Diuretic activity and mechanism of Mosla chinensis Maxim. cv. Jiangxiangru in normal Rats

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-16

This study found that Mosla chinensis Maxim. cv. Jiangxiangru decoction, extract, and volatile oil exhibit diuretic activity in rats by affecting hormone levels and inhibiting water reabsorption via aquaporins in the collecting tubules without causing electrolyte disturbance.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-16 · read from full text

This preprint investigated the diuretic activity and proposed mechanism of Mosla chinensis cv. Jiangxiangru by testing its water decoction, water extract, and volatile oil in a saline-loaded rat model, with furosemide as a positive control. Across 48 male Sprague-Dawley rats (48-hour urine collection period with multiple time points), the authors measured urine volume, urine electrolytes (K+, Na+, Cl−) and pH, and assessed levels of ALD, ANP, ADH, Na+-K+-ATPase, and aquaporins AQP1, AQP2, and AQP3 via ELISA plus gene/protein analyses. Jiangxiangru decoction produced the strongest diuretic effect, with weaker effects in water extract and volatile oil, and the authors report that urinary pH and electrolytes did not significantly change while suggesting that reduced water reabsorption in collecting tubules via aquaporin involvement (together with hormone-related pathways) may underlie the effect. The paper does not appear to explicitly discuss limitations beyond its preprint status and lack of peer review, and it was conducted in normal rats rather than in a disease model. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Jiangxiangru, a commonly used clinical Chinese medicine, has been investigated mainly over its effects on Summer heatstroke and the dampness inside the spleen and stomach. This study focuses on the diuretic effect of Jiangxiangru in normal rats as well as the underlying mechanism.Methods: 48 rats were randomly divided into the model group (saline), the positive control group (furosemide 0.02g/kg), low and high dosage of water decoction of Jiangxiangru group (0.2 g/ml and 1g/ml), low and high dosage of water extract of Jiangxiangru group (0.1463g/ml and 0.7317g/ml), and the low and high dosage of volatile oil of Jiangxiangru group (0.1791g/ml and 1.4328g/ml). Each group was assigned 6 rats. Thirty minutes after the successful establishment of the model, the rats were treated orally with corresponding doses of drugs at 10 ml/kg. The control group received an equivalent amount of water. After administration, Urine volume at each time point was measured and urine K+, Na+, Cl- content were measured. The contents of ALD, ANP, ADH, Na+-K+-ATPase, the gene expression and protein levels of AQP1, AQP2 and AQP3 in urine of rats in each group were determined. SPSS22.0 statistical software was used to analyze the experimental data. One way ANOVA and multiple comparisons between LSD groups were performed. The difference is considered significant When p < 0.05 or p < 0.01.Results: Our results showed that Jiangxiangru decoction group has the strongest diuretic effect, followed by water extract, then the volatile oil. The diuretic mechanism of Jiangxiangru may affect the kidney in addition to the hormone level related to the change of body fluid metabolism. The distal convoluted tubules are related to the content of aquaporin AQP in the collecting tube, thereby inhibiting water reabsorption.Conclusion: The contents of Na+, K+, and Cl- and PH in urine of rats don’t change significantly in this experiment. The diuretic effect of Jiangxiangru could not cause electrolyte disturbance and other adverse reactions. This fully reflects the complex composition of traditional Chinese medicine, the role of multi-target characteristics.
Full text 80,641 characters · extracted from preprint-html · click to expand
Diuretic activity and mechanism of Mosla chinensis Maxim. cv. Jiangxiangru in normal Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Diuretic activity and mechanism of Mosla chinensis Maxim. cv. Jiangxiangru in normal Rats Longxue Li, Suyun Xiao, Weiqi Liu, Dan Lei, Weiyue Deng, Juan He, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-37431/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Jiangxiangru , a commonly used clinical Chinese medicine, has been investigated mainly over its effects on Summer heatstroke and the dampness inside the spleen and stomach. This study focuses on the diuretic effect of Jiangxiangru in normal rats as well as the underlying mechanism. Methods : 48 rats were randomly divided into the model group (saline), the positive control group (furosemide 0.02g/kg), low and high dosage of water decoction of Jiangxiangru group (0.2 g/ml and 1g/ml), low and high dosage of water extract of Jiangxiangru group (0.1463g/ml and 0.7317g/ml), and the low and high dosage of volatile oil of Jiangxiangru group (0.1791g/ml and 1.4328g/ml). Each group was assigned 6 rats. Thirty minutes after the successful establishment of the model, the rats were treated orally with corresponding doses of drugs at 10 ml/kg. The control group received an equivalent amount of water. After administration, Urine volume at each time point was measured and urine K + , Na + , Cl - content were measured. The contents of ALD, ANP, ADH, Na + -K + -ATPase, the gene expression and protein levels of AQP 1 , AQP 2 and AQP 3 in urine of rats in each group were determined. SPSS22.0 statistical software was used to analyze the experimental data. One way ANOVA and multiple comparisons between LSD groups were performed. The difference is considered significant When p < 0.05 or p < 0.01. Results : Our results showed that Jiangxiangru decoction group has the strongest diuretic effect, followed by water extract, then the volatile oil. The diuretic mechanism of Jiangxiangru may affect the kidney in addition to the hormone level related to the change of body fluid metabolism. The distal convoluted tubules are related to the content of aquaporin AQP in the collecting tube, thereby inhibiting water reabsorption. Conclusion : The contents of Na + , K + , and Cl - and PH in urine of rats don’t change significantly in this experiment. The diuretic effect of Jiangxiangru could not cause electrolyte disturbance and other adverse reactions. This fully reflects the complex composition of traditional Chinese medicine, the role of multi-target characteristics. Urology & Nephrology Mosla chinensis Maxim. cv. Jiangxiangru Diuretic activity hormone AQPS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Diuretics have wide clinical application in treating edema caused by various reasons. They can also be used to treat hypertension(Xing hai ning, Li chen et al. 2016), kidney injury(Jeon, Kim et al. 2018), chronic heart failure(Qavi, Kamal et al. 2015), and other diseases(Alhanafy, Labeeb et al. 2018). As the medical research towards diuretics deepened, the increase in observed post-treatment clinical adverse reactions (Yang 2018) has turned the public attention to traditional Chinese medicines (TCMs)(Lin, Pan et al. 2014, Liu, Yang et al. 2019). In China, several TCMs are used as diuretic drugs (Jia and Jia 2016, Li, Cai et al. 2016, Gao, Bai et al. 2018). However, most of them are lacking pharmacological studies to reveal the molecular pathways that might be contributing to diuretic effects. Mosla chinensis Maxim. cv. Jiangxiangru (Chinese: Jiangxiangru , 江香薷) is one of these TCMs. It belongs to the the Labiates family and is a famous herbal TCM that is described in the authoritative medical book of Chinese Pharmacopoeia(CHINA 2015). Elsholtzia is the aerial part of Mosla chinensis Maximak or M. chinensis Jiangxiangru (Liu, Wang et al. , Zhimin, Wang et al. 2016). Jiangxiangru , a herb mainly distributed in Yichun and Xinyu in Jiangxi Province of China, is genuinely a regional herb used in the Traditional Chinese Medicine(Liu, Wang et al. , Qi, Fang et al. 2015, Zhimin, Wang et al. 2016) (Chinese Pharmacopoeia). Elsholtzia can relieve the sweating caused by the heat in summer, and the effect is like ephedrine in winter(XianGuo 2013, lingyuan 2015). It tastes mild and warm, with effects including perspiration, diuresis, and resolving swelling, and dehumidification. Modern research shows that there are many chemical components in Jiangxiangru , such as flavonoids, terpenoids, glycosides, steroids, coumarins, organic acids, fats, and lignans(Hu, Xie et al. 2010). Different extracts of Jiangxiangru contain different active ingredients, and their pharmacological effects may also be different. Therefore, to increase the efficiency of further development of Jiangxiangru product and their usage, we tested the diuretic effects of Jiangxiangru over the decoction group, the water extract and the volatile oil. Amongst them, volatile oil is the main active ingredient and has antipyretic, anti-inflammatory and analgesic effects (Luo, Yang et al. 2006, Jiang, Lu et al. 2007, Hu, Xie et al. 2010, Li, Cui et al. 2014, Zhimin, Wang et al. 2016). The purpose of the study was to evaluate the diuretic activities in normal rats. We assessed the urine output volume, the urinary electrolyte concentrations (Na + , K + and Cl - ) and pH value, the levels of Na + -K + -ATPase, atriopeptin (ANP), anti-diuretic hormone (ADH) and aldosterone (ALD), as well as AQPs levels for efficacy evaluation. Methods study chemicals and reagents Jiangxiangru (batch number: 180823) was purchased from Jiangxi Jiangzhong Traditional Chinese Medicine Decoction Co., Ltd. The Jiangxiangru was placed in a round-bottom flask. After soaking in the proportion of distilled water to 1:10 for 30 minutes, the volatile oil was extracted by steam distillation for 5 hours then collected (yield: 0.67%). The volatile oil was prepared into 200 ml low and high concentration volatile oil solution with distilled water containing 2% Tween-80, respectively. The reduced crude drug amounts were 0.1791 and 1.4328 g/ ml, respectively. The water extract with low and high concentration was obtained by condensed extractpart of the extract, and the equivalent crude drug dosage was 0.1463 and 0.7317g/ml, respectively. Jiangxiangru decoction is decocted by pharmacy group of Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine [batch number: 121223, specification: 1g (crude drug)/1ml]; Furosemide tablets (Shanghai Chaohui Pharmaceutical Co., Ltd., batch number: 1811N10, specification: 20mg/tablet); rat aldosterone (ALD) ELISA kit (batch number: 201904), rat anti-diuretic hormone (ADH) enzyme-linked immunosorbent (ELISA) kit (batch number: 201904). Rat atrial natriuretic peptide (ANP) ELISA kit (batch number: 201904), rat Na + -K + -ATPase ELISA kit (batch number: 201903), rat aquaporin 1 (AQP1) ELISA kit (batch number: 201904), rat aquaporin 2 (AQP2) ELISA kit (batch number: 201904), rat aquaporin 3 (AQP3) ELISA kit (batch number: 201904) were purchased from Shanghai Herpeng Biology Company. Technology Co., Ltd. RNA kit (Beijing Quanshijin Biotechnology Co., Ltd.); Real-time PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, USA) and Corbbet Cycler (Qiagen, Valencia, CA, and USA). Animal treatment and sample collection Fifty SPF-grade SD male rats weight range 180 ±20g were provided by the Experimental Animal Science and Technology Center of Jiangxi University of Traditional Chinese Medicine with the certificate number SCXK (Gan) 2018-0003. Feeding was conducted in SPF barrier system of experimental animal science and technology center of Jiangxi University of Traditional Chinese Medicine, at a temperature of 20-23℃, humidity of 45%-55%, and the license number is SYXK (Gan) 2018-0004. All experiments were carried out in adherence with the guidelines of the Institutional Animal Care and Use Committee of China and were approved by the Animal Care and Research Committee of Jiangxi University of Traditional Chinese Medicine. The 50 rats were isolated for one week. After the isolation rats were placed in metabolic cage for 3 days; then on the 4 th day, fasting (no water) for 18 hours. The rats were given 2.5ml/100g saline water to record the urine volume for 2 hours. The rats whose urine volume was more than 40% of the water supply were successfully established as saline water load model (Chen, Feng et al. , Feng, Chen et al. , Gao, Bai et al. 2018). It can be used in the following experiments. 48 rats were randomly divided into 8 groups: the model group (saline), the positive control group (furosemide 0.02g/kg), low and high dosage of water decoction of Jiangxiangru group (0.2 g/ml and 1g/ml), low and high dosage of water extract of Jiangxiangru group (0.1463g/ml and 0.7317g/ml), and the low and high dosage of volatile oil of Jiangxiangru group (0.1791g/ml and 1.4328g/ml). Each group was assigned 6 rats. According to clinical TCM practice the dosage of Jiangxiangru for adults (60 kg/person) is 10~30 g/kg/day (Editorial Committee of Zhonghua Bencao National Traditional Chinese Herb Administration, 1999). For rats, this dosage is 0.166~1.5g/kg/day (raw herb). Thirty minutes after the successful establishment of the model, the rats were treated orally with corresponding doses of drugs at 10 ml/kg. The control group received an equivalent amount of water. After administration, rats in each group were immediately put into metabolic cages. Urine samples were collected after 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 144 and 168 hours respectively. Urine volume at each time point was measured and urine K + , Na + , Cl - content were measured with Beckman AU2700 biochemical analyzer. At the end of the experimental period, 4 mL of blood were collected in vacuum tubes from the abdominal aorta, allowed to clot on ice, and subsequently subjected to centrifugation at 3000 rpm at 4°C for 10 min. The supernatant was stored at -80°C for further analysis. All of the rats were sacrificed by cervical dislocation. The contents of ALD, ANP, ADH, Na + -K + -ATPase, the gene expression and protein levels of AQP 1 , AQP 2 and AQP 3 in urine of rats in each group were determined. Biochemical methods Enzyme-linked immunosorbent assay (ELISA) kit was used to analyze ALD, ANP, ADH, Na + -K + -ATPase, AQP 1 , AQP 2 and AQP 3 in urine. Rat urine was centrifuged at 3000 rpm for 10 min at 4 ℃ in an Eppendorf centrifuge. The supernatant was collected, and recombinant rat Na + -K + -ATPase, ANP, ADH, ALD, AQP 1 , AQP 2 and AQP 3 were used to construct standard curves. The absorbance of standards and samples was determined spectrophotometrically at 450 nm using a Multiskan GO (Thermo scientific, USA) microplate reader. The results were plotted against the linear portion of a standard curve. RNA-isolation and qPCR Renal medulla samples were cleaved by Trans Zol Up homogenized and added chloroform. The solution was divided into colorless aqueous phase and pink organic phase. RNA was adsorbed in aqueous phase by silica gel membrane centrifugal column. RNA was prepared by reverse transcription using a RNA kit. Real-time PCR was performed using Power SYBR Green PCR Master Mix and Corbbet Cycler. Each reaction was performed in 40 cycles with a total volume of 10 μl. Primer sequences and PCR amplification reactions were as according to the literature (Yan, Zeng et al. 2014). The internal reference gene of the experiment was GAPDH (Zhong, Li et al. 2018). The primer sequences and reaction systems are shown in Tables 1 and 2. Table 1 Primer sequences of genes were descripted for RT-qPCR Gene Forward primer (5' - 3’) Reverse primer (5' - 3') AQP1 GACTACACTGGCTGTGGGATCAA CCAGGGCACTCCCAATGAA AOP2 GGTTGCTCCATGAATCCAG GGGGTCCGATCCAGAAGAGGA AQP3 ACTCCAGTGTGGAGGTGGAC ACACTAGGAGTTGATCCCCG GAPDH TGGGTTTCCCGTTGATGA AGGGCTGCCTTCTCTTGT Table 2 Reaction system of quantitative PCR assays Reagent Volume (μl) cDNA ddH2O S YBR GREEN II Forward primer Reverse primer ROX correction fluid Total volume 1.0 3.0 5.0 0.4 0.4 0.2 10.0 The mixed test solution was placed in a fluorescence quantitative PCR machine for reaction. The amplification reaction conditions were as following: 95 ° C for 30 s; 95 ° C for 10 s, 60 ° C for 1 min, 40 cycles; then the reaction temperature was raised from 50 ° C to 90 ° C (1 ° C every 6 s); The ct values of the reference gene and the target gene were collected; finally, the relative expression level of the target gene was calculated, and the data was processed according to the experimental method of Yang et al(Yang, Liu et al. 2015) Statistics analysis SPSS22.0 statistical software was used to analyze the experimental data. Data were expressed as mean ± standard deviation (x ±s). One way ANOVA and multiple comparisons between LSD groups were performed. The difference is considered significant When p < 0.05 or p < 0.01. Results Effect on urinary excretion volume In order to determine whether Jiangxiangru has diuretic effect, we measured the urine volume of rats treated with Jiangxiangru or furosemide at 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 120, 144 hours. We found that 1 hour after administration, the urine volume of the low and high dosage of decoction of Jiangxiangru group, the high dose of volatile oil of Jiangxiangru group and positive control group increased significantly compared with the model group (P < 0.01 or P 0.05). At 2 hours after administration, the urine volume of rats in positive control group increased, but there was no significant difference (P > 0.05). At 3-5 hours after administration, the urine volume of rats in each group had no significant difference (P > 0.05); but at 24 hours and 96 hours after administration, the urine volume of rats in high-dose of decoction of Jiangxiangru group increased, the difference was statistically significant(P < 0.05). This indicated that the water decoction of Jiangxiangru had a longer effect than furosemide. From Figure 1, compared with model group, the total urine volume of rats in high dose of decoction of Jiangxiangru group and positive control group increased at 1h,6h,96h,120h,144h hours with statistical significance (P < 0.05), indicating that the water decoction of Mosla chinensis has obvious diuretic effect. Effect on urinary pH and electrolyte concentrations The changes of urinary ph and electrolytes in urine of rats at 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 120, 144 hours were observed (Fig. 2, Fig. 3). Compared with the model group, the contents of Na + , K + , and Cl - in the urine of rats in the administration group did not change significantly, and the pH of the urine of rats in each group had no significant difference (P > 0.05). Effect on urine levels of Na + -K + -ATPase, ALD, ANP, ADH ELISA kit was used to verify whether Jiangxiangru could affect the contents of ALD, ANP, ADH and Na + -k + -ATPase in rat urine. Compared with model group, ALD secretion in urine of rats were increased in different treatment groups of Jiangxiangru , the difference was statistically significant between the high and low dosages of decoction of Jiangxiangru group and the high dose of volatile oil of Jiangxiangru group (P < 0.01 or P < 0.05). The contents of ANP in the urine of rats in the high and low dosage of decoction of Jiangxiangru group and the high dose of volatile oil of Jiangxiangru group increased. Among these groups, the high dosage of decoction has the most significantly difference (P 0.05), while the high dosage of decoction of Jiangxiangru group increased the content of ADH insignificantly (P > 0.05). There was no significant change in the content of Na + -K + -ATPase in urine of different treatment groups of Jiangxiangru (P > 0.05). The contents of ALD, ANP, ADH and Na + -k + -ATPase in plasma of rats in each group were compared as shown in Fig4 and Fig5. The levels of AQP1, AQP2 and AQP3 in Rat Urine and serum In order to determine whether Jiangxiangru affects the contents of AQP 1 , AQP 2 and AQP 3 in rat serum and urine, we used ELISA kit to detect the content of AQP s proteins and RT-PCR to detect the gene expression of AQP 1 , AQP 2 and AQP 3 in rat renal medulla. Compared with the model group, all groups of Jiangxiangru decreased the amount of AQP 1 insignificantly (P > 0.05). AQP 2 expression in the low dosage of decoction group (0.2g/ml) and low dosage of water extract (0.1463g/ml) of Jiangxiangru group have significantly decreased while the equivalent high dosage groups experienced no significant change. Water extract and volatile oil of Jiangxiangru decreased the amount of AQP 3 expression, and the difference was significant (P < 0.05 or P < 0.01). The changes of AQP 1 , AQP 2 and AQP 3 aquaporin in rat serum are shown in Fig6A. At the same time, the protein levels of urine AQPs in each group were observed. The AQPs level results showed in Fig6B. All groups with Jiangxiangru administration had their furosemide of AQP 1 level significantly lower than that of the control group (P < 0.01). Low dosage of decoction group (0.2g/ml), low dosage of water extract group(0.1463g/ml), and high dosage of volatile oil group had significant difference in AQP 2 (P < 0.01). The AQP3 protein content of low-dose group of Jiangxiangru decoction, volatile oil group, and furosemide group were significantly lower than that of model control group (P < 0.01). Discussion Urine is the most intuitive indicator to detect whether drugs have diuretic effect. Urine production includes three processes: glomerular filtration, renal tubule and collecting duct reabsorption and secretion. Diuretics are medications producing diuretic effects of varying strength by acting on different parts of the renal tubule, thus affecting the pathway of urine production. The excretion of electrolytes is also related to the site of drug action. Classic diuretics mainly exert diuretic effect by increasing the excretion of Na + and Cl - after drug intervention as Na + and Cl - excretion positively influences diuresis. For example, furosemide mainly acts on the thick segment of the ascending branch of the medullary ridge, and reduces the reabsorption of Na + and Cl - by inhibiting Na + -K + -2Cl - co-transport, increases the excretion of NaCl, and increases the urinary H + and K + Excretion, which can cause hypokalemia. Therefore, it is crucial to determine the contents of Na + , K + , and Cl - in urine of rats treated with Jiangxiangru . Jiangxiangru and its 3 delivery reagents had no effects on contents of Na + , K + , and Cl - in urine. Therefore, we believe that the diuretic effect of Jiangxiang and each of it treatment group is not achieved by affecting Na + -K + -2Cl - co-transport. The main function of ALD synthesized and secreted by adrenocortical globular zone cells is to increase the re-absorption of Na + and water, promote K + excretion and maintain the balance of water-salt metabolism. The active polypeptide ANP synthesized and secreted by the atrium is also known as atrial natriuretic factor or atrial natriuretic peptide. Its main functions are natriuretic, diuretic, inhibiting rennin release and ALD secretion. ADH is secreted by the hypothalamus and its main function is to promote water reabsorption. The diuretic activity and mechanism of drugs are not only related to the levels of related diuretic hormones (ALD, ADH, ANP), but also to the levels of aquaporin in urine regulated by hormones. Therefore, this study explored the diuretic activity and its mechanism of Jiangxiangru related diuretic hormones (ALD, ADH, and ANP). Jiangxiangru and its 3 delivery reagents had no effects on the anti-metabolite enzymes. The results showed that the high dosage of decoction of Jiangxiangru group can increase the secretion of ALD and increase the secretion of ANP, especially the effect of ALD on dose-response relationship, suggesting that the aqueous extract of Jiangxiangru has diuretic effect. There was also anti-diuretic effect, which is related to the multi-component and multi-target characteristics of traditional Chinese medicine. The volatile oil of Jiangxiangru also has similar action characteristics. Additionally, from the influence of gene expression and protein level of AQP, Jiangxiangru showed complex urinary production effects. The three preparations groups significantly down-regulated the expression of AQP 1 gene, and the protein level was significantly lower than that of the control group. The group of decoction showed an increase in the expression of AQP 2 and AQP 3 genes, and the protein also increased. The other groups down-regulated the expression of AQP 2 and AQP 3 genes, and the protein was lower than the control group. Conclusion The contents of Na + , K + , and Cl - and PH in urine of rats don’t change significantly in this experiment. The diuretic effect of Jiangxiangru could not cause electrolyte disturbance and other adverse reactions. This fully reflects the complex composition of traditional Chinese medicine, the role of multi-target characteristics. Declarations Ethics approval and consent to participate :All experiments were carried out in adherence with the guidelines of the Institutional Animal Care and Use Committee of China and were approved by the Animal Care and Research Committee of Jiangxi University of Traditional Chinese Medicine. Consent for publication : The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All participants agreed to publish. Availability of data and materials : The data used to support the findings of this study are available from the corresponding author upon request. Competing interests : The authors have no conflicts of interest to declare. Funding : This research was supported by Double-First Class discipline construction project (No. JXSYLXK-ZHYA0138). Authors' contributions :(I) Conception and design: Zhiyong Liu; (II) Administrative support: Suyun Xiao., Dan Lei; (III) Provision of study materials: Longxue Li., Kun Shu. Weiyue Deng.; (IV) Collection and assembly of data: Yun Huang.,Weiqi Liu , Juan He., Zhongrui Wu.; (V) Data analysis and interpretation: Shouming Li ; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Acknowledgements : Thanks to Kun Shu for some of the experiments in the manuscript. References "Structure and biological activities of a pectic polysaccharide from Mosla chinensis Maxim. cv. Jiangxiangru." Carbohydr Polym 105 : 276-284. Alhanafy, A. M., A. Labeeb and A. Khalil (2018). "The Role of Diuretics in Treatment of Aromatase Inhibitors Induced Musculoskeletal Symptoms in Women with Non Metastatic Breast Cancer." Asian Pac J Cancer Prev 19 (12): 3525-3531. Chen, D.-Q., Y.-L. Feng, T. Tian, H. Chen, L. Yin, Y.-Y. Zhao and R.-C. Lin "Diuretic and anti-diuretic activities of fractions of Alismatis rhizoma." Journal of Ethnopharmacology 157 : 114-118. CHINA, P. C. o. t. M. o. H. o. t. P. s. R. o. (2015). Pharmacopoeia of the People's Republic of China: 2015 edition. One. Feng, Y.-L., H. Chen, T. Tian, D.-Q. Chen, Y.-Y. Zhao and R.-C. Lin "Diuretic and anti-diuretic activities of the ethanol and aqueous extracts of Alismatis rhizoma." Journal of Ethnopharmacology 154 (2): 386-390. Gao, L., Y. Bai, X. b. Feng and L. m. Zheng (2018). "Diuresis effects of astragalus membranaceus its paired drugs in the saline loading rat model of qi deficiency." World Journal of Integrated Traditional and Western Medicine 13 (10): 1344-1347. Hu, H. W., X. M. Xie, P. Z. Zhang and R. G. Shu (2010). "[Study on the flavonoids from Mosla chinensis 'jiangxiangru']." Zhong Yao Cai 33 (2): 218-219. Jeon, J., D. H. Kim, S. I. Baeg, E. J. Lee, C. R. Chung, K. Jeon, J. E. Lee, W. Huh, G. Y. Suh, Y. G. Kim, D. J. Kim, H. Y. Oh and H. R. Jang (2018). "Association between diuretics and successful discontinuation of continuous renal replacement therapy in critically ill patients with acute kidney injury." Crit Care 22 (1): 255. Jia, K. and T. Jia (2016). "Comparison of Antidiuretic Activity of Ootheca Mantidis before and after Processing and Its Medicinal Part against Insufficiency of Kidney-Yang and Diuresis Rats." China Pharmacy 27 (07): 879-882. Jiang, H. M., X. Y. Lu, J. Fang, X. L. Xu, K. Yi and B. Ge (2007). "[Study on extraction technology of Mosla chinensis volatile oil]." Zhong Yao Cai 30 (9): 1135-1139. Li, j., p. Cai, j. Zhang and l. Pan (2016). "Medicinal Study on Pteridophytes in Diuresis and Lincolysis." Chinese Journal of Ethnic Medicine 22 (03): 52-53. Li, J. E., S. W. Cui, S. P. Nie and M. Y. Xie (2014). "Structure and biological activities of a pectic polysaccharide from Mosla chinensis Maxim. cv. Jiangxiangru." Carbohydr Polym 105 : 276-284. Lin, N., J. Pan and N. Guan (2014). "Diuretic Mechanism of Astragalus in Mice and Its Material Basis." Pharmacy Today 24 (07): 481-483+488. lingyuan, Z. (2015). Theoretical research based on pathogenesis of summer stagnation, Beijing University of Chinese Medicine. Liu, Y., Z. Wang and J. Zhang "Dietary Chinese Herbs || Mosla chinensis Maxim. 香薷 (Xiangru, Chinese Mosla Herb)." Springer Vienna 10.1007/978-3-211-99448-1 (Chapter 73): 637-644. Liu, Y., Z. Wang and J. Zhang "Dietary Chinese Herbs || Mosla chinensis Maxim. 香薷 (Xiangru, Chinese Mosla Herb)." 10.1007/978-3-211-99448-1 (Chapter 73): 637-644. Liu, Z., L. Yang, L. Li, R. Wei, X. Luo, T. Xu, Y. Huang, Z. Mu and J. He (2019). "Diuretic and Antidiuretic Activities of Ethanol Extract and Fractions of Lagopsis supina in Normal Rats." BioMed Research International 2019 : 8. Luo, G. M., G. Y. Yang, H. Y. Liu, Y. Chen, X. Li and Y. Q. Yang (2006). "[Optimization of the extraction technology for the essential oil from Mosla chinensis Maxim]." Zhong Yao Cai 29 (3): 284-286. Qavi, A. H., R. Kamal and R. W. Schrier (2015). "Clinical Use of Diuretics in Heart Failure, Cirrhosis, and Nephrotic Syndrome." Int J Nephrol 2015 : 975934. Qi, M., W. J. Fang, X. Y. Zhang, G. M. Luo and S. O. Pharmacy (2015). "The Research Progress of M. chinensis- jiangxiangru's Chemical Components and Pharmacological Effects." Journal of Jiangxi University of Traditional Chinese Medicine. XianGuo, H. (2013). "Talk about hot weather and dampness of the role of Elsholtzia." Chinese Traditional Medicine Modern Distance Education(17): 156-156. Xing hai ning, Li chen and W. lin (2016). " Study on Diuretics Application in Treatment of Hypertension." World Latest Medicine Information (Electronic Version) 16 (15): 13-14. Yan, S., J. Zeng, Y. Bi, J. Wei, ., X. Wang, G. Luo, J. Zhu and G. Ren (2014). "Effects of plantago asiatica L.seeds on diuretic activity aquaporins and ion channels in normal rats." chin hosp pharm J 34 (12): 968-971. Yang, A., Z. Liu, B. Yan, M. Zhou and X. Xiong (2015). "Preparation of camptothecin-loaded targeting nanoparticles and their antitumor effects on hepatocellular carcinoma cell line H22." Drug Delivery 23 (5): 1. Yang, b. (2018). "Rational use of diuretics." China Food and Drug Administration(10): 42-49. Zhimin, L. I., M. Wang, L. Peng and S. O. Pharmacy (2016). "Chemical Composition Analysis of Essential Oil from Mosla chinensis Maxim. cv. Jiangxiangru and Inhibitory Activity of the Oil and Its Major Constituents on Biofilm Formation of Staphylococcus aureus." Food Science. Zhong, Y., S. Li, L. Chen, Z. Liu, X. Luo, P. Xu and L. Chen (2018). "In Vivo Toxicity of Solasonine and Its Effects on cyp450 Family Gene Expression in the Livers of Male Mice from Four Strains." Toxins (Basel) 10 (12). Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-37431","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":737048,"identity":"4104f443-0204-4167-b98f-c78bb232cc2a","order_by":0,"name":"Longxue Li","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Longxue","middleName":"","lastName":"Li","suffix":""},{"id":737049,"identity":"5a1de93d-2c1f-4ee7-9b38-5fe33dc4b5c9","order_by":1,"name":"Suyun Xiao","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Suyun","middleName":"","lastName":"Xiao","suffix":""},{"id":737050,"identity":"e8c0e1e0-075d-43b6-a258-e8fd77eb227d","order_by":2,"name":"Weiqi Liu","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weiqi","middleName":"","lastName":"Liu","suffix":""},{"id":737051,"identity":"7f24deff-6b01-4b53-a4c5-6382e494c566","order_by":3,"name":"Dan Lei","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Lei","suffix":""},{"id":737052,"identity":"296de7b9-1b77-4369-b1f3-19f45a719b9a","order_by":4,"name":"Weiyue Deng","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weiyue","middleName":"","lastName":"Deng","suffix":""},{"id":737053,"identity":"812bcc18-f5e4-4a69-b962-30fb8b360256","order_by":5,"name":"Juan He","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"He","suffix":""},{"id":737054,"identity":"b00aafb6-315d-4499-9a1e-1a9afe6f24c6","order_by":6,"name":"Zhongrui Wu","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhongrui","middleName":"","lastName":"Wu","suffix":""},{"id":737055,"identity":"219e712c-10ef-4ee4-a5f3-df317f67a75b","order_by":7,"name":"Xiaoqin Tan","email":"","orcid":"","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoqin","middleName":"","lastName":"Tan","suffix":""},{"id":737056,"identity":"e9443bc4-a481-4c07-a424-e0dee4bd61c7","order_by":8,"name":"Shouming Li","email":"","orcid":"","institution":"Jiangxi Children Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shouming","middleName":"","lastName":"Li","suffix":""},{"id":737057,"identity":"5c59f613-2eab-493e-96c8-612b38665456","order_by":9,"name":"Zhiyong Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIie2PsWoCQRCGZ1k4m4nb5kjwGUa2EFGSVzkRksbiIH1YONBXWMFHSBEQUu+xkEpyrZBXsFixSWGRVS6k27UMZL/qH/g/ZgYgkfiDdDkABzpFtvhyNEYhVFjJfhVucl0+3ObaRJRTt43FDTo7JlVElA7KQ1na3kC8kERqkMAwt5+FDkOSmqwc6h1NVvSJA654vnwLK1MkO3ndbsjsvDJUJuNXEcW2Sl8hfSCZIqr0q7PSzKfM9y9Rsie/6FHSlr8z7Y/MdV0FfxHCrg94HPWoqefgjnf3QlS12weUlgrguvgZmIr2Pc9+n7mkmEgkEv+Rbzb4TXz1beJCAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-7553-7641","institution":"Jiangxi University of Traditional Chinese Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Zhiyong","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2020-06-22 06:13:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-37431/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-37431/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":1477844,"identity":"c98bcdcc-91e9-48f4-9ac8-ff13924dc836","added_by":"auto","created_at":"2020-07-02 13:11:22","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":123984,"visible":true,"origin":"","legend":"The volume of excreted urine was measured at 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 120, 144 hours; cumulative values were reported as mean ± SD for 6 rats in each group. *P\u003c 0.05 and **P\u003c 0.01 compared to the controls group.","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/1.jpg"},{"id":1477845,"identity":"15dd0c7a-844d-4f17-9357-9d7c7730f384","added_by":"auto","created_at":"2020-07-02 13:11:22","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":35043,"visible":true,"origin":"","legend":"Effects of Jiangxiangru and its three groups together with furosemide on urinary pH at the x-axis indicates assessment time points after oral administration; the values were reported as mean ± SD for 6 rats in each group. *P\u003c 0.05 and **P\u003c 0.01 compared to the controls group.","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/2.jpg"},{"id":1477846,"identity":"41fe563e-6a05-4a32-b2a2-c0d8797b3809","added_by":"auto","created_at":"2020-07-02 13:11:23","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":168960,"visible":true,"origin":"","legend":"Effects of Jiangxiangru and it’s three groups together with furosemide on urinary electrolyte Na+、K+、CL- concentrations at the x-axis indicates assessment time points after oral administration; The values were reported as mean ± SD for 6 rats in each group. *P\u003c 0.05 and **P\u003c 0.01 compared to the controls group.","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/3.jpg"},{"id":1477847,"identity":"d4de4ecf-f859-446c-93cb-39ea6ebc56fb","added_by":"auto","created_at":"2020-07-02 13:11:23","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1349227,"visible":true,"origin":"","legend":"Effects of Jiangxiangru and its three groups together with furosemide on the levels of Na+-K+-ATPase from rat urine (mol/l) at 144 h after oral administration; the values were reported as mean ± SD for 6 rats in each group. *P\u003c 0.05 and **P\u003c 0.01 compared to the controls group.","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/4.jpg"},{"id":1477848,"identity":"a5f6aa23-a069-4fd7-88ee-96b0160c7edc","added_by":"auto","created_at":"2020-07-02 13:11:23","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":96335,"visible":true,"origin":"","legend":"Effects of Jiangxiangru and its three groups together with furosemide on the levels of ANP, ADH and ALD from rat urine (pg/mL) at at 144h after oral administration; the values were reported as mean ± SD for 6 rats in each group. *P\u003c 0.05 and **P\u003c 0.01 compared to the controls groups.","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/5.jpg"},{"id":1477849,"identity":"8d5eb617-e62f-4ef6-a39c-6140445299b1","added_by":"auto","created_at":"2020-07-02 13:11:23","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":110225,"visible":true,"origin":"","legend":"Effects of Jiangxiangru and its three groups together with furosemide on the levels of AQPs from rat urine and serum at 144h after oral administration; the values were reported as mean ± SD for 6 rats in each group. *P\u003c 0.05 and **P\u003c 0.01 compared to the controls groups. (6A: The changes of AQP1, AQP2 and AQP3 aquaporin in rat serum, 6B: the protein levels of urine AQPs)","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/6.jpg"},{"id":15669258,"identity":"38dfe5f3-7b31-4ca8-b6c8-b371f0d214df","added_by":"auto","created_at":"2021-11-18 13:52:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1072591,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-37431/v1/a8b0f325-d0d8-4a58-8050-23b7920232cb.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eDiuretic activity and mechanism of \u003cem\u003eMosla chinensis Maxim. cv. Jiangxiangru \u003c/em\u003ein normal Rats\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eDiuretics have wide clinical application in treating edema caused by various reasons. They can also be used to treat hypertension(Xing hai ning, Li chen et al. 2016), kidney injury(Jeon, Kim et al. 2018), chronic heart failure(Qavi, Kamal et al. 2015), and other diseases(Alhanafy, Labeeb et al. 2018). As the medical research towards diuretics deepened, the increase in observed post-treatment clinical adverse reactions (Yang 2018) has turned the public attention to traditional Chinese medicines (TCMs)(Lin, Pan et al. 2014, Liu, Yang et al. 2019). In China, several TCMs are used as diuretic drugs (Jia and Jia 2016, Li, Cai et al. 2016, Gao, Bai et al. 2018). However, most of them are lacking pharmacological studies to reveal the molecular pathways that might be contributing to diuretic effects. \u003cem\u003eMosla chinensis Maxim. cv. Jiangxiangru\u003c/em\u003e (Chinese: \u003cem\u003eJiangxiangru\u003c/em\u003e, 江香薷) is one of these TCMs. It belongs to the the Labiates family and is a famous herbal TCM that is described in the authoritative medical book of Chinese Pharmacopoeia(CHINA 2015).\u003c/p\u003e\n\u003cp\u003eElsholtzia is the aerial part of \u003cem\u003eMosla chinensis Maximak\u003c/em\u003e or \u003cem\u003eM. chinensis Jiangxiangru \u003c/em\u003e(Liu, Wang et al. , Zhimin, Wang et al. 2016). \u003cem\u003eJiangxiangru\u003c/em\u003e, a herb mainly distributed in Yichun and Xinyu in Jiangxi Province of China, is genuinely a regional herb used in the Traditional Chinese Medicine(Liu, Wang et al. , Qi, Fang et al. 2015, Zhimin, Wang et al. 2016) (Chinese Pharmacopoeia). Elsholtzia can relieve the sweating caused by the heat in summer, and the effect is like ephedrine in winter(XianGuo 2013, lingyuan 2015). It tastes mild and warm, with effects including perspiration, diuresis, and resolving swelling, and dehumidification. Modern research shows that there are many chemical components in \u003cem\u003eJiangxiangru\u003c/em\u003e, such as flavonoids, terpenoids, glycosides, steroids, coumarins, organic acids, fats, and lignans(Hu, Xie et al. 2010). Different extracts of \u003cem\u003eJiangxiangru\u003c/em\u003e contain different active ingredients, and their pharmacological effects may also be different. Therefore, to increase the efficiency of further development of Jiangxiangru product and their usage, we tested the diuretic effects of Jiangxiangru over the decoction group, the water extract and the volatile oil. Amongst them, volatile oil is the main active ingredient and has antipyretic, anti-inflammatory and analgesic effects (Luo, Yang et al. 2006, Jiang, Lu et al. 2007, Hu, Xie et al. 2010, Li, Cui et al. 2014, Zhimin, Wang et al. 2016).\u003c/p\u003e\n\u003cp\u003eThe purpose of the study was to evaluate the diuretic activities in normal rats. We assessed the urine output volume, the urinary electrolyte concentrations (Na\u003csup\u003e+\u003c/sup\u003e\u003csub\u003e,\u003c/sub\u003e K\u003csup\u003e+\u003c/sup\u003e and Cl\u003csup\u003e-\u003c/sup\u003e) and pH value, the levels of Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase, atriopeptin (ANP), anti-diuretic hormone (ADH) and aldosterone (ALD), as well as AQPs levels for efficacy evaluation.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003estudy chemicals and reagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eJiangxiangru\u003c/em\u003e (batch number: 180823) was purchased from Jiangxi Jiangzhong Traditional Chinese Medicine Decoction Co., Ltd. The \u003cem\u003eJiangxiangru\u003c/em\u003e was placed in a round-bottom flask. After soaking in the proportion of distilled water to 1:10 for 30 minutes, the volatile oil was extracted by steam distillation for 5 hours then collected (yield: 0.67%). The volatile oil was prepared into 200 ml low and high concentration volatile oil solution with distilled water containing 2% Tween-80, respectively. The reduced crude drug amounts were 0.1791 and 1.4328 g/ ml, respectively. The water extract with low and high concentration was obtained by condensed extractpart of the extract, and the equivalent crude drug dosage was 0.1463 and 0.7317g/ml, respectively. \u003cem\u003eJiangxiangru\u003c/em\u003e decoction is decocted by pharmacy group of Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine [batch number: 121223, specification: 1g (crude drug)/1ml]; Furosemide tablets (Shanghai Chaohui Pharmaceutical Co., Ltd., batch number: 1811N10, specification: 20mg/tablet); rat aldosterone (ALD) ELISA kit (batch number: 201904), rat anti-diuretic hormone (ADH) enzyme-linked immunosorbent (ELISA) kit (batch number: 201904). Rat atrial natriuretic peptide (ANP) ELISA kit (batch number: 201904), rat Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase ELISA kit (batch number: 201903), rat aquaporin 1 (AQP1) ELISA kit (batch number: 201904), rat aquaporin 2 (AQP2) ELISA kit (batch number: 201904), rat aquaporin 3 (AQP3) ELISA kit (batch number: 201904) were purchased from Shanghai Herpeng Biology Company. Technology Co., Ltd. RNA kit (Beijing Quanshijin Biotechnology Co., Ltd.); Real-time PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, USA) and Corbbet Cycler (Qiagen, Valencia, CA, and USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal treatment and sample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFifty SPF-grade SD male rats weight range 180 \u0026plusmn;20g were provided by the Experimental Animal Science and Technology Center of Jiangxi University of Traditional Chinese Medicine with the certificate number SCXK (Gan) 2018-0003. Feeding was conducted in SPF barrier system of experimental animal science and technology center of Jiangxi University of Traditional Chinese Medicine, at a temperature of 20-23℃, humidity of 45%-55%, and the license number is SYXK (Gan) 2018-0004. All experiments were carried out in adherence with the guidelines of the Institutional Animal Care and Use Committee of China and were approved by the Animal Care and Research Committee of Jiangxi University of Traditional Chinese Medicine.\u003c/p\u003e\n\u003cp\u003eThe 50 rats were isolated for one week. After the isolation rats were placed in metabolic cage for 3 days; then on the 4\u003csup\u003eth\u003c/sup\u003e day, fasting (no water) for 18 hours. The rats were given 2.5ml/100g saline water to record the urine volume for 2 hours. The rats whose urine volume was more than 40% of the water supply were successfully established as saline water load model (Chen, Feng et al. , Feng, Chen et al. , Gao, Bai et al. 2018). It can be used in the following experiments.\u003c/p\u003e\n\u003cp\u003e48 rats were randomly divided into 8 groups: the model group (saline), the positive control group (furosemide 0.02g/kg), low and high dosage of water decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group (0.2 g/ml and 1g/ml), low and high dosage of water extract of \u003cem\u003eJiangxiangru\u003c/em\u003e group (0.1463g/ml and 0.7317g/ml), and the low and high dosage of volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e group (0.1791g/ml and 1.4328g/ml). Each group was assigned 6 rats. According to clinical TCM practice the dosage of \u003cstrong\u003e\u003cem\u003eJiangxiangru\u003c/em\u003e\u003c/strong\u003e for adults (60 kg/person) is 10~30 g/kg/day (Editorial Committee of Zhonghua Bencao National Traditional Chinese Herb Administration, 1999). For rats, this dosage is 0.166~1.5g/kg/day (raw herb). Thirty minutes after the successful establishment of the model, the rats were treated orally with corresponding doses of drugs at 10 ml/kg. The control group received an equivalent amount of water.\u003c/p\u003e\n\u003cp\u003eAfter administration, rats in each group were immediately put into metabolic cages. Urine samples were collected after 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 144 and 168 hours respectively. Urine volume at each time point was measured and urine K\u003csup\u003e+\u003c/sup\u003e, Na\u003csup\u003e+\u003c/sup\u003e, Cl\u003csup\u003e-\u003c/sup\u003econtent were measured with Beckman AU2700 biochemical analyzer. At the end of the experimental period, 4 mL of blood were collected in vacuum tubes from the abdominal aorta, allowed to clot on ice, and subsequently subjected to centrifugation at 3000 rpm at 4\u0026deg;C for 10 min. The supernatant was stored at -80\u0026deg;C for further analysis. All of the rats were sacrificed by cervical dislocation. The contents of ALD, ANP, ADH, Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase, the gene expression and protein levels of AQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e and AQP\u003csub\u003e3\u003c/sub\u003e in urine of rats in each group were determined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiochemical methods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEnzyme-linked immunosorbent assay (ELISA) kit was used to analyze ALD, ANP, ADH, Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase, AQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e and AQP\u003csub\u003e3\u003c/sub\u003e in urine. Rat urine was centrifuged at 3000 rpm for 10 min at 4 ℃ in an Eppendorf centrifuge. The supernatant was collected, and recombinant rat Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase, ANP, ADH, ALD, AQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e and AQP\u003csub\u003e3\u003c/sub\u003e were used to construct standard curves. The absorbance of standards and samples was determined spectrophotometrically at 450 nm using a Multiskan GO (Thermo scientific, USA) microplate reader. The results were plotted against the linear portion of a standard curve.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA-isolation and qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRenal medulla samples were cleaved by Trans Zol Up homogenized and added chloroform. The solution was divided into colorless aqueous phase and pink organic phase. RNA was adsorbed in aqueous phase by silica gel membrane centrifugal column. RNA was prepared by reverse transcription using a RNA kit. Real-time PCR was performed using Power SYBR Green PCR Master Mix and Corbbet Cycler. Each reaction was performed in 40 cycles with a total volume of 10 \u0026mu;l.\u003c/p\u003e\n\u003cp\u003ePrimer sequences and PCR amplification reactions were as according to the literature (Yan, Zeng et al. 2014). The internal reference gene of the experiment was GAPDH (Zhong, Li et al. 2018). The primer sequences and reaction systems are shown in Tables 1 and 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1 Primer sequences of genes were descripted for RT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"567\"\u003e\n\u003cp\u003eGene\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Forward primer (5' - 3\u0026rsquo;)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;Reverse primer (5' - 3')\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"567\"\u003e\n\u003cp\u003eAQP1\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; GACTACACTGGCTGTGGGATCAA\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;CCAGGGCACTCCCAATGAA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"567\"\u003e\n\u003cp\u003eAOP2\u0026nbsp; \u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;GGTTGCTCCATGAATCCAG\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;GGGGTCCGATCCAGAAGAGGA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"567\"\u003e\n\u003cp\u003eAQP3\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; ACTCCAGTGTGGAGGTGGAC\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;ACACTAGGAGTTGATCCCCG\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"567\"\u003e\n\u003cp\u003eGAPDH\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; TGGGTTTCCCGTTGATGA\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026nbsp;AGGGCTGCCTTCTCTTGT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2 Reaction\u0026nbsp;system\u0026nbsp;of\u0026nbsp;quantitative\u0026nbsp;PCR\u0026nbsp;assays\u003c/strong\u003e\u003c/p\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"227\"\u003e\n\u003cp\u003eReagent\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"218\"\u003e\n\u003cp\u003eVolume (\u0026mu;l)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"227\"\u003e\n\u003cp\u003ecDNA\u003c/p\u003e\n\u003cp\u003eddH2O\u003c/p\u003e\n\u003cp\u003eS YBR GREEN II\u003c/p\u003e\n\u003cp\u003eForward primer\u003c/p\u003e\n\u003cp\u003eReverse primer\u003c/p\u003e\n\u003cp\u003eROX correction fluid\u003c/p\u003e\n\u003cp\u003eTotal volume\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"218\"\u003e\n\u003cp\u003e1.0\u003c/p\u003e\n\u003cp\u003e3.0\u003c/p\u003e\n\u003cp\u003e5.0\u003c/p\u003e\n\u003cp\u003e0.4\u003c/p\u003e\n\u003cp\u003e0.4\u003c/p\u003e\n\u003cp\u003e0.2\u003c/p\u003e\n\u003cp\u003e10.0\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe mixed test solution was placed in a fluorescence quantitative PCR machine for reaction. The amplification reaction conditions were as following: 95 \u0026deg; C for 30 s; 95 \u0026deg; C for 10 s, 60 \u0026deg; C for 1 min, 40 cycles; then the reaction temperature was raised from 50 \u0026deg; C to 90 \u0026deg; C (1 \u0026deg; C every 6 s); The ct values of the reference gene and the target gene were collected; finally, the relative expression level of the target gene was calculated, and the data was processed according to the experimental method of Yang et al(Yang, Liu et al. 2015)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSPSS22.0 statistical software was used to analyze the experimental data. Data were expressed as mean \u0026plusmn; standard deviation (x \u0026plusmn;s). One way ANOVA and multiple comparisons between LSD groups were performed. The difference is considered significant When p \u0026lt; 0.05 or p \u0026lt; 0.01.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEffect on urinary excretion volume\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to determine whether \u003cem\u003eJiangxiangru\u003c/em\u003e has diuretic effect, we measured the urine volume of rats treated with \u003cem\u003eJiangxiangru\u003c/em\u003e or furosemide at 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 120, 144 hours. We found that 1 hour after administration, the urine volume of the low and high dosage of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group, the high dose of volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e group and positive control group increased significantly compared with the model group (P \u0026lt; 0.01 or P \u0026lt; 0.05). The effect of the high dose of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group was the most obvious, and the urine volume of other groups also increased, there was no significant difference (P \u0026gt; 0.05). At 2 hours after administration, the urine volume of rats in positive control group increased, but there was no significant difference (P \u0026gt; 0.05). At 3-5 hours after administration, the urine volume of rats in each group had no significant difference (P \u0026gt; 0.05); but at 24 hours and 96 hours after administration, the urine volume of rats in high-dose of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group increased, the difference was statistically significant(P \u0026lt; 0.05). This indicated that the water decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e had a longer effect than furosemide.\u003c/p\u003e\n\u003cp\u003eFrom Figure 1, compared with model group, the total urine volume of rats in high dose of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group and positive control group increased at 1h,6h,96h,120h,144h hours with statistical significance (P \u0026lt; 0.05), indicating that the water decoction of Mosla chinensis has obvious diuretic effect.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect on urinary pH\u003c/strong\u003e \u003cstrong\u003eand electrolyte concentrations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe changes of urinary ph and electrolytes in urine of rats at 1, 2, 3, 4, 5, 6, 24, 48, 72, 96, 120, 144 hours were observed (Fig. 2, Fig. 3). Compared with the model group, the contents of Na\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and Cl\u003csup\u003e-\u003c/sup\u003e in the urine of rats in the administration group did not change significantly, and the pH of the urine of rats in each group had no significant difference (P \u0026gt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect on \u003c/strong\u003e\u003cstrong\u003eurine levels of \u003c/strong\u003e\u003cstrong\u003eNa\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase,\u003c/strong\u003e \u003cstrong\u003eALD, ANP, ADH \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eELISA kit was used to verify whether \u003cem\u003eJiangxiangru\u003c/em\u003e could affect the contents of ALD, ANP, ADH and Na\u003csup\u003e+\u003c/sup\u003e-k\u003csup\u003e+\u003c/sup\u003e-ATPase in rat urine. Compared with model group, ALD secretion in urine of rats were increased in different treatment groups of \u003cem\u003eJiangxiangru\u003c/em\u003e, the difference was statistically significant between the high and low dosages of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group and the high dose of volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e group (P \u0026lt; 0.01 or P \u0026lt; 0.05). The contents of ANP in the urine of rats in the high and low dosage of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group and the high dose of volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e group increased. Among these groups, the high dosage of decoction has the most significantly difference (P \u0026lt; 0.05). The high dosage of water extract of \u003cem\u003eJiangxiangru\u003c/em\u003e reduced the amount of ADH (P \u0026gt; 0.05), while the high dosage of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group increased the content of ADH insignificantly (P \u0026gt; 0.05). There was no significant change in the content of Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase in urine of different treatment groups of \u003cem\u003eJiangxiangru\u003c/em\u003e (P \u0026gt; 0.05). The contents of ALD, ANP, ADH and Na\u003csup\u003e+\u003c/sup\u003e-k\u003csup\u003e+\u003c/sup\u003e-ATPase in plasma of rats in each group were compared as shown in Fig4 and Fig5.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe\u003c/strong\u003e\u003cstrong\u003e levels of \u003c/strong\u003e\u003cstrong\u003eAQP1, AQP2 and AQP3 in Rat Urine and serum \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to determine whether \u003cem\u003eJiangxiangru\u003c/em\u003e affects the contents of AQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e and AQP\u003csub\u003e3\u003c/sub\u003e in rat serum and urine, we used ELISA kit to detect the content of AQP\u003csub\u003es\u003c/sub\u003e proteins and RT-PCR to detect the gene expression of AQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e and AQP\u003csub\u003e3\u003c/sub\u003e in rat renal medulla. Compared with the model group, all groups of \u003cem\u003eJiangxiangru\u003c/em\u003e decreased the amount of \u003cem\u003eAQP\u003csub\u003e1\u003c/sub\u003e\u003c/em\u003e insignificantly (P \u0026gt; 0.05). \u003cem\u003eAQP\u003csub\u003e2\u003c/sub\u003e\u003c/em\u003e expression in the low dosage of decoction group (0.2g/ml) and low dosage of water extract (0.1463g/ml) of \u003cem\u003eJiangxiangru\u003c/em\u003e group have significantly decreased while the equivalent high dosage groups experienced no significant change. Water extract and volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e decreased the amount of\u003cem\u003e AQP\u003csub\u003e3\u003c/sub\u003e\u003c/em\u003e expression, and the difference was significant (P \u0026lt; 0.05 or P \u0026lt; 0.01). The changes of \u003cem\u003eAQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e\u003c/em\u003e and \u003cem\u003eAQP\u003csub\u003e3\u003c/sub\u003e\u003c/em\u003e aquaporin in rat serum are shown in Fig6A. At the same time, the protein levels of urine AQPs in each group were observed. The AQPs level results showed in Fig6B. All groups with \u003cem\u003eJiangxiangru\u003c/em\u003e administration had their furosemide of AQP\u003csub\u003e1\u003c/sub\u003e level significantly lower than that of the control group (P \u0026lt; 0.01). Low dosage of decoction group (0.2g/ml), low dosage of water extract group(0.1463g/ml), and high dosage of volatile oil group had significant difference in AQP\u003csub\u003e2\u003c/sub\u003e (P \u0026lt; 0.01). The AQP3 protein content of low-dose group of \u003cem\u003eJiangxiangru\u003c/em\u003e decoction, volatile oil group, and furosemide group were significantly lower than that of model control group (P \u0026lt; 0.01).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eUrine is the most intuitive indicator to detect whether drugs have diuretic effect. Urine production includes three processes: glomerular filtration, renal tubule and collecting duct reabsorption and secretion. Diuretics are medications producing diuretic effects of varying strength by acting on different parts of the renal tubule, thus affecting the pathway of urine production. The excretion of electrolytes is also related to the site of drug action. Classic diuretics mainly exert diuretic effect by increasing the excretion of Na\u003csup\u003e+\u003c/sup\u003e and Cl\u003csup\u003e-\u003c/sup\u003e after drug intervention as Na\u003csup\u003e+\u003c/sup\u003e and Cl\u003csup\u003e-\u003c/sup\u003e excretion positively influences diuresis. For example, furosemide mainly acts on the thick segment of the ascending branch of the medullary ridge, and reduces the reabsorption of Na\u003csup\u003e+\u003c/sup\u003e and Cl\u003csup\u003e-\u003c/sup\u003e by inhibiting Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-2Cl\u003csup\u003e-\u003c/sup\u003e co-transport, increases the excretion of NaCl, and increases the urinary H\u003csup\u003e+\u003c/sup\u003e and K\u003csup\u003e+\u003c/sup\u003e Excretion, which can cause hypokalemia. Therefore, it is crucial to determine the contents of Na\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and Cl\u003csup\u003e-\u003c/sup\u003e in urine of rats treated with \u003cem\u003eJiangxiangru\u003c/em\u003e. \u003cem\u003eJiangxiangru\u003c/em\u003e and its 3 delivery reagents had no effects on contents of Na\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and Cl\u003csup\u003e-\u003c/sup\u003e in urine. Therefore, we believe that the diuretic effect of Jiangxiang and each of it treatment group is not achieved by affecting Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-2Cl\u003csup\u003e-\u003c/sup\u003e co-transport.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The main function of ALD synthesized and secreted by adrenocortical globular zone cells is to increase the re-absorption of Na\u003csup\u003e+\u003c/sup\u003e and water, promote K\u003csup\u003e+\u003c/sup\u003e excretion and maintain the balance of water-salt metabolism. The active polypeptide ANP synthesized and secreted by the atrium is also known as atrial natriuretic factor or atrial natriuretic peptide. Its main functions are natriuretic, diuretic, inhibiting rennin release and ALD secretion. ADH is secreted by the hypothalamus and its main function is to promote water reabsorption. The diuretic activity and mechanism of drugs are not only related to the levels of related diuretic hormones (ALD, ADH, ANP), but also to the levels of aquaporin in urine regulated by hormones. Therefore, this study explored the diuretic activity and its mechanism of \u003cem\u003eJiangxiangru\u003c/em\u003e related diuretic hormones (ALD, ADH, and ANP). \u003cem\u003eJiangxiangru\u003c/em\u003e and its 3 delivery reagents had no effects on the anti-metabolite enzymes. The results showed that the high dosage of decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group can increase the secretion of ALD and increase the secretion of ANP, especially the effect of ALD on dose-response relationship, suggesting that the aqueous extract of \u003cem\u003eJiangxiangru\u003c/em\u003e has diuretic effect. There was also anti-diuretic effect, which is related to the multi-component and multi-target characteristics of traditional Chinese medicine. The volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e also has similar action characteristics.\u003c/p\u003e\n\u003cp\u003eAdditionally, from the influence of gene expression and protein level of AQP, \u003cem\u003eJiangxiangru\u003c/em\u003e showed complex urinary production effects. The three preparations groups significantly down-regulated the expression of \u003cem\u003eAQP\u003csub\u003e1\u003c/sub\u003e\u003c/em\u003e gene, and the protein level was significantly lower than that of the control group. The group of decoction showed an increase in the expression of \u003cem\u003eAQP\u003csub\u003e2\u003c/sub\u003e\u003c/em\u003e and \u003cem\u003eAQP\u003c/em\u003e\u003csub\u003e3\u003c/sub\u003e genes, and the protein also increased. The other groups down-regulated the expression of \u003cem\u003eAQP\u003csub\u003e2\u003c/sub\u003e\u003c/em\u003e and \u003cem\u003eAQP\u003c/em\u003e\u003csub\u003e3\u003c/sub\u003e genes, and the protein was lower than the control group.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe contents of Na\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and Cl\u003csup\u003e-\u003c/sup\u003e and PH in urine of rats don\u0026rsquo;t change significantly in this experiment. The diuretic effect of \u003cem\u003eJiangxiangru\u003c/em\u003e could not cause electrolyte disturbance and other adverse reactions. This fully reflects the complex composition of traditional Chinese medicine, the role of multi-target characteristics.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e :All experiments were carried out in adherence with the guidelines of the Institutional Animal Care and Use Committee of China and were approved by the Animal Care and Research Committee of Jiangxi University of Traditional Chinese Medicine.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All participants agreed to publish.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e The data used to support the findings of this study are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e The authors have no conflicts of interest to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003eThis research was supported by Double-First Class discipline construction project (No. JXSYLXK-ZHYA0138).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions \u003c/strong\u003e:(I) Conception and design: Zhiyong Liu; (II) Administrative support: Suyun Xiao., Dan Lei; (III) Provision of study materials: Longxue Li., Kun Shu. Weiyue Deng.; (IV) Collection and assembly of data: Yun Huang.,Weiqi Liu , Juan He., Zhongrui Wu.; (V) Data analysis and interpretation: Shouming Li ; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003eThanks to Kun Shu for some of the experiments in the manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e\"Structure and biological activities of a pectic polysaccharide from Mosla chinensis Maxim. cv. Jiangxiangru.\" Carbohydr Polym \u003cstrong\u003e105\u003c/strong\u003e: 276-284.\u003c/p\u003e\n\u003cp\u003eAlhanafy, A. M., A. Labeeb and A. Khalil (2018). \"The Role of Diuretics in Treatment of Aromatase Inhibitors Induced Musculoskeletal Symptoms in Women with Non Metastatic Breast Cancer.\" Asian Pac J Cancer Prev \u003cstrong\u003e19\u003c/strong\u003e(12): 3525-3531.\u003c/p\u003e\n\u003cp\u003eChen, D.-Q., Y.-L. Feng, T. Tian, H. Chen, L. Yin, Y.-Y. Zhao and R.-C. Lin \"Diuretic and anti-diuretic activities of fractions of Alismatis rhizoma.\" Journal of Ethnopharmacology \u003cstrong\u003e157\u003c/strong\u003e: 114-118.\u003c/p\u003e\n\u003cp\u003eCHINA, P. C. o. t. M. o. H. o. t. P. s. R. o. (2015). Pharmacopoeia of the People's Republic of China: 2015 edition. One.\u003c/p\u003e\n\u003cp\u003eFeng, Y.-L., H. Chen, T. Tian, D.-Q. Chen, Y.-Y. Zhao and R.-C. Lin \"Diuretic and anti-diuretic activities of the ethanol and aqueous extracts of Alismatis rhizoma.\" Journal of Ethnopharmacology \u003cstrong\u003e154\u003c/strong\u003e(2): 386-390.\u003c/p\u003e\n\u003cp\u003eGao, L., Y. Bai, X. b. Feng and L. m. Zheng (2018). \"Diuresis effects of astragalus membranaceus its paired drugs in the saline loading rat model of qi deficiency.\" World Journal of Integrated Traditional and Western Medicine \u003cstrong\u003e13\u003c/strong\u003e(10): 1344-1347.\u003c/p\u003e\n\u003cp\u003eHu, H. W., X. M. Xie, P. Z. Zhang and R. G. Shu (2010). \"[Study on the flavonoids from Mosla chinensis 'jiangxiangru'].\" Zhong Yao Cai \u003cstrong\u003e33\u003c/strong\u003e(2): 218-219.\u003c/p\u003e\n\u003cp\u003eJeon, J., D. H. Kim, S. I. Baeg, E. J. Lee, C. R. Chung, K. Jeon, J. E. Lee, W. Huh, G. Y. Suh, Y. G. Kim, D. J. Kim, H. Y. Oh and H. R. Jang (2018). \"Association between diuretics and successful discontinuation of continuous renal replacement therapy in critically ill patients with acute kidney injury.\" Crit Care \u003cstrong\u003e22\u003c/strong\u003e(1): 255.\u003c/p\u003e\n\u003cp\u003eJia, K. and T. Jia (2016). \"Comparison of Antidiuretic Activity of Ootheca Mantidis before and after Processing and Its Medicinal Part against Insufficiency of Kidney-Yang and Diuresis Rats.\" China Pharmacy \u003cstrong\u003e27\u003c/strong\u003e(07): 879-882.\u003c/p\u003e\n\u003cp\u003eJiang, H. M., X. Y. Lu, J. Fang, X. L. Xu, K. Yi and B. Ge (2007). \"[Study on extraction technology of Mosla chinensis volatile oil].\" Zhong Yao Cai \u003cstrong\u003e30\u003c/strong\u003e(9): 1135-1139.\u003c/p\u003e\n\u003cp\u003eLi, j., p. Cai, j. Zhang and l. Pan (2016). \"Medicinal Study on Pteridophytes in Diuresis and Lincolysis.\" Chinese Journal of Ethnic Medicine \u003cstrong\u003e22\u003c/strong\u003e(03): 52-53.\u003c/p\u003e\n\u003cp\u003eLi, J. E., S. W. Cui, S. P. Nie and M. Y. Xie (2014). \"Structure and biological activities of a pectic polysaccharide from Mosla chinensis Maxim. cv. Jiangxiangru.\" Carbohydr Polym \u003cstrong\u003e105\u003c/strong\u003e: 276-284.\u003c/p\u003e\n\u003cp\u003eLin, N., J. Pan and N. Guan (2014). \"Diuretic Mechanism of Astragalus in Mice and Its Material Basis.\" Pharmacy Today \u003cstrong\u003e24\u003c/strong\u003e(07): 481-483+488.\u003c/p\u003e\n\u003cp\u003elingyuan, Z. (2015). Theoretical research based on pathogenesis of summer stagnation, Beijing University of Chinese Medicine.\u003c/p\u003e\n\u003cp\u003eLiu, Y., Z. Wang and J. Zhang \"Dietary Chinese Herbs || Mosla chinensis Maxim. 香薷 (Xiangru, Chinese Mosla Herb).\" Springer Vienna \u003cstrong\u003e10.1007/978-3-211-99448-1\u003c/strong\u003e(Chapter 73): 637-644.\u003c/p\u003e\n\u003cp\u003eLiu, Y., Z. Wang and J. Zhang \"Dietary Chinese Herbs || Mosla chinensis Maxim. 香薷 (Xiangru, Chinese Mosla Herb).\"\u0026nbsp; \u003cstrong\u003e10.1007/978-3-211-99448-1\u003c/strong\u003e(Chapter 73): 637-644.\u003c/p\u003e\n\u003cp\u003eLiu, Z., L. Yang, L. Li, R. Wei, X. Luo, T. Xu, Y. Huang, Z. Mu and J. He (2019). \"Diuretic and Antidiuretic Activities of Ethanol Extract and Fractions of Lagopsis supina in Normal Rats.\" BioMed Research International \u003cstrong\u003e2019\u003c/strong\u003e: 8.\u003c/p\u003e\n\u003cp\u003eLuo, G. M., G. Y. Yang, H. Y. Liu, Y. Chen, X. Li and Y. Q. Yang (2006). \"[Optimization of the extraction technology for the essential oil from Mosla chinensis Maxim].\" Zhong Yao Cai \u003cstrong\u003e29\u003c/strong\u003e(3): 284-286.\u003c/p\u003e\n\u003cp\u003eQavi, A. H., R. Kamal and R. W. Schrier (2015). \"Clinical Use of Diuretics in Heart Failure, Cirrhosis, and Nephrotic Syndrome.\" Int J Nephrol \u003cstrong\u003e2015\u003c/strong\u003e: 975934.\u003c/p\u003e\n\u003cp\u003eQi, M., W. J. Fang, X. Y. Zhang, G. M. Luo and S. O. Pharmacy (2015). \"The Research Progress of M. chinensis- jiangxiangru's Chemical Components and Pharmacological Effects.\" Journal of Jiangxi University of Traditional Chinese Medicine.\u003c/p\u003e\n\u003cp\u003eXianGuo, H. (2013). \"Talk about hot weather and dampness of the role of Elsholtzia.\" Chinese Traditional Medicine Modern Distance Education(17): 156-156.\u003c/p\u003e\n\u003cp\u003eXing hai ning, Li chen and W. lin (2016). \" Study on Diuretics Application in Treatment of Hypertension.\" World Latest Medicine Information (Electronic Version) \u003cstrong\u003e16\u003c/strong\u003e(15): 13-14.\u003c/p\u003e\n\u003cp\u003eYan, S., J. Zeng, Y. Bi, J. Wei, ., X. Wang, G. Luo, J. Zhu and G. Ren (2014). \"Effects of plantago asiatica L.seeds on diuretic activity aquaporins and ion channels in normal rats.\" chin hosp pharm J \u003cstrong\u003e34\u003c/strong\u003e(12): 968-971.\u003c/p\u003e\n\u003cp\u003eYang, A., Z. Liu, B. Yan, M. Zhou and X. Xiong (2015). \"Preparation of camptothecin-loaded targeting nanoparticles and their antitumor effects on hepatocellular carcinoma cell line H22.\" Drug Delivery \u003cstrong\u003e23\u003c/strong\u003e(5): 1.\u003c/p\u003e\n\u003cp\u003eYang, b. (2018). \"Rational use of diuretics.\" China Food and Drug Administration(10): 42-49.\u003c/p\u003e\n\u003cp\u003eZhimin, L. I., M. Wang, L. Peng and S. O. Pharmacy (2016). \"Chemical Composition Analysis of Essential Oil from Mosla chinensis Maxim. cv. Jiangxiangru and Inhibitory Activity of the Oil and Its Major Constituents on Biofilm Formation of Staphylococcus aureus.\" Food Science.\u003c/p\u003e\n\u003cp\u003eZhong, Y., S. Li, L. Chen, Z. Liu, X. Luo, P. Xu and L. Chen (2018). \"In Vivo Toxicity of Solasonine and Its Effects on cyp450 Family Gene Expression in the Livers of Male Mice from Four Strains.\" Toxins (Basel) \u003cstrong\u003e10\u003c/strong\u003e(12).\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Mosla chinensis Maxim. cv. Jiangxiangru, Diuretic activity, hormone, AQPS","lastPublishedDoi":"10.21203/rs.3.rs-37431/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-37431/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003e\u003cem\u003eJiangxiangru\u003c/em\u003e, a commonly used clinical Chinese medicine, has been investigated mainly over its effects on Summer heatstroke and the dampness inside the spleen and stomach. This study focuses on the diuretic effect of \u003cem\u003eJiangxiangru\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003ein normal\u003cstrong\u003e \u003c/strong\u003erats as well as the underlying mechanism.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e:\u003cstrong\u003e \u003c/strong\u003e48 rats were randomly divided into the model group (saline), the positive control group (furosemide 0.02g/kg), low and high dosage of water decoction of \u003cem\u003eJiangxiangru\u003c/em\u003e group (0.2 g/ml and 1g/ml), low and high dosage of water extract of \u003cem\u003eJiangxiangru\u003c/em\u003e group (0.1463g/ml and 0.7317g/ml), and the low and high dosage of volatile oil of \u003cem\u003eJiangxiangru\u003c/em\u003e group (0.1791g/ml and 1.4328g/ml). Each group was assigned 6 rats.\u003cstrong\u003e \u003c/strong\u003eThirty minutes after the successful establishment of the model, the rats were treated orally with corresponding doses of drugs at 10 ml/kg. The control group received an equivalent amount of water. After administration, Urine volume at each time point was measured and urine K\u003csup\u003e+\u003c/sup\u003e, Na\u003csup\u003e+\u003c/sup\u003e, Cl\u003csup\u003e- \u003c/sup\u003econtent were measured. The contents of ALD, ANP, ADH, Na\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase, the gene expression and protein levels of AQP\u003csub\u003e1\u003c/sub\u003e, AQP\u003csub\u003e2\u003c/sub\u003e and AQP\u003csub\u003e3\u003c/sub\u003e in urine of rats in each group were determined. SPSS22.0 statistical software was used to analyze the experimental data. One way ANOVA and multiple comparisons between LSD groups were performed. The difference is considered significant When p \u0026lt; 0.05 or p \u0026lt; 0.01.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e:\u003cstrong\u003e \u003c/strong\u003eOur results showed that \u003cem\u003eJiangxiangru\u003c/em\u003e decoction group has the strongest diuretic effect, followed by water extract, then the volatile oil. The diuretic mechanism of \u003cem\u003eJiangxiangru\u003c/em\u003e may affect the kidney in addition to the hormone level related to the change of body fluid metabolism. The distal convoluted tubules are related to the content of aquaporin AQP in the collecting tube, thereby inhibiting water reabsorption.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: The contents of Na\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and Cl\u003csup\u003e-\u003c/sup\u003e and PH in urine of rats don’t change significantly in this experiment. The diuretic effect of \u003cem\u003eJiangxiangru\u003c/em\u003e could not cause electrolyte disturbance and other adverse reactions. This fully reflects the complex composition of traditional Chinese medicine, the role of multi-target characteristics.\u003c/p\u003e","manuscriptTitle":"Diuretic activity and mechanism of Mosla chinensis Maxim. cv. Jiangxiangru in normal Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-07-02 13:11:22","doi":"10.21203/rs.3.rs-37431/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f32ec364-90e6-46e4-a6be-97970e53078d","owner":[],"postedDate":"July 2nd, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":136278,"name":"Urology \u0026 Nephrology"}],"tags":[],"updatedAt":"2020-07-03T18:02:33+00:00","versionOfRecord":[],"versionCreatedAt":"2020-07-02 13:11:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-37431","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-37431","identity":"rs-37431","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00