miR-361-5p regulates SLC25A24 to maintain mitochondrial function and alleviate granulosa cell dysfunction in diminished ovarian reserve.

OA: gold CC-BY-NC-ND-4.0
Full text 41,311 characters · extracted from pmc-nxml · 5 sections · click to expand

Methods

From 2023.2 to 2024.2, patients undergoing assisted reproductive technology treatment at the Reproductive and Genetics Center of our hospital were included in this study. The inclusion criteria were patients aged between 20 and 40 years who had been unable to conceive naturally for over a year. Patients with polycystic ovary syndrome, premature ovarian failure, endometriosis, reproductive endocrine diseases, ovarian tumors, or those who had undergone chemotherapy or pelvic radiotherapy were excluded. A total of 20 patients were diagnosed with DOR, while 20 patients with normal ovarian function served as the control group. The control group patients were infertile due to tubal or male factors. Follicular fluid was collected from all patients. Clinical information collected included age, BMI, duration of infertility (years), follicle-stimulating hormone (FSH, mIU/mL), luteinizing hormone (LH, mIU/mL), FSH/LH ratio, estradiol (E₂, pg/mL), progesterone (ng/mL), anti-Müllerian hormone (AMH, ng/mL), and antral follicle count. The study protocol was approved by the Institutional Review Board of our hospital. Informed consent was obtained from all patients participating in the study. KGN cells, a human ovarian granulosa cell line, were used in the study for further experiments. Human granulosa cells were isolated from the follicular fluid of patients undergoing assisted reproductive technology at our hospital. The follicular fluid was collected during oocyte retrieval, and granulosa cells were separated using a density gradient centrifugation method and identified as described previously [ 21 ]. After isolation, granulosa cells were immediately cultured in culture medium which was supplemented with 10% fetal bovine serum (Gibco, Australia), 1% Penicillin mixture (Solarbio, Beijing, China), and placed in 5% CO 2 , 37 °C incubator (Thermo, USA) prior to experimentation. The 3rd generation of cultured cells was selected for further study. To investigate the role of miR-361-5p in granulosa cells, KGN cells were transfected with various miRNA mimics and inhibitors using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions. The cells were grouped into the following transfection conditions: negative control (NC) inhibitor, miR-361-5p inhibitor, NC mimic, miR-361-5p mimic, NC shRNA, SLC25A24 shRNA, and combinations of miR-361-5p inhibitor with either NC shRNA or SLC25A24 shRNA. The negative control used in this study refers to a non-specific inhibitor or mimic that does not target any specific gene, used to account for any non-specific effects. These controls, along with the miRNA mimics and inhibitors, were specifically designed and synthesized by Shanghai IBS Biotech Co., Ltd. Transfection efficiency was confirmed by quantitative real-time PCR (qRT-PCR) and Western blot analysis, ensuring effective modulation of miR-361-5p and SLC25A24 expression. Total RNA was extracted from cells and exosomes using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Reverse transcription and quantitative PCR (qPCR) were performed using the Quant One Step qRT-PCR Kit (Probe) (LM-0102; LMai Biotech Co., Ltd.). Specific primers for miR-25-3p and U6 snRNA (as an internal control) were used to quantify the expression levels. The sequences of the primers synthesized by Tsingke Biotech Ltd. were listed in Table  1 . Table 1 Primer sequence information Forward primer (5′−3′) Reverse primer (5′−3′) miR-361-5p GCGCGTTATCAGAATCTCCAG AGTGCAGGGTCCGAGGTATT SLC25A24 GATCTCCCGTGACTTCCTCG CTGGAAGAGGGTCTCGTAGC U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT GAPDH ATGGGCAGCCGTTAGGAAAG ATCACCCGGAGGAGAAATCG Primer sequence information Protein extracts from tissues and cells were obtained using the Pierce™ IP Lysis Buffer (Thermo Fisher). Subsequently, 40 μg of protein from each sample was subjected to electrophoresis on a 10% SDS-PAGE gel (Beyotime) and then transferred onto polyvinylidene difluoride (PVDF) membranes (Beyotime). To prevent non-specific binding, the membranes were blocked with 5% fat-free milk for 1 h at room temperature before being incubated with primary antibodies against SLC25A24 (1:1000; Abcam; ab221120), Aromatase (1:2000; Abcam; ab114260), StAR (1:5000; Abcam; ab133657), LC3-II (1:20,000; Abcam; ab103506), LC3-I (1:1000; Abcam; ab192890), BECN1 (1:1000; Abcam; ab207612), P62 (1:1000; Abcam; ab109012), PINK (1:1000; Abcam; ab186303), Parkin (1:2000; Abcam; ab177625), and β-actin (1:5000; Abcam; ab8227) overnight at 4 °C. The following day, the membranes were incubated with a rabbit anti-mouse IgG secondary antibody (1:2000; Abcam) at room temperature for 2 h. β-actin served as the endogenous control throughout the assay. Supernatants from KGN cells and tissues were collected after centrifugation at 1000 g for 10 min. The concentrations of estradiol and progesterone within these supernatants were quantitatively determined employing ELISA kits (Nanjing Jiancheng, China) following the manufacturers’ instructions. Briefly, 100 μL of sample was added to pre-coated plates and incubated for 2 h at room temperature. After washing the plates, a biotinylated detection antibody was added and the plates were incubated. Following a series of washes, streptavidin-HRP was added and the plates were incubated for 30 min. The reaction was developed using TMB substrate and stopped with sulfuric acid. The level of intracellular ROS was determined by DCFH-DA staining. Cells were pretreated with indicated drugs for 2 h. Cells were then harvested and incubated with DCFH-DA (10 mM) for 30 min in the dark at 37 °C. After staining, cells were washed twice with D-PBS. The intracellular ROS fluorescence intensity was quantified by flow cytometry and the images were taken by a fluorescence microscope (Olympus IX53; Olympus Corporation, Tokyo, Japan). Quantitative PCR (qPCR) was rigorously applied to assess mtDNA in KGN cells. DNA was extracted meticulously using the Sangon DNA Genome Extraction Kit. For mtDNA analysis, primers mtF3212 and mtR3319 were employed, while for nuclear DNA quantification, the 18S ribosomal RNA gene was targeted with primers 18S1546F and 18S1546R, following the protocol described by Bai et al. [ 22 ]. The real-time qPCR was performed on the ABI-Prism 7700 Sequence Detector System. Each 10 μL PCR mixture included 1 × TaqMan Universal PCR Master Mix, 500 nM concentration of each primer, 200 nM TaqMan probe, and a range of 0.2 to 2 ng genomic DNA. The PCR protocol was set to an initial 2 min incubation at 50 °C and 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C for denaturation and 60 s at 60 °C for annealing and extension. This protocol was designed to ensure the precise and reliable quantification of mtDNA. Following the protocol described in a previous study [ 23 ], ATP levels were measured using a luciferin-luciferase ATP assay system and a CentroPRO LB 962 luminometer, as per the guidelines provided by Molecular Probes (A22066). Briefly, ten denuded oocytes were placed into a 0.2 mL centrifuge tube containing 30 μL of lysis buffer (20 mM Tris, 0.9% Tween 20, and 0.9% Nonidet-40) and homogenized by vortexing until complete lysis was achieved. A standard reaction solution was prepared according to the manufacturer’s instructions and kept on ice away from light until used. For the assay, 5 μL of each sample was transferred into a 96-well plate and equilibrated for 10 s. Subsequently, 150 μL of the reaction solution was added to each well. After a 2-s delay, the luminescence was integrated over 10 s. Light intensity was quantified using ICE software, which is designed for setting up ATP assay protocols. The software’s parameter was preset at 1 for the control samples. The luminescence intensity for the treatment samples was recorded and expressed as relative values compared to the control. Mitochondrial membrane potential was assessed using JC-1 staining (5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolylcarbocyanine iodide). Cells were seeded in six-well plates and treated according to experimental requirements. Post-treatment, cells were incubated with JC-1 dye (10 μg/mL; Sigma-Aldrich, USA) at 37 °C for 20 min, allowing for adequate staining. Post incubation, cells were washed twice with PBS to remove excess dye. The mitochondrial membrane potential was determined by measuring the intensity of red fluorescence (aggregates, indicating higher potential) and green fluorescence (monomers, indicating lower potential) using a fluorescence microscope. Utilizing the bioinformatics tool TargetScan, potential binding sites for miR-361-5p on the 3’-untranslated region (3’-UTR) of SLC25A24 were identified. To experimentally validate the prediction, constructs of luciferase reporter vectors containing the wild-type 3’-UTR of SLC25A24 (SLC25A24-WT) alongside mutant variants of these regions (SLC25A24-MUT) were synthesized (Shanghai Transheep Biotech Co., Ltd.). These constructs were co-transfected into KGN cells lines utilizing Lipofectamine™ 3000 Transfection Reagent (Invitrogen), with assays conducted 48 h post-transfection to assess luciferase activity via a dual-luciferase reporter gene system. For the Cell Counting Kit-8 (CCK-8) assay, which is used to assess cell viability based on mitochondrial activity, 5,000 KGN cells per well were seeded in a 96-well plate and allowed to adhere for 24 h. Post-transfection with either siRNA targeting SLC25A24 or a control siRNA, cells were further incubated to allow for gene knockdown effects. Subsequently, 10 µL of CCK-8 solution (Sant Biotechnology, Shanghai, China) was added to each well, and the plate was incubated for 1 h at 37 °C. Absorbance was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader to assess cell viability. All assays were conducted in triplicate to ensure consistency and reliability of the results. To detect apoptotic cells in KGN cell samples, the TUNEL (Terminal deoxynucleotidyl transferase dUTP nick end labeling) assay was performed. Cells were cultured on coverslips, fixed with 4% paraformaldehyde for 30 min, and permeabilized with 0.1% Triton X-100 on ice for 2 min. After incubation with the TUNEL reaction mixture at 37 °C for 60 min in the dark, cells were counterstained with DAPI to label nuclei. TUNEL-positive cells, emitting green fluorescence, were observed under a fluorescence microscope, and the percentage of apoptotic cells was calculated by comparing the number of TUNEL-positive cells to the total number of DAPI-stained cells. This assay provided insights into the effects of miR-361-5p and SLC25A24 on cell survival. Data were expressed as mean ± standard deviation (SD). Comparative analyses among multiple groups employed ANOVA tests. SPSS software version 22.0 (IBM Corporation, USA) was utilized for all statistical computations, with a P-value of less than 0.05 denoting statistical significance.

Results

There were no statistically significant differences between the control and DOR groups in terms of age, BMI, duration of infertility, LH, Basal E₂, or progesterone levels. However, patients in the DOR group had significantly higher levels of FSH and FSH/LH ratios compared to the control group, while AMH levels and the number of antral follicles were significantly lower in the DOR group ( P  < 0.05) (Table  2 ). miR-361-5p expression was significantly lower in the DOR group compared to the control group ( P  < 0.01). The expression level of miR-361-5p was negatively correlated with FSH levels ( r  = −0.658, P  = 0.002) and positively correlated with AMH levels ( r  = 0.623, P  = 0.003) and the antral follicle count ( r  = 0.791, P  < 0.001) (Fig.  1 ). However, these correlations are based on clinical measurements, and further studies are needed to explore the potential direct effects of these factors on miR-361-5p expression in granulosa cells. Table 2 Clinical characteristics of patients Characteristics DOR Group ( n  = 20) Control Group ( n  = 20) P Age, y 33.32 ± 3.98 29.4 ± 3.37 0.977 BMI, kg/m 2 21.46 ± 2.28 20.56 ± 1.85 0.129 Duration of Infertility, y 2.10 ± 0.55 1.95 ± 0.60 0.418 Basal FSH, mIU/mL 14.35 ± 2.17 5.29 ± 1.09  < 0.001 Basal LH, mIU/mL 4.06 ± 1.55 4.50 ± 1.02 0.335 FSH/LH 3.94 ± 1.57 1.21 ± 0.32  < 0.001 Antral follicle number 3.37 ± 0.64 11.72 ± 3.16  < 0.001 Basal E₂, pg/mL 24.87 ± 20.40 18.87 ± 9.64 0.189 Progesterone, ng/mL 69.02 ± 8.86 68.21 ± 10.60 0.795 AMH, ng/mL 1.28 ± 0.56 4.44 ± 0.94  < 0.001 P  < 0.05 represents statistical significant Fig. 1 Correlation of miR-361-5p expression with clinical parameters. ( A ) Relative expression of miR-361-5p in control and DOR groups; ( B ) Negative correlation between miR-361-5p expression and FSH levels (mIU/mL); ( C ) Positive correlation between miR-361-5p expression and AMH levels (ng/mL); ( D ) Positive correlation between miR-361-5p expression and the number of antral follicles. P  < 0.05 represents statistical significant. ** P  < 0.01 Clinical characteristics of patients P  < 0.05 represents statistical significant Correlation of miR-361-5p expression with clinical parameters. ( A ) Relative expression of miR-361-5p in control and DOR groups; ( B ) Negative correlation between miR-361-5p expression and FSH levels (mIU/mL); ( C ) Positive correlation between miR-361-5p expression and AMH levels (ng/mL); ( D ) Positive correlation between miR-361-5p expression and the number of antral follicles. P  < 0.05 represents statistical significant. ** P  < 0.01 To explore the role of miR-361-5p in DOR, we analyzed the expression level of miR-361-5p in KGN cells using qRT-PCR. Compared to the NC inhibitor group, the miR-361-5p inhibitor group showed a significant decrease in miR-361-5p expression ( P  < 0.01), while the miR-361-5p mimic group exhibited a significant increase compared to the NC mimic group ( P  < 0.01) (Fig.  2 A). The CCK-8 assay showed that at 48 and 72 h, cell viability was significantly reduced in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01), whereas the miR-361-5p mimic group showed significantly increased cell viability compared to the NC mimic group ( P  < 0.01) (Fig.  2 B). The TUNEL assay revealed that the miR-361-5p inhibitor group had a significantly higher level of apoptosis compared to the NC inhibitor group ( P  < 0.01), while the miR-361-5p mimic group had a significantly lower level of apoptosis compared to the NC mimic group ( P  < 0.01). No significant differences were observed between the NC inhibitor and NC mimic groups (Fig.  2 C). Fig. 2 Influence of miR-361-5p on cell viability, apoptosis, and hormonal regulation in KGN cells. ( A ) Relative expression levels of miR-361-5p in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( B ) Cell viability measured by CCK-8 assay at 0, 24, 48, and 72 h for NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic groups; ( C ) TUNEL assay images showing apoptotic cells (green fluorescence) and total cells (blue fluorescence) in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic, scale bar: 50μm; ( D ) Estradiol levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( E ) Progesterone levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( F ) Western blot analysis of Aromatase and StAR protein levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic. ** vs NC inhibitor, ## vs NC mimic. ** P  < 0.01, ## P  < 0.01 Influence of miR-361-5p on cell viability, apoptosis, and hormonal regulation in KGN cells. ( A ) Relative expression levels of miR-361-5p in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( B ) Cell viability measured by CCK-8 assay at 0, 24, 48, and 72 h for NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic groups; ( C ) TUNEL assay images showing apoptotic cells (green fluorescence) and total cells (blue fluorescence) in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic, scale bar: 50μm; ( D ) Estradiol levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( E ) Progesterone levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( F ) Western blot analysis of Aromatase and StAR protein levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic. ** vs NC inhibitor, ## vs NC mimic. ** P  < 0.01, ## P  < 0.01 ELISA results indicated that estradiol and progesterone levels were significantly lower in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01), and significantly higher in the miR-361-5p mimic group compared to the NC mimic group ( P  < 0.01) (Fig.  2 D and E). Western blot analysis showed that the miR-361-5p inhibitor group had significantly lower levels of Aromatase and StAR proteins compared to the NC inhibitor group ( P  < 0.01), while the miR-361-5p mimic group exhibited significantly higher levels of these proteins compared to the NC mimic group ( P  < 0.01). No significant differences were observed between the NC inhibitor and NC mimic groups (Fig.  2 F). In KGN cells, compared to the NC inhibitor group, the miR-361-5p inhibitor group showed a significant increase in ROS levels and a significant decrease in mtDNA, ATP, and JC-1 levels ( P  < 0.01) (Fig.  3 A). Conversely, the miR-361-5p mimic group showed a significant decrease in ROS levels and a significant increase in mtDNA, ATP, and JC-1 levels compared to the NC mimic group ( P  < 0.01) (Fig.  3 B, C, and D). There were no significant differences between the NC inhibitor and NC mimic groups. These findings suggest that miR-361-5p plays a critical role in regulating oxidative stress and mitochondrial function in KGN cells. Fig. 3 Effects of miR-361-5p on mitochondrial function and autophagy in KGN cells. ( A ) ROS levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( B ) mtDNA levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( C ) ATP levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( D ) JC-1 staining images showing mitochondrial membrane potential in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic, scale bar: 100 μm; ( E ) Western blot analysis of LC3-II, LC3-I, BECN1, P62, PINK, and Parkin protein levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic. ** vs NC inhibitor, ## vs NC mimic. ** P  < 0.01, ## P  < 0.01 Effects of miR-361-5p on mitochondrial function and autophagy in KGN cells. ( A ) ROS levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( B ) mtDNA levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( C ) ATP levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( D ) JC-1 staining images showing mitochondrial membrane potential in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic, scale bar: 100 μm; ( E ) Western blot analysis of LC3-II, LC3-I, BECN1, P62, PINK, and Parkin protein levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic. ** vs NC inhibitor, ## vs NC mimic. ** P  < 0.01, ## P  < 0.01 Western blot analysis revealed that, compared to the NC inhibitor group, the miR-361-5p inhibitor group exhibited significantly higher levels of LC3-II, BECN1, PINK, and Parkin proteins, and a significantly lower level of P62 protein. The level of LC3-I showed a slight increase, but the difference was not statistically significant, while the LC3-II/LC3-I ratio was significantly elevated ( P  < 0.01) (Fig.  3 E). In contrast, the miR-361-5p mimic group showed significantly lower levels of LC3-II, BECN1, PINK, and Parkin proteins, and a significantly higher level of P62 protein compared to the NC mimic group. The level of LC3-I showed a slight decrease, but the difference was not statistically significant, while the LC3-II/LC3-I ratio was significantly reduced ( P  < 0.01). There were no significant differences between the NC inhibitor and NC mimic groups. These results indicate that miR-361-5p influences autophagy-related protein expression and autophagic flux in KGN cells. In granulosa cells from DOR patients, the results of RT-PCR showed that the expression level of SLC25A24 was significantly higher compared to the control group ( P  < 0.01) (Fig.  4 A). Western blot analysis confirmed that SLC25A24 protein levels were also significantly elevated in the DOR group compared to the control group ( P  < 0.01) (Fig.  4 B). Moreover, there was a significant negative correlation between miR-361-5p and SLC25A24 expression levels ( r  = −0.766, P  < 0.001) (Fig.  4 C). Fig. 4 Expression analysis and validation of miR-361-5p and SLC25A24. ( A ) Relative expression of SLC25A24 in granulosa cells from the control and DOR groups; ( B ) Western blot analysis of SLC25A24 protein levels in granulosa cells from the control and DOR groups; ( C ) Correlation analysis between miR-361-5p and SLC25A24 mRNA expression levels; ( D ) Relative expression of SLC25A24 in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( E ) Western blot analysis of SLC25A24 protein levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( F ) Predicted binding site of miR-361-5p on the 3’ UTR of SLC25A24 mRNA; ( G ) Dual-luciferase reporter assay showing the effect of miR-361-5p on the luciferase activity of SLC25A24-WT and SLC25A24-MUT vectors. ** vs NC inhibitor, ## vs NC mimic. ** P  < 0.01, ## P  < 0.01 Expression analysis and validation of miR-361-5p and SLC25A24. ( A ) Relative expression of SLC25A24 in granulosa cells from the control and DOR groups; ( B ) Western blot analysis of SLC25A24 protein levels in granulosa cells from the control and DOR groups; ( C ) Correlation analysis between miR-361-5p and SLC25A24 mRNA expression levels; ( D ) Relative expression of SLC25A24 in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( E ) Western blot analysis of SLC25A24 protein levels in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, NC mimic, and miR-361-5p mimic; ( F ) Predicted binding site of miR-361-5p on the 3’ UTR of SLC25A24 mRNA; ( G ) Dual-luciferase reporter assay showing the effect of miR-361-5p on the luciferase activity of SLC25A24-WT and SLC25A24-MUT vectors. ** vs NC inhibitor, ## vs NC mimic. ** P  < 0.01, ## P  < 0.01 In KGN cells, qRT-PCR results showed that the expression level of SLC25A24 was significantly increased in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01). Conversely, in the miR-361-5p mimic group, SLC25A24 expression was significantly decreased ( P  < 0.01) compared to the NC mimic group (Fig.  4 D). Western blot analysis further confirmed that SLC25A24 protein levels were significantly higher in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01), and significantly lower in the miR-361-5p mimic group compared to the NC mimic group ( P  < 0.01) (Fig.  4 E). The dual-luciferase reporter assay demonstrated that co-transfection with miR-361-5p mimics significantly inhibited the luciferase activity of the SLC25A24-WT (wild type) vector ( P  < 0.01), but not the SLC25A24-MUT (mutant) vector. This result confirmed the direct targeting relationship between miR-361-5p and SLC25A24 (Fig.  4 F, G). Western blot analysis showed that SLC25A24 protein levels were significantly reduced in the sh-SLC25A24 group compared to the shNC group ( P  < 0.01, Fig.  5 A). At 48 and 72 h, cell viability assays showed that the miR-361-5p inhibitor group had significantly lower cell viability compared to the NC inhibitor group ( P  < 0.01). In contrast, the miR-361-5p inhibitor + sh-SLC25A24 group exhibited significantly higher cell viability compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01). There was no significant difference in cell viability between the miR-361-5p inhibitor group and the miR-361-5p inhibitor + shNC group, indicating that the knockdown of SLC25A24 can counteract the negative effects of miR-361-5p inhibition on cell viability (Fig.  5 B). Fig. 5 SLC25A24 knockdown rescued miR-361-5p inhibition-induced function in KGN cells. ( A ) Western blot analysis showing SLC25A24 protein levels in shNC and sh-SLC25A24 groups; ( B ) Cell viability measured by CCK-8 assay at 0, 24, 48, and 72 h for NC inhibitor, miR-361-5p inhibitor, miR-361-5p inhibitor + shNC, and miR-361-5p inhibitor + sh-SLC25A24 groups; ( C ) TUNEL assay images showing apoptotic cells (green fluorescence) and total cells (blue fluorescence) in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, miR-361-5p inhibitor + shNC, and miR-361-5p inhibitor + sh-SLC25A24, scale bar: 50 μm; ( D ) ELISA results showing estradiol and progesterone levels in the different groups; ( E ) Western blot analysis showing Aromatase and StAR protein levels in the different groups; ( F ) ROS levels in the different groups, scale bar: 100 μm; ( G ) mtDNA levels in the different groups; ( H ) ATP levels in the different groups; ( I ) JC-1 staining images showing mitochondrial membrane potential in the different groups, scale bar: 100 μm; ( J ) Western blot analysis showing LC3-II, LC3-I, BECN1, P62, PINK, and Parkin protein levels in the different groups. ** vs NC inhibitor, ## vs miR-361-5p inhibitor + shNC. ** P  < 0.01, ## P  < 0.01 SLC25A24 knockdown rescued miR-361-5p inhibition-induced function in KGN cells. ( A ) Western blot analysis showing SLC25A24 protein levels in shNC and sh-SLC25A24 groups; ( B ) Cell viability measured by CCK-8 assay at 0, 24, 48, and 72 h for NC inhibitor, miR-361-5p inhibitor, miR-361-5p inhibitor + shNC, and miR-361-5p inhibitor + sh-SLC25A24 groups; ( C ) TUNEL assay images showing apoptotic cells (green fluorescence) and total cells (blue fluorescence) in KGN cells transfected with NC inhibitor, miR-361-5p inhibitor, miR-361-5p inhibitor + shNC, and miR-361-5p inhibitor + sh-SLC25A24, scale bar: 50 μm; ( D ) ELISA results showing estradiol and progesterone levels in the different groups; ( E ) Western blot analysis showing Aromatase and StAR protein levels in the different groups; ( F ) ROS levels in the different groups, scale bar: 100 μm; ( G ) mtDNA levels in the different groups; ( H ) ATP levels in the different groups; ( I ) JC-1 staining images showing mitochondrial membrane potential in the different groups, scale bar: 100 μm; ( J ) Western blot analysis showing LC3-II, LC3-I, BECN1, P62, PINK, and Parkin protein levels in the different groups. ** vs NC inhibitor, ## vs miR-361-5p inhibitor + shNC. ** P  < 0.01, ## P  < 0.01 TUNEL assay results demonstrated that apoptosis levels were significantly higher in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01), while the miR-361-5p inhibitor + sh-SLC25A24 group showed significantly lower apoptosis levels compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01). There was no significant difference between the miR-361-5p inhibitor group and the miR-361-5p inhibitor + shNC group, suggesting that SLC25A24 knockdown mitigates the pro-apoptotic effect of miR-361-5p inhibition (Fig.  5 C). ELISA results indicated that estradiol and progesterone levels were significantly lower in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01). In contrast, the miR-361-5p inhibitor + sh-SLC25A24 group had significantly higher levels of these hormones compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01), indicating that SLC25A24 knockdown can counteract the hormone-reducing effects of miR-361-5p inhibition (Fig.  5 D). Western blot analysis of Aromatase and StAR protein levels showed a significant reduction in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01). Conversely, the miR-361-5p inhibitor + sh-SLC25A24 group exhibited significantly higher levels of these proteins compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01), further supporting the role of SLC25A24 in regulating hormone synthesis (Fig.  5 E). ROS levels were significantly higher, and mtDNA and ATP levels were significantly lower in the miR-361-5p inhibitor group compared to the NC inhibitor group ( P  < 0.01). However, the miR-361-5p inhibitor + sh-SLC25A24 group had significantly lower ROS levels and higher mtDNA and ATP levels compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01), suggesting a protective effect of SLC25A24 knockdown against oxidative stress and mitochondrial impairment (Fig.  5 F-H). JC-1 staining revealed that the miR-361-5p inhibitor group had significantly lower mitochondrial membrane potential compared to the NC inhibitor group ( P  < 0.01), while the miR-361-5p inhibitor + sh-SLC25A24 group showed significantly higher mitochondrial membrane potential compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01). This indicates that SLC25A24 knockdown can alleviate mitochondrial dysfunction induced by miR-361-5p inhibition (Fig.  5 I). Finally, western blot analysis showed that the miR-361-5p inhibitor group had significantly higher levels of autophagy-related proteins LC3-II, BECN1, PINK, and Parkin, and significantly lower levels of P62 compared to the NC inhibitor group ( P  < 0.01). The LC3-II/LC3-I ratio was also significantly elevated ( P  < 0.01). In contrast, the miR-361-5p inhibitor + sh-SLC25A24 group exhibited significantly lower levels of these autophagy-related proteins and a lower LC3-II/LC3-I ratio compared to the miR-361-5p inhibitor + shNC group ( P  < 0.01), indicating that SLC25A24 knockdown can modulate autophagy processes affected by miR-361-5p inhibition (Fig.  5 J).

Background

Diminished ovarian reserve (DOR) is a significant challenge in reproductive medicine, characterized by a reduced number and quality of oocytes, often leading to infertility and suboptimal responses to assisted reproductive technology treatments [ 1 , 2 ]. The pathophysiology of DOR involves complex interactions between genetic, environmental, and endocrine factors [ 3 ]. Granulosa cells, which play a crucial role in follicular development and oocyte maturation, are central to understanding and addressing DOR [ 4 ]. MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression post-transcriptionally by binding to the 3’ untranslated regions (3’ UTRs) of target mRNAs, thus influencing various cellular processes, including apoptosis, proliferation, and differentiation [ 5 ]. In ovarian biology, many miRNAs have been identified as key regulators of granulosa cell function and ovarian reserve [ 6 ]. For example, miR-21 is known to promote granulosa cell survival and proliferation by targeting the pro-apoptotic gene PDCD4, thereby enhancing follicular development and oocyte quality [ 7 ]. Similarly, miR-132 and miR-212 have been shown to regulate steroidogenesis in granulosa cells by modulating the expression of CYP11A1 and STAR, critical enzymes in the biosynthesis of steroid hormones [ 8 , 9 ]. These miRNAs ensure proper hormonal balance and support follicular growth. Another miRNA, miR-23a, has been found to suppress apoptosis and enhance cell proliferation in ovarian granulosa cells by targeting X-linked inhibitor of apoptosis, contributing to improved follicular survival and function [ 10 ]. MiR-361-5p, a critical regulator in various biological systems, has been extensively studied for its role in influencing cellular processes such as apoptosis, proliferation, and differentiation [ 11 , 12 ]. In cancer biology, miR-361-5p acts as a tumor suppressor by targeting genes involved in cell proliferation and apoptosis, such as FOXM1 and COX-2 [ 13 ]. In cardiovascular systems, it regulates endothelial cell function and angiogenesis by targeting VEGFA and TGF-β signaling pathways [ 14 ]. These studies underscore the versatile role of miR-361-5p in cellular homeostasis and disease, suggesting its potential impact on ovarian biology. Granulosa cells are essential for supporting oocyte development and producing steroid hormones necessary for reproductive function [ 15 ]. Dysregulation of granulosa cell function can lead to impaired folliculogenesis, contributing to conditions such as DOR [ 16 ]. Mitochondrial function within granulosa cells is vital for energy production, steroidogenesis, and cellular survival [ 15 ]. SLC25A24, a mitochondrial solute carrier, is involved in transporting adenine nucleotides across the inner mitochondrial membrane, playing a crucial role in maintaining mitochondrial homeostasis and function [ 17 ]. Dysregulation of SLC25A24 has been linked to increased oxidative stress and mitochondrial dysfunction, common features in the pathogenesis of DOR [ 18 , 19 ]. Emerging hypotheses propose that miR-361-5p could play a pivotal role in the regulation of granulosa cell function, potentially through its interaction with the mRNA of the mitochondrial protein SLC25A24. This interaction is of significant interest within the realm of DOR, characterized by heightened oxidative stress and mitochondrial impairment, which are critical factors in the apoptosis of granulosa cells and the decline of ovarian function [ 20 ]. Given the crucial functions of miR-361-5p, further exploration into its specific mechanisms within ovarian granulosa cells and its effects on mitochondrial dynamics in the context of DOR is warranted. This research aims to uncover new therapeutic avenues for enhancing ovarian reserve and fertility in women with DOR. By understanding the role of miR-361-5p in regulating SLC25A24 and mitochondrial function, our findings could provide a foundation for developing miRNA-based therapies to mitigate granulosa cell dysfunction and improve reproductive outcomes. Given that miR-361-5p is a known tumor suppressor, future studies will need to carefully consider its safety and specificity in therapeutic applications, ensuring that such therapies can target granulosa cells without unintended effects on other cell types.

Conclusion

This study reveals that miR-361-5p plays a crucial role in maintaining mitochondrial function in human granulosa cells by targeting SLC25A24. This regulation enhances cell viability, reduces oxidative stress, and mitigates apoptosis, addressing key aspects of DOR. Our findings suggest that modulating miR-361-5p could serve as a novel therapeutic strategy to improve ovarian function and fertility outcomes. Future research should focus on validating these results in vivo and exploring the broader miR-361-5p regulatory network to uncover additional therapeutic targets for ovarian dysfunction and other related conditions.

Discussion

The present study investigates the regulatory role of miR-361-5p in maintaining mitochondrial function and reducing dysfunction in human granulosa cells by targeting SLC25A24. Our data reveal that miR-361-5p plays a critical role in regulating granulosa cell function by modulating SLC25A24 expression. This regulation appears to protect granulosa cells from oxidative stress and apoptosis by maintaining mitochondrial homeostasis, as evidenced by enhanced mitochondrial membrane potential, reduced ROS production, and improved cellular viability. These findings align with previous studies highlighting the importance of mitochondrial integrity in granulosa cell function and overall ovarian health [ 24 – 26 ]. The therapeutic implications of these findings are significant, especially in the context of DOR, a major cause of infertility. Current treatments for DOR are often ineffective, and the preservation of mitochondrial function in granulosa cells could offer a new therapeutic approach [ 27 , 28 ]. By targeting miR-361-5p and SLC25A24, it may be possible to develop new strategies to preserve or restore mitochondrial function in granulosa cells, thereby enhancing ovarian reserve and improving fertility outcomes. Moreover, given the role of oxidative stress and mitochondrial dysfunction in various ovarian pathologies, the modulation of miR-361-5p could also benefit conditions such as polycystic ovary syndrome and premature ovarian failure [ 29 ]. However, we acknowledge that while miR-361-5p modulation offers potential therapeutic benefit in granulosa cells, there are important caveats when considering its use in other cell types, especially cancer cells. As a known tumor suppressor, miR-361-5p could have dual effects depending on the cellular context. In granulosa cells, where it appears to protect against oxidative stress and apoptosis, miR-361-5p modulation may offer therapeutic benefits. However, in nascent or emerging cancer cells, reducing apoptosis through therapeutic interventions could inadvertently accelerate tumor cell growth. This is particularly relevant if SLC25A24, or other miR-361-5p targets, are expressed in cancerous tissues, where miR-361-5 ps tumor suppressor function might influence cancer cell survival. Given these considerations, it is crucial to develop targeted, cell-specific delivery methods that selectively modulate miR-361-5p expression in granulosa cells, thereby minimizing potential off-target effects in other tissues, particularly cancer cells. This approach would help ensure that miR-361-5p-based therapies can achieve their therapeutic potential without inadvertently promoting tumorigenesis. Additionally, we have explicitly noted the need for caution when translating these findings into clinical applications. While SLC25A24 is primarily expressed in granulosa cells in our study, future research should focus on assessing the expression of SLC25A24 in cancerous tissues and evaluating how miR-361-5p modulation affects mitochondrial function and apoptosis in cancer cells. A more comprehensive understanding of SLC25A24’s role across different cell types will be essential before considering miR-361-5p as a therapeutic target beyond ovarian disorders. Our results demonstrate a clear inverse relationship between miR-361-5p and SLC25A24 expression levels. The miR-361-5p mimic experiments showed increased granulosa cell viability and reduced apoptosis, while miR-361-5p inhibition led to the opposite effects. These observations are consistent with the known functions of SLC25A24 in mitochondrial ATP transport and oxidative stress regulation [ 30 ]. By reducing SLC25A24 expression, miR-361-5p helps to maintain mitochondrial homeostasis and cellular function under stress conditions, thus mitigating the adverse effects associated with DOR. Our findings contributes to the growing literature on miRNA regulation of mitochondrial function, extending findings from other cell types to granulosa cells. Previous research has shown that miR-361-5p can regulate apoptosis and cellular stress responses in various cell types, including cancer and endothelial cells [ 12 , 31 ]. Our study extends these observations to ovarian granulosa cells, demonstrating a similar regulatory mechanism. Differences in experimental conditions, such as cell types and specific miRNA targets, may explain variations in findings across studies. Our use of human granulosa cell lines and clinically relevant samples adds a valuable dimension to this body of research, providing direct implications for fertility treatments. While our study offers significant insights, it is not without limitations. Firstly, the in vitro nature of our experiments using KGN cell lines, though informative, may not fully capture the complex in vivo environment of human ovaries [ 32 ]. Future studies should aim to validate these findings in animal models and clinical samples to establish translational relevance. Additionally, while we have focused on SLC25A24 as a direct target of miR-361-5p, there may be other off-target effects of miR-361-5p that contribute to the observed changes in mitochondrial function. Further investigation into the miR-361-5p regulatory network and its broader effects on cellular processes is warranted. Finally, while miR-361-5p modulation presents a promising therapeutic avenue to enhance ovarian reserve and improving fertility outcomes, careful consideration of its broader implications, particularly in cancer biology, is necessary. Future research should focus on understanding the role of miR-361-5p in diverse cellular contexts and evaluating its potential risks and benefits for clinical application. In conclusion, this study elucidates a critical regulatory pathway involving miR-361-5p and SLC25A24 in granulosa cells, offering insights into the maintenance of mitochondrial function in human granulosa cells and potential therapeutic approaches for DOR.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-06-28T06:08:18.748782+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0