \u0026micro;l cDNA template (diluted 1:6), and 10.5 \u0026micro;l nuclease-free water.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for quantitative real-time polymerase chain reaction (qRT-PCR)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCTB1-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGGACAAGCCACAAGATTACAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCTB1-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAGCAGTCTCATTCCAAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGSK3-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCTCCTCATTGCCACCTTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGSK3-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACAGACTCCACTTCCGAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDKK1-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGTTGTTACTGTGGAGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDKK1-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAAGAATTACTGGCTTGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWNT-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGTGGTGGGTGGTCATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWNT-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGACACGCAGGCAATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAPC-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCACTCCACAACATCATTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAPC-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAACAGGTTTCACAGTAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCD44-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAACGAATCCTGAAGACATCTACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCD44-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACCTCCTGAAGTGCTGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTCCACTGGCGTCTTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCTTGAGGCTGTTGTCATACTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eCTB1: β-catenin; GSK3: glycogen synthase kinase-3β; DKK1: dickkopf-1; WNT: wingless/integrated; APC: adenomatous polyposis coli; CD44: cluster of differentiation 44; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; F: forward; R: reverse.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThermocycling conditions were as follows: initial enzyme activation at 95\u0026deg;C for 15 min, followed by 40 cycles of denaturation at 95\u0026deg;C for 15\u0026ndash;30 s, annealing at 60\u0026deg;C for 30 s, and extension at 72\u0026deg;C for 30 s using an ABI 5400 thermal cycler (Applied Biosystems, USA). Fluorescence was recorded during the annealing/extension step of each cycle. Primer efficiency was validated to fall within the acceptable range of 90\u0026ndash;110%, and specificity of amplification was confirmed by melt curve analysis, which demonstrated single sharp peaks without evidence of primer-dimer formation. All reactions were performed in technical duplicates to ensure reproducibility. Gene expression levels were normalized to GAPDH, and relative expression was calculated using the 2\u003csup\u003e\u0026minus;∆Ct\u003c/sup\u003e method.\u003c/p\u003e\n\u003ch3\u003eWestern blot analysis of total and phosphorylated β-catenin\u003c/h3\u003e\n\u003cp\u003eFor Western blot analysis of total and phosphorylated β-catenin, the endometrial samples were lysed with RIPA lysis buffer containing protease and phosphatase inhibitors. Endometrial tissue lysates were prepared in RIPA buffer supplemented with protease and phosphatase inhibitors. Protein concentrations were quantified using the BCA Protein Assay (Beyotime, China). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, MA, USA). Membranes were blocked with 5% BSA and incubated overnight at 4\u0026deg;C with primary antibodies against phosphorylated β-catenin (p-β-catenin (BC-22): sc-57535), total β-catenin (β-catenin (E-5): sc-7963), and β-actin (C4: sc-47778) (all Santa Cruz Biotechnology, CA, USA; 1:300 dilution). After washing, membranes were incubated with HRP-conjugated secondary antibodies (anti-rabbit: sc-2357, anti-mouse: sc-516102; Santa Cruz Biotechnology; 1:1000 dilution) for 1 h at room temperature. Protein band intensities were quantified by densitometry, and all values were normalized to β-actin as the internal loading control to ensure accurate quantification.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eOutcome measures, Sample size and statistical analysis\u003c/h2\u003e \u003cp\u003eThe primary outcome of this trial was β-catenin mRNA expression in the eutopic endometrium, which was assessed using quantitative real-time PCR before and after 12 weeks of AST or placebo supplementation. Secondary outcomes included total and phosphorylated β-catenin protein levels, assessed by Western blot analysis, and implantation rate in subsequent ART cycles. All molecular analyses were performed on endometrial biopsies collected in the mid-luteal phase, and implantation outcomes were recorded during the first frozen embryo transfer cycle following the intervention. Based on Pazhohan et al. [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], the calculated sample size (n\u0026thinsp;=\u0026thinsp;50; 25 per group) provided 90% power at α\u0026thinsp;=\u0026thinsp;0.05 to detect intergroup differences, accounting for a 15% dropout rate. Normality of distribution was tested using the Shapiro\u0026ndash;Wilk test. For parametric data, Student\u0026rsquo;s t-test was used. Paired t-tests compared pre- and post-intervention data within groups, and independent t-tests compared post-intervention data between groups. Non-parametric variables were analyzed with the Mann\u0026ndash;Whitney U test. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD), with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant. Analyses were performed with SPSS v22.0 (SPSS Inc., Chicago, IL, USA), and figures were prepared with GraphPad software.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eComparison of Implantation Rates Between Groups\u003c/h3\u003e\n\u003cp\u003eThe implantation rate (the number of sacs seen on ultrasound/ number of embryos transferred \u0026times; 100) was compared between the two groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Ethics Committee of Tehran University of Medical Sciences (approval code: IR.TUMS.MEDICINE.REC.1400.1085; December 19, 2021) and conducted in accordance with the Declaration of Helsinki. The trial was registered with the Iranian Registry of Clinical Trials (IRCT20220625055274N1; 2022-09-03). This paper presents only a part of the IRCT registered clinical trial outcomes. Written informed consent was obtained from all participants prior to enrollment, including consent for the use of endometrial samples before and after the intervention and for publication of the study findings and associated data. All data were processed confidentially and fully anonymized to protect participant privacy.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eBaseline characteristics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll participants completed the trial. Demographic and clinical characteristics of the study population have been reported previously [48]. Throughout the trial, no adverse effects or signs of toxicity related to AST supplementation were clinically observed, and participants demonstrated good compliance with the intervention protocol. Compliance was evaluated at each follow-up visit by pill count, complemented with patient self-reports during scheduled phone calls, and adherence \u0026ge;80% was considered acceptable. As described in the earlier report, the two groups did not differ significantly with respect to age, BMI, or other baseline characteristics. Based on pill counts of returned bottles, the adherence rates were 91% in the AST group and 94% in the placebo group. No adverse events or side effects related to AST or placebo supplementation were observed during the trial.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emRNA expression of Wnt signaling pathway genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of Wnt signaling pathway genes in endometrial tissue was assessed using qPCR \u003cstrong\u003e(Fig. 2)\u003c/strong\u003e. Before the intervention, no significant differences were observed between the AST and placebo groups (all P \u0026gt; 0.05).\u003c/p\u003e\n\u003cp\u003eFollowing the intervention, \u0026beta;-catenin expression was significantly lower in the AST group compared with the placebo group (P = 0.005). In contrast, GSK-3\u0026beta; (P = 0.019) and DKK-1 (P = 0.023) expression levels were significantly higher in the AST group than in the placebo group. No significant differences were detected between the groups in the expression of WNT-7a (P = 0.218), APC (P = 0.149), or CD44 (P = 0.607).\u003c/p\u003e\n\u003cp\u003eIn the AST group, \u0026beta;-catenin expression decreased significantly after the intervention compared with baseline (P = 0.041). These changes were accompanied by significant increases in GSK-3\u0026beta; (P = 0.009) and DKK-1 (P = 0.042) expression levels. In addition, CD44 expression was significantly reduced following the intervention compared with baseline (P = 0.021). No significant changes were observed in WNT-7a (P = 0.248) or APC (P = 0.689) expression in the AST group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein expression level of total and phosphorylated \u0026beta;-catenin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein expression of total and phosphorylated \u0026beta;-catenin was assessed to compare the AST and placebo groups following the intervention. As shown in \u003cstrong\u003eFig. 3\u003c/strong\u003e, no significant difference was detected in total \u0026beta;-catenin protein levels between the two groups (P = 0.626). In contrast, phosphorylated (inactive) \u0026beta;-catenin expression was significantly higher in the AST group compared with the placebo group (P = 0.042).\u003c/p\u003e\n\u003cp\u003eIn the AST group, total \u0026beta;-catenin protein levels remained unchanged after the intervention (P = 0.962), whereas phosphorylated \u0026beta;-catenin levels increased significantly compared with baseline (P = 0.006). In the placebo group, no significant change in phosphorylated \u0026beta;-catenin expression was observed before and after the intervention (P = 0.080).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe Effect of AST on Implantation Rate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe implantation rate (the number of sacs seen on ultrasound/ number of embryos transferred \u0026times; 100) was compared between the two groups \u003cstrong\u003e(Table 2)\u003c/strong\u003e. The results showed no statistically significant difference in the implantation rate between the treatment group and the placebo group (P = 0.441).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Effect of AST supplementation on implantation outcomes in the AST and placebo group\u003c/p\u003e\n\u003cdiv align=\"left\"\u003e\n \u003ctable dir=\"rtl\" border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eP values\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003ePlacebo\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eAST\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 188px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.394\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.7600\u0026plusmn;0.8306\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.9200\u0026plusmn;0.7023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 188px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eNumber of sacs seen on ultrasound\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.424\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.0400\u0026plusmn;0.7348\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.2400\u0026plusmn;0.4358\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 188px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eNumber of embryos transferred\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 156px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.4200\u0026plusmn;0.0674\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.3333\u0026plusmn;0.0726\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 188px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e*Implantation rate (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eData are presented as mean \u0026plusmn; SD or percentage, as appropriate. Implantation rate (%) was calculated as: (number of gestational sacs observed on ultrasound 2 weeks after embryo transfer \u0026divide; number of transferred embryos) \u0026times; 100. AST, Astaxanthin group; SD, standard deviation.\u003c/p\u003e\n\u003cp\u003eThe Graphical Abstract summarizes the main findings of this study \u003cstrong\u003e(Fig. 4)\u003c/strong\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this randomized, triple-blind, placebo-controlled trial, we investigated the impact of AST supplementation on Wnt/\u0026beta;-catenin signaling in the eutopic endometrium of infertile women with endometriosis undergoing ART. Our findings demonstrated that 12 weeks of AST supplementation (6 mg/day) significantly downregulated \u0026beta;-catenin mRNA expression while upregulating GSK-3\u0026beta; and DKK-1 expression. At the protein level, phosphorylated (inactive) \u0026beta;-catenin was elevated, whereas total \u0026beta;-catenin remained unchanged. Additionally, CD44 expression was significantly reduced. Collectively, these results suggest that AST modulates Wnt/\u0026beta;-catenin signaling toward an inhibitory profile, potentially improving endometrial receptivity.\u003c/p\u003e\n\u003cp\u003eProgesterone resistance in endometriosis patients leads to aberrant activation of the Wnt/\u0026beta;-catenin signaling pathway, contributing to the over-expression of genes responsible for regulating the receptivity of the endometrium [34]. In a case-control study, Pazhohan et al. [30] reported that the abnormal activation of the Wnt/\u0026beta;-catenin signaling pathway in the secretory phase of the menstrual cycle in endometriosis patients is characterized by excessive inactivation of GSK-3\u0026beta; and suppression of DKK-1 expression. In another prospective study [54], the same team reported that the expression of the active form of \u0026beta;-catenin in the endometrial cells of endometriosis patients reduced significantly after 12-14 weeks of vitamin D supplementation. In our study, AST administration could significantly decrease the expression level of \u0026beta;-catenin. However, the inactive form of \u0026beta;-catenin significantly increased in the treatment group after the intervention. A significant increase in the expression levels of GSK-3\u0026beta; and DKK-1 was also observed in the treatment group. The expression level of CD44 showed a significant decrease after intervention as well.\u003c/p\u003e\n\u003cp\u003eTo date, no studies have directly examined the effects of AST on endometriosis or endometrial tissue; thus, much of the available evidence regarding its role in Wnt/\u0026beta;-catenin signaling is derived from cancer and other pathological models. AST has been found to hinder the growth of cancer cells and promote cell death in various types of carcinoma cells\u0026nbsp;[45, 46]. It achieves this by reducing the ratio of phosphorylated Akt to total Akt, thereby suppressing the downstream signaling pathways of Akt, including NF-\u0026kappa;B, Wnt, and STAT3. In a study on human hepatocellular carcinoma cells, Li et al [45] showed that AST could cause apoptosis of tumor cells and inhibit cell proliferation by decreasing the mRNA and protein levels of GSK-3\u0026beta; and \u0026beta;-catenin in a dose-dependent manner. The levels of inactive GSK-3\u0026beta; were consistently decreased, indicating a reduction in the nuclear transfer of \u0026beta;-catenin. In a study involving a hamster model of oral cancer, Kavitha et al. [46] found that AST could exert chemopreventive effects by inhibiting Wnt signaling. This inhibition was achieved by blocking the phosphorylation of GSK-3\u0026beta;, the key signaling kinase. The researchers also proposed that AST may deactivate the upstream signaling kinases Erk/Akt, thereby mediating the inhibition of these pathways. Although cancer-model studies reported decreases in both GSK-3\u0026beta; and \u0026beta;-catenin after AST treatment, the opposite pattern observed in our endometrial samples likely reflects context-dependent effects related to tissue type, experimental design, and molecular endpoints measured. AST treatment is also capable of suppressing \u003cem\u003eH. pylori\u003c/em\u003e-induced activation of the oncogenic Wnt/\u0026beta;-catenin pathway in human gastric epithelial cells by increasing the \u0026beta;-catenin entry into the nucleus [55]. These discrepancies highlight the importance of tissue-specific regulatory mechanisms when interpreting AST\u0026rsquo;s effects on Wnt/\u0026beta;-catenin signaling.\u003c/p\u003e\n\u003cp\u003eIn the current and previous study [48], AST supplementation showed notable regulatory effects on oxidative stress, inflammatory markers, gene expression, and several ART outcomes, including the number and maturity of oocytes and embryo quality. However, no significant differences were observed between the groups in implantation rate or in chemical and clinical pregnancy rates, which are considered key ART outcomes. Compatible with our results, in an RCT carried out by Gharaei et al. [56], no significant differences were reported regarding pregnancy outcomes after AST treatment. This is also in agreement with Lu et al. [57] who demonstrated no significant differences in implantation rate after a 3-month Vitamin C therapy on infertile endometriosis patients. Mier-Cabrera et al. [58] also showed no remarkable changes in pregnancy rates among endometriosis patients who took vitamins C and E supplementation for 6 months. These findings suggest that successful implantation reflects the efficiency of the whole culture system in an ART setting and requires a complex sequence of signaling events, involving the acquisition of adhesive ligands and loss of inhibitory components that are crucial for initiating pregnancy [59]. This process also relies on a receptive endometrium, a viable embryo, and a coordinated dialogue between maternal tissues and the embryo during the blastocyst stage [60]. The quality of the embryos, the age of the woman, the presence of any underlying fertility issues, and the specific protocols and techniques used during the ART procedure can also affect the chance of successful implantation [18]. Several other variables affect pregnancy outcomes. Male gamete status, embryologist and clinician skills in embryo transfer (ET), and effects of cryopreservation in frozen ET cycles can have crucial impacts on ART outcomes. Additional research involving a larger number of participants may be necessary to compare the outcomes between fresh and frozen cycles.\u003c/p\u003e\n\u003cp\u003eTo the best of our knowledge, this is the first randomized controlled trial evaluating the effects of AST supplementation on the eutopic endometrium and implantation in infertile patients with endometriosis. The randomized, triple-blind design minimized bias, ensured comparability between groups, reduced potential confounding factors, and strengthened the overall validity of the study. The trial included participants from across the country, all of whom received standardized treatment protocols. Adherence and potential side effects were closely monitored through regular phone calls and clinical visits, ensuring protocol compliance and providing important safety and tolerability data.\u003c/p\u003e\n\u003cp\u003eNevertheless, several limitations should be acknowledged. The relatively small sample size may have limited our ability to detect subtle changes in response to AST, and a larger cohort is needed to fully evaluate ART outcomes. The study population was restricted to patients with moderate-to-severe endometriosis, which may limit the generalizability of the findings to other stages or broader patient populations. Additionally, live birth rate (LBR), the most relevant ART success endpoint, was not analyzed. Future studies should consider measuring serum or plasma AST levels and its oxidation products, as well as performing kinase activity assays and detailed analyses of phosphorylated protein forms to clarify mechanistic effects. Although we did not directly assess TCF/LEF transcriptional activity or nuclear translocation of \u0026beta;-catenin, the coordinated changes in \u0026beta;-catenin phosphorylation status and upstream regulatory components strongly support functional attenuation of canonical Wnt signaling. Furthermore, our analysis was restricted to frozen ICSI cycles and did not include outcomes from fresh cycles\u003cspan dir=\"RTL\"\u003e. Ultimately, these findings may not be generalizable to all patients with endometriosis, but they are relevant to infertile individuals with moderate-to-severe disease undergoing assisted reproduction.\u003c/span\u003e\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur findings demonstrate that astaxanthin (AST) modulates Wnt/\u0026beta;-catenin signaling in the eutopic endometrium of women with advanced endometriosis, suggesting a potential role in restoring endometrial molecular balance. Although clinical reproductive outcomes were not assessed in this study, AST may represent a promising dietary adjunct for correcting endometrial signaling abnormalities associated with endometriosis. Further research is warranted to evaluate its long-term molecular effects and potential implications for fertility.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eWnt \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Wingless-related integration site\u003c/p\u003e\n\u003cp\u003e\u0026beta;-catenin \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Beta-catenin\u003c/p\u003e\n\u003cp\u003eART \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Assisted Reproductive Techniques / Technologies\u003c/p\u003e\n\u003cp\u003eAST \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Astaxanthin\u003c/p\u003e\n\u003cp\u003ePCR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Polymerase Chain Reaction\u003c/p\u003e\n\u003cp\u003eGSK-3\u0026beta; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Glycogen Synthase Kinase 3 Beta\u003c/p\u003e\n\u003cp\u003eDKK-1 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Dickkopf Wnt Signaling Pathway Inhibitor 1\u003c/p\u003e\n\u003cp\u003eCD44 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Cluster of Differentiation 44\u003c/p\u003e\n\u003cp\u003eRIF \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Recurrent Implantation Failure\u003c/p\u003e\n\u003cp\u003eFOXO1 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Forkhead Box Protein O1\u003c/p\u003e\n\u003cp\u003eAxin \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Axis Inhibition Protein\u003c/p\u003e\n\u003cp\u003eAPC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Adenomatous Polyposis Coli\u003c/p\u003e\n\u003cp\u003eFz \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Frizzled\u003c/p\u003e\n\u003cp\u003eNF-\u0026kappa;B \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Nuclear Factor Kappa-light-chain-enhancer of Activated B Cells\u003c/p\u003e\n\u003cp\u003eRCT \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Randomized Controlled Trial\u003c/p\u003e\n\u003cp\u003eIUD \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Intrauterine Device\u003c/p\u003e\n\u003cp\u003eCOS \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Controlled Ovarian Stimulation\u003c/p\u003e\n\u003cp\u003eCONSORT \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Consolidated Standards of Reporting Trials\u003c/p\u003e\n\u003cp\u003eLH \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Luteinizing Hormone\u003c/p\u003e\n\u003cp\u003ePBS \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Phosphate-Buffered Saline\u003c/p\u003e\n\u003cp\u003eWB \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Western Blot\u003c/p\u003e\n\u003cp\u003erFSH \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Recombinant Follicle-Stimulating Hormone\u003c/p\u003e\n\u003cp\u003ehCG \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Human Chorionic Gonadotropin\u003c/p\u003e\n\u003cp\u003eICSI \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Intracytoplasmic Sperm Injection\u003c/p\u003e\n\u003cp\u003eASEBIR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Asociaci\u0026oacute;n para el Estudio de la Biolog\u0026iacute;a de la Reproducci\u0026oacute;n\u003c/p\u003e\n\u003cp\u003eRIN \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;RNA Integrity Number\u003c/p\u003e\n\u003cp\u003ecDNA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Complementary DNA\u003c/p\u003e\n\u003cp\u003eGAPDH \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Glyceraldehyde-3-Phosphate Dehydrogenase\u003c/p\u003e\n\u003cp\u003eRIPA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Radioimmunoprecipitation Assay\u003c/p\u003e\n\u003cp\u003eBCA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Bicinchoninic Acid\u003c/p\u003e\n\u003cp\u003eSDS-PAGE \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Sodium Dodecyl Sulfate\u0026ndash;Polyacrylamide Gel Electrophoresis\u003c/p\u003e\n\u003cp\u003ePVDF \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Polyvinylidene Difluoride\u003c/p\u003e\n\u003cp\u003eBSA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Bovine Serum Albumin\u003c/p\u003e\n\u003cp\u003eHRP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Horseradish Peroxidase\u003c/p\u003e\n\u003cp\u003eICH-GCP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;International Council for Harmonisation \u0026ndash; Good Clinical Practice\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are deeply grateful to Dr. Joerg Schnackenberg, Senior Researcher at Astareal, for his invaluable support throughout this research and his collaborative spirit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eF.A. and A.A. designed the research; S.R. performed the research; S.N. analyzed the data; A.SH. and M.S. contributed new reagents/analytical tools; S.R. wrote the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Medical Research Council of Tehran University of Medical Sciences (grant number 9811113002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available in the Supplementary Files accompanying this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of Tehran University of Medical Sciences (approval code: IR.TUMS.MEDICINE.REC.1400.636; August 15, 2021).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSmolarz B, Szyłło K, Romanowicz H. Endometriosis: epidemiology, classification, pathogenesis, treatment and genetics (review of literature). Int J Mol Sci. 2021;22(19):10554.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonavina G, Taylor HS. Endometriosis-associated infertility: From pathophysiology to tailored treatment. Front Endocrinol (Lausanne). 2022;13:1020827.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYland J, Carvalho LFP, Beste M, Bailey A, Thomas C, Abr\u0026atilde;o MS et al. Endometrioma, the follicular fluid inflammatory network and its association with oocyte and embryo characteristics. 2020;40(3):399\u0026ndash;408.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Ziegler D, Borghese B, Chapron CJTL. Endometriosis and infertility: pathophysiology and management. 2010;376(9742):730\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta S, Goldberg JM, Aziz N, Goldberg E, Krajcir N, Agarwal AJF et al. Pathogenic mechanisms in endometriosis-associated infertility. 2008;90(2):247\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBulletti C, Coccia ME, Battistoni S. Borini AJJoar, genetics. Endometr infertility. 2010;27(8):441\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorton J, Sterrenburg M, Lane S, Maheshwari A, Li TC, Cheong Y. Reproductive, obstetric, and perinatal outcomes of women with adenomyosis and endometriosis: a systematic review and meta-analysis. Hum Reprod Update. 2019;25(5):592\u0026ndash;632.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMay KE, Villar J, Kirtley S, Kennedy SH, Becker CM. Endometrial alterations in endometriosis: a systematic review of putative biomarkers. Hum Reprod Update. 2011;17(5):637\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIgarashi TM, Bruner-Tran KL, Yeaman GR, Lessey BA, Edwards DP, Eisenberg E, et al. Reduced expression of progesterone receptor-B in the endometrium of women with endometriosis and in cocultures of endometrial cells exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Fertil Steril. 2005;84(1):67\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark JS, Lee JH, Kim M, Chang HJ, Hwang KJ, Chang KH. Endometrium from women with endometriosis shows increased proliferation activity. Fertil Steril. 2009;92(4):1246\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrosens I, Brosens JJ, Benagiano G. The eutopic endometrium in endometriosis: are the changes of clinical significance? Reprod Biomed Online. 2012;24(5):496\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu RW, Strug MR, Joshi NR, Jeong JW, Miele L, Lessey BA, et al. Decreased Notch pathway signaling in the endometrium of women with endometriosis impairs decidualization. J Clin Endocrinol Metab. 2015;100(3):E433\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAghajanova L, Hamilton A, Kwintkiewicz J, Vo KC, Giudice LC. Steroidogenic enzyme and key decidualization marker dysregulation in endometrial stromal cells from women with versus without endometriosis. Biol Reprod. 2009;80(1):105\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhn JI, Yoo JY, Kim TH, Kim YI, Ferguson SD, Fazleabas AT, et al. cAMP-Response Element-Binding 3-Like Protein 1 (CREB3L1) is Required for Decidualization and its Expression is Decreased in Women with Endometriosis. Curr Mol Med. 2016;16(3):276\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsteen KG, Bruner-Tran KL, Eisenberg E. Reduced progesterone action during endometrial maturation: a potential risk factor for the development of endometriosis. Fertil Steril. 2005;83(3):529\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlemmt PA, Carver JG, Kennedy SH, Koninckx PR, Mardon HJ. Stromal cells from endometriotic lesions and endometrium from women with endometriosis have reduced decidualization capacity. Fertil Steril. 2006;85(3):564\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuzaki S, Botchorishvili R, Pouly JL, Canis MJM. therapies c. Targeting the Wnt/β-catenin pathway in endometriosis: a potentially effective approach for treatment and prevention. 2014;2(1):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashiri A, Halper KI, Orvieto RJRB. Endocrinology. Recurrent Implantation Failure-update overview on etiology, diagnosis, treatment and future directions. 2018;16:1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVainio S, Heikkil\u0026auml; M, Kispert A, Chin N, McMahon APJN. Female development in mammals is regulated by Wnt-4 signalling. 1999;397(6718):405\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBui T, Zhang L, Rees M, Bicknell R, Harris, AJBjoc. Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in normal human endometrium and endometrial carcinoma. 1997;75(8):1131\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai Z-Z, Zhang J, Zhou W-J, Shi J-W, Yang H-L, Yang S-L et al. Identification of potential biomarkers and immune infiltration characteristics in recurrent implantation failure using bioinformatics analysis. 2023;14:992765.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuryawanshi A, Tadagavadi RK, Swafford D, Manicassamy, SJFii. Modulation of inflammatory responses by Wnt/β-catenin signaling in dendritic cells: a novel immunotherapy target for autoimmunity and cancer. 2016;7:460.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSonderegger S, Pollheimer J, Kn\u0026ouml;fler MJP. Wnt signalling in implantation, decidualisation and placental differentiation\u0026ndash;review. 2010;31(10):839\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamed OA, Jonnaert M, Labelle-Dumais C, Kuroda K, Clarke HJ. Dufort DJPotNAoS. Uterine Wnt/β-catenin signaling is required for implantation. 2005;102(24):8579\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArici A, Oral E, Bukulmez O, Duleba A, Olive DL, Jones EEJF et al. The effect of endometriosis on implantation: results from the Yale University in vitro fertilization and embryo transfer program. 1996;65(3):603\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurney RO, Talbi S, Hamilton AE, Vo KC, Nyegaard M, Nezhat CR et al. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis. 2007;148(8):3814\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Horst PH, Wang Y, van der Zee M, Burger CW, Blok LJJM. endocrinology c. Interaction between sex hormones and WNT/β-catenin signal transduction in endometrial physiology and disease. 2012;358(2):176\u0026thinsp;\u0026ndash;\u0026thinsp;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehdinejadiani S, Amidi F, Mehdizadeh M, Barati M, Pazhohan A, Alyasin A et al. Effects of letrozole and clomiphene citrate on Wnt signaling pathway in endometrium of polycystic ovarian syndrome and healthy women. 2019;100(3):641\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNei H, Saito T, Yamasaki H, Mizumoto H, Ito E. Kudo RJMCPicwtUoTMACC. Nuclear localization of β-catenin in normal and carcinogenic endometrium. 1999;25(3):207\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePazhohan A, Amidi F, Akbari-Asbagh F, Seyedrezazadeh E, Farzadi L, Khodarahmin M et al. The Wnt/β-catenin signaling in endometriosis, the expression of total and active forms of β-catenin, total and inactive forms of glycogen synthase kinase-3β, WNT7a and DICKKOPF-1. 2018;220:1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTulac S, Overgaard MT, Hamilton AE, Jumbe NL, Suchanek E, Giudice LCJTJCE et al. Dickkopf-1, an inhibitor of Wnt signaling, is regulated by progesterone in human endometrial stromal cells. 2006;91(4):1453\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Hanifi-Moghaddam P, Hanekamp EE, Kloosterboer HJ, Franken P, Veldscholte J et al. Progesterone inhibition of Wnt/β-catenin signaling in normal endometrium and endometrial cancer. 2009;15(18):5784\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Li Y, Semenov M, Han C, Baeg G-H, Tan Y et al. Control of β-catenin phosphorylation/degradation by a dual-kinase mechanism. 2002;108(6):837\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsteen KG, Bruner-Tran KL, Eisenberg EJF. sterility. Reduced progesterone action during endometrial maturation: a potential risk factor for the development of endometriosis. 2005;83(3):529\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZanatta A, Rocha AM, Carvalho FM, Pereira RM, Taylor HS, Motta EL et al. The role of the Hoxa10/HOXA10 gene in the etiology of endometriosis and its related infertility: a review. 2010;27:701\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuzaki S. Darcha CJPo. In vitro effects of a small-molecule antagonist of the Tcf/\u0026szlig;-catenin complex on endometrial and endometriotic cells of patients with endometriosis. 2013;8(4):e61690.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelarde MC, Aghajanova L, Nezhat CR, Giudice LCJE. Increased mitogen-activated protein kinase kinase/extracellularly regulated kinase activity in human endometrial stromal fibroblasts of women with endometriosis reduces 3\u0026prime;, 5\u0026prime;-cyclic adenosine 5\u0026prime;-monophosphate inhibition of cyclin D1. 2009;150(10):4701\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantanam N, Kavtaradze N, Murphy A, Dominguez C, Parthasarathy SJTR. Antioxidant supplementation reduces endometriosis-related pelvic pain in humans. 2013;161(3):189\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCacciottola L, Donnez J, Dolmans M-MJIJMS. targets? Can endometriosis-related oxidative stress pave the way for new treatment 2021;22(13):7138.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSukan B, Akdevelioğlu Y, Sukan VNJCNR. Effect of antioxidant supplementation on endometriosis-related pain: A systematic review. 2022;11(4):753\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTesarik JJB. Towards personalized antioxidant use in female infertility: Need for more molecular and clinical studies. 2021;9(12):1933.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaleki-Hajiagha A, Shafie A, Maajani K, Amidi F. Effect of astaxanthin supplementation on female fertility and reproductive outcomes: a systematic review and meta-analysis of clinical and animal studies. J ovarian Res. 2024;17(1):163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYousry MJJA, Chemistry F. Antioxidant activities of astaxanthin and related carotenoids. 2000;48(4):1150\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohandel Z, Farkhondeh T, Aschner M, Pourbagher-Shahri AM, Samarghandian SJB. Pharmacotherapy. Anti-inflammatory action of astaxanthin and its use in the treatment of various diseases. 2022;145:112179.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Dai W, Xia Y, Chen K, Li S, Liu T et al. Astaxanthin inhibits proliferation and induces apoptosis of human hepatocellular carcinoma cells via Inhibition of NF-κB P65 and Wnt/β-catenin in vitro. 2015;13(10):6064\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKavitha K, Kowshik J, Kishore TKK, Baba AB. Nagini SJBeBA-GS. Astaxanthin inhibits NF-κB and Wnt/β-catenin signaling pathways via inactivation of Erk/MAPK and PI3K/Akt to induce intrinsic apoptosis in a hamster model of oral cancer. 2013;1830(10):4433\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKowshik J, Nivetha R, Ranjani S, Venkatesan P, Selvamuthukumar S, Veeravarmal V et al. Astaxanthin inhibits hallmarks of cancer by targeting the PI3K/NF-κΒ/STAT3 signalling axis in oral squamous cell carcinoma models. 2019;71(10):1595\u0026ndash;610.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRostami S, Alyasin A, Saedi M, Nekoonam S, Khodarahmian M, Moeini A et al. Astaxanthin ameliorates inflammation, oxidative stress, and reproductive outcomes in endometriosis patients undergoing assisted reproduction: A randomized, triple-blind placebo-controlled clinical trial. 2023;14:1144323.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaraone I, Sinisgalli C, Ostuni A, Armentano MF, Carmosino M, Milella L et al. Astaxanthin anticancer effects are mediated through multiple molecular mechanisms: A systematic review. 2020;155:104689.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCanis M, Donnez JG, Guzick DS, Halme JK, Rock JA, Schenken RS et al. Revised american society for reproductive medicine classification of endometriosis: 1996. 1997;67(5):817\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFassbender A, Rahmioglu N, Vitonis AF, Vigano P, Giudice LC, D\u0026rsquo;Hooghe TM et al. World endometriosis research foundation endometriosis phenome and biobanking harmonisation project: IV. Tissue collection, processing, and storage in endometriosis research. 2014;102(5):1244\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoyes R, Hertig A, Rock JJO, Survey G. Dating endometrial biopsy. 1950;5(4):561\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThe Istanbul consensus workshop on embryo assessment: proceedings of an expert meeting. Human reproduction (Oxford, England). 2011;26(6):1270-83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePazhohan A, Danaei-Mehrabad S, Mohamad-Rezaeii Z, Amidi F, Khodarahmian M, Shabani Nashtaei M et al. The modulating effects of vitamin D on the activity of β-catenin in the endometrium of women with endometriosis: a randomized exploratory trial. 2021;37(3):278\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim SH, Kim HJN. Inhibitory effect of astaxanthin on gene expression changes in Helicobacter pylori-infected human gastric epithelial cells. 2021;13(12):4281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGharaei R, Alyasin A, Mahdavinezhad F, Samadian E, Ashrafnezhad Z, Amidi FJJAR et al. Randomized controlled trial of astaxanthin impacts on antioxidant status and assisted reproductive technology outcomes in women with polycystic ovarian syndrome. 2022;39(4):995\u0026ndash;1008.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu X, Wu Z, Wang M, Cheng WJJIMR. Effects of vitamin C on the outcome of in vitro fertilization\u0026ndash;embryo transfer in endometriosis: A randomized controlled study. 2018;46(11):4624\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMier-Cabrera J, Genera-Garc\u0026iacute;a M, De la Jara-D\u0026iacute;az J, Perichart-Perera O, Vadillo-Ortega F, Hern\u0026aacute;ndez-Guerrero CJIJG et al. Effect of vitamins C and E supplementation on peripheral oxidative stress markers and pregnancy rate in women with endometriosis. 2008;100(3):252\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAchache H, Revel AJH. Endometrial receptivity markers, the journey to successful embryo implantation. 2006;12(6):731\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeklenburg G, Salker M, Molokhia M, Lavery S, Trew G, Aojanepong T et al. Natural selection of human embryos: decidualizing endometrial stromal cells serve as sensors of embryo quality upon implantation. 2010;5(4):e10258.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-womens-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bmwh","sideBox":"Learn more about [BMC Women's Health](http://bmcwomenshealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bmwh/default.aspx","title":"BMC Women's Health","twitterHandle":"","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, Astaxanthin, Wnt/β-Catenin Signaling, Eutopic Endometrium, Female Reproductive Health, Randomized Controlled Trial","lastPublishedDoi":"10.21203/rs.3.rs-8971122/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8971122/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eEndometriosis is a chronic gynecological disorder associated with pelvic pain and infertility, characterized by molecular and cellular dysregulation in the eutopic endometrium. Aberrant Wnt/β-catenin signaling has been implicated in disease pathophysiology. Astaxanthin (AST), a potent antioxidant, may influence cellular signaling pathways relevant to female reproductive health. This study investigated the effects of AST on Wnt/β-catenin signaling in the eutopic endometrium of women with advanced endometriosis.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this randomized, triple-blind, placebo-controlled trial, 50 women with advanced-stage endometriosis received either AST (6 mg/day) or placebo for 12 weeks. Endometrial samples were collected during the mid-secretory phase before and after the intervention. Wnt/β-catenin pathway gene expression was quantified using real-time PCR, and protein levels were assessed by Western blotting.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eAST supplementation was associated with reduced β-catenin expression (P\u0026thinsp;=\u0026thinsp;0.041) and increased GSK-3β (P\u0026thinsp;=\u0026thinsp;0.009) and DKK-1 (P\u0026thinsp;=\u0026thinsp;0.042) levels. CD44 expression was also lower post-intervention (P\u0026thinsp;=\u0026thinsp;0.021). These findings suggest that AST may promote a shift toward normalization of Wnt/β-catenin signaling in the eutopic endometrium.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eIn women with advanced endometriosis, AST supplementation was associated with modulation of Wnt/β-catenin pathway components in the eutopic endometrium. While these results are exploratory, they highlight the potential of AST to influence endometrial signaling pathways, supporting further investigation of its role in reproductive health.\u003c/p\u003e\u003ch2\u003eTrial Registration\u003c/h2\u003e \u003cp\u003eIranian Registry of Clinical Trials (IRCT) IRCT20220625055274N1. Registered on 03 September 2022.\u003c/p\u003e","manuscriptTitle":"Astaxanthin Therapy in Women with Advanced Endometriosis: A Randomized Controlled Trial with Exploratory Analysis of Endometrial Wnt/β-Catenin Signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-31 10:42:17","doi":"10.21203/rs.3.rs-8971122/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2026-03-26T10:09:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-23T13:58:38+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-02T12:20:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-27T21:44:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Women's Health","date":"2026-02-27T15:21:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-womens-health","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bmwh","sideBox":"Learn more about [BMC Women's Health](http://bmcwomenshealth.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bmwh/default.aspx","title":"BMC Women's Health","twitterHandle":"","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d1dab0ff-80ad-49df-b9b8-52de81441064","owner":[],"postedDate":"March 31st, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-31T10:42:17+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-31 10:42:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8971122","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8971122","identity":"rs-8971122","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.