Human TP53 gene polymorphisms among patients with... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/8-1364" }, "headline": "Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection...", "datePublished": "2019-08-06T12:29:07", "dateModified": "2024-03-12T16:35:00", "author": [ { "@type": "Person", "name": "Missiani Ochwoto" }, { "@type": "Person", "name": "Colins O. Oduma" }, { "@type": "Person", "name": "Julius Oyugi" }, { "@type": "Person", "name": "Dufton Mwaengo" }, { "@type": "Person", "name": "Bartholomew N. Ondigo" }, { "@type": "Person", "name": "James H. Kimotho" }, { "@type": "Person", "name": "Alex K. Maiyo" }, { "@type": "Person", "name": "Ruth M. Nyangacha" }, { "@type": "Person", "name": "Gladys Chesumbai" }, { "@type": "Person", "name": "Elijah Songok" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Human TP53 is the gatekeeper for generation of human cells and is highly conserved. Some alteration/mutation in TP53 adversely affects the regulatory function of the protein, potentially resulting in cancer. This study investigated mutations in codons 72 and 249 of TP53, among patients with hepatocellular carcinoma (HCC) and chronic hepatitis B virus (HBV) infection at the Moi Teaching and Referral Hospital (MTRH), Eldoret, Kenya. Methods In total, 33 HBV-positive patients attending MTRH hospital between September 2013 and July 2017 were purposely selected from medical records for the study; those with HCC were confirmed from the cancer registry. The patients were aged between 25-67 years, with a male-to-female ratio of 1.1:1. Blood samples were collected from the patients. DNA was extracted, amplified and sequenced using TP53 forward and reverse primers. Gene mutation detection and analysis was done on exons 4 codon 72 and exon 7 codon 249. Results Of the 33 patients, 75.8% were chronically infected with HBV and had HCC; the rest were HBsAg positive without HCC. Homozygous proline was prevalent (54.5%) at exon 4 codon 72, followed by heterozygous Arg/Pro (33.3%) and lastly homozygous Arg/Arg (12.1%). Pro/Pro allele was frequent in HCC group while Arg/Arg allele was common in patients without HCC. There was no significant association between the HCC and codon polymorphisms (P=0.12). In exon 7, codon 249, 24.2% of patients had an Arg/Ser mutation of which, 75.0% had HCC and 25.0% did not. There was no significant association between HCC patients and codon 249 mutation (P=0.15). Conclusion TP53 is a gene gate keeper, the mutations under study may dependently play a role in HCC development. This study did not find any association between TP53 mutations and presence of HCC. Therefore, TP53 Arg-72 and Ser-249 mutation is not a clear prognosis indicator for hepatocellular carcinoma among HBV infected patients in Kenya. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/8-1364", "name": "Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma..." } } ] } Home Browse Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Ochwoto M, Oduma CO, Oyugi J et al. Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.12688/f1000research.19416.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Revised Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] Missiani Ochwoto https://orcid.org/0000-0001-7143-7283 1,2 , Colins O. Oduma https://orcid.org/0000-0001-9678-8143 3 , Julius Oyugi 2 , [...] Dufton Mwaengo 2 , Bartholomew N. Ondigo https://orcid.org/0000-0003-3607-9964 1,3 , James H. Kimotho 1 , Alex K. Maiyo 1 , Ruth M. Nyangacha 1 , Gladys Chesumbai 4 , Elijah Songok 1 Missiani Ochwoto https://orcid.org/0000-0001-7143-7283 1,2 , Colins O. Oduma https://orcid.org/0000-0001-9678-8143 3 , [...] Julius Oyugi 2 , Dufton Mwaengo 2 , Bartholomew N. Ondigo https://orcid.org/0000-0003-3607-9964 1,3 , James H. Kimotho 1 , Alex K. Maiyo 1 , Ruth M. Nyangacha 1 , Gladys Chesumbai 4 , Elijah Songok 1 PUBLISHED 12 Mar 2024 Author details Author details 1 Kenya Medical Research Institute,, Nairobi, Kenya 2 Microbiology Department, University of Nairobi, Nairobi, Kenya 3 Department of Biochemistry and Molecular Biology, Egerton University, Nakuru, Kenya 4 Eldoret Cancer Registry, Moi Teaching and Referral Hospital, Eldoret, Kenya Missiani Ochwoto Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Colins O. Oduma Roles: Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing – Original Draft Preparation, Writing – Review & Editing Julius Oyugi Roles: Funding Acquisition, Project Administration, Resources, Supervision, Writing – Review & Editing Dufton Mwaengo Roles: Project Administration, Resources, Supervision, Writing – Review & Editing Bartholomew N. Ondigo Roles: Methodology, Project Administration, Supervision, Writing – Review & Editing James H. Kimotho Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Alex K. Maiyo Roles: Data Curation, Formal Analysis, Investigation, Methodology, Validation, Visualization Ruth M. Nyangacha Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Gladys Chesumbai Roles: Formal Analysis, Project Administration, Supervision, Visualization Elijah Songok Roles: Funding Acquisition, Resources, Software, Supervision, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract Background Human TP53 is the gatekeeper for generation of human cells and is highly conserved. Some alteration/mutation in TP53 adversely affects the regulatory function of the protein, potentially resulting in cancer. This study investigated mutations in codons 72 and 249 of TP53 , among patients with hepatocellular carcinoma (HCC) and chronic hepatitis B virus (HBV) infection at the Moi Teaching and Referral Hospital (MTRH), Eldoret, Kenya. Methods In total, 33 HBV-positive patients attending MTRH hospital between September 2013 and July 2017 were purposely selected from medical records for the study; those with HCC were confirmed from the cancer registry. The patients were aged between 25-67 years, with a male-to-female ratio of 1.1:1. Blood samples were collected from the patients. DNA was extracted, amplified and sequenced using TP53 forward and reverse primers. Gene mutation detection and analysis was done on exons 4 codon 72 and exon 7 codon 249. Results Of the 33 patients, 75.8% were chronically infected with HBV and had HCC; the rest were HBsAg positive without HCC. Homozygous proline was prevalent (54.5%) at exon 4 codon 72, followed by heterozygous Arg/Pro (33.3%) and lastly homozygous Arg/Arg (12.1%). Pro/Pro allele was frequent in HCC group while Arg/Arg allele was common in patients without HCC. There was no significant association between the HCC and codon polymorphisms (P=0.12). In exon 7, codon 249, 24.2% of patients had an Arg/Ser mutation of which, 75.0% had HCC and 25.0% did not. There was no significant association between HCC patients and codon 249 mutation (P=0.15). Conclusion TP53 is a gene gate keeper, the mutations under study may dependently play a role in HCC development. This study did not find any association between TP53 mutations and presence of HCC. Therefore, TP53 Arg-72 and Ser-249 mutation is not a clear prognosis indicator for hepatocellular carcinoma among HBV infected patients in Kenya. READ ALL READ LESS Keywords p53 Gene mutation, Codon 249, Hepatocellular carcinoma, p53 Exon 4, p53 exon 7 Corresponding Author(s) Missiani Ochwoto ( [email protected] ) Close Corresponding author: Missiani Ochwoto Competing interests: No competing interests were disclosed. Grant information: This work was supported by KEMRI IRG grant from Kenya Medical Research Institute, protocol Number KEMRI/SERU/ CVR/001/3211 and IRG Number L057. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2024 Ochwoto M et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Ochwoto M, Oduma CO, Oyugi J et al. Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.12688/f1000research.19416.2 ) First published: 06 Aug 2019, 8 :1364 ( https://doi.org/10.12688/f1000research.19416.1 ) Latest published: 12 Mar 2024, 8 :1364 ( https://doi.org/10.12688/f1000research.19416.2 ) Revised Amendments from Version 1 The main reason for this version is to submit our responses addressing comments raised by the reviewers (Lamech Mwapagha and Harris Onywera) so that we complete the publication process. In this version, we have deleted information on exon 6 so that this publication will concentrate on polymorphisms of exon 4 and 7. Abstract: We have edited the conclusion to align with the findings “TP53 Arg-72 and Ser-249 mutation is not a clear prognosis indicator for hepatocellular carcinoma.” In methods : We have provided the justification of conducting the study at MTRH. All reagents and machines used have the name, the manufacturer and town/city. In PCR amplification, we have provided expected band size in the electrophoresis. In Results : We have provided GenBank accession numbers (MN119310-MN119350) of the sequences generated for confirmation. We have provided Figure 2, which is a summary of aligned TP53 exon 4, codon 72 amino acids sequence. This figure will provide a quick visualization of the mutations. We have provided additional information in caption of Figure 1 to explain the details in the figure. Meaning of abbreviation used in Table 3 and Table 4 are now explained below each table. In discussion we added a statement as one of the limitations of the study as suggested by the reviewers. In reference , we have added reference 9 (Hall et al., 2011) and 30 (Kumar et al., 2016). The main reason for this version is to submit our responses addressing comments raised by the reviewers (Lamech Mwapagha and Harris Onywera) so that we complete the publication process. In this version, we have deleted information on exon 6 so that this publication will concentrate on polymorphisms of exon 4 and 7. Abstract: We have edited the conclusion to align with the findings “TP53 Arg-72 and Ser-249 mutation is not a clear prognosis indicator for hepatocellular carcinoma.” In methods : We have provided the justification of conducting the study at MTRH. All reagents and machines used have the name, the manufacturer and town/city. In PCR amplification, we have provided expected band size in the electrophoresis. In Results : We have provided GenBank accession numbers (MN119310-MN119350) of the sequences generated for confirmation. We have provided Figure 2, which is a summary of aligned TP53 exon 4, codon 72 amino acids sequence. This figure will provide a quick visualization of the mutations. We have provided additional information in caption of Figure 1 to explain the details in the figure. Meaning of abbreviation used in Table 3 and Table 4 are now explained below each table. In discussion we added a statement as one of the limitations of the study as suggested by the reviewers. In reference , we have added reference 9 (Hall et al., 2011) and 30 (Kumar et al., 2016). To read any peer review reports and author responses for this article, follow the "read" links in the Open Peer Review table. READ REVIEWER RESPONSES Abbreviations AFB1: Aflatoxin B1; BLAST: Basic Local Alignment Search Tool; CHB: Chronic Hepatitis B; DNA: Deoxyribonucleic acid; EDTA: Ethylene diamine tetra acetic acid; G: Guanine; HBsAg: Hepatitis B surface Antigen; HBV: Hepatitis B virus; HCC: Hepatocellular carcinoma; HCV: Hepatitis C virus; KEMRI: Kenya Medical Research Institute; MEGA: Molecular Evolutionary Genetics Analysis; IARC: International Agency for Research on Cancer; MTRH: Moi Teaching and Referral Hospital; NCBI: National Center for Biotechnology Information; PCR: Polymerase Chain Reaction; T: Thymine. Introduction Hepatocellular carcinoma (HCC) is the fourth most common malignancy according to the World Health Organization (2022) . HCC is increasing in incidence and has a mortality incidence of 800,000 deaths globally per year ( Stewart et al ., 2016 ). Reported incidences of HCC vary worldwide, with the West, Asia and Africa having the highest incidence rates. According to report on the Global Burden of Disease Cancer Collaboration et al. (2017) HCC is the fifth and seventh most common cancer in men and women, respectively. There are various causes of HCC, of which the most common is chronic infection with hepatitis B virus (HBV) and hepatitis C virus (HCV). In Kenya, those infected with HBV constitute 78.0% of HCC cases ( Mutuma et al ., 2011 ). HCC is the primary liver cancer derived from uncontrolled multiplication of hepatocytes ( Gomes et al ., 2013 ). Just like in any other cancer, TP53 has a crucial role in HCC tumor suppression. The gene hampers progression of the cell cycle if DNA is damaged ( Kruiswijk et al ., 2015 ; Sasaki et al ., 2011 ), a role that is inactivated in most cancers mainly through alteration in TP53 , which can be caused by external agents ( Gomes et al ., 2013 ; Tokino & Nakamura, 2000 ). TP53 alterations are observed in most cancers and they affect major regulators of various signaling pathways involved in tumor suppression ( Kandoth et al ., 2013 ; Yang et al. , 2013 ). TP53 has ten coding exons, with mutations distributed in all of them, with a strong predominance in exons 4–9, encoding the DNA-binding domain of the protein ( Rivlin et al ., 2015 ). Studies have demonstrated that mutant TP53 contributes immensely to replication of damaged DNA and to tumor progression. These mutant proteins bind to TP53 response elements thereby weakening the process of DNA repair and TP53 -mediated apoptosis ( Carvajal et al ., 2012 ; Maiuri et al ., 2010 ). In exon 7, codon 249 (AGG→AGT, arginine to serine) has been identified as a “hotspot”. Differences in ethnicity and geographical location among other factors have varied impact on TP53 codon 249 (AGG→AGT) mutation profiles ( Kandoth et al ., 2013 ; Wen et al ., 2016 ). In exon 4, an arginine to Proline substitution at codon 72 has been investigated as risk modifier in several cancer models; however, its role in cancer progression remains uncertain. There is paucity of information on TP53 in Kenya. In this study, we evaluated the presence of TP53 gene mutations in exons 4 and 7 among HCC patients attending Moi Teaching and Referral Hospital (MTRH), in western region of Kenya. Methods Study site and sample population The samples were collected from jaundiced patients chronically infected with HBV attending MTRH, Eldoret, Kenya between September 2013 and July 2017. The MTRH was selected as it is one of the largest national referral hospitals in western Kenya, where rates of HBV infection was found to be 50% among patient with jaundice ( Ochwoto et al ., 2016 ). A mixed method designs were used in this study. First, patients were purposively selected from hospital records based on them being jaundiced and HBV-positive with or without HCC. Secondly, the patients were contacted and then recruited in person. Lastly, those with HCC had their cancer status confirmed using the cancer registry of Eldoret Hospital, Uasin Gishu, Kenya. A patient with HCC was defined as having liver cancer based on the patient’s medical record and cancer registry file. All patients with HCC were selected. Other patients’ medical records obtained from the hospital included gender and residential area. The male-to-female ratio was 1.1:1 and the age range was from 25 to 67 years. None of the patients had received any viral HBV treatment by the time of sample collection. Ethical consideration The ethical approval to conduct the study was obtained from Institutional Research and Ethics Committee (IREC) of MTRH/Moi University (approval number 001002), from Kenya Medical Research Institute Scientific Ethics Review Unit (approval number KEMRI/SERU/CVR/001/3211) and from Eldoret Cancer Registry (approval number ECR/DRA/2017/001). Further, the participants had to provide informed consent for the study prior to blood draw. Collection and preparation of blood samples Blood samples were collected in vials anti-coagulated with EDTA. Plasma was separated at MRTH and thereafter the plasma tubes were shipped on dry ice to the KEMRI Production Unit in Nairobi. The samples were then stored in aliquots at -80°C until subsequent testing. Serological testing Screening for hepatitis B virus surface antigen (HBsAg) and antibody to the core protein (anti-HBc) were performed using the COBAS e411 platform (Elecsys; Roche Diagnostics, Quebec, Canada). Chronic hepatitis B (CHB) was determined by anti-HBc IgM positive serology, as described previously ( Park et al ., 2015 ). Extraction of DNA from plasma Circulating DNA of Human TP53 tumor suppressor gene was extracted from 200 µl of plasma samples using QIAmp DNA mini-extraction kit (Qiagen Inc, Germantown, Maryland, USA) according to manufacturer’s instructions. The DNA was subsequently eluted in 60 µl of AE buffer and quantity measured by NanoDrop spectrophotometer (Thermo Scientific, Wilmington, Delaware USA) and stored at -30°C until use. PCR amplification of human TP53 Three different primers targeting TP53 gene exons 4 and 7 ( Table 1 ) were used in amplification of the DNA extracts using conventional PCR. The PCR mix targeting the two exons was similar except for the primer. Each PCR tube contained a total volume of 50 µl reaction mixture, with 5 µl of 10 µg human genomic DNA template or AE buffer for negative controls, 5 µl of 10X PCR buffer 5 µl of 25 mM MgCl 2 , 5 µl of 1.25mM dNTP mix, 0.2 µl of 5U of Taq DNA polymerase (Qiagen Inc, Germantown, Maryland, USA), 1.25 µl each of a 20 uM stock of forward and reverse primer of sequences ( Table 1 ). Table 1. Primers used for TP53 PCR amplification and sequencing. Primer Sequence (5’ to 3’) Expected band size Exon 4 forward ATCTACAGTCCCCCTTGCCG 296bp Exon 4 reverse GCAACTGACCGTGCAAGTCA Exon 7 forward CTTGCCACAGGTCTCCCCAA 254bp Exon 7 reverse AGGGGTCAGCGGCAAGCAGA The mix was loaded to Veriti, 96 well thermal cycler machine (ABI systems Foster, California, USA). PCR amplification profile for exon 7 was set at 95°C for 10 minutes initial denaturation and 35 cycles of denaturation at 95°C for 45 seconds, annealing at 58°C for 30 seconds and extension at 72°C 30 seconds. Final extension was at 72°C for 10 minutes. For exon 4 the PCR amplification profile was set at 94°C for 12 minutes initial denaturation and 35 cycles of denaturation at 94°C for 40 seconds, annealing at 56°C for 30 seconds and extension at 72°C 30 seconds. Final extension was at 72°C for 10 minutes. After that, a 4 µl aliquot of PCR product was electrophoresed by using 2% agarose (Fisher Scientific), 2 µl of 5X Gelpilot DNA loading Dye (Qiagen Inc, Germantown, Maryland, USA) together with 100 bp track DNA ladder (Invitrogen, California, USA) in 1X TBE buffer containing SYBR-safe DNA gel stain (Invitrogen, California, USA) and visualized using an ultraviolet trans-illuminator gel Doc-It 2 Imager then viewed using Vision Works LS software v.7.1. For exon 7, 5 μl of the all negative amplicons was used in the second nested PCR (forward primer exon 7b 5-AGGCGCACTGGCCTCCTT-3 and reverse primer exon 7b 5-TGTGCAGGGTGGCAAGTGGC-3). The master mix and the PCR profile of the nested PCR were similar to the first round profile. The amplicons were viewed following electrophoresis on a 2% agarose gel. DNA sequencing All PCR-positive amplicons were purified using the Qiagen Gel purification kit according to the manufacturers recommended protocol. The purified DNA was quantified using a Nanodrop spectrophotometer (Thermo Fisher Scientific), and purified DNA (50 ng) was sent for Sanger sequencing at Macrogen, Inc. (Netherlands) using the first primer sequences and the manufacturer’s guidelines Mutation detection and analysis The directly amplified sequences were assembled using GENETYX version 9.1.0 (GENETYX Co., Tokyo, Japan; PCAP is an open-access alternative) DNA sequence analysis software. The sequences were aligned to TP53 gene sequences using NCBI BLAST for identity confirmation. The contigs from GENETYX were then aligned to the TP53 gene reference sequence from the International Agency for Research on Cancer (IARC) database using Bioedit software version 7.2.5 ( Hall et al., 2011 ). Mutations to the sequences were analyzed using MEGA v.7.0 ( Kumar et al., 2016 ) software. Statistical analysis Test for statistical significance of mutation profile parameters were done using the χ 2 test and Fisher’s exact test. P-values less than 0.05 were considered statistically significant. To examine possible associations between mutations in TP53 exons and hepatocellular carcinogenesis, we analyzed 2x2 tables using Fisher’s exact test. Odds ratios (ORs) were used to analyze two significant associations at 95% confidence interval (CI). Statistical analysis was performed using SAS version 9.4. Results Participant demographics There were 33 subjects in total for whom results in exon 4 and 7 were obtained. The characteristics of the subjects are shown in Table 2 . The ratio of male to female was 51.5% to 48.5%. All the subjects were positive for HBsAg. Those who were chronically infected and had HCC were 75.8% (25/33), of which 48.0% were female and 52.0% were male. Among those that did not have HCC but were HBsAg positive (24.2%), half were female and the other half male. Table 2. Demographic and molecular characteristics of the subjects. Characteristics Participants n Frequency, % Gender Male 17 51.5 Female 16 48.5 HCC status HCC 25 75.8 Without HCC 8 24.2 Codon 72 polymorphisms Arg/Arg 4 12.1 Pro/Pro 17 51.5 Pro/Arg 12 36.4 Ser 249 mutation AGG (Arg) 25 75.8 AGT (Ser) 8 24.2 Arg – Arginine; HCC- Hepatocellular carcinoma; Pro – Proline; Ser - Serine. TP53 exon 4, codon 72 polymorphism analysis A total of 33 samples were amplified with clear forward and reverse sequences for exon 4 codon 72. Amino acids of the aligned sequences ( Figure 2 ) revealed that majority (54.5%) of polymor-phisms at codon 72 were Pro/Pro (CCC) alleles, followed by heterozygous Arg/Pro (33.3%) and homozygous Arg/Arg (CGC) (12.1%) ( Figure 1 ). All those homozygous for Arg/Arg were male. The sequences generated from this study were deposited in GenBank with accession number MN119310-MN119350 and aligned in Figure 2 using MG595994.1 as reference sequence. Figure 1. Frequency of polymorphisms of Proline (Pro) and Arginine (Arg)in codon 72, exon 4 of TP53 of patients who were HBV positive with or without HCC. Majority of the patients had Proline amino acid at this codon followed by a mixture of Proline (Pro) and Arginine (Arg). Figure 2. Aligned amino acids sequences of exon 4 using GenBank: MG595994.1 as a reference sequence; the highlighted codon 72, P (or a dot) represent - Proline (P), R represent - Arginine (R) and X represent a mixture of Proline and Arginine. There was statistically significant association between the sex of the subject and the polymorphism identity (Fisher’s exact test=5.4 and P=0.04), with all the homozygous Arg/Arg belonging to male patients, whereas a higher proportion of female patients had homozygous Pro/Pro (64.7%) compared to male patients (35.3%) and a higher proportion of male had the heterozygous Pro/Arg(58.3%) compared to female patients (41.7%). On the other hand there was no statistical significance between the HCC and the polymorphisms (Fisher’s exact test=3.58 and P=0.12). However, it is important to note that at codon 72 most of the patients with HCC had Pro/Pro alleles, followed by heterozygous Pro/Arg and lastly homozygous Arg/Arg ( Table 3 ). The Pro/Pro allele was more frequent in the HCC group, whereas all female patients with Arg/Arg alleles did not have HCC ( Table 4 ). Table 3. Association between TP53 codon 7 polymorphisms, gender and hepatocellular carcinoma (HCC). Polymorphisms Female Male Fisher’s exact test value P-value Arg/Arg 0 4 (100%) 5.4 0.04 Pro/Pro 11 (64.7%) 6 (35.3%) Pro/Arg 5 (41.7%) 7 (58.3%) Polymorphisms Without HCC HCC Fisher’s exact test value P-value Pro/Pro 2 (11.7%) 15 (88.2%) 3.58 0.12 Pro/Arg 4 (33.3%) 8 (66.6%) Arg/Arg 2 (50.0%) 2 (50.0%) Arg – Arginine; HCC- Hepatocellular carcinoma; Pro – Proline; Ser - Serine. There was no significant association between HCC, gender and TP53 codon 72 Pro/Arg when both HCC cases and the non-HCC cases were compared (P=0.57). Equally there was no significant association between HCC, gender and TP53 codon 72 Pro/Pro (P=0.40; Table 4 ) Table 4. Association between gender and allele polymorphism at TP53 Arg72. Polymorphisms Sex HCC status, n (%) Total Fisher’s exact test value P-value Without HCC HCC Arg/Arg Male 2 (50.0%) 2 (50.0%) 4 - - Female - - - Total 2 (50.0%) 2 (50.0%) 4 (100%) Pro/Arg Female 2 (40.0%) 3 (60.0%) 5 (100.0%) 0.68 0.57 Male 2 (28.6%) 5 (71.4%) 7 (100.0%) Total 4 (33.3%) 8 (66.7%) 12 (100.0%) Pro/Pro Female 2 (18.2%) 9 (81.9%) 11 (100.0%) 0.27 0.40 Male - 6 (100.0%) 6 (100.0%) Total 2 (11.8%) 15 (88.2%) 17 (100.0%) Arg – Arginine; HCC- Hepatocellular carcinoma; Pro – Proline; Ser - Serine. Mutations at exon 7, codon 249 Out of the 33 subjects, eight (24.2%) had the Arg>Ser codon 249 mutation and the majority (75.8%) did not have the mutation. Serine 249 mutation was seen more in males (87.5%) than females (12.5%) and there was an association between the sex and mutation (Fisher's exact test=5.47, P=0.04) with male at higher risk compared to female (OR=10.5, 95% CI =1.1-98.9%) ( Table 5 ). Table 5. HCC status and Codon 249 mutation. Variable Codon 249 mutation Total AGG AGT Sex Female 15 (93.8%) 1 (6.20%) Male 10 (58.8%) 7 (41.2%) HCC status Acute hepatitis 6 (24.0%) 2 (25.0%) 8 (24.0%) Chronic hepatitis 19 (76.0%) 6 (75.0%) 25 (76.0% Total 25 (100.0%) 8 (100.0%) 33 (100.0%) Mutation: Guanine-to-thymine transversion in the third base of codon 249 of TP53 gene. Exon 7, Codon 249 mutations and HCC Majority (75.0%) of those with the serine 249 mutation had HCC; only (25.0% with the mutation were without HCC) ( Table 5 ) Similarly, among those without the mutation, 76.0% had HCC and 6 (24.0%) did not have HCC. The findings showed no significant association in the presence of codon 249 mutations between patients with and without HCC (P=0.15) at 95% CI (OR=0.52: 95% CI 0.054-4.773). Discussion The association between HCC and mutations at codon 72 or 249 of TP53 remains controversial. To our knowledge, this is the first information concerning TP53 exon 4 and 7 mutation in Kenya among HBV-positive patients with and without HCC. A number of studies have described two structurally different forms of wild-type p53 resulting from the substitution of a proline for an arginine at residue 72, with different biochemical and biological characteristics ( Thomas et al ., 1999 ). Different prevalence of this substitution has been reported in various studies. In our present study, the homozygous Pro/Pro genotype was the most common (54.5%), and the least is homozygous Arg/Arg. This prevalence of allele is similar to Taiwanese ( Mah et al ., 2011 ), Egyptian ( Neamatallah et al ., 2014 ) and Chinese ( Wang et al ., 1999 ). We observed that patients with HCC had higher frequencies of Pro/Pro (88.2%) compared to observation made among Moroccan population (11.8%) ( Ezzikouri et al ., 2010 ) and Egyptian patients with HCV ( Koushik et al ., 2004 ; Neamatallah et al ., 2014 ). The association between TP53 codon 72 Pro/Arg gene polymorphism and liver cancer remains controversial, with some studies showing and others lacking the association. Among the studies that show associations, Dong et al ., 2018 found that the TP53 Pro allele and Pro/Pro genotype were associated with cancer risk ( Dong et al ., 2018 ). In Egyptian patients with HCC, development of HCC was associated with Pro/Pro allele carriage as compared to Arg/Arg or Arg/Pr alleles ( Neamatallah et al ., 2014 ). This study did not find any association between polymorphisms and HCC among the HBV-positive patients. Other studies comparing acute hepatitis C and HCC have not found any association between codon 72 polymorphism and disease severity or HCC ( Eskander et al ., 2014 ; Hu et al ., 2014 ). The inconsistency in association and prevalence observed could be attributable to geographical, environmental or ethnic differences in the studied population. Our findings show the presence of selective guanine-to-thymine transversion mutation in the third base of codon 249 of TP53 in DNA isolated from 24.2% HCC patients. This mutation corresponds to arginine-to-serine substitution. Our findings corroborate data available among populations from Guangxi, Taiwan and The Gambia, where similar mutations were reported ( Mah et al ., 2011 ; Özdemir et al ., 2010 ). However, evidence presented from a European population, which reported no mutation, is contrary to our findings ( Kirk et al ., 2000 ). According to a report by the Global Burden of Disease Cancer Collaboration et al. (2017) , differences in geographical location, ethnicity, hereditary disorders, and excessive exposure to mutation-inducing agents as well as study size population could explain the discordance observed in the reported findings between our study and European studies ( Global Burden of Disease Cancer Collaboration et al. , 2017 ). Our study found no significant association between codon 249 mutation and hepatocellular carcinogenesis. However, exposure to codon 249 mutation might be considered a predisposing factor for HCC (OR=0.5278; 95% CI 0.0584-4.7736). These findings are in agreement with finite data available in Taiwan, United states, Japan, Australia, Gambian and Guangxi populations ( Kirk et al ., 2000 ; Mah et al ., 2011 ; Özdemir et al ., 2010 ; Stern et al ., 2001 ). Likewise, array of lit-erature is available implicating that the presence of this very mutation in HCC patients from developed countries including the United States, China, Japan and Australia is remarkably low ( Bruix et al ., 2011 ; Kirk et al ., 2000 ; Özdemir et al ., 2010 ). We further found that males were overrepresented in the mutation positive categories in patients with and without HCC. This could be ascribed to possible occurrence of faster and more severe HCC in males than females ( Li et al ., 2017 ). However, there was an association between the sex and mutation (Fisher's exact test=5.47, P-value =0.04). Counter-intuitively, TP53 codon 249 mutations were observed not only in HCC patients but also in the non-HCC patients, thus, corroborating earlier findings by Kirk et al. (2000) that reported codon 249 mutation presence in 3 of 53 control subjects (6%), and those of Ozturk (1995) , who reported codon 249 mutations in non-malignant liver tissues. A possible explanatory analysis for this finding is that mutations to codon 249 is generally known as a hotspot for aflatoxin B1 (AFB1)-driven modification. According to Özdemir et al . (2010) , AFB1 induces codon 249 mutation among cancer patients residing in AFB1 high-risk regions, where chronic HBV and HCV infections are also endemic. Furthermore, among TP53 mutations described in human cancers and compiled in the IARC TP53 mutation database , 66% occur in patients with HCC originating from regions with a high incidence of HCC and high exposure to dietary AFB1. However, we did not perform aflatoxin exposure tests for the subjects to corroborate this. Additionally, published data from the Ministry of Health and the Gastroenterology Society of Kenya on guidelines for the treatment of HBV and HCV infections in Kenya (2015) suggested that 80% of HCC cases in the country are due to chronic infection with HBV ( Ochwoto et al ., 2016 ). This evidence perhaps indicates that the existence of the mutation in TP53 may be suggestive of an early genetic event in hepatocellular carcinogenesis. Consequently, it is argued that presence of a single mutation alone in DNA is unlikely to cause cancer, rather cumulative or multiple mutations in tumor suppressor genes are required ( Adjiri, 2017 ; Lv et al ., 2013 ). Recommendations and limitations Although this study investigated for the presence of TP53 mutation in exon 4 and 7 hepatocellular carcinoma patients, there is a need to look at the remaining exons. The cross-sectional nature of the study limited our analysis. Thus, we were unable to perfume any analysis to determine the evolution of the TP53 mutations among the patients with HCC. The use of samples that only amplified the forward and reverse fragments of exon 7 and 4 could bias the mutational prevalence. The mutations reported in this study were found in samples taken from the patients’ blood and we did not obtain tumor tissues from the patients for verification. Secondly, the study involved HBV infected patients, using the acute infected patients as negative control population; we recommend that involvement of health participants who are not infected with HBV and may be the same ages and gender may result to deeper understanding of exon 4 and 7 mutations and their roles in HCC development. Conclusion TP53 is a gatekeeper gene, and codon 72 and 249 mutations could play a role in HCC development. However, this study did not find any association between patients infected HBV with or without HCC. We further did not observe any clear mutational patterns between TP53 mutations and HCC development. We therefore conclude that in a cross sectional set up, TP53 mutation is not a good indicator for prognosis or tumor marker among HBV positive subjects in Kenya. Data availability Underlying data TP53 sequence data obtained from this study are available from GenBank, accession numbers MN119310 to MN119350 . Acknowledgments We acknowledge the study participants and the staff of Moi Teaching and Referral Hospital. Faculty Opinions recommended References Adjiri A: DNA Mutations May Not Be the Cause of Cancer. Oncol Ther. 2017; 5 (1): 85–101. PubMed Abstract | Publisher Full Text | Free Full Text Bruix J, Sherman M, ; American Association for the Study of Liver Diseases: Management of hepatocellular carcinoma: an update. Hepatology. 2011; 53 (3): 1020–1022. PubMed Abstract | Publisher Full Text | Free Full Text Carvajal LA, Hamard PJ, Tonnessen C, et al. : E2F7, a novel target, is up-regulated by p53 and mediates DNA damage-dependent transcriptional repression. Genes Dev. 2012; 26 (14): 1533–1545. PubMed Abstract | Publisher Full Text | Free Full Text Dong Z, Zheng L, Liu W, et al. : Association of mRNA expression of TP53 and the TP53 codon 72 Arg/Pro gene polymorphism with colorectal cancer risk in Asian population: a bioinformatics analysis and meta-analysis. Cancer Manag Res. 2018; 10 : 1341–1349. PubMed Abstract | Publisher Full Text | Free Full Text Eskander EF, Abd-Rabou AA, Yahya SM, et al. : "P53 codon 72 single base substitution in viral hepatitis C and hepatocarcinoma incidences". Indian J Clin Biochem. 2014; 29 (1): 3–7. PubMed Abstract | Publisher Full Text | Free Full Text Ezzikouri S, El Feydi AE, Afifi R, et al. : Polymorphisms in antioxidant defence genes and susceptibility to hepatocellular carcinoma in a Moroccan population. Free Radic Res. 2010; 44 (2): 208–216. PubMed Abstract | Publisher Full Text Global Burden of Disease Cancer Collaboration, Fitzmaurice C, Allen C, et al. : Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life-years for 32 Cancer Groups, 1990 to 2015: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2017; 3 (4): 524–548. PubMed Abstract | Publisher Full Text | Free Full Text Gomes MA, Priolli DG, Tralhão JG, et al. : Hepatocellular carcinoma: epidemiology, biology, diagnosis, and therapies. Rev Assoc Med Bras (1992). 2013; 59 (5): 514–524. PubMed Abstract | Publisher Full Text Hall T, Biosciences I, Carlsbad C: BioEdit: an important software for molecular biology. GERF Bull Biosci. 2011; 2 (1): 60–61. Reference Source Hu S, Zhao L, Yang J, et al. : The association between polymorphism of P53 Codon72 Arg/Pro and hepatocellular carcinoma susceptibility: evidence from a meta-analysis of 15 studies with 3,704 cases. Tumor Biol. 2014; 35 (4): 3647–56. PubMed Abstract | Publisher Full Text Kandoth C, McLellan MD, Vandin F, et al. : Mutational landscape and significance across 12 major cancer types. Nature. 2013; 502 (7471): 333–339. PubMed Abstract | Publisher Full Text | Free Full Text Kirk GD, Camus-Randon AM, Mendy M, et al. : Ser-249 p53 mutations in plasma DNA of patients with hepatocellular carcinoma from The Gambia. J Natl Cancer Inst. 2000; 92 (2): 148–53. PubMed Abstract Koushik A, Platt RW, Franco EL: p53 codon 72 polymorphism and cervical neoplasia: a meta-analysis review. Cancer Epidemiol Biomarkers Prev. 2004; 13 (1): 11–22 . PubMed Abstract | Publisher Full Text Kruiswijk F, Labuschagne CF, Vousden KH: p53 in survival, death and metabolic health: a lifeguard with a licence to kill. Nat Rev Mol Cell Biol. 2015; 16 (7): 393–405. PubMed Abstract | Publisher Full Text Kumar S, Stecher G, Tamura K: MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016; 33 (7): 1870–1874. PubMed Abstract | Publisher Full Text | Free Full Text Li Y, Li H, Spitsbergen JM, et al. : Males develop faster and more severe hepatocellular carcinoma than females in k ras V12 transgenic zebrafish. Sci Rep. 2017; 7 : 41280. PubMed Abstract | Publisher Full Text | Free Full Text Lv L, Wang P, Zhou X, et al. : Association between the p53 codon 72 Arg/Pro polymorphism and hepatocellular carcinoma risk. Tumour Biol. 2013; 34 (3): 1451–1459. PubMed Abstract | Publisher Full Text Mah YH, Hsu CS, Liu CH, et al. : Serum p53 gene polymorphisms and severity of hepatitis B or C-related chronic liver diseases in Taiwan. Hapatol Int. 2011; 5 (3): 814–821. PubMed Abstract | Publisher Full Text Maiuri MC, Galluzzi L, Morselli E, et al. : Autophagy regulation by p53. Curr Opin Cell Biol. 2010; 22 (2): 181–185. PubMed Abstract | Publisher Full Text Mutuma GZ, Mbuchi MW, Zeyhle E, et al. : Prevalence of Hepatitis B Virus (HBV) surface antigen and HBV-associated hepatocellular carcinoma in Kenyans of various ages. Afr J Health Sci. 2011; 18 : 53–61. Reference Source Neamatallah MA, El-Missiry MA, Said MA, et al. : TP53 polymorphism as a risk factor for hepatocellular carcinoma in hepatitis C virus-infected Egyptian patients. Egypt J Basic Appl Sci. 2014; 1 (1): 9–15. Publisher Full Text Ochwoto M, Kimotho JH, Oyugi J, et al. : Hepatitis B infection is highly prevalent among patients presenting with jaundice in Kenya. BMC Infect Dis. 2016; 16 : 101. PubMed Abstract | Publisher Full Text | Free Full Text Özdemir FT, Tiftikci A, Sancak S, et al. : The prevalence of the mutation in codon 249 of the P53 gene in patients with hepatocellular carcinoma (HCC) in Turkey. J Gastrointest Cancer. 2010; 41 (3): 185–189. PubMed Abstract | Publisher Full Text Ozturk M: p53 mutations in nonmalignant human liver: fingerprints of aflatoxins? Hepatology. 1995; 21 (2): 600–601. PubMed Abstract | Publisher Full Text Park JW, Kwak KM, Kim SE, et al. : Differentiation of acute and chronic hepatitis B in IgM anti-HBc positive patients. World J Gastroenterol. 2015; 21 (13): 3953–3959. PubMed Abstract | Publisher Full Text | Free Full Text Rivlin N, Koifman G, Rotter V: p53 orchestrates between normal differentiation and cancer. Semin Cancer Biol. 2015; 32 : 10–17. PubMed Abstract | Publisher Full Text Sasaki M, Kawahara K, Nishio M, et al. : Regulation of the MDM2-P53 pathway and tumor growth by PICT1 via nucleolar RPL11. Nat Med. 2011; 17 (8): 944–951. PubMed Abstract | Publisher Full Text | Free Full Text Stern MC, Umbach DM, Yu MC, et al. : Hepatitis B, aflatoxin B(1), and p53 codon 249 mutation in hepatocellular carcinomas from Guangxi, People's Republic of China, and a meta-analysis of existing studies. Cancer Epidemiol Biomarkers Prev. 2001; 10 (6): 617–625. PubMed Abstract Stewart SL, Kwong SL, Bowlus CL, et al. : Racial/ethnic disparities in hepatocellular carcinoma treatment and survival in California, 1988-2012. World J Gastroenterol. 2016; 22 (38): 8584–8595. PubMed Abstract | Publisher Full Text | Free Full Text Thomas M, Kalita A, Labrecque S, et al. : Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol. 1999; 19 (2): 1092–100. PubMed Abstract | Publisher Full Text | Free Full Text Tokino T, Nakamura Y: The role of p53-target genes in human cancer. Crit Rev Oncol Hematol. 2000; 33 (1): 1–6. PubMed Abstract | Publisher Full Text Wang NM, Tsai CH, Yeh KT, et al. : P53 codon 72Arg polymorphism is not a risk factor for carcinogenesis in the chinese. Int J Mol Med. 1999; 4 (3): 249–52. PubMed Abstract | Publisher Full Text Wen X, Lu F, Liu S: Prognostic value of p53 mutation for poor outcome of Asian primary liver cancer patients: evidence from a cohort study and meta-analysis of 988 patients. Onco Targets Ther. 2016; 9 : 7425–7433. PubMed Abstract | Publisher Full Text | Free Full Text World Health Organization: Fact sheet. 3 February 2022; accessed on 01 March 2023. Reference Source Yang Y, Xia T, Li N, et al. : Combined effects of p53 and MDM2 polymorphisms on susceptibility and surgical prognosis in hepatitis B virus-related hepatocellular carcinoma. Protein Cell. 2013; 4 (1): 71–81. PubMed Abstract | Publisher Full Text | Free Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 06 Aug 2019 ADD YOUR COMMENT Comment Author details Author details 1 Kenya Medical Research Institute,, Nairobi, Kenya 2 Microbiology Department, University of Nairobi, Nairobi, Kenya 3 Department of Biochemistry and Molecular Biology, Egerton University, Nakuru, Kenya 4 Eldoret Cancer Registry, Moi Teaching and Referral Hospital, Eldoret, Kenya Missiani Ochwoto Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Colins O. Oduma Roles: Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing – Original Draft Preparation, Writing – Review & Editing Julius Oyugi Roles: Funding Acquisition, Project Administration, Resources, Supervision, Writing – Review & Editing Dufton Mwaengo Roles: Project Administration, Resources, Supervision, Writing – Review & Editing Bartholomew N. Ondigo Roles: Methodology, Project Administration, Supervision, Writing – Review & Editing James H. Kimotho Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Alex K. Maiyo Roles: Data Curation, Formal Analysis, Investigation, Methodology, Validation, Visualization Ruth M. Nyangacha Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Gladys Chesumbai Roles: Formal Analysis, Project Administration, Supervision, Visualization Elijah Songok Roles: Funding Acquisition, Resources, Software, Supervision, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This work was supported by KEMRI IRG grant from Kenya Medical Research Institute, protocol Number KEMRI/SERU/ CVR/001/3211 and IRG Number L057. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 12 Mar 2024, 8:1364 https://doi.org/10.12688/f1000research.19416.2 version 1 Published: 06 Aug 2019, 8:1364 https://doi.org/10.12688/f1000research.19416.1 Copyright © 2024 Ochwoto M et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Ochwoto M, Oduma CO, Oyugi J et al. Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.12688/f1000research.19416.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 12 Mar 2024 Revised Views 0 Cite How to cite this report: Ali Shaaban MA. Reviewer Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.161477.r410414 ) The direct URL for this report is: https://f1000research.com/articles/8-1364/v2#referee-response-410414 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 22 Sep 2025 Menat Allah Ali Shaaban , Ain Shams University, Cairo, Egypt Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.161477.r410414 Introduction: Paragraph 1: References at years 2016 and 2017 need to be updated as incidence and number of deaths are dynamic values that may show changes over years. The collection of samples was finished on 2017. ... Continue reading READ ALL Introduction: Paragraph 1: References at years 2016 and 2017 need to be updated as incidence and number of deaths are dynamic values that may show changes over years. The collection of samples was finished on 2017. There was a previous version. I just don’t get why there is a delay till 2025. Also, oncogenesis is affected by several internal and external factors that are affected by time and many theories are in continuous emerge for oncogenesis on molecular level. Plus, the technical quality is actually improved over the past 10 years. Methods: Study site and sample population: why patients were chosen only when having jaundice PCR amplification of human TP53... 2nd paragraph 5th row: “extension at 72°C for 30 seconds” instead of “extension at 72°C 30 seconds”. Statistical analysis: was sample size calculated? You have not mentioned. Results: Participant demographics The ratio of male to female was 51.5% to 48.5%. You have mentioned before clearly that the ratio is 1.1: 1. Here, you mention the percentage not the ratio, you may mention that the percentages are 51.5% and 48.5% for males and females, respectively. Also change male to males, and females instead of female e.g. “48.0% were females and 52.0% were males” instead of “48.0% were female and 52.0% were male” TP53 exon 4, codon 72 polymorphism analysis “All those homozygous for Arg/Arg were males” instead of “All those homozygous for Arg/Arg were male”. Table 5 is titled HCC status and Codon 249 mutation, however, the data in the table is not clear. Please revise the data and make it clearer. Discussion: 1 st paragraph: please mention in brief the relation between the codons, the exons and the studied polymorphisms to make it easier to follow. pro/pro percent in the current study is 54.5% and you mentioned this several times. Then, in the same paragraph in the discussion you said patients with HCC had higher frequencies of Pro/Pro (88.2%). Please revise the whole sentence: We observed that patients with HCC had higher frequencies of Pro/Pro (88.2%) compared to observation made among Moroccan population (11.8%) ( Ezzikouri et al ., 2010 ) and Egyptian patients with HCV ( Koushik et al ., 2004 ; Neamatallah et al ., 2014 )”. The reference Neamatallah et al ., 2014 was mentioned 2 times with non-comparable results. 2 nd paragraph, 4 th line: “Arg/Pro alleles” instead of “Arg/Pr alleles” Other studies comparing acute hepatitis C and HCC have not found any association between codon 72 polymorphism and disease severity or HCC: in this sentence, do you intentionally mean Hepatitis C, though your study was on patients with Hepatitis B. Is it for comparing? That was to short mention for comparing Hepatitis B and C. Additionally, the current study did not mention any data about the staging of HCC in the results and the sample data were not divided according to staging of HCC, thus, you did not state relation to severity in your study to compare with other studies. Actually, this is an important missing point. Staging of any tumor is an essential data while studying a certain marker. That was why I was wondering also why you collect samples from jaundiced patients. That means that patients were in late stages of HCC. But, actually, it is better to reveal the importance of a marker in detecting the disease in early stages. 3 rd paragraph, 13 th line: What do you mean by “presence of this very mutation in HCC patients”. The sentence is not clear. Recommendations and limitations: 6th row: perfume any analysis. I guess there is a spelling mistake here. The sentence is not clear. Conclusion : in the conclusion of the study, whether in the abstract or the final, you have mentioned the study was to detect the association between TP53 and HCC development. Then, you mentioned TP53 as a prognostic marker. Actually, more data e.g. regarding staging -as I have mentioned- are required to assess the role of TP53, but you have to be precise in your conclusion, what your study found. Then, further recommendations can be put to make more sample size to get the chance to have good data may be through a project as I do understand that these techniques need a fund to be performed on adequate informative sample size. Finally, I thought about telling to update many references to cope with 2025, but basically the technique was made on 2017 after sample collection or a bit later I guess. Please, try to update references wherever feasible. Lastly, I really do appreciate this work and this effort. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: clinical pathology , subspecialty is chemistry and molecular studies I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Ali Shaaban MA. Reviewer Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.161477.r410414 ) The direct URL for this report is: https://f1000research.com/articles/8-1364/v2#referee-response-410414 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 06 Aug 2019 Views 0 Cite How to cite this report: Onywera H. Reviewer Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.21284.r55879 ) The direct URL for this report is: https://f1000research.com/articles/8-1364/v1#referee-response-55879 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 06 Nov 2019 Harris Onywera , Institute of Infectious Disease and Molecular Medicine, University of Cape Town, Cape Town, South Africa; Division of Medical Virology, Department of Pathology, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.21284.r55879 Summary of the article by Ochwoto and colleagues The article by Ochwoto and colleagues aimed to identify polymorphisms in the human TP53 gene among Kenyan patients with hepatocellular carcinoma (HCC) and chronic hepatitis B. TP53 is a ... Continue reading READ ALL Summary of the article by Ochwoto and colleagues The article by Ochwoto and colleagues aimed to identify polymorphisms in the human TP53 gene among Kenyan patients with hepatocellular carcinoma (HCC) and chronic hepatitis B. TP53 is a gene that encodes tumour protein p53 that controls the cell cycle (division or proliferation), thereby suppressing tumorigenesis. Mutations in the TP53 impair the function of the tumour protein p53, causing the cells to proliferate uncontrollably. Ochwoto and colleagues examined mutations in codons 72 and 249, which exit in exons 4 and 7, correspondingly. They found that there was genetic heterogeneity in the nucleotide mutations in the TP53 gene, which resulted in either synonymous or nonsynonymous mutations. Further analyses found no association between p53 mutations and HCC, suggesting that mutations in the TP53 gene may not be good biomarkers for HCC, specifically among Kenyan patients with hepatitis B virus (HBV) infections. There is paucity of data on the polymorphisms in the TP53 gene and their association, if there is any, with HCC on Kenyan cohort. Whereas the study by Ochwoto and colleagues adds knowledge to the existing literature, I approve it with sound reservations. First and foremost, they do not sufficiently address all their objectives. For instance, they indicate that they will investigate polymorphisms in specific codons found in exons 4, 6 and 7. However, they do not present any of the results for exon 6, yet they say in the “recommendations and limitations” section that they examined this. Besides, they detail (in the “methods” section) the primers that were used to amplify and sequence exon 6. What happened to exon 6 results? What codon positions in this exon were analysed? The authors do not consistently present their results. I mean, the way they present/tabulate their results for codon 72 (in exon 4) is totally different from codons 249 (exon 7). No PCR/sequencing and healthy controls were included in their study. There are sections in the manuscripts that have not been referenced. Ochwoto and colleagues do not adequately highlight findings of the literature that they use – as it is not clear what some of those studies reported. For example, in the discussion section (paragraph 1), they state: “Different prevalence of this substitution has been reported in various studies.” With this, they assume that the reader is aware of what those studies reported. To address this, they should give a range of the prevalence that these studies found, so that the reader can easily compare findings presented herein with/to what is already known. Another sentence would be in paragraph 2 ( discussion ), where they write, “This study did not find any association between polymorphisms and HCC among the HBV-positive patients. Other studies have shown similar findings (Eskander et al., 2014 1 ; Hu et al., 2014 2 ). The inconsistency in association and prevalence observed could be attributable to ethnic differences, since….” Could the authors kindly briefly highlight what some of these studies found? Apart from the aforementioned concerns, there are other concerns and a few typos and grammatical mistakes that need to be corrected. For example, the last sentence in paragraph 2 ( discussion ) is written as: “…since most study have been performed…” Study should be in plural. My detailed review is as below: Reviewer’s comments (according to manuscript section) Title and author affiliations Could the authors add “infection” after “chronic hepatitis B” so that it reads “chronic hepatitis B”? The extra comma (,) in affiliation 2 should be removed. Abstract The authors say in the background that “ANY” alteration/mutation in the TP53 gene adversely affects the regulatory function of the protein, potentially resulting in cancer. Synonymous mutations do not have this effect as the amino acids are not altered. Mutations in TP53 are not always associated with altered p53. The words “mutations to” should be changed to “mutations in”. Is “codon 7” supposed to be “codon 72”? The background does not provide motivation for the study and why it was conducted on a Kenyan cohort? Is it because there is paucity of data surrounding this topic, especially in Kenya? Is it because there are high rates of recurrent liver tumours/cancers? Remove the semi-colon (;) in the methods and put a full stop (.). Why do the authors say exons 4 and 7 were analysed yet in the manuscript they mention exon 6 too? In the results , “12.1%,” should be “12.1%” and “Arg-Ser” should be “Arg/Ser”. They should be consistent when they present the mutations, either use forward slash (/) or hyphen (-) throughout the manuscript. Part of their conclusion in the abstract is not supported by their findings. The authors’ study is a cross-sectional one and test causal roles, it can only show an association between the polymorphism and HCC. It is thus inaccurate to say that the “mutations under study may dependently play a role in HCC development”. Moreover, they did not examine if other factors contributed to HCC development and whether the mutations they detected co-occurred with other mutations. The authors write, “ TP53 mutation is a poor indicator for prognosis and a tumor’s biological behavior among HBV-positive subjects in Kenya.” The cross-sectional nature of their study does not permit them to assess this. They did not use a longitudinal study to study the mutation outcomes. In addition, they did not have information on tumour staging, response to treatment, survival rates (in comparison with healthy controls), vascular invasion (blood and/or lymph vessel invasion, LBVI), and Child-Pugh score. If Ochwoto and colleagues needed to examine the role of TP53 mutation on HCC development and whether these mutations could be indicators for prognosis, then they should have i) utilized a longitudinal study with important participant information, and ii) assessed where the mutations acted dependently (synergistically with other TP53 mutations) or independently to promote carcinogenesis in HCC. My last comment on the abstract , should it be “P53” or “p53” in the conclusion ? Keywords Why is “codon 249” included as keyword but “codon 72” is not? I am also curious why “p53 exon 6” was not included yet other exons were, despite the fact that the authors indicate that they examined mutations in codons in exon 6. Author roles All authors are supposed to approve the final version of the manuscript. Based on the author contribution section, it appears like Maiyo AK and Chesumbaio G did not (review and edit the manuscript); hence, did not approve the final draft of the manuscript. Could the authors clarify if this was the case? Abbreviations There are abbreviations in the manuscripts that need to be included in this part. For instance, “AE” buffer, “DNA”, “HBsAg”, “CHB”, “AFB1”, and so on. Introduction Paragraph 1: There should be a comma after “Global Burden of Disease Cancer Collaboration et al. (2017)”. Paragraph 2: “Alteration to” should be “Alteration in”. The last sentence in this paragraph needs to be referenced as this is a fact that is being stated. Paragraph 3: The first sentence is relatively long and needs to be split into two, that is, put as two sentences. This sentences need to be referenced: “In exon 7, codon 249 (AGG→AGT, arginine to serine) has been identified as a “hotspot”.” and “In exon 4, an arginine to Proline substitution at codon 72 has been investigated as risk modifier in several cancer models; however, its role in cancer progression remains uncertain.” In the latter sentence, “Proline” should appear as “proline”. In addition, the authors say that “codon 72 has been investigated as risk modifier in several cancer models”. What did these investigations find? Was there an association? Do their investigations suggest that mutation (Arg to Pro substitution) in codon 72 plays a role in cancer development? Or did the authors intend to say that those studies found mutation in codon 72 (Arg to Pro substitution) to be a risk factor for cancer? Paragraph 4: there should be a comma after “In this study”. Although in paragraph the authors write, “ TP53 has ten coding exons, with mutations distributed in all of them, with a strong predominance in exons 4-9,…” it is unclear why the authors chose to study mutations in only exons 4, 6, and 7 (as they state in paragraph 4). Why did they not examine exons 8 and 9? Is there another reason besides limited information on TP53 polymorphisms in Kenya that motivated the authors to conduct their study in Eldoret, Kenya? Methods Study site and sample population: There is no need to write MTRH in full as this has been done before (in the last paragraph in the introduction section). The sentence “The MTRH was selected as it is one of the largest national referral hospitals in western Kenya, where rates of HBV infection are considered to be high (Ochwoto et al., 2016 3 ).” should come immediately after the first sentence. Regarding this sentence, the authors should state the rates of HBV infection that have been reported at MTRH. They should not assume that anyone reading the current paper is aware of this. The second sentence needs to be rephrased. Do the authors mean that they included only jaundice patients and that these patients were HBV-positive with and without HCC? It is not clear if the study by Ochwoto and colleagues is a cross-sectional one or a longitudinal study. They mention that after the patients were selected from the medical records, they “were then recruited in person.” Were the patients called and asked to participate in this study? Was it after this that samples were collected? The design of the study (whether cross-sectional or longitudinal) is somewhat confusing. If indeed it is a cross-sectional study, they should clarify and even acknowledge the fact that this was a retrospective study that depended on stored samples. The redundancy in the section, for instance, twice-mentioning that the study selected patients with jaundice, should be addressed/eliminated. “Eldoret hospital” should be “Eldoret Hospital”, and “age range were” should be “age range was”. What were the exclusion criteria in their study? Finally, the authors mention that information on “residential area” was abstracted from the health records. In spite of this, they do not use this information in their analyses. This information is not reported in their manuscript. Ethical consideration: “The ethical approval to conduct the study was obtained from Institutional Research and Ethics Committee (IREC) of MTRH/Moi University (approval number 001002), from Kenya Medical Research Institute Scientific Ethics Review Unit (approval number KEMRI/SERU/CVR/001/3211) and from Eldoret Cancer Registry (approval number ECR/DRA/2017/001).” should be changed to “The ethical approval to conduct the study was obtained from the Institutional Research and Ethics Committee (IREC) of MTRH/Moi University (approval number 001002), from the Kenya Medical Research Institute Scientific Ethics Review Unit (approval number KEMRI/SERU/CVR/001/3211) and from the Eldoret Cancer Registry (approval number ECR/DRA/2017/001).” In line with my comments above (regarding the nature of the study), the authors say that “the participants consented for the study prior to blood draw.” The consent that the patient provided, was it an informed one? Was it a verbal or written consent? Were/Are the patients aware that this study in particular was being conducted? Did they receive any compensation/incentive? Collection and preparation of blood samples: The statement “Plasma was separated at MRTH and thereafter the plasma tubes were shipped on dry ice to the KEMRI Production Unit in Nairobi.” could be written as “Plasma was separated at MRTH and then shipped in plasma tubes on dry ice to the KEMRI Production Unit in Nairobi.” Serological testing: Remove the extra hyphen in “IgM--positive”. Extraction of DNA from plasma: Information on the source of the reagents (e.g., DNA mini-extraction kit) or equipment (e.g., NanoDrop spectrophotometer), which is bracketed, need to be comprehensive. Apart from including the name of the company, name of the city and country is required. PCR amplification of human TP53 : The authors did not include any controls (negative and positive). How sure are they that their method is valid and that they did not get contamination during PCR? In the paragraph 1 of this section, “the extracts” should be written “the DNA extracts”. Moreover, there should be a space between “5” and “µl” so that it becomes “5 µl” instead of “5µl”. This statement “…of forward primer and reverse primer of sequences…” could be written as “…of forward and reverse primers…”. Table 1 could be put as part of the supplementary data. I am just curious, were the same primers used in PCR the same as those used for sequencing (putting into consideration that the authors mention there was an aspect of nested PCR)? Still in paragraph 1, “and” should be included between “… USA),” and “1.25 µl”. In paragraph 2, what is the model of the ABI PCR machine that was used? This sentence, “Amplification for exon 7 the PCR profile set at 95°C for 10 minutes initial denaturation and 35 cycles of denaturation…” does not makes sense. It needs to be corrected. Both the statements, “Final extension was at…” should be written as “Final extension was performed at…” Still regarding this paragraph (2), why did the authors opt not to give the PCR details for exon 6? The sentence in paragraph 3 is long and needs to be written as two or more sentences. “5X Gelpilot DNA loading” should be “5X Gelpilot DNA Loading”. For paragraph 4, why did the authors use “negative amplicons” in the second nested PCR? Is “negative amplicon” not a failed experiment according in their context? Why was this not performed for exons 4 and 6? Lastly, throughout this section (and the rest of the manuscript), the authors should include the information on the source of the reagents or equipment (which is bracketed) need to be comprehensive. Apart from including the name of the company, name of the city and country is required. This information should be furnished where appropriately, if possible even for the ultraviolet trans-illuminator gel Doc-It 2 Imager, 5X Gelpilot DNA Loading Dye. DNA sequencing: The authors need to state that they used Sanger sequencing. There should be an apostrophe (‘) in the word “manufacturers”. It should be: manufacturer’s and not manufacturers. “send” should be changed to “sent”. There should be a full stop at the end of this paragraph. Mutation detection and analyses: Is there any reason include the sentence “PCAP is an open-access alternative”? The authors should be specific about the BLAST they used. Was it BLAST n or BLAST p or both? “Bioedit” and “mutations to the” should be changed to “BioEdit” and “Mutations in”, respectively. Delete these words, “bioinformatics editing tool”. Lastly, about this section, the authors must reference BioEdit and MEGA software. Statistical analyses: What do the authors mean by “profile parameters”? The last sentence about SAS version 9.4 can be first sentence in this section. It is not clear what they mean by, “used to analyze two significant associations”? Did all the expected values in the 2x2 contingency tables warrant the use of Fischer’s exact text? Were all the expected value >5? If this was not the case, then Chi square test should be used in such scenarios. Odds ratios are used to measure the strength/magnitude of association. “P-values less” should be “P-values of less”. Results Participant demographics: The authors do mention exon 6 yet these results are hugely lacking. No results regarding this are presented. Can the authors please provide the results for this? The sentence “Among those (24.2%) that did not have HCC but were HBsAg positive, half were female and the other half male.” should be written as “Among those that did not have HCC but were HBsAg positive (24.2%), half were female.” The title for Table 2 is not accurate. While the title says “clinical” and “molecular” characteristics, the variable “gender” does not fit in any of that (clinical or molecular). Gender is a demographic characteristic. The symbol % should be deleted in the numbers (e.g., 75.8%) in the last column as this (5) is already put in the column title. At the bottom of this table, ALL abbreviations (e.g., HCC, Arg, etc.) should be written in full (e.g., hepatocellular carcinoma, arginine, etc.). The same is required for Tables 3, 4 and 5. Furthermore, the numbers in Table 5 need to have spaces between them and opening brackets, e.g., it should be “6 (24.0%)” and not “6(24.0%)”. This should be done for the other numbers, where necessary. The comma in the title for Table 4 should be removed. TP53 exon 4, codon 72 polymorphism analysis: Paragraphs 2 and 3, the authors display the Fisher test value at differing decimal places; some are at 2 decimal places while others are at 1 decimal place. They must ensure that they are consistent. The same is true for the other sections entitled: “Mutations at exon 7, codon 249” and “Codon 249 mutation and HCC”. Check the number of decimal places for the p-values and CIs, throughout the manuscript (even in the tables). Paragraph 2 (of section titled: TP53 exon 4, codon 72 polymorphism analysis), there should be a full stop after “p=0.12)”. The next sentence should then be case sensitive (“However”). The last sentence of this paragraph, “The Pro/Pro allele was more frequent in the HCC group, whereas all patients wth Arg/Arg alleles did not have HCC (Table 4).” needs to be changed/revised. First, there is a typo (“with” is written as “wth”). Secondly, the statement is untrue. I see that there are HCC patients (2 males) who had Arg/Arg alleles. For Figure 1, it is not relevant to have a 3D-plot as the third dimension is meaningless. My last comments on results: In order to ensure consistency, the authors should decide if they want to write “P=value”, “p=value”, or “P-value”. Moreover, they should decide on whether to include space before/after the equal sign (=). I see in one place they have “Fisher test=3.58’ while in another they have “Fisher's exact test =5.47”. The other thing, is it “Fisher test” or “Fisher's exact test”. Ochwoto and colleagues do not consistently present (tabulate) their results for the mutations found in the codons that they studies. No results are presented for exon 6. Moreover, the way they presented the results for codon 72 is considerably different from those of codon 249. Why did they opt for this strategy? Discussion Paragraph 1: They indicate that to the best of their knowledge, this is the first time information concerning TP53 exons 4, 6, and 7 are presented in Kenya. They should say that this is among HBV-positive patients with and without HCC, as there are other investigators , who studied exons 6 and 7 (though in the context of oral squamous cell carcinoma). Ochwoto and colleagues do not present results for exon 6 yet they mention this exon in their discussion. They also have the sentence “A number of studies have described two structurally different forms of wild-type p53…”, yet they end up providing only one reference (Thomas et al., 1999 4 ).” There should be additional references then. This paragraph has a typo (“study” written as “tufy”). The prevalence values (of the specific mutations in different cohorts, e.g., Taiwanese, Chinese, etc.) should be provided. This should also be done for the part where they say, “Different prevalence of this substitution…”. A range should be provided in this case. This sentence “In this tufy, the HBV-positive Kenyan population, the homozygous Pro/Pro genotype is…” could be written as “In our present study, the homozygous Pro/Pro genotype was…”. The last sentence of this paragraph, they say “higher frequencies”, but they do not indicate what they compared these frequencies with. Higher than which comparison group? There should be a coma after “11.8%” and the abbreviation “Vs” put as “vs”. Paragraph 2: The comma towards the end of the second sentence (“with cancer risk,” should be removed (and he words be “with cancer risk”). The next sentence, which starts with “In Egyptian patients…”, should have a full stop at the end, not a comma. It is also not clear if Ochwoto and colleagues are referring to their present results or other’s results when they state, “This study did not find any association between polymorphisms and HCC among the HBV-positive patients.” The authors should also give a few details about the studies by Eskander et al. , 2014 1 and Hu et al. , 2014 2 . Otherwise, the reader is left to wonder what the other studies found when they simply say, “Other studies have shown similar findings”. The last sentence of this paragraph should have the words “most study” changed to “most studies”. Just to add on some of the reasons for inconsistencies in study findings, I believe heterogeneity in study methodology, sample (population) size, and specimen type could at least partly be contributing factors. Paragraph 3: The authors should express the 8/33 as a percentage and go ahead and give us the exact rates that were reported on the cohorts from China, Taiwan and The Gambia. This sentence “However, evidence presented from a European population, which reported no mutation, is contrary to our findings (Kirk et al. , 2000).” needs to be rewritten. This study 5 , done on an Egyptian cohort, should be included in this section and findings on rates of mutants in codon 249 reported. Another study would be this 6 , which found no mutation in codon 249 among HCC Korean patients. In manuscript by Ochwoto and colleagues, the part written, “offer explanation to” could be written as “could explain” as it is not certain what resulted in the discordance. Delete “(p=0.6821) at level of significance p<0.05”. Personally, I disagree with the fact that the authors think that based on the odds ratio (OR=0.5278; 95% CI 0.0584-4.7736), codon 249 might be a predisposing factor for HCC. The OR value do not support that as the values range from 0 to over 1. OR >1 indicates increased occurrence of an event whereas OR <1 indicates decreased occurrence of event (protective exposure). Paragraph 4: The sentence could begin with, “We further found that males were overrepresented…”. The last sentence (However, there was there was an association between the sex and mutation (Fisher's exact test =5.47, P-value =0.039) needs to be rectified – as “there was” is repeated. The information on statistics (Fisher's exact test =5.47, P-value =0.039) should be deleted as they are already in the results section. Paragraph 5: The authors need to present the rates (prevalence) rather than numbers so that their values can be compared to what is in the literature. This sentence (“ TP53 codon 249 mutations were observed not only in HCC patients but also in one the non-HCC patient”) should have the prevalence so that the rates can be easily compared with/to others. Change “this corroborates earlier findings” to “thus, corroborating earlier findings”, “mutations to” to “mutation in”, and “A possible explanatory analysis…” to “A possible explanation…”. The authors mention that mutations in codon 249 are generally known as a hotspot for aflatoxin B1 (AFB1)-driven modification, and that AFB1 induces codon 249 mutation among cancer patients residing in AFB1 high-risk regions, where chronic HBV and HCV infections are also endemic. While they acknowledge that they did not perform aflatoxin exposure tests on their subjects, what makes them speculate that AFB1 could have an impact on their cohort? Can the authors please comment on the levels of aflatoxins in the region, Eldoret? Do the authors know if there are certain foods in the region that have AFB1 levels beyond the tolerated level? Do the authors think that other factors such as alcohol and smoking could have a similar influence on TP53 as AFB1? Recommendations and limitations In this section, they mention exon 6, but no results were presented. The sentence “Although this study has investigated for” should be “Although this study investigated”. The sentence “However, this study was a cross-sectional study that involved 33 HBV-positive patients, of whom 25 had HCC, it was hard to compare the evolution of the mutations among the patients with HCC.” could be written as “The cross-sectional nature of the study limited our analysis. Thus, we were unable to perfume any analysis to determine the evolution of the TP53 mutations among the patients with HCC.” Conclusion I tend to disagree with the authors’ conclusion as they do not write this section based on their findings. Their study was not a longitudinal one, which could/would enable them assess the role of polymorphisms (codons 72 and 249) in HCC development. Further, their study did not show that these mutations are poor indicator for prognosis. References The authors need to present up-to-date information. Of all there >30 references, there is none for 2019, while there are only one, two, and three for 2018, 2017, and 2016, respectively. The rest are for the previous years, prior to 2016. Other comments No PCR and sequencing controls were included in the study. Therefore, how sure are the authors that there were no contaminants in their study? How sure are they that they targeted the right gene? The authors do not mention anything about the size of the amplicon that they expected and whether they observed it. No healthy human controls were included. Moreover, there was no information on tumour size, histopathological features, cancer staging, and treatment outcome. Thus, it is hard to infer speculate on the role of the TP53 mutations in their study. The authors should not be too quick to generalize results as their sample size was relatively small, besides their study having other limitations. The authors did not adjust their analysis for multiple comparisons. Moreover, they do not acknowledge other confounders. The method they used for amplification and sequencing may have resulted in their ability to capture other mutations. They could have confirmed their findings using droplet digital PCR (ddPCR), restriction fragment length polymorphisms (RFLP), or polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP). What could be the implications of the TP53 mutations that the authors identified in their study? The implications should relate to their study cohort/population. The study cohort/population is not sufficiently described. There is less information about the study cohort/population. Do the authors know the HIV status of the cohort? Other information that would have been relevant and important in their discussion would be HBV genotypes, other potential cancers, hereditary disorders and so on. The results by Ochwoto and colleagues do not have the electrophoresis results. I recommend that they provide the results for band visualization? The authors have information about the age of the study participants. One study on a small cohort of Hispanics 7 associated TP53R249S mutation with a younger age (besides worse prognosis). The work by Ochwoto and colleagues has the potential to add more knowledge if they could stratify their participants by age (young vs old) and then examine if there is any association of the TP53 mutations with age. To strengthen this finding (in the discussion ) where they say “Our study found no significant association between codon 249 mutation and hepatocellular carcinogenesis…”, I suggest that they include this paper 8 which does not support their findings. The suggested article found a strong association between TP53R249S in plasma and HCC Qidong patients. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Partly References 1. Eskander EF, Abd-Rabou AA, Yahya SM, El Sherbini A, et al.: "P53 codon 72 single base substitution in viral hepatitis C and hepatocarcinoma incidences". Indian J Clin Biochem . 2014; 29 (1): 3-7 PubMed Abstract | Publisher Full Text 2. Hu S, Zhao L, Yang J, Hu M: The association between polymorphism of P53 Codon72 Arg/Pro and hepatocellular carcinoma susceptibility: evidence from a meta-analysis of 15 studies with 3,704 cases. Tumour Biol . 2014; 35 (4): 3647-56 PubMed Abstract | Publisher Full Text 3. Ochwoto M, Kimotho JH, Oyugi J, Okoth F, et al.: Hepatitis B infection is highly prevalent among patients presenting with jaundice in Kenya. BMC Infect Dis . 2016; 16 : 101 PubMed Abstract | Publisher Full Text 4. Thomas M, Kalita A, Labrecque S, Pim D, et al.: Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol . 1999; 19 (2): 1092-100 PubMed Abstract | Publisher Full Text 5. Abd Elhameed A, Abo-Elenein A, Ibrahim W, El-kassas G, et al.: Study of P53 Gene Mutations as a New Early Diagnostic Markers of Hepatocellular Carcinoma in Egyptian Patients. Madridge Journal of Oncogenesis . 2018; 2 (1): 21-29 Publisher Full Text 6. Lee SN, Park CK, Sung CO, Choi JS, et al.: Correlation of mutation and immunohistochemistry of p53 in hepatocellular carcinomas in Korean people. J Korean Med Sci . 2002; 17 (6): 801-5 PubMed Abstract | Publisher Full Text 7. Jiao J, Niu W, Wang Y, Baggerly K, et al.: Prevalence of Aflatoxin-Associated TP53R249S Mutation in Hepatocellular Carcinoma in Hispanics in South Texas. Cancer Prev Res (Phila) . 11 (2): 103-112 PubMed Abstract | Publisher Full Text 8. Huang XH, Sun LH, Lu DD, Sun Y, et al.: Codon 249 mutation in exon 7 of p53 gene in plasma DNA: maybe a new early diagnostic marker of hepatocellular carcinoma in Qidong risk area, China. World J Gastroenterol . 2003; 9 (4): 692-5 PubMed Abstract | Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Microbiome, Sexually Transmitted Infections, and Cancer I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Onywera H. Reviewer Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.21284.r55879 ) The direct URL for this report is: https://f1000research.com/articles/8-1364/v1#referee-response-55879 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Mwapagha L. Reviewer Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.21284.r55172 ) The direct URL for this report is: https://f1000research.com/articles/8-1364/v1#referee-response-55172 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 30 Oct 2019 Lamech Mwapagha , Faculty of Health and Applied Sciences, Department of Natural and Applied Sciences, Namibia University of Science and Technology, Windhoek, Namibia Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.21284.r55172 General In this manuscript, Ochwoto et al. investigate mutations in TP53, among patients with hepatocellular carcinoma (HCC) and chronic hepatitis B virus (HBV) infection at the Moi Teaching and Referral Hospital (MTRH), Eldoret, Kenya. They conclude that ... Continue reading READ ALL General In this manuscript, Ochwoto et al. investigate mutations in TP53, among patients with hepatocellular carcinoma (HCC) and chronic hepatitis B virus (HBV) infection at the Moi Teaching and Referral Hospital (MTRH), Eldoret, Kenya. They conclude that TP53 mutation is a poor indicator for prognosis among HBV-positive persons in Kenya, due to a lack of association between TP53 mutations and HCC development. Comments to Authors In general, the manuscript owns some degree of novelty and clarifies previously existing hypothesis on the relationship between TP53 mutations and HCC. However, the study seems to have some glaring omissions with methodology and the results. The authors aimed to evaluate TP53 mutations in exons 4, 6 and 7, but there were no results shown for exon 6. Even though, this study didn’t find a significant relationship between TP53 mutations and HCC development in Kenya. It would have been ideal to include healthy subjects as part of the controls since previous studies have shown the presence of TP53 mutations in healthy cohorts albeit at much lower frequencies to HCC subjects, thus, it is difficult to make any inferences due to the lack of such controls. An interesting part of this study relies on the sequencing results, am referring to mutation detection and analysis. Accordingly, I think that the study would have greatly benefited from some experimental validation of this data e.g. Restriction endonuclease to validate the mutations.There are also no supporting results depicting the presence/lack of the said mutations i.e. Gel electrophoresis images and sequence electropherograms. Thus, making reproducibility of this work partly possible in validating the conclusions made. Minor Points Omitted results/typographical errors: Study site and sample population, Page 3, line 6 “HBV or HBV” delete one. Serology testing, Page 3, line 2 “were was” correct the sentence. PCR mastermix, page 4, give the genomic DNA template concentration as opposed to a generic quantity. DNA sequencing, page 4, line 5 “were send” edit to were sent. Table 1, include the expected band sizes or mention these in the methodology. Include Exon 6 results. Figure 1 legend, not detailed and descriptive. Results, page 5, lines 2-3 delete word “more”. Results, page 5, paragraph 1 last line. The authors state “….all patients wth Arg/Arg alleles did not have HCC….” But both tables 3 and 4 show the presence of 2 (50%) HCC subjects with the polymorphisms. Codon 249 mutation and HCC, section is not clear, check for grammatical errors. Discussion, Page 6, line 3, no exon 6 results. Discussion, Line 9, “tufy” edit to study. Discussion, Paragraph 2, line 9, “most study” edit to most studies. Summary This manuscript provides novel interesting data on TP53 mutation and HCC in Kenya. Subject to addressing the concerns raised, this work is scientifically sound and worthy of indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Cancer Genomics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Mwapagha L. Reviewer Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.21284.r55172 ) The direct URL for this report is: https://f1000research.com/articles/8-1364/v1#referee-response-55172 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 06 Aug 2019 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 12 Mar 24 read Version 1 06 Aug 19 read read Lamech Mwapagha , Namibia University of Science and Technology, Windhoek, Namibia Harris Onywera , University of Cape Town, Cape Town, South Africa; University of Cape Town, Cape Town, South Africa Menat Allah Ali Shaaban , Ain Shams University, Cairo, Egypt Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Ali Shaaban M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 22 Sep 2025 | for Version 2 Menat Allah Ali Shaaban , Ain Shams University, Cairo, Egypt 0 Views copyright © 2025 Ali Shaaban M. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Introduction: Paragraph 1: References at years 2016 and 2017 need to be updated as incidence and number of deaths are dynamic values that may show changes over years. The collection of samples was finished on 2017. There was a previous version. I just don’t get why there is a delay till 2025. Also, oncogenesis is affected by several internal and external factors that are affected by time and many theories are in continuous emerge for oncogenesis on molecular level. Plus, the technical quality is actually improved over the past 10 years. Methods: Study site and sample population: why patients were chosen only when having jaundice PCR amplification of human TP53... 2nd paragraph 5th row: “extension at 72°C for 30 seconds” instead of “extension at 72°C 30 seconds”. Statistical analysis: was sample size calculated? You have not mentioned. Results: Participant demographics The ratio of male to female was 51.5% to 48.5%. You have mentioned before clearly that the ratio is 1.1: 1. Here, you mention the percentage not the ratio, you may mention that the percentages are 51.5% and 48.5% for males and females, respectively. Also change male to males, and females instead of female e.g. “48.0% were females and 52.0% were males” instead of “48.0% were female and 52.0% were male” TP53 exon 4, codon 72 polymorphism analysis “All those homozygous for Arg/Arg were males” instead of “All those homozygous for Arg/Arg were male”. Table 5 is titled HCC status and Codon 249 mutation, however, the data in the table is not clear. Please revise the data and make it clearer. Discussion: 1 st paragraph: please mention in brief the relation between the codons, the exons and the studied polymorphisms to make it easier to follow. pro/pro percent in the current study is 54.5% and you mentioned this several times. Then, in the same paragraph in the discussion you said patients with HCC had higher frequencies of Pro/Pro (88.2%). Please revise the whole sentence: We observed that patients with HCC had higher frequencies of Pro/Pro (88.2%) compared to observation made among Moroccan population (11.8%) ( Ezzikouri et al ., 2010 ) and Egyptian patients with HCV ( Koushik et al ., 2004 ; Neamatallah et al ., 2014 )”. The reference Neamatallah et al ., 2014 was mentioned 2 times with non-comparable results. 2 nd paragraph, 4 th line: “Arg/Pro alleles” instead of “Arg/Pr alleles” Other studies comparing acute hepatitis C and HCC have not found any association between codon 72 polymorphism and disease severity or HCC: in this sentence, do you intentionally mean Hepatitis C, though your study was on patients with Hepatitis B. Is it for comparing? That was to short mention for comparing Hepatitis B and C. Additionally, the current study did not mention any data about the staging of HCC in the results and the sample data were not divided according to staging of HCC, thus, you did not state relation to severity in your study to compare with other studies. Actually, this is an important missing point. Staging of any tumor is an essential data while studying a certain marker. That was why I was wondering also why you collect samples from jaundiced patients. That means that patients were in late stages of HCC. But, actually, it is better to reveal the importance of a marker in detecting the disease in early stages. 3 rd paragraph, 13 th line: What do you mean by “presence of this very mutation in HCC patients”. The sentence is not clear. Recommendations and limitations: 6th row: perfume any analysis. I guess there is a spelling mistake here. The sentence is not clear. Conclusion : in the conclusion of the study, whether in the abstract or the final, you have mentioned the study was to detect the association between TP53 and HCC development. Then, you mentioned TP53 as a prognostic marker. Actually, more data e.g. regarding staging -as I have mentioned- are required to assess the role of TP53, but you have to be precise in your conclusion, what your study found. Then, further recommendations can be put to make more sample size to get the chance to have good data may be through a project as I do understand that these techniques need a fund to be performed on adequate informative sample size. Finally, I thought about telling to update many references to cope with 2025, but basically the technique was made on 2017 after sample collection or a bit later I guess. Please, try to update references wherever feasible. Lastly, I really do appreciate this work and this effort. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise clinical pathology , subspecialty is chemistry and molecular studies I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Ali Shaaban MA. Peer Review Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.161477.r410414) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/8-1364/v2#referee-response-410414 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2019 Onywera H. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 06 Nov 2019 | for Version 1 Harris Onywera , Institute of Infectious Disease and Molecular Medicine, University of Cape Town, Cape Town, South Africa; Division of Medical Virology, Department of Pathology, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa 0 Views copyright © 2019 Onywera H. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Summary of the article by Ochwoto and colleagues The article by Ochwoto and colleagues aimed to identify polymorphisms in the human TP53 gene among Kenyan patients with hepatocellular carcinoma (HCC) and chronic hepatitis B. TP53 is a gene that encodes tumour protein p53 that controls the cell cycle (division or proliferation), thereby suppressing tumorigenesis. Mutations in the TP53 impair the function of the tumour protein p53, causing the cells to proliferate uncontrollably. Ochwoto and colleagues examined mutations in codons 72 and 249, which exit in exons 4 and 7, correspondingly. They found that there was genetic heterogeneity in the nucleotide mutations in the TP53 gene, which resulted in either synonymous or nonsynonymous mutations. Further analyses found no association between p53 mutations and HCC, suggesting that mutations in the TP53 gene may not be good biomarkers for HCC, specifically among Kenyan patients with hepatitis B virus (HBV) infections. There is paucity of data on the polymorphisms in the TP53 gene and their association, if there is any, with HCC on Kenyan cohort. Whereas the study by Ochwoto and colleagues adds knowledge to the existing literature, I approve it with sound reservations. First and foremost, they do not sufficiently address all their objectives. For instance, they indicate that they will investigate polymorphisms in specific codons found in exons 4, 6 and 7. However, they do not present any of the results for exon 6, yet they say in the “recommendations and limitations” section that they examined this. Besides, they detail (in the “methods” section) the primers that were used to amplify and sequence exon 6. What happened to exon 6 results? What codon positions in this exon were analysed? The authors do not consistently present their results. I mean, the way they present/tabulate their results for codon 72 (in exon 4) is totally different from codons 249 (exon 7). No PCR/sequencing and healthy controls were included in their study. There are sections in the manuscripts that have not been referenced. Ochwoto and colleagues do not adequately highlight findings of the literature that they use – as it is not clear what some of those studies reported. For example, in the discussion section (paragraph 1), they state: “Different prevalence of this substitution has been reported in various studies.” With this, they assume that the reader is aware of what those studies reported. To address this, they should give a range of the prevalence that these studies found, so that the reader can easily compare findings presented herein with/to what is already known. Another sentence would be in paragraph 2 ( discussion ), where they write, “This study did not find any association between polymorphisms and HCC among the HBV-positive patients. Other studies have shown similar findings (Eskander et al., 2014 1 ; Hu et al., 2014 2 ). The inconsistency in association and prevalence observed could be attributable to ethnic differences, since….” Could the authors kindly briefly highlight what some of these studies found? Apart from the aforementioned concerns, there are other concerns and a few typos and grammatical mistakes that need to be corrected. For example, the last sentence in paragraph 2 ( discussion ) is written as: “…since most study have been performed…” Study should be in plural. My detailed review is as below: Reviewer’s comments (according to manuscript section) Title and author affiliations Could the authors add “infection” after “chronic hepatitis B” so that it reads “chronic hepatitis B”? The extra comma (,) in affiliation 2 should be removed. Abstract The authors say in the background that “ANY” alteration/mutation in the TP53 gene adversely affects the regulatory function of the protein, potentially resulting in cancer. Synonymous mutations do not have this effect as the amino acids are not altered. Mutations in TP53 are not always associated with altered p53. The words “mutations to” should be changed to “mutations in”. Is “codon 7” supposed to be “codon 72”? The background does not provide motivation for the study and why it was conducted on a Kenyan cohort? Is it because there is paucity of data surrounding this topic, especially in Kenya? Is it because there are high rates of recurrent liver tumours/cancers? Remove the semi-colon (;) in the methods and put a full stop (.). Why do the authors say exons 4 and 7 were analysed yet in the manuscript they mention exon 6 too? In the results , “12.1%,” should be “12.1%” and “Arg-Ser” should be “Arg/Ser”. They should be consistent when they present the mutations, either use forward slash (/) or hyphen (-) throughout the manuscript. Part of their conclusion in the abstract is not supported by their findings. The authors’ study is a cross-sectional one and test causal roles, it can only show an association between the polymorphism and HCC. It is thus inaccurate to say that the “mutations under study may dependently play a role in HCC development”. Moreover, they did not examine if other factors contributed to HCC development and whether the mutations they detected co-occurred with other mutations. The authors write, “ TP53 mutation is a poor indicator for prognosis and a tumor’s biological behavior among HBV-positive subjects in Kenya.” The cross-sectional nature of their study does not permit them to assess this. They did not use a longitudinal study to study the mutation outcomes. In addition, they did not have information on tumour staging, response to treatment, survival rates (in comparison with healthy controls), vascular invasion (blood and/or lymph vessel invasion, LBVI), and Child-Pugh score. If Ochwoto and colleagues needed to examine the role of TP53 mutation on HCC development and whether these mutations could be indicators for prognosis, then they should have i) utilized a longitudinal study with important participant information, and ii) assessed where the mutations acted dependently (synergistically with other TP53 mutations) or independently to promote carcinogenesis in HCC. My last comment on the abstract , should it be “P53” or “p53” in the conclusion ? Keywords Why is “codon 249” included as keyword but “codon 72” is not? I am also curious why “p53 exon 6” was not included yet other exons were, despite the fact that the authors indicate that they examined mutations in codons in exon 6. Author roles All authors are supposed to approve the final version of the manuscript. Based on the author contribution section, it appears like Maiyo AK and Chesumbaio G did not (review and edit the manuscript); hence, did not approve the final draft of the manuscript. Could the authors clarify if this was the case? Abbreviations There are abbreviations in the manuscripts that need to be included in this part. For instance, “AE” buffer, “DNA”, “HBsAg”, “CHB”, “AFB1”, and so on. Introduction Paragraph 1: There should be a comma after “Global Burden of Disease Cancer Collaboration et al. (2017)”. Paragraph 2: “Alteration to” should be “Alteration in”. The last sentence in this paragraph needs to be referenced as this is a fact that is being stated. Paragraph 3: The first sentence is relatively long and needs to be split into two, that is, put as two sentences. This sentences need to be referenced: “In exon 7, codon 249 (AGG→AGT, arginine to serine) has been identified as a “hotspot”.” and “In exon 4, an arginine to Proline substitution at codon 72 has been investigated as risk modifier in several cancer models; however, its role in cancer progression remains uncertain.” In the latter sentence, “Proline” should appear as “proline”. In addition, the authors say that “codon 72 has been investigated as risk modifier in several cancer models”. What did these investigations find? Was there an association? Do their investigations suggest that mutation (Arg to Pro substitution) in codon 72 plays a role in cancer development? Or did the authors intend to say that those studies found mutation in codon 72 (Arg to Pro substitution) to be a risk factor for cancer? Paragraph 4: there should be a comma after “In this study”. Although in paragraph the authors write, “ TP53 has ten coding exons, with mutations distributed in all of them, with a strong predominance in exons 4-9,…” it is unclear why the authors chose to study mutations in only exons 4, 6, and 7 (as they state in paragraph 4). Why did they not examine exons 8 and 9? Is there another reason besides limited information on TP53 polymorphisms in Kenya that motivated the authors to conduct their study in Eldoret, Kenya? Methods Study site and sample population: There is no need to write MTRH in full as this has been done before (in the last paragraph in the introduction section). The sentence “The MTRH was selected as it is one of the largest national referral hospitals in western Kenya, where rates of HBV infection are considered to be high (Ochwoto et al., 2016 3 ).” should come immediately after the first sentence. Regarding this sentence, the authors should state the rates of HBV infection that have been reported at MTRH. They should not assume that anyone reading the current paper is aware of this. The second sentence needs to be rephrased. Do the authors mean that they included only jaundice patients and that these patients were HBV-positive with and without HCC? It is not clear if the study by Ochwoto and colleagues is a cross-sectional one or a longitudinal study. They mention that after the patients were selected from the medical records, they “were then recruited in person.” Were the patients called and asked to participate in this study? Was it after this that samples were collected? The design of the study (whether cross-sectional or longitudinal) is somewhat confusing. If indeed it is a cross-sectional study, they should clarify and even acknowledge the fact that this was a retrospective study that depended on stored samples. The redundancy in the section, for instance, twice-mentioning that the study selected patients with jaundice, should be addressed/eliminated. “Eldoret hospital” should be “Eldoret Hospital”, and “age range were” should be “age range was”. What were the exclusion criteria in their study? Finally, the authors mention that information on “residential area” was abstracted from the health records. In spite of this, they do not use this information in their analyses. This information is not reported in their manuscript. Ethical consideration: “The ethical approval to conduct the study was obtained from Institutional Research and Ethics Committee (IREC) of MTRH/Moi University (approval number 001002), from Kenya Medical Research Institute Scientific Ethics Review Unit (approval number KEMRI/SERU/CVR/001/3211) and from Eldoret Cancer Registry (approval number ECR/DRA/2017/001).” should be changed to “The ethical approval to conduct the study was obtained from the Institutional Research and Ethics Committee (IREC) of MTRH/Moi University (approval number 001002), from the Kenya Medical Research Institute Scientific Ethics Review Unit (approval number KEMRI/SERU/CVR/001/3211) and from the Eldoret Cancer Registry (approval number ECR/DRA/2017/001).” In line with my comments above (regarding the nature of the study), the authors say that “the participants consented for the study prior to blood draw.” The consent that the patient provided, was it an informed one? Was it a verbal or written consent? Were/Are the patients aware that this study in particular was being conducted? Did they receive any compensation/incentive? Collection and preparation of blood samples: The statement “Plasma was separated at MRTH and thereafter the plasma tubes were shipped on dry ice to the KEMRI Production Unit in Nairobi.” could be written as “Plasma was separated at MRTH and then shipped in plasma tubes on dry ice to the KEMRI Production Unit in Nairobi.” Serological testing: Remove the extra hyphen in “IgM--positive”. Extraction of DNA from plasma: Information on the source of the reagents (e.g., DNA mini-extraction kit) or equipment (e.g., NanoDrop spectrophotometer), which is bracketed, need to be comprehensive. Apart from including the name of the company, name of the city and country is required. PCR amplification of human TP53 : The authors did not include any controls (negative and positive). How sure are they that their method is valid and that they did not get contamination during PCR? In the paragraph 1 of this section, “the extracts” should be written “the DNA extracts”. Moreover, there should be a space between “5” and “µl” so that it becomes “5 µl” instead of “5µl”. This statement “…of forward primer and reverse primer of sequences…” could be written as “…of forward and reverse primers…”. Table 1 could be put as part of the supplementary data. I am just curious, were the same primers used in PCR the same as those used for sequencing (putting into consideration that the authors mention there was an aspect of nested PCR)? Still in paragraph 1, “and” should be included between “… USA),” and “1.25 µl”. In paragraph 2, what is the model of the ABI PCR machine that was used? This sentence, “Amplification for exon 7 the PCR profile set at 95°C for 10 minutes initial denaturation and 35 cycles of denaturation…” does not makes sense. It needs to be corrected. Both the statements, “Final extension was at…” should be written as “Final extension was performed at…” Still regarding this paragraph (2), why did the authors opt not to give the PCR details for exon 6? The sentence in paragraph 3 is long and needs to be written as two or more sentences. “5X Gelpilot DNA loading” should be “5X Gelpilot DNA Loading”. For paragraph 4, why did the authors use “negative amplicons” in the second nested PCR? Is “negative amplicon” not a failed experiment according in their context? Why was this not performed for exons 4 and 6? Lastly, throughout this section (and the rest of the manuscript), the authors should include the information on the source of the reagents or equipment (which is bracketed) need to be comprehensive. Apart from including the name of the company, name of the city and country is required. This information should be furnished where appropriately, if possible even for the ultraviolet trans-illuminator gel Doc-It 2 Imager, 5X Gelpilot DNA Loading Dye. DNA sequencing: The authors need to state that they used Sanger sequencing. There should be an apostrophe (‘) in the word “manufacturers”. It should be: manufacturer’s and not manufacturers. “send” should be changed to “sent”. There should be a full stop at the end of this paragraph. Mutation detection and analyses: Is there any reason include the sentence “PCAP is an open-access alternative”? The authors should be specific about the BLAST they used. Was it BLAST n or BLAST p or both? “Bioedit” and “mutations to the” should be changed to “BioEdit” and “Mutations in”, respectively. Delete these words, “bioinformatics editing tool”. Lastly, about this section, the authors must reference BioEdit and MEGA software. Statistical analyses: What do the authors mean by “profile parameters”? The last sentence about SAS version 9.4 can be first sentence in this section. It is not clear what they mean by, “used to analyze two significant associations”? Did all the expected values in the 2x2 contingency tables warrant the use of Fischer’s exact text? Were all the expected value >5? If this was not the case, then Chi square test should be used in such scenarios. Odds ratios are used to measure the strength/magnitude of association. “P-values less” should be “P-values of less”. Results Participant demographics: The authors do mention exon 6 yet these results are hugely lacking. No results regarding this are presented. Can the authors please provide the results for this? The sentence “Among those (24.2%) that did not have HCC but were HBsAg positive, half were female and the other half male.” should be written as “Among those that did not have HCC but were HBsAg positive (24.2%), half were female.” The title for Table 2 is not accurate. While the title says “clinical” and “molecular” characteristics, the variable “gender” does not fit in any of that (clinical or molecular). Gender is a demographic characteristic. The symbol % should be deleted in the numbers (e.g., 75.8%) in the last column as this (5) is already put in the column title. At the bottom of this table, ALL abbreviations (e.g., HCC, Arg, etc.) should be written in full (e.g., hepatocellular carcinoma, arginine, etc.). The same is required for Tables 3, 4 and 5. Furthermore, the numbers in Table 5 need to have spaces between them and opening brackets, e.g., it should be “6 (24.0%)” and not “6(24.0%)”. This should be done for the other numbers, where necessary. The comma in the title for Table 4 should be removed. TP53 exon 4, codon 72 polymorphism analysis: Paragraphs 2 and 3, the authors display the Fisher test value at differing decimal places; some are at 2 decimal places while others are at 1 decimal place. They must ensure that they are consistent. The same is true for the other sections entitled: “Mutations at exon 7, codon 249” and “Codon 249 mutation and HCC”. Check the number of decimal places for the p-values and CIs, throughout the manuscript (even in the tables). Paragraph 2 (of section titled: TP53 exon 4, codon 72 polymorphism analysis), there should be a full stop after “p=0.12)”. The next sentence should then be case sensitive (“However”). The last sentence of this paragraph, “The Pro/Pro allele was more frequent in the HCC group, whereas all patients wth Arg/Arg alleles did not have HCC (Table 4).” needs to be changed/revised. First, there is a typo (“with” is written as “wth”). Secondly, the statement is untrue. I see that there are HCC patients (2 males) who had Arg/Arg alleles. For Figure 1, it is not relevant to have a 3D-plot as the third dimension is meaningless. My last comments on results: In order to ensure consistency, the authors should decide if they want to write “P=value”, “p=value”, or “P-value”. Moreover, they should decide on whether to include space before/after the equal sign (=). I see in one place they have “Fisher test=3.58’ while in another they have “Fisher's exact test =5.47”. The other thing, is it “Fisher test” or “Fisher's exact test”. Ochwoto and colleagues do not consistently present (tabulate) their results for the mutations found in the codons that they studies. No results are presented for exon 6. Moreover, the way they presented the results for codon 72 is considerably different from those of codon 249. Why did they opt for this strategy? Discussion Paragraph 1: They indicate that to the best of their knowledge, this is the first time information concerning TP53 exons 4, 6, and 7 are presented in Kenya. They should say that this is among HBV-positive patients with and without HCC, as there are other investigators , who studied exons 6 and 7 (though in the context of oral squamous cell carcinoma). Ochwoto and colleagues do not present results for exon 6 yet they mention this exon in their discussion. They also have the sentence “A number of studies have described two structurally different forms of wild-type p53…”, yet they end up providing only one reference (Thomas et al., 1999 4 ).” There should be additional references then. This paragraph has a typo (“study” written as “tufy”). The prevalence values (of the specific mutations in different cohorts, e.g., Taiwanese, Chinese, etc.) should be provided. This should also be done for the part where they say, “Different prevalence of this substitution…”. A range should be provided in this case. This sentence “In this tufy, the HBV-positive Kenyan population, the homozygous Pro/Pro genotype is…” could be written as “In our present study, the homozygous Pro/Pro genotype was…”. The last sentence of this paragraph, they say “higher frequencies”, but they do not indicate what they compared these frequencies with. Higher than which comparison group? There should be a coma after “11.8%” and the abbreviation “Vs” put as “vs”. Paragraph 2: The comma towards the end of the second sentence (“with cancer risk,” should be removed (and he words be “with cancer risk”). The next sentence, which starts with “In Egyptian patients…”, should have a full stop at the end, not a comma. It is also not clear if Ochwoto and colleagues are referring to their present results or other’s results when they state, “This study did not find any association between polymorphisms and HCC among the HBV-positive patients.” The authors should also give a few details about the studies by Eskander et al. , 2014 1 and Hu et al. , 2014 2 . Otherwise, the reader is left to wonder what the other studies found when they simply say, “Other studies have shown similar findings”. The last sentence of this paragraph should have the words “most study” changed to “most studies”. Just to add on some of the reasons for inconsistencies in study findings, I believe heterogeneity in study methodology, sample (population) size, and specimen type could at least partly be contributing factors. Paragraph 3: The authors should express the 8/33 as a percentage and go ahead and give us the exact rates that were reported on the cohorts from China, Taiwan and The Gambia. This sentence “However, evidence presented from a European population, which reported no mutation, is contrary to our findings (Kirk et al. , 2000).” needs to be rewritten. This study 5 , done on an Egyptian cohort, should be included in this section and findings on rates of mutants in codon 249 reported. Another study would be this 6 , which found no mutation in codon 249 among HCC Korean patients. In manuscript by Ochwoto and colleagues, the part written, “offer explanation to” could be written as “could explain” as it is not certain what resulted in the discordance. Delete “(p=0.6821) at level of significance p<0.05”. Personally, I disagree with the fact that the authors think that based on the odds ratio (OR=0.5278; 95% CI 0.0584-4.7736), codon 249 might be a predisposing factor for HCC. The OR value do not support that as the values range from 0 to over 1. OR >1 indicates increased occurrence of an event whereas OR <1 indicates decreased occurrence of event (protective exposure). Paragraph 4: The sentence could begin with, “We further found that males were overrepresented…”. The last sentence (However, there was there was an association between the sex and mutation (Fisher's exact test =5.47, P-value =0.039) needs to be rectified – as “there was” is repeated. The information on statistics (Fisher's exact test =5.47, P-value =0.039) should be deleted as they are already in the results section. Paragraph 5: The authors need to present the rates (prevalence) rather than numbers so that their values can be compared to what is in the literature. This sentence (“ TP53 codon 249 mutations were observed not only in HCC patients but also in one the non-HCC patient”) should have the prevalence so that the rates can be easily compared with/to others. Change “this corroborates earlier findings” to “thus, corroborating earlier findings”, “mutations to” to “mutation in”, and “A possible explanatory analysis…” to “A possible explanation…”. The authors mention that mutations in codon 249 are generally known as a hotspot for aflatoxin B1 (AFB1)-driven modification, and that AFB1 induces codon 249 mutation among cancer patients residing in AFB1 high-risk regions, where chronic HBV and HCV infections are also endemic. While they acknowledge that they did not perform aflatoxin exposure tests on their subjects, what makes them speculate that AFB1 could have an impact on their cohort? Can the authors please comment on the levels of aflatoxins in the region, Eldoret? Do the authors know if there are certain foods in the region that have AFB1 levels beyond the tolerated level? Do the authors think that other factors such as alcohol and smoking could have a similar influence on TP53 as AFB1? Recommendations and limitations In this section, they mention exon 6, but no results were presented. The sentence “Although this study has investigated for” should be “Although this study investigated”. The sentence “However, this study was a cross-sectional study that involved 33 HBV-positive patients, of whom 25 had HCC, it was hard to compare the evolution of the mutations among the patients with HCC.” could be written as “The cross-sectional nature of the study limited our analysis. Thus, we were unable to perfume any analysis to determine the evolution of the TP53 mutations among the patients with HCC.” Conclusion I tend to disagree with the authors’ conclusion as they do not write this section based on their findings. Their study was not a longitudinal one, which could/would enable them assess the role of polymorphisms (codons 72 and 249) in HCC development. Further, their study did not show that these mutations are poor indicator for prognosis. References The authors need to present up-to-date information. Of all there >30 references, there is none for 2019, while there are only one, two, and three for 2018, 2017, and 2016, respectively. The rest are for the previous years, prior to 2016. Other comments No PCR and sequencing controls were included in the study. Therefore, how sure are the authors that there were no contaminants in their study? How sure are they that they targeted the right gene? The authors do not mention anything about the size of the amplicon that they expected and whether they observed it. No healthy human controls were included. Moreover, there was no information on tumour size, histopathological features, cancer staging, and treatment outcome. Thus, it is hard to infer speculate on the role of the TP53 mutations in their study. The authors should not be too quick to generalize results as their sample size was relatively small, besides their study having other limitations. The authors did not adjust their analysis for multiple comparisons. Moreover, they do not acknowledge other confounders. The method they used for amplification and sequencing may have resulted in their ability to capture other mutations. They could have confirmed their findings using droplet digital PCR (ddPCR), restriction fragment length polymorphisms (RFLP), or polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP). What could be the implications of the TP53 mutations that the authors identified in their study? The implications should relate to their study cohort/population. The study cohort/population is not sufficiently described. There is less information about the study cohort/population. Do the authors know the HIV status of the cohort? Other information that would have been relevant and important in their discussion would be HBV genotypes, other potential cancers, hereditary disorders and so on. The results by Ochwoto and colleagues do not have the electrophoresis results. I recommend that they provide the results for band visualization? The authors have information about the age of the study participants. One study on a small cohort of Hispanics 7 associated TP53R249S mutation with a younger age (besides worse prognosis). The work by Ochwoto and colleagues has the potential to add more knowledge if they could stratify their participants by age (young vs old) and then examine if there is any association of the TP53 mutations with age. To strengthen this finding (in the discussion ) where they say “Our study found no significant association between codon 249 mutation and hepatocellular carcinogenesis…”, I suggest that they include this paper 8 which does not support their findings. The suggested article found a strong association between TP53R249S in plasma and HCC Qidong patients. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Partly References 1. Eskander EF, Abd-Rabou AA, Yahya SM, El Sherbini A, et al.: "P53 codon 72 single base substitution in viral hepatitis C and hepatocarcinoma incidences". Indian J Clin Biochem . 2014; 29 (1): 3-7 PubMed Abstract | Publisher Full Text 2. Hu S, Zhao L, Yang J, Hu M: The association between polymorphism of P53 Codon72 Arg/Pro and hepatocellular carcinoma susceptibility: evidence from a meta-analysis of 15 studies with 3,704 cases. Tumour Biol . 2014; 35 (4): 3647-56 PubMed Abstract | Publisher Full Text 3. Ochwoto M, Kimotho JH, Oyugi J, Okoth F, et al.: Hepatitis B infection is highly prevalent among patients presenting with jaundice in Kenya. BMC Infect Dis . 2016; 16 : 101 PubMed Abstract | Publisher Full Text 4. Thomas M, Kalita A, Labrecque S, Pim D, et al.: Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol . 1999; 19 (2): 1092-100 PubMed Abstract | Publisher Full Text 5. Abd Elhameed A, Abo-Elenein A, Ibrahim W, El-kassas G, et al.: Study of P53 Gene Mutations as a New Early Diagnostic Markers of Hepatocellular Carcinoma in Egyptian Patients. Madridge Journal of Oncogenesis . 2018; 2 (1): 21-29 Publisher Full Text 6. Lee SN, Park CK, Sung CO, Choi JS, et al.: Correlation of mutation and immunohistochemistry of p53 in hepatocellular carcinomas in Korean people. J Korean Med Sci . 2002; 17 (6): 801-5 PubMed Abstract | Publisher Full Text 7. Jiao J, Niu W, Wang Y, Baggerly K, et al.: Prevalence of Aflatoxin-Associated TP53R249S Mutation in Hepatocellular Carcinoma in Hispanics in South Texas. Cancer Prev Res (Phila) . 11 (2): 103-112 PubMed Abstract | Publisher Full Text 8. Huang XH, Sun LH, Lu DD, Sun Y, et al.: Codon 249 mutation in exon 7 of p53 gene in plasma DNA: maybe a new early diagnostic marker of hepatocellular carcinoma in Qidong risk area, China. World J Gastroenterol . 2003; 9 (4): 692-5 PubMed Abstract | Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Microbiome, Sexually Transmitted Infections, and Cancer I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Onywera H. Peer Review Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.21284.r55879) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/8-1364/v1#referee-response-55879 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2019 Mwapagha L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 30 Oct 2019 | for Version 1 Lamech Mwapagha , Faculty of Health and Applied Sciences, Department of Natural and Applied Sciences, Namibia University of Science and Technology, Windhoek, Namibia 0 Views copyright © 2019 Mwapagha L. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions General In this manuscript, Ochwoto et al. investigate mutations in TP53, among patients with hepatocellular carcinoma (HCC) and chronic hepatitis B virus (HBV) infection at the Moi Teaching and Referral Hospital (MTRH), Eldoret, Kenya. They conclude that TP53 mutation is a poor indicator for prognosis among HBV-positive persons in Kenya, due to a lack of association between TP53 mutations and HCC development. Comments to Authors In general, the manuscript owns some degree of novelty and clarifies previously existing hypothesis on the relationship between TP53 mutations and HCC. However, the study seems to have some glaring omissions with methodology and the results. The authors aimed to evaluate TP53 mutations in exons 4, 6 and 7, but there were no results shown for exon 6. Even though, this study didn’t find a significant relationship between TP53 mutations and HCC development in Kenya. It would have been ideal to include healthy subjects as part of the controls since previous studies have shown the presence of TP53 mutations in healthy cohorts albeit at much lower frequencies to HCC subjects, thus, it is difficult to make any inferences due to the lack of such controls. An interesting part of this study relies on the sequencing results, am referring to mutation detection and analysis. Accordingly, I think that the study would have greatly benefited from some experimental validation of this data e.g. Restriction endonuclease to validate the mutations.There are also no supporting results depicting the presence/lack of the said mutations i.e. Gel electrophoresis images and sequence electropherograms. Thus, making reproducibility of this work partly possible in validating the conclusions made. Minor Points Omitted results/typographical errors: Study site and sample population, Page 3, line 6 “HBV or HBV” delete one. Serology testing, Page 3, line 2 “were was” correct the sentence. PCR mastermix, page 4, give the genomic DNA template concentration as opposed to a generic quantity. DNA sequencing, page 4, line 5 “were send” edit to were sent. Table 1, include the expected band sizes or mention these in the methodology. Include Exon 6 results. Figure 1 legend, not detailed and descriptive. Results, page 5, lines 2-3 delete word “more”. Results, page 5, paragraph 1 last line. The authors state “….all patients wth Arg/Arg alleles did not have HCC….” But both tables 3 and 4 show the presence of 2 (50%) HCC subjects with the polymorphisms. Codon 249 mutation and HCC, section is not clear, check for grammatical errors. Discussion, Page 6, line 3, no exon 6 results. Discussion, Line 9, “tufy” edit to study. Discussion, Paragraph 2, line 9, “most study” edit to most studies. Summary This manuscript provides novel interesting data on TP53 mutation and HCC in Kenya. Subject to addressing the concerns raised, this work is scientifically sound and worthy of indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Cancer Genomics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Mwapagha L. Peer Review Report For: Human TP53 gene polymorphisms among patients with Hepatocellular carcinoma and chronic hepatitis B infection in Kenya [version 2; peer review: 3 approved with reservations] . F1000Research 2024, 8 :1364 ( https://doi.org/10.5256/f1000research.21284.r55172) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/8-1364/v1#referee-response-55172 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Human TP53 gene polymorphisms among patients...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/8-1364/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/8-1364/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/8-1364/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Ochwoto M et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/8-1364/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/8-1364", templates : { twitter : "Human TP53 gene polymorphisms among patients with Hepatocellular.... Ochwoto M et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/8-1364/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/19416/161477") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "161477"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "280324": 0, "280326": 0, "280327": 0, "55172": 54, "280321": 0, "55173": 0, "280322": 0, "280323": 0, "280328": 0, "280329": 0, "280330": 0, "280331": 0, "52120": 0, "52121": 0, "52122": 0, "309407": 0, "52123": 0, "52124": 0, "333221": 0, "410406": 0, "333220": 0, "410407": 0, "333223": 0, "333222": 0, "268967": 0, "268972": 0, "410414": 5, "410415": 0, "268973": 0, "410412": 0, "268974": 0, "294958": 0, "410413": 0, "268975": 0, "294959": 0, "410410": 0, "255023": 0, "268968": 0, "333224": 0, "410411": 0, "255022": 0, "268969": 0, "410408": 0, "268970": 0, "410409": 0, "268971": 0, "268976": 0, "294960": 0, "274876": 0, "274877": 0, "274878": 0, "274879": 0, "274872": 0, "274873": 0, "274874": 0, "274875": 0, "356548": 0, "274880": 0, "356545": 0, "274881": 0, "356544": 0, "356547": 0, "356546": 0, "52807": 0, "55879": 83, "52808": 0, "52809": 0, "54115": 0, "54116": 0, "53862": 0, "53863": 0, "53864": 0, "264180": 0, "264181": 0, "264182": 0, "284534": 0, "264183": 0, "284535": 0, "264188": 0, "284540": 0, "264189": 0, "264184": 0, "284536": 0, "264185": 0, "284537": 0, "264186": 0, "284538": 0, "264187": 0, "284539": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "8cf65339-8a49-4aa1-af89-bd0c4d93eaf0"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.