Navitoclax mediates Interleukin-3 induced human umbilical vein endothelial cells survival and angiogenesis

Navitoclax mediates Interleukin-3 induced human umbilical vein endothelial cells survival and angiogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Navitoclax mediates Interleukin-3 induced human umbilical vein endothelial cells survival and angiogenesis Nur Syahidah Nor Hisam, Azizah Ugusman, Nor Fadilah Rajab, Karina Di Gregoli, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2759691/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Navitoclax is an effective pro-apoptotic agent against cancer cells. Uncontrolled cell survival is a hallmark of pathological angiogenesis in cancer and could promote plaque instability that contributes to atherosclerosis progression owing to intraplaque neovascularization. Cancer cell inhibition by navitoclax can restrain metastasis; therefore, it is possible to reduce endothelial cells survival and is expected to confer a novel therapeutic strategy for advanced atherosclerosis in regards to plaque instability. However, regulation of endothelial cell activity by navitoclax is yet to be examined. This study will analyze navitoclax efficacy in modulating human umbilical vein endothelial cells (HUVEC) viability, proliferation, migration and angiogenesis. Navitoclax concentrations ranging from 0.2 to 3.0µM at four-time points; 18-, 24-, 48- and 72-hours were used for MTT assay. The IC 50 value for 18-hours post-treatment was undefined due to low efficacy at a limited time. While for 24-, 48- and 72-hours, the IC 50 values were 0.91µM, 0.72µM, and 0.12µM, respectively. Navitoclax potency to inhibit HUVEC viability increased as the treatment time elevated. 0.9µM navitoclax for 24 hours treatment was selected for subsequent experiments. Next, 25 ng/ml IL-3 was used to induce the in-vitro angiogenesis model within 6 hours. Expectedly, navitoclax reduced the tube formation and migration of HUVEC induced by IL-3 in consistent with CXCL-8 released and MMP-3 expression in the cell. However, HUVEC proliferative activity was not affected by navitoclax treatment, as well as the BCL-2 gene expression. Therefore, an anti-angiogenic effect of navitoclax on HUVEC by preventing the cell motility through CXCL-8 and MMP-3 mechanism is determined. ABT-263 angiogenesis cell viability HUVEC migration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Neovascularization or new blood vessel development occurs through either angiogenesis, arteriogenesis or vasculogenesis. Angiogenesis is an expansion of the existing vasculature through the sprouting of endothelial cells that drives neovascularization. Activation, migration, proliferation and maturation of unique precursor cells are the underlying processes of this angiogenic sprouting [ 1 ]. This dynamic process is modulated by various growth factors, cytokines as well as extracellular matrix (ECM) activity. Under the physiological situation, angiogenesis helps to repair the damaged tissues [ 2 , 3 ], re-establish the blood supply to restore nutrients delivery [ 4 ], and aids the placenta development [ 5 , 6 ]. In certain circumstances, however, new vessel regeneration drives the pathogenesis of various life-threatening diseases, including cancer and diabetic retinopathy [ 7 , 8 ]. Additionally, recent findings reported that intimal neovascularization within atherosclerotic plaques might promote plaque destabilization and lead to fatal cardiovascular events such as stroke and heart attack [ 9 , 10 ]. This is due to abnormal vascular branching, immature and “leaky” endothelial tube linings that will permit inflammatory mediators as well as blood constituents’ infiltration into the lesion area [ 11 ]. Regulation of cell survival and proliferation is fundamental in stimulating other signaling proteins and growth factors for new vessel development. Proliferation and migration of endothelial cells contribute to angiogenesis, and this process is regulated by various cytokines, including interleukin-3 (IL-3) [ 12 , 13 ]. IL-3 is produced by active T cells, natural killer cells, mast cells and megakaryocytes, where at some point IL-3 will bind to the receptor on the endothelial cells [ 14 ]. Initially, the ability of IL-3 was identified to stimulate the production, development and function of hemopoietic cells, including mast cells, basophils, neutrophils, eosinophils, macrophages and erythrocytes [ 12 ]. Nevertheless, the role of IL-3 beyond hematopoiesis was reported, whereby it could regulate endothelial cells proliferation [ 15 ], motility and angiogenic response [ 13 ] that contributes to chronic inflammation that is related with endothelial cells [ 16 ]. This evidence was supported by discovering IL-3 receptor (IL-3 R) alpha and beta chains within the plasma membranes of endothelial cells [ 17 , 18 ]. IL-3 was able to sustain immunologically regulated chronic inflammatory response in pathological conditions via endothelial-leukocyte adhesion molecule 1 (ELAM-1) activation [ 15 ] and endothelial cells motility mediated by IL-3 was demonstrated to recruit platelet-activating factor (PAF) activity [ 13 ]. Additionally, IL-3 and its receptors play an essential role in cancer metastasis as it is secreted by leukemia cells that enhance the survival and proliferation of cancer cells, ultimately contributing to the development of cancer pathology [ 12 , 19 ]. Besides, tumor-derived endothelial cells induced by IL-3 autocrine signal exhibited rapid turnover rate and high expression of inflammatory genes that promote vessel growth compared to normal endothelial cells [ 13 , 20 ]. Apart from that, IL-3 is involved in cardiovascular disease (CVD) pathology due to its ability to act as pro-inflammatory and pro-angiogenic agents. Evidence reported a potential paracrine signal of IL-3 in CVD via endothelial cell-derived extracellular vesicles release may hinder the cardioprotective effect due to changes in protein cargo [ 16 ]. Furthermore, a previous study showed high expression of IL-3 R alpha within intraplaque neovessels in advanced human carotid plaques, hence revealing the involvement of IL-3 in atherogenesis [ 18 ]. Ergo, IL-3 is utilized in this study to establish the in-vitro angiogenesis model that mimics the intraplaque neovascularization process. Interleukin-8 (IL-8, or CXCL-8) is a chemokine with a distinguishing CXC amino acid pattern that was initially identified for its leukocyte chemotactic activity [ 21 ]. CXCL-8 is reported to induce tumorigenic and proangiogenic activities. CXCL-8 has biological activities independent from and in addition to its well-known role in controlling inflammatory reactions. Particularly relevant to cancerCXCL-8 is a potent angiogenesis mediator. There is growing evidence that inflammation and fibroproliferation have a role in the etiology of atherosclerosis [ 22 , 23 ]. Angiogenesis has also been observed within atherosclerotic plaques, suggesting that it may contribute to the pathophysiology of plaque formation [ 11 , 24 ]. CXCL-8 is over-expressed in human coronary artery plaque samples compared to control samples from internal mammary arteries without atherosclerosis, where it co-localized with factor VIII-related antigen expression on endothelial cells in coronary atherectomy specimens and is the major mediator of net angiogenic activity of the plaque in the rat cornea micro-pocket assay [ 25 ]. Therefore, association of CXCL-8 expression with navitoclax effect on the in-vitro angiogenesis model is going to be determined in this study. The expression of matrix metalloproteinase (MMP) has been proposed to involve in the angiogenesis that links to the advancement of plaque growth in atherosclerosis. MMPs are a family of structurally related proteinases that widely known for their ability to degrade extracellular matrix (ECM) and can also process bio-active molecules such as growth factors. However, MMP expression is not conventionally present but is usually controlled by: (1) cytokines, growth factors, and cell ± cell and cell ± matrix interactions that control gene expression; (2) activation of its proenzyme form; and (3) the presence of MMP inhibitors namely tissue metalloproteinases (TIMP) inhibitors [ 26 ]. One study has suggested that human stromelysin promoter variation is associated with the development of coronary atherosclerosis[ 27 ]. Further studies have reported that a stromelysin-1 promoter also known as MMP-3 plays an important role in regulating stromelysin-1 gene expression and may be involved in the pathological development of atherosclerosis [ 28 ]. Furthermore, MMP-3 expression has been associated with cell activity such as migration and causing the development of angiogenesis [ 18 ]. MMPs are suggested as a new biomarker to atherosclerotic plaque instability. Based on the previous findings reported, navitoclax effect on the expression of MMP-3 which is one of the stromelysin group members is worth to be observed. BCL-2 family proteins have been reported as the intrinsic key modulator of cell survival or death [ 29 , 30 ]. A multicomplex interaction among BCL-2 family proteins, comprised of pro- and anti-apoptotic mediators, will determine cell fate [ 31 ]. Navitoclax displays a pro-apoptotic response towards cancer cells by targeting several BCL-2 family proteins, including BCL-2, Bcl-xL and Bcl-w [ 32 , 33 ]. Navitoclax has entered human clinical trials for treating small cell lung cancer [ 34 , 35 ], chronic lymphocytic leukemia [ 36 ], and other lymphoid malignancies [ 37 ]. Recently, it shows promising outcomes in preclinical studies of breast cancer [ 38 ] and oral tumors [ 39 ]. Apart from that, navitoclax potency as a single agent and in combination with other chemotherapeutic agents was reported to effectively ameliorate cancerprogression in our published review [ 40 ]. In cancer, excessive proliferation of tumor cells and neo-angiogenesis lead to tumor metastasis, thus worsening the situation. Similarly, in atherosclerosis, a new blood vessel formation will deteriorate the plaque stability and cause it to rupture, eventually causing myocardial infarction and thrombosis [ 10 ]. High expression of BCL-2 anti-apoptotic proteins is reported in cancer cells, making the tumor resistant to conventional chemotherapy [ 41 , 42 ]. Plus, a study on cardiovascular disease demonstrated an abundant expression of BCL-2 pro-survival proteins that contributes to myocyte replication [ 43 ]. Due to that, they are potentially an attractive target for drug development to obstruct cell survival. The atherosclerosis pathogenesis is comparable to cancer in abnormal cell proliferation, leading to intraplaque angiogenesis [ 44 , 45 ]. Thus, an initiative to include navitoclax in atherosclerosis treatment development is predicted to produce a promising therapeutic outcome. However, most published reports demonstrated the pharmacology and clinical applications of navitoclax only on cancer cells. Hence, there is limited evidence of navitoclax potency in reducing primary cells such as endothelial cells viability mainly. Considering that uncontrolled endothelial cell proliferation is the underlying process of angiogenesis, which leads to atherosclerotic plaque instability, a study to evaluate the navitoclax potency to inhibit the survival of human endothelial cells will be carried out. Subsequently, navitoclax inhibitory effect on endothelial cell angiogenesis is conducted in the presence of IL-3. Additionally, modulation of endothelial cell proliferation and motility by navitoclax is being carried out further to elucidate navitoclax mechanisms in deteriorating in-vitro blood vessel formation. Lastly, the gene expressions of CXCL-8, MMP-3 and BCL-2 are investigated to determine the association of navitoclax effect with the target gene on each cell biological assays; angiogenesis (CXCL-8), migration (MMP-3), proliferation (BCL-2). We hypothesize that the ability of navitoclax to inhibit human endothelial cells survival is augmented with increasing dosage. Besides, the angiogenesis is diminished by navitoclax through the downregulation of endothelial cell motility and proliferation. Materials And Methods - Materials and chemical reagent Cell culture: Basal endothelial cell medium (ECM) (Cat Number: 1001-b; Sciencell, USA), endothelial cell growth supplement (ECGS) (Cat Number: 1001-b; Sciencell, USA), M199 media (Cat Number: 31100-027; Gibco, USA), collagenase I (Cat No: SCR103; Merk, Jerman), fetal bovine serum (FBS) (Cat No: F7524; Sigma Aldrich, non-USA), penicillin-streptomycin (pen/strep) (Cat No: LM-A4118; Biosera, France), phosphate-buffered saline (PBS) tablet (Cat No: P4417-100; Sigma Aldrich, USA), trypsin-EDTA (0.25% trypsin, 1 mM EDTA) with phenol red (Cat No: 25200-056; Gibco, USA). Cell assay: Thiazolyl blue tetrazolium bromide (MTT) powder (Cat No: T-030-1; Gold BioTechnology, USA), navitoclax (Cat No: FN16901; Carbosynth, USA), dimethyl sulfoxide (DMSO) (Cat No: D4540; Sigma Aldrich, USA). Matrigel ™ reduced with growth factor (Cat. No. 354230, Scientific Lab Supplies), IL-3 (Cat no: AF1418061; R&D systems, USA), basal media of endothelial cells (Cat. No. 354230; Sciencell, USA). The Calbiochem® BrdU Cell Proliferation Assay (Cat no. QIA58-200TEST; Merck, Germany) RT-qPCR: innuPREP RNA mini kit 2.0 (Cat no: AJG#845-KS-2040050; Jena Analytics, Germany), ReverTra Ace qPCR Rt Master Mix with gDNA Remover (Cat no: FSQ 301; Toyobo, Japan), Thunderbird SYBR qPCR Mix kit (Cat no: QPS 201; Toyobo, Japan), forward and reverse primers; MMP-3, BCL-2 and CXCL-8. i. Primary endothelial cells isolation Endothelial cells of human umbilical cord veins were detached by following the procedures from previous studies [ 46 , 47 ]. The umbilical cords were obtained from the labor ward of the Department of Obstetrics and Gynaecology, Hospital Canselor Tuanku Mukhriz (HCTM). Ethical approval for this study was given by the Ethical Research Committee of Universiti Kebangsaan Malaysia (Reference number: UKM PPI/111/8/JEP-2020-006), and written consent was obtained from all donors before delivery. The cells were cultured in sterile complete ECM consisting of basal medium, 1% ECGS, 1% pen/strep and 5% FBS. They were stored in a CO 2 incubator at 37˚C containing 5% CO 2 . The media was replaced when it turned yellowish or within 48 hours until the cells reached 80% confluency. The authenticity of HUVEC was confirmed in our lab by the morphology of cobblestone-shaped endothelial cells and CD31 marker expression via immunocytochemistry. HUVEC from passage 3 to passage 5 were used in this study. ii. Cell viability assay 3-(4,5-Dimethythiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was conducted to analyze the number of viable cells after the treatment [48,49] . Initially, 2 x 10 5 cells/well were seeded in 96 well-plates until 80% confluency. An untreated group and a vehicle group containing 0.01 µM DMSO were included in this study. A range of navitoclax concentrations between 0.2 µM to 3.0 µM was added into the well in triplicates. The cells were placed in a CO 2 incubator at 37˚C for different treatment periods; 18, 24, 48 and 72 hours. After that, the cells were incubated with MTT solution for 3 hours to allow the formation of formazan crystals representing viable cells. Next, dimethyl sulfoxide (DMSO) was added to dissolve the remaining crystals. The absorbance was quantified by using the spectrophotometric plate reader at 570 nm. The equation below was applied to calculate the percentage of cell viability: The line of the best-fit curve was generated by Graphpad Prism 8.4.3 software, using the non-linear regression (curve fit) of dose vs response. The drug dose that reduced 50% of cell viability (IC 50 ) was determined by Prism through the best-fit curve generated. iii. Angiogenesis assay Tube formation assay was conducted to study the endothelial cell angiogenesis by using a µ-Slide angiogenesis system. First, 10µl Matrigel ™ reduced with growth factor was placed in a well and was allowed to polymerize at 37°C for an hour. HUVEC were seeded in the well containing Matrigel at a density of 2 x 10 4 with the treatment of 25ng/ml IL-3 and 0.9 µM navitoclax. Tube formations were allowed to occur for 8 hours, and cell images were captured every 2 hours. The tube formation potential is calculated in each sample as the total length of branching using an Angiogenesis Analyzer plugin from a computer-assisted image analysis system (ImageJ software). Images from at least four random fields at 5x magnification are examined from an independent experiment. iv. Migration assay The in-vitro scratch test method was carried out to determine endothelial cell migration after navitoclax treatment by referring to the protocol from previous study [ 50 ]. 5 x 10 4 cells were seeded in a 24-well plate and incubated until they reached 90% confluency. The cells were then scraped by 200µl pipette tips and the floating cells were washed with PBS immediately. After that, new media with treatment was added into the well. A constant pressure was applied during scraping to reduce variation of wound size. Three wound areas in each well were set and captured using a live inverted microscope at 0 hour until 24 hours. The wound areas were determined using an ImageJ software. Then, the area of wound closure percentage was calculated using this formula; v. Proliferation assay This assay was conducted using a colorimetric bromodeoxyuridine (BrdU) cell proliferation assay kit. 2 x 10 4 cells were seeded in 96-well plates and incubated until they reached 90% confluency. Then, new media was added along with the treatment. BrdU Label (1:2000) was added into the well after 4 hours the treatment started to allow 20 hours incubation. After the treatment, the cells were incubated with 200 µl of fixative solution for 30 minutes at room temperature. 1X Anti-BrdU Antibody was incubated with the cells for 1 hour at room temperature. The cells were washed three times with 1X Wash Buffer before adding 1X Peroxidase Goat Anti-Mouse IgG HRP Conjugate for 30 minutes incubation. After that, the washing step was repeated again for three times before flooding the entire plate with distilled water. Substrate Solution was put into the well and incubated for 15 minutes in the dark at room temperature. Lastly, Stop Solution was added before measuring the absorbance at 450–540 nm using spectrophotometric plate reader. The percentage of BrdU positive cells was calculated using excel. vi. RT-qPCR 3 x 10 5 HUVECs were seeded in 6 well plates and the treatments were administered once the cell had reached 90% confluency. RNA extraction was performed using innuPREP RNA mini kit 2.0. The concentration and purity of RNA were read using a nanodrop spectrophotometer machine. Next, PCR reverse transcription process was performed using ReverTra Ace qPCR Rt Master Mix with gDNA Remover to convert 500 µg RNA. For DNAse I reaction process, a mixture of 4x DN Master Mix and ‘gDNA Remover’ (2 µl), and a balanced volume between RNA sample and RNA-free water (6 µl) were added into a 200 µl tube and incubated in thermal cycler machine (Bio-Rad, Model CFX Connect, USA) for 5 minutes at a temperature of 37 ℃. Next, 2 µl 5x DN Master Mix was added into the tube for DNAse II reaction process whereby the sample was further incubated at 37 ℃ for 15 min and heated at 98 ℃ for 5 min. Samples were stored at -20℃. Real-time qPCR was carried out using the Thunderbird SYBR qPCR Mix kit. The primers to be used in this study are MMP − 3, BCL-2, CXCL8 and 36B4 (housekeeping gene). The sequence for the primers can be referred to Table 1 . The RT-qPCR reactions consist of 10 µl Thunderbird SYBR qPCR mix, 0.6 µl forward primer (6 pmol), 0.6 µl reverse primer (pmol), 2 µl cDNA (0.5 µg) and 6.8 µl RNA-free water were prepared in 200 µl qPCR tube. The tube was then put into the CFX 96 Real-Time PCR Detection System (Bio-Rad, CA, USA RT-qPCR machine) and the protocol was set as follows; pre-denaturation at 95 ℃ for 60 seconds, 40 cycles of denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 60 seconds; the data collection was set at the annealing step. Lastly, the relative changes in target gene expression were analyzed using the 2 − Delta−Delta Ct method (2 −∆∆Ct ). Table 1 Primer sequence. Primer Primer sequence Product Size (bp) MMP-3 Forward: GATCCTGCTTTGTCCTTTGATGCT Reverse: CTGAAGGAAGAGATGGCCAAAATG 145 BCL-2 Forward: GGTGGGGTCATGTGTGTGG Reverse: CGGTTCAGGTACTCAGTCATCC 89 CXCL8 Forward: GAGAGTGATTGAGAGTGGACCAC Reverse: CACAACCCTCTGCACCCAGTTT 112 36B4 Forward: GCCAGCGAAGCCACGCTGCTGAAC Reverse: CGAACACCTGCTGGATGACCAGCCC 76 vii. Statistical analysis Results are shown as mean ± SEM. IBM SPSS statistics version 26 was used to carry out statistical analysis. The mean difference between control and treatment groups was compared statistically using an independent sample t-test. One-way analysis of variance (ANOVA) test was run to compare the mean difference between treatment groups, followed by Tukey post-hoc test. The difference was considered significant at p < 0.05. Results Navitoclax concentration against cell viability The navitoclax effect against HUVEC viability at four different time points (i.e., 18, 24, 48 and 72 hours) were investigated via MTT assay. The navitoclax concentrations used were 0.2 µM, 0.4 µM, 0.6 µM, 0.8 µM, 1.0 µM, 1.5 µM, 2.0 µM and 3.0 µM. There was no significant difference in the cell viability between untreated and vehicle control groups, hence the treated groups were normalized to the untreated group. On the other hand, the mean of cell viability between treated and untreated groups at different treatment periods is significantly different, p < 0.05 (Fig. 1 ). The highest navitoclax concentration which is 3.0 µM reduced the 100% cell viability to 73.65 ± 9.40%, 12.34 ± 6.50%, 0.37 ± 0.16% and 2.09 ± 1.28% after 18, 24, 48 and 72 hours respectively. Besides, at the lowest navitoclax concentration (i.e., 0.2 µM), the 100% of cell viability decreased more than 50% after 72 hours of treatment. A graph of log dose against cell survival at different time points was plotted to compare the potency of different treatment periods in reducing cell viability (Fig. 2 ). As the treatment time increased, the log dose against cell survival curves was shifted to the left. There was a statistically significant mean difference in cell viability between treatment times as determined by one-way ANOVA, p < 0.001. Regarding the Tukey post-hoc test, the cell viability was significantly reduced in 48 hours (50.18 ± 11.55%, p < 0.05) and 72 hours (24.45 ± 10.12%, p 0.05) post-treatment group. From the dose-response graph, IC 50 values for each time point were deduced. The IC 50 value showed a decreasing trend as the treatment period was increased. There was no IC 50 detected after 18 hours treatment; even at the highest concentration used, the cell viability observed was still higher than 50%. However, for 24 hours of treatment, the IC 50 value was identified at 0.91 µM, then after 48 hours was 0.72 µM, and lastly for 72 hours was 0.12 µM. The morphological observation was performed to determine the cell changes before and after the treatment, as shown in Fig. 3 . All the control groups show the cobblestone-like structure of HUVEC which indicate healthy and normal cells. Whilst at 0.2 µM, the cells’ structure was altered and shrunk, especially after 24, 48 and 72 hours of treatment. On top of that, the number of cell shrinkage was elevated dramatically with 3.0 µM navitoclax after 24, 48 and 72 hours of treatment. These findings indicate more cells were dead with navitoclax treatment. Nevertheless, after 18 hours, the number of normal cells were still visible. Based on the MTT assay result, 0.9 µM navitoclax for 24 hours treatment has been selected for subsequent experiment to determine the regulation of HUVEC angiogenesis and motility. Establishment of in-vitro angiogenesis model by IL-3 The influence of various IL-3 concentrations on the induction of HUVECs tube formation after 6 hours, as measured by the mean total branching length can be depicted in Fig. 4 . The total branching length is represented by the total segments and branches length [ 51 ]. The images displayed more branches and segments were formed by HUVECs with 25ng/ml. 10ng/ml and 25ng/ml IL-3 generated considerably longer branches than the control quantitatively. However, there was no statistically significant change in the mean total branch length between the three concentrations of IL-3. Nonetheless, the total branch length was greatest at 25ng/ml IL-3. This result shows a model of in-vitro angiogenesis generated by IL-3, one of the principal cytokines known to promote intraplaque angiogenesis. Navitoclax inhibits the in-vitro angiogenesis model Modulation of IL-3-induced HUVEC tube formation by 0.9 µM navitoclax was observed for 8 hours. All groups began to develop tube formation after two hours of incubation. The blockage of the branches was then observed after 4 hours in the IL-3 with navitoclax treated group and continued to deteriorate until the end of the incubation period (24 hours). Quantification of total branching length was performed after 8 hours treatment since at 24 hours the branches and segments were unlikely to be recognized by imageJ – Angiogenesis Analyzer. In the presence of navitoclax, as seen in Fig. 5 (A), the number of segments and associated branches decreases. In addition, numerous isolated branches were observed, indicating the degeneration of the tube development. Similar to the data shown in Fig. 4 A, 25 ng/ml IL-3 greatly increased tube formation, whereas navitoclax considerably reduced the overall branching length compared to the inducer group (Fig. 5 B). Regulation of navitoclax on IL-3 induced HUVEC proliferation and migration To observe the cell behavior related to in-vitro angiogenesis, a migration and proliferation assay was undertaken. After 24 hours of incubation, the wound area in the control and IL-3 groups was not completely covered by cells, as evidenced in Fig. 6 A. Possibly, by extending the incubation period, the entire wound will heal. Quantification of the data (Fig. 6 B) reveals that the control group generated 42% wound closure, whereas IL-3 demonstrated the highest percentage which was 49%. Despite this, there was no statistically significant difference between the control and IL-3 groups, p > 0.05. After 24 hours of treatment with navitoclax, as depicted in Fig. 6 A, a small number of cells had moved to the wound site. Around 17% of wound closure was impacted by navitoclax treatment, as seen in Fig. 6 B, whereby p < 0.05 indicates statistical significance in comparison to the control and IL-3 groups. The data demonstrate that after 24 hours of treatment, navitoclax inhibits cell motility, as measured by a decrease in the percentage of wound closure area. BrdU assay was done to quantify proliferating cells by permitting BrdU marker incorporation into newly produced DNA of actively developing cells. As seen in Fig. 7 , the data were not statistically significant across all groups. IL-3 increased by 16% after 24 hours of treatment, while navitoclax reduced BrdU-positive cells by just 2% compared to the control group. This result indicates navitoclax had minimal effect on the reduction of proliferating cells. Modulation of target genes related to HUVEC angiogenesis and motility by navitoclax Cell lysate was used to assess mRNA expression levels. Three mRNA targets were chosen as markers for angiogenesis (CXCL-8), migration (MMP-3) and proliferation (BCL-2). In angiogenesis, endothelial cells secrete CXCL-8, a pro-angiogenesis chemokine, to facilitate the formation of tubes. In agreement with the angiogenesis result, CXCL-8 expression in the IL-3 cell lysate was slightly lower than the control, however in the presence of navitoclax, the CXCL-8 level was dramatically enhanced, p < 0.001. This may indicate that navitoclax degenerates the branches by inhibiting the secretion of CXCL-8. Subsequently, the activation of MMP-3 levels was correlated with cell migration data, in which the expressions increased significantly in response to IL-3 treatment and were inhibited by navitoclax. Finally, BCL-2 expressions were evaluated to determine the impact of navitoclax on HUVEC survival. Unexpectedly, the BCL-2 concentrations in IL-3 with or without navitoclax were comparable, and slightly lower than the control. Discussion Our study conducted several optimizations in order to discover an appropriate set of navitoclax concentrations against proliferating endothelial cells (data not shown) with a finalized range between 0.2 µM to 3.0 µM. Different treatment times were performed to evaluate the potency of navitoclax in mediating HUVEC survival over time. This study included two control groups: untreated cells and cells incubated with 0.01 µM DMSO (vehicle control). The vehicle control group did not show a significant effect on cell death. This result would validate the anti-survival impact of navitoclax alone in the treatment group. After 18 hours of navitoclax treatment, more intact cells were still visible. Even though the statistical analysis showed a significant mean difference output between untreated and treated groups, from the dose-response curve plotted, the cell viability was reduced below 80% only at the highest navitoclax concentration used. We proposed it is due to a minimal time for the navitoclax to have an effect on HUVEC and a low range of concentration used. Nevertheless, our study did not proceed with higher navitoclax concentration; thus, the IC 50 for 18 hours treatment could not be identified. An investigation to determine a relevant concentration range of navitoclax for 18 hours treatment is worth conducting. The result can further disclose that the time-dependent navitoclax activity is influenced by the concentration. However, as the treatment time increased with a constant concentration range, the number of intact cells was diminished. After 24, 48 and 72 hours of treatment, the IC 50 values of navitoclax were successfully determined. Our findings are supported by a previous study that reported approximately 50% reduction of HUVEC viability after 72 hours of 0.1 µM navitoclax treatment though they did not report on the morphological changes [ 52 ]. Our studies also showed a comparable IC 50 value after 72 hours of treatment which was 0.12 µM. After all, this current study demonstrated that the IC 50 value decreases as the treatment time increases. This indicates that the potency of navitoclax in reducing HUVEC viability is escalated over time. The data from the MTT assay conducted in this study would represent the number of living cells that can be detected after navitoclax treatment. This may indirectly indicate the cytotoxicity effect of navitoclax on living cells and illustrate that navitoclax can inhibit metabolically active cells. Yet, endothelial cell apoptosis induced by navitoclax is not clearly determined through this assessment. Hence, an investigation to ascertain the navitoclax apoptotic effect and its mechanism on endothelial cells is worth proceeding. Most of the navitoclax cytotoxicity studies have been conducted on various cancer cells, including small-cell lung cancer (SCLC) cell lines, leukemia cells, breast cancer cells and neuroblastoma. This drug has been demonstrated to block anti-apoptotic proteins of the Bcl-2 family, which then triggers the downstream signaling of cell death. A different range of navitoclax concentrations were used in cytotoxicity assay against cancer cells subject to navitoclax efficacy. As demonstrated by a previous study, navitoclax treatment was highly efficacious towards head and neck squamous cancer cell lines; hence low dosage range was used starting from 0.0 to 1.5 µM [ 53 ]. In contrast, other tumor cells were less potent against navitoclax treatment; thus, a high concentration range was applied (i.e. 5 µM to 10 µM) for breast cancer cells [ 38 ], human oral squamous cell carcinoma-derived cell lines [ 39 ] and leukemia cells [ 54 ]. There is growing evidence for the therapeutic outcome of pro-apoptotic and anti-angiogenic agents on pathological angiogenesis other than cancer, such as advanced atherosclerosis. Angiogenesis in advanced atherosclerosis is primarily regulated by endothelial cells and smooth muscle cells survival as well as motility[ 11 ]. Therefore, a study of navitoclax cytotoxicity via cell viability assay to determine its IC50 value on primary cells (i.e., endothelial cells) is worth being conducted before further investigating its mechanism and pharmacological characteristics. A previous study has reported 10 µM navitoclax exhibited a significant but moderate pro-apoptotic effect against a primary cell which was human mesenchymal stromal cells [ 55 ]. Their results hence reassured the potential of navitoclax treatment to mediate a therapeutic effect against primary cells. The in-vitro angiogenesis model would represent the neovascularization that occurs at the intraplaque region hence causing plaque instability and rupture. High expression of IL-3 receptor was detected upon pro-inflammatory agent stimulation such as IL-3, and these receptors were accumulated in coronary atherosclerotic plaques with neovessels development [ 18 ]. The discovery suggested that IL-3 – induced inflammation is strongly associated with angiogenic response. Besides, IL-3 was shown to mediate the angiogenic response in wound healing and tumor vasculature by activating endothelial cell-derived extracellular vesicles via STAT5 [ 56 ] and β-catenin signaling pathway [ 19 , 20 ] respectively. In view of this evidence, the in-vitro angiogenesis model induced by IL-3 is justified to imitate the pathological neovascularization that contributes to the progression of atherosclerosis and cancer. The establishment of this model is crucial prior to navitoclax treatment in order to mimic the pathological condition of the disease. Therefore, 25 ng/ml IL-3 was administered with navitoclax to observe the efficacy of navitoclax in ameliorating the disease model. Based on the MTT assay result, 0.9 M navitoclax was used in the subsequent tests to observe the regulation of navitoclax on the in-vitro intraplaque angiogenesis model. All studies were conducted with an incubation period of 24 hours, hence the IC50 value at 24 hours was utilized. In addition, the IC50 value employed in this study demonstrates the effectiveness of navitoclax in blocking the formation of in-vitro blood vessels by half-maximal inhibitory dose. Hence, it is possible to conclude that the inhibition of the subsequent cell biological test was not due to the absence of live cells. As illustrated by the tube formation assay, in the presence of navitoclax, the in-vitro angiogenesis induced by IL-3 was remarkably suppressed within 8 hours. This finding reveals a novel navitoclax function as anti-angiogenic agent on IL-3 – induced HUVEC neovascularization through cell motility inhibition. In accordance with the inhibitory effect of navitoclax on HUVEC angiogenesis and migration, the release of CXCL-8 and MMP-3 expression in cell lysates was reduced notably in navitoclax-treated group. Our findings revealed a novel function of navitoclax as anti-angiogenic drug through the regulation of CXCL-8 and MMP-3 expressions. Interestingly, CXCL-8 and MMP-3 levels were also highly expressed in the presence of IL-3 which may suggest the involvement of these molecules in the downstream signaling of IL-3 receptor activation. Nevertheless, current study determined anti-proliferative effect of navitoclax on HUVEC to be minimal and BCL-2 protein involvement was insignificant. On top of that, this is the first in-vitro study to employ navitoclax as one the pharmacological strategies to ameliorate intraplaque angiogenesis in atherosclerosis. Several drugs have been proposed for this disease model, however, the outcomes are yet to be elucidated. This is due to a lack of in-vivo disease model and some of the treatments display unappealing effects. Conclusion This is among the few studies that reported the navitoclax effect on primary cell viability, which is HUVEC mainly. Navitoclax demonstrated a moderate toxicity result on primary human endothelial cells with a concentration below 3.0 µM indicated by the number of viable cells after 6- and 24-hours treatment time. The potency of navitoclax elevated as the treatment time increased. The action of navitoclax is time- and concentration-dependent on HUVEC. The finding suggested using 0.9 µM navitoclax in 24 hours treatment period is appropriate for further HUVEC in-vitro study. Research on navitoclax effect in less than 24 hours treatment time will require higher navitoclax concentration, whilst for longer treatment time (i.e., > 24 hours), lower navitoclax dose can be used. Our results provide the first evidence of navitoclax as an anti-angiogenic agent against IL-3 – induced HUVEC angiogenesis. Besides, navitoclax effects on matrix metalloproteinases activities and CXCL-8 released to degenerate blood vessel formation were revealed through in-vitro study. Unexpectedly, this drug showed minimal association with BCL-2 expression and proliferative activity of endothelial cells, as opposed from the cancer study. As in general, navitoclax has moderate toxicity effect on the metabolically active endothelial cells. Other than that, with half – maximal concentration applied, navitoclax is able to significantly inhibit the in-vitro tube formation and cell migration induced by IL-3 through the downregulation of CXCL-8 and MMP-3 activities. In conclusion, navitoclax is proposed to produce therapeutic outcomes in pathological angiogenesis such as intraplaque angiogenesis in atherosclerosis through its anti-angiogenic properties. Declarations ACKNOWLEDGMENT This research was supported by a grant from the Ministry of Education, Malaysia (FRGS/1/2019/SKK06/UKM/02/7) and Universiti Kebangsaan Malaysia (UKM). We like to thank the Department of Obstetrics and Gynecology, Universiti Kebangsaan Malaysia Medical Center (PPUKM) for their support in providing human umbilical cord samples. Appreciation also goes to the Department of Physiology, Faculty of Medicine, Universiti Kebangsaan Malaysia for the usage of their equipment and expertise for HUVEC isolation. Funding This research was supported by a grant from the Ministry of Education, Malaysia (FRGS/1/2019/SKK06/UKM/02/7) and Universiti Kebangsaan Malaysia (UKM). CONFLICT OF INTEREST The authors declare no conflict of interest, financial or otherwise. AUTHOR CONTRIBUTIONS AU and NNMA designed the study conceptualization and supervised the experiment. MFA assisted the umbilical cord collection and isolation process. NSNH conducted the experiment and drafted the manuscript. KDG and NFR edited and reviewed the manuscript. All authors approved the final version of the manuscript. References Simionescu, D. (2012). Vasculogenesis and Angiogenesis - from Embryonic Development to Regenerative Medicine. In S. Dan (Ed.), IntechOpen . IntechOpen. https://doi.org/10.5772/1341 Honnegowda, T. M., Kumar, P., Udupa, E. G. P., Kumar, S., Kumar, U., & Rao, P. (2015). Role of angiogenesis and angiogenesis factors in acute and chronic wound healing. Plastic and Aesthetic Research, 2 , 243–249. https://doi.org/10.4103/2347-9264.165438 Li, J., Zhang, Y., & Kirsner, R. S. (2003). Angiogenesis in wound repair: angiogenic growth factors and the extracellular matrix. Microscopy Research and Technique, 60 (1), 107–114. https://doi.org/10.1002/JEMT.10249 Raiter, A., Bechor, Z., Kleiman, M., Leshem-Lev, D., Battler, A., & Hardy, B. (2010). Angiogenic Peptides Improve Blood Flow and Promote Capillary Growth in a Diabetic and Ischaemic Mouse Model. European Journal of Vascular and Endovascular Surgery, 40 (3), 381–388. https://doi.org/10.1016/j.ejvs.2010.02.003 Pereira, R. D., De Long, N. E., Wang, R. C., Yazdi, F. T., Holloway, A. C., & Raha, S. (2015). Angiogenesis in the Placenta: The Role of Reactive Oxygen Species Signaling. BioMed Research International, 2015 (814543). https://doi.org/10.1155/2015/814543 Zygmunt, M., Herr, F., Münstedt, K., Lang, U., & Liang, O. D. (2003). Angiogenesis and vasculogenesis in pregnancy. European Journal of Obstetrics, Gynecology, and Reproductive Biology, 110 Suppl , 10–18. https://doi.org/10.1016/S0301-2115(03)00168-4 Fleiner, M., Kummer, M., Mirlacher, M., Sauter, G., Cathomas, G., Krapf, R., & Biedermann, B. C. (2004). Arterial neovascularization and inflammation in vulnerable patients: Early and late signs of symptomatic atherosclerosis. Circulation, 110 (18), 2843–2850. https://doi.org/10.1161/01.CIR.0000146787.16297.E8 Noma, H., Funatsu, H., Yamashita, H., Kitano, S., Mishima, H. K., & Hori, S. (2002). Regulation of angiogenesis in diabetic retinopathy: Possible balance between vascular endothelial growth factor and endostatin. Archives of Ophthalmology, 120 (8), 1075–1080. https://doi.org/10.1001/archopht.120.8.1075 Bentzon, J. F., Otsuka, F., Virmani, R., & Falk, E. (2014). Mechanisms of plaque formation and rupture. Circulation Research, 114 (12), 1852–1866. https://doi.org/10.1161/CIRCRESAHA.114.302721 Perrotta, P., Veseli, B. E., Veken, B. Van Der, Roth, L., Martinet, W., & Meyer, G. R. Y. De. (2019). Pharmacological strategies to inhibit intra-plaque angiogenesis in atherosclerosis. Vascular Pharmacology , 112 (May 2018), 72–78. https://doi.org/10.1016/j.vph.2018.06.014 Virmani, R., Kolodgie, F. D., Burke, A. P., Finn, A. V., Gold, H. K., Tulenko, T. N., Wrenn, S. P., & Narula, J. (2005). Atherosclerotic plaque progression and vulnerability to rupture: Angiogenesis as a source of intraplaque hemorrhage. In Arteriosclerosis, Thrombosis, and Vascular Biology (Vol. 25, Issue 10, pp. 2054–2061). Lippincott Williams & Wilkins. https://doi.org/10.1161/01.ATV.0000178991.71605.18 Broughton, S. E., Dhagat, U., Hercus, T. R., Nero, T. L., Grimbaldeston, M. A., Bonder, C. S., Lopez, A. F., & Parker, M. W. (2012). The GM-CSF/IL-3/IL-5 cytokine receptor family: From ligand recognition to initiation of signaling. Immunological Reviews, 250 (1), 277–302. https://doi.org/10.1111/j.1600-065X.2012.01164.x Dentelli, P., Sorbo, L. Del, Rosso, A., Molinar, A., Garbarino, G., Camussi, G., Pegoraro, L., & Brizzi, M. F. (1999). Human IL-3 Stimulates Endothelial Cell Motility and Promotes In Vivo New Vessel Formation. The Journal of Immunology, 163 (4). Hercus, T. R., Dhagat, U., Kan, W. L. T., Broughton, S. E., Nero, T. L., Perugini, M., Sandow, J. J., D’Andrea, R. J., Ekert, P. G., Hughes, T., Parker, M. W., & Lopez, A. F. (2013). Signalling by the βc family of cytokines. Cytokine and Growth Factor Reviews, 24 (3), 189–201. https://doi.org/10.1016/j.cytogfr.2013.03.002 Brizzi, M. F., Garbarino, G., Rossi, P. R., Pagliardi, G. L., Arduino, C., Avanzi, G. C., & Pegoraro, L. (1993). Rapid Publication Interleukin 3 Stimulates Proliferation and Triggers Endothelial-Leukocyte Adhesion Molecule 1 Gene Activation of Human Endothelial Cells Key words: endothelial cells * endo-thelial-leukocyte adhesion molecule 1 * inflammation * inter-leukin 3 * proliferation Introduction . 91 , 2887–2892. Penna, C., Femminò, S., Tapparo, M., Lopatina, T., Fladmark, K. E., Ravera, F., Comità, S., Alloatti, G., Giusti, I., Dolo, V., Camussi, G., Pagliaro, P., & Brizzi, M. F. (2021). The Inflammatory Cytokine IL-3 Hampers Cardioprotection Mediated by Endothelial Cell-Derived Extracellular Vesicles Possibly via Their Protein Cargo. Cells, 10 (1), 1–21. https://doi.org/10.3390/CELLS10010013 Korpelainen, E., Gamble, J., Smith, W., Goodall, G., Qiyu, S., Woodcock, J., Dottore, M., Vadas, M., & Lopez, A. (1993). The receptor for interleukin 3 is selectively induced in human endothelial cells by tumor necrosis factor alpha and potentiates interleukin 8 secretion and neutrophil transmigration. Proceedings of the National Academy of Sciences of the United States of America, 90 (23), 11137–11141. https://doi.org/10.1073/PNAS.90.23.11137 Mohamad Anuar, N. N. (2016). Regulation of Vascular Cells Function by Colony Stimulating Factors . September . Lombardo, G., Gili, M., Grange, C., Cavallari, C., Dentelli, P., Togliatto, G., Taverna, D., Camussi, G., & Brizzi, M. F. (2017). IL-3R-alpha blockade inhibits tumor endothelial cell-derived extracellular vesicle (EV)-mediated vessel formation by targeting the β-catenin pathway. Oncogene 2017 37:9 , 37 (9), 1175–1191. https://doi.org/10.1038/s41388-017-0034-x Dentelli, P., Rosso, A., Olgasi, C., Camussi, G., & Brizzi, M. F. (2011). IL-3 is a novel target to interfere with tumor vasculature. Oncogene 2011 30:50 , 30 (50), 4930–4940. https://doi.org/10.1038/onc.2011.204 Ziegler, M. E., Hatch, M. M. S., Wu, N., Muawad, S. A., & Hughes, C. C. W. (2016). mTORC2 mediates CXCL12-induced angiogenesis. Angiogenesis, 19 (3), 359–371. https://doi.org/10.1007/s10456-016-9509-6 Wihastuti, T. A., Sargowo, D., Tjokroprawiro, A., Permatasari, N., Widodo, M. A., & Soeharto, S. (2014). Vasa vasorum anti-angiogenesis through H2O2, HIF-1α, NF-κB, and iNOS inhibition by mangosteen pericarp ethanolic extract (Garcinia mangostana Linn) in hypercholesterol-diet-given Rattus norvegicus Wistar strain. Vascular Health and Risk Management, 10 , 523–531. https://doi.org/10.2147/VHRM.S61736 Guillot, N., Kollins, D., Badimon, J. J., Schlondorff, D., & Hutter, R. (2013). Accelerated Reendothelialization, Increased Neovascularization and Erythrocyte Extravasation after Arterial Injury in BAMBI-/- Mice. PLoS ONE, 8 (3), 1–7. https://doi.org/10.1371/journal.pone.0058550 Perrotta, P., Pintelon, I., De Vries, M. R., Quax, P. H. A., Timmermans, J. P., De Meyer, G. R. Y., & Martinet, W. (2020). Three-Dimensional Imaging of Intraplaque Neovascularization in a Mouse Model of Advanced Atherosclerosis. Journal of Vascular Research, 57 (6), 348–354. https://doi.org/10.1159/000508449 Simonini, A., Moscucci, M., Muller, D. W. M., Bates, E. R., Pagani, F. D., Burdick, M. D., & Strieter, R. M. (2000). IL-8 is an angiogenic factor in human coronary atherectomy tissue. Circulation, 101 (13), 1519–1526. https://doi.org/10.1161/01.CIR.101.13.1519 Raza, S. L., & Cornelius, L. A. (2000). Matrix Metalloproteinases: Pro- and Anti-Angiogenic Activities . 47–54. Ye, S., Watts, G. F., Mandalia, S., Humphries, S. E., & Henney, A. M. (1995). Preliminary report: genetic variation in the human stromelysin promoter is associated with progression of coronary atherosclerosis . 209–215. Ye, S., Eriksson, P., Hamsten, A., Kurkinen, M., Humphries, S. E., & Henney, A. M. (1996). Progression of Coronary Atherosclerosis Is Associated with a Common Genetic Variant of the Human Stromelysin-1 Promoter Which Results in Reduced Gene Expression * . 271 (22), 13055–13060. Shi, J., Zhou, Y., Huang, H.-C., & Mitchison, T. J. (2011). Navitoclax (ABT-263) Accelerates Apoptosis during Drug-Induced Mitotic Arrest by Antagonizing Bcl-xL. Cancer Research, 71 (13), 4518–4526. https://doi.org/10.1158/0008-5472.CAN-10-4336 Suvarna, V., Singh, V., & Murahari, M. (2019). Current overview on the clinical update of Bcl-2 anti-apoptotic inhibitors for cancer therapy. European Journal of Pharmacology, 862 , 172655. https://doi.org/10.1016/j.ejphar.2019.172655 Mohamad Anuar, N. N., Nor Hisam, N. S., Liew, S. L., & Ugusman, A. (2020). Clinical Review: Navitoclax as a Pro-Apoptotic and Anti-Fibrotic Agent. Frontiers in Pharmacology, 11 (564108), 1–16. https://doi.org/10.3389/fphar.2020.564108 Chen, J., Jin, S., Abraham, V., Huang, X., Liu, B., Mitten, M. J., Nimmer, P., Lin, X., Smith, M., Shen, Y., Shoemaker, A. R., Tahir, S. K., Zhang, H., Ackler, S. L., Rosenberg, S. H., Maecker, H., Sampath, D., Leverson, J. D., Tse, C., & Elmore, S. W. (2011). The Bcl-2/Bcl-X L /Bcl-w Inhibitor, Navitoclax, Enhances the Activity of Chemotherapeutic Agents In Vitro and In Vivo. Molecular Cancer Therapeutics, 10 (12), 2340–2349. https://doi.org/10.1158/1535-7163.MCT-11-0415 Tse, C., Shoemaker, A. R., Adickes, J., Anderson, M. G., Chen, J., Jin, S., Johnson, E. F., Marsh, K. C., Mitten, M. J., Nimmer, P., Roberts, L., Tahir, S. K., Xiao, Y., Yang, X., Zhang, H., Fesik, S., Rosenberg, S. H., & Elmore, S. W. (2008). ABT-263: A potent and orally bioavailable Bcl-2 family inhibitor. Cancer Research, 68 (9), 3421–3428. https://doi.org/10.1158/0008-5472.CAN-07-5836 Gandhi, L., Camidge, D. R., De Oliveira, M. R., Bonomi, P., Gandara, D., Khaira, D., Hann, C. L., McKeegan, E. M., Litvinovich, E., Hemken, P. M., Dive, C., Enschede, S. H., Nolan, C., Chiu, Y. L., Busman, T., Xiong, H., Krivoshik, A. P., Humerickhouse, R., Shapiro, G. I., & Rudin, C. M. (2011). Phase I study of navitoclax (ABT-263), a novel bcl-2 family inhibitor, in patients with small-cell lung cancer and other solid tumors. Journal of Clinical Oncology, 29 (7), 909–916. https://doi.org/10.1200/JCO.2010.31.6208 Clinical Cancer Research , 18 (11), 3163–3169. https://doi.org/10.1158/1078-0432.CCR-11-3090 Roberts, A. W., Seymour, J. F., Brown, J. R., Wierda, W. G., Kipps, T. J., Khaw, S. L., Carney, D. A., He, S. Z., Huang, D. C. S., Xiong, H., Cui, Y., Busman, T. A., McKeegan, E. M., Krivoshik, A. P., Enschede, S. H., & Humerickhouse, R. (2012). Substantial susceptibility of chronic lymphocytic leukemia to BCL2 inhibition: Results of a phase I study of navitoclax in patients with relapsed or refractory disease. Journal of Clinical Oncology, 30 (5), 488–496. https://doi.org/10.1200/JCO.2011.34.7898 Wilson, W. H., O’Connor, O. A., Czuczman, M. S., LaCasce, A. S., Gerecitano, J. F., Leonard, J. P., Tulpule, A., Dunleavy, K., Xiong, H., Chiu, Y. L., Cui, Y., Busman, T., Elmore, S. W., Rosenberg, S. H., Krivoshik, A. P., Enschede, S. H., & Humerickhouse, R. A. (2010). Navitoclax, a targeted high-affinity inhibitor of BCL-2, in lymphoid malignancies: A phase 1 dose-escalation study of safety, pharmacokinetics, pharmacodynamics, and antitumour activity. The Lancet Oncology, 11 (12), 1149–1159. https://doi.org/10.1016/S1470-2045(10)70261-8 Lee, E. Y., Gong, E. Y., Shin, J. S., Moon, J. H., Shim, H. J., Kim, S. M., Lee, S., Jeong, J., Gong, J. H., Kim, M. J., Lee, D. H., Park, Y. S., Shin, J., Hong, S. W., Kim, Y. S., & Jin, D. H. (2018). Human breast cancer cells display different sensitivities to ABT-263 based on the level of survivin. Toxicology in Vitro, 46 , 229–236. https://doi.org/10.1016/j.tiv.2017.09.023 Yang, I. H., Jung, J. Y., Kim, S. H., Yoo, E. S., Cho, N. P., Lee, H., Lee, J. Y., Hong, S. D., Shin, J. A., & Cho, S. D. (2019). ABT-263 exhibits apoptosis-inducing potential in oral cancer cells by targeting C/EBP-homologous protein. Cellular Oncology, 42 (3), 357–368. https://doi.org/10.1007/s13402-019-00431-5 Nor Hisam, N. S., Ugusman, A., Rajab, N. F., Ahmad, M. F., Fenech, M., Liew, S. L., & Mohamad Anuar, N. N. (2021). Combination therapy of navitoclax with chemotherapeutic agents in solid tumors and blood cancer: A review of current evidence. Pharmaceutics, 13 (9). https://doi.org/10.3390/pharmaceutics13091353 Journal of Medicinal Chemistry , 50 (4), 641–662. https://doi.org/10.1021/jm061152t Liu, J., Nie, Z., Lei, Y., Yang, S., & Liu, Z. (2017). The expression of ERβ2, Bcl-xl and Bax in non-small cell lung cancer and associated with prognosis. International Journal of Clinical & Experimental Pathology, 10 (9), 10040–10046. Limana, F., Urbanek, K., Chimenti, S., Quaini, F., Leri, A., Kajstura, J., Nadal-Ginard, B., Izumo, S., & Anversa, P. (2002). Bcl-2 overexpression promotes myocyte proliferation. Proceedings of the National Academy of Sciences of the United States of America, 99 (9), 6257–6262. https://doi.org/10.1073/PNAS.092672899 Ross, J. S., Stagliano, N. E., Donovan, M. J., Breitbart, R. E., & Ginsburg, G. S. (2001). Atherosclerosis and cancer: common molecular pathways of disease development and progression. Annals of the New York Academy of Sciences, 947 (1), 271–293. https://doi.org/10.1111/J.1749-6632.2001.TB03949.X Tapia-Vieyra, J. V., Delgado-Coello, B., & Mas-Oliva, J. (2017). Atherosclerosis and Cancer; A Resemblance with Far-reaching Implications. Archives of Medical Research, 48 (1), 12–26. https://doi.org/10.1016/J.ARCMED.2017.03.005 Ugusman, A., Zakaria, Z., Hui, C. K., & Nordin, N. A. M. M. (2010). Piper sarmentosum increases nitric oxide production in oxidative stress: a study on human umbilical vein endothelial cells. Clinics, 65 (7), 709–714. https://doi.org/10.1590/S1807-59322010000700010 Sundar, U. M., Ugusman, A., Chua, H. K., Latip, J., & Aminuddin, A. (2019). Piper sarmentosum promotes endothelial nitric oxide production by reducing asymmetric dimethylarginine in tumor necrosis factor-α-induced human umbilical vein endothelial cells. Frontiers in Pharmacology, 10 (SEP), 1–9. https://doi.org/10.3389/fphar.2019.01033 Hamid, A., Azmi, M. A., Rajab, N. F., Awang, N., & Jufri, N. F. (2020). Cytotoxic effects of organotin(IV) dithiocarbamate compounds with different functional groups on leukemic cell line, K-562. Sains Malaysiana, 49 (6), 1421–1430. https://doi.org/10.17576/jsm-2020-4906-20 Latif, M. A., Ibrahim, F. W., Arshad, S. A., Hui, C. K., Jufri, N. F., & Hamid, A. (2019). Cytotoxicity, proliferation and migration rate assessments of human dermal fibroblast adult cells using zingiber zerumbet extract. Sains Malaysiana, 48 (1), 121–127. https://doi.org/10.17576/jsm-2019-4801-14 Krishna Vedula, S. R., Ravasio, A., Lim, C. T., & Ladoux, B. (2013). Collective Cell Migration: A Mechanistic Perspective. Physiology, 28 , 370–379. https://doi.org/10.1152/physiol.00033.2013 Carpentier, G. (2012). Angiogenesis Analyzer for ImageJ - Gilles Carpentier Research Web Site: Computer Image Analysis . http://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ &artpage=4-6&lang=en Zhu, Y., Tchkonia, T., Fuhrmann-Stroissnigg, H., Dai, H. M., Ling, Y. Y., Stout, M. B., Pirtskhalava, T., Giorgadze, N., Johnson, K. O., Giles, C. B., Wren, J. D., Niedernhofer, L. J., Robbins, P. D., & Kirkland, J. L. (2016). Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors. Aging Cell, 15 (3), 428–435. https://doi.org/10.1111/acel.12445 Ow, T. J., Fulcher, C. D., Thomas, C., Broin, P., López, A., Reyna, D. E., Smith, R. V., Sarta, C., Prystowsky, M. B., Schlecht, N. F., Schiff, B. A., Rosenblatt, G., Belbin, T. J., Harris, T. M., Childs, G. C., Kawachi, N., Guha, C., & Gavathiotis, E. (2019). Optimal targeting of BCL-family proteins in head and neck squamous cell carcinoma requires inhibition of both BCL-xL and MCL-1. Oncotarget, 10 (4), 494–510. https://doi.org/10.18632/oncotarget.26563 Lock, R., Carol, H., Houghton, P. J., Morton, C. L., Anders Kolb, E., Gorlick, R., Patrick Reynolds, C., Maris, J. M., Keir, S. T., Wu, J., & Smith, M. A. (2008). Initial testing (stage 1) of the BH3 mimetic ABT-263 by the pediatric preclinical testing program. Pediatric Blood and Cancer, 50 (6), 1181–1189. https://doi.org/10.1002/pbc.21433 Grezella, C., Fernandez-Rebollo, E., Franzen, J., Ventura Ferreira, M. S., Beier, F., & Wagner, W. (2018). Effects of senolytic drugs on human mesenchymal stromal cells. Stem Cell Research and Therapy, 9 (1), 1–6. https://doi.org/10.1186/s13287-018-0857-6 Lombardo, G., Dentelli, P., Togliatto, G., Rosso, A., Gili, M., Gallo, S., Deregibus, M. C., Camussi, G., & Brizzi, M. F. (2016). Activated Stat5 trafficking Via Endothelial Cell-derived Extracellular Vesicles Controls IL-3 Pro-angiogenic Paracrine Action. Scientific Reports, 6 (1), 1–14. https://doi.org/10.1038/srep25689 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2759691","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":188117997,"identity":"706703dd-76ab-470a-8a23-eb8b2680bded","order_by":0,"name":"Nur Syahidah Nor Hisam","email":"","orcid":"","institution":"Universiti Kebangsaan Malaysia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nur","middleName":"Syahidah Nor","lastName":"Hisam","suffix":""},{"id":188117998,"identity":"249f2e08-af9f-4bcf-a1e0-8e6d0a2343e7","order_by":1,"name":"Azizah Ugusman","email":"","orcid":"","institution":"Universiti Kebangsaan Malaysia Medical Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Azizah","middleName":"","lastName":"Ugusman","suffix":""},{"id":188117999,"identity":"3ad534f7-ea7e-495a-83eb-8b4a27dea1ee","order_by":2,"name":"Nor Fadilah Rajab","email":"","orcid":"","institution":"Universiti Kebangsaan Malaysia","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nor","middleName":"Fadilah","lastName":"Rajab","suffix":""},{"id":188118000,"identity":"dbdee4bc-5e46-408a-9194-b9eff0064c66","order_by":3,"name":"Karina Di Gregoli","email":"","orcid":"","institution":"University of Bristol","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Karina","middleName":"Di","lastName":"Gregoli","suffix":""},{"id":188118001,"identity":"0d1d6e3a-6a06-439c-ad08-8d18a0c40c52","order_by":4,"name":"Mohd Faizal Ahmad","email":"","orcid":"","institution":"Universiti Kebangsaan Malaysia Medical Centre","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohd","middleName":"Faizal","lastName":"Ahmad","suffix":""},{"id":188118002,"identity":"d1590974-fe5d-4716-bcfb-f303a4360458","order_by":5,"name":"Nur Najmi Mohamad Anuar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIiWNgGAWjYNACHgYefgY2ECsBRBgQp0WygTQtIGUHiNViLpH77MEPmW0yxjfSUjcwtqVFM7A3b5NgzDmMU4vljHRzwx6e2zxmN9KO3WBsy8lt4DlWJsG4DbcWgxtpbBI8YC3pbUAtFbkNEjlmBLVI/gFqMZ4B0yL/hrAWaZAtBhIwh0nwENBy5hmbtAxQi8SZZ2k3Es6l5bbxpBVbJG5Lx63lONBhb3tu2/O3p5nd+FCWnNvPfnjjjY/brHFqAQPGHigjAYih0dOMXwvDD0yhOgJaRsEoGAWjYAQBANzuUdbYquh6AAAAAElFTkSuQmCC","orcid":"","institution":"Universiti Kebangsaan Malaysia","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Nur","middleName":"Najmi Mohamad","lastName":"Anuar","suffix":""}],"badges":[],"createdAt":"2023-03-31 07:14:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2759691/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2759691/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":35294255,"identity":"93b81ffc-a754-4d4b-8fce-2801d9956e6f","added_by":"auto","created_at":"2023-04-04 21:50:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":50229,"visible":true,"origin":"","legend":"\u003cp\u003eNavitoclax dose-response curve at different time points via MTT assay. A-D; the dose-response curve of navitoclax against endothelial cells viability after 18-, 24-, 48- and 72-hours treatment. The results were displayed as mean ± SEM of n=4 in triplicates, ***p \u0026lt; 0.001 against control.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/d78f7cf1cc30caa71a72a0cf.png"},{"id":35293776,"identity":"a07e8495-66d4-4d22-a36d-ed7c90b6f77b","added_by":"auto","created_at":"2023-04-04 21:42:17","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":39102,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of navitoclax Log(dose) – response curve against four different time points; 18-, 24-, 48- and 72-hours. Log\u003csub\u003e10\u003c/sub\u003e(-10) showing 100% cell viability represents the control. The results were presented as a mean of n=4 in triplicates, *p \u0026lt; 0.05 against 18 hours treatment.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/0b0503f4c68905cc02a0c621.jpeg"},{"id":35294400,"identity":"28513b9f-0412-4302-bfeb-ebf6c69f3035","added_by":"auto","created_at":"2023-04-04 21:58:17","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":89799,"visible":true,"origin":"","legend":"\u003cp\u003eMorphology of control and treated HUVEC with 0.2 and 3.0 µM navitoclax) 24 hours post-treatment, observed under an inverted microscope and photomicrographs, 100X magnification.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/543eb8f449f3b076f493a635.jpeg"},{"id":35294258,"identity":"629461ed-b828-4028-8018-33fef3a26470","added_by":"auto","created_at":"2023-04-04 21:50:17","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1201942,"visible":true,"origin":"","legend":"\u003cp\u003eIL-3 promotes HUVECs tube formation within 6 hours. A: Representative images of the established in-vitro angiogenesis model by 1, 10 and 25 ng/ml IL-3, 50X magnification. Upper: Representative images of tube formation; Bottom: Phase contrast images with the superposition of vectorial objects generated by customized Angiogenesis Analyzer for ImageJ are shown: green – branches; yellow – segments; blue sky – meshes; red surrounded by blue – nodes surrounded by junctions [51]. B: Quantitative analysis to compare the total branching length induced by three different IL-3 concentrations. The results were presented as a mean ± SEM of n=4, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/21325cd8c4deb52291da7794.jpeg"},{"id":35293778,"identity":"eb67872e-2cfb-4df0-ac98-47e21d9f61c4","added_by":"auto","created_at":"2023-04-04 21:42:17","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1137984,"visible":true,"origin":"","legend":"\u003cp\u003eNavitoclax inhibits the in-vitro angiogenesis model. A: Representative images of the established in-vitro angiogenesis model in the absence and presence of navitoclax after 8 hours treatment, 50X magnification. Upper: Representative images of tube formation; Bottom: Phase contrast images with the superposition of vectorial objects generated by customized Angiogenesis Analyzer for ImageJ are shown: green – branches; yellow – segments; blue sky – meshes; dark blue – isolated branches; red surrounded by blue – nodes surrounded by junctions [51]. B: Quantitative analysis of treatment effect on total branching length. The results were presented as a mean ± SEM of n=4, *p ≤ 0.05; **p ≤ 0.01.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/0d843e2c859d506ee650fce5.jpeg"},{"id":35293781,"identity":"f2b16464-6542-45f0-9b03-4091eb5731e4","added_by":"auto","created_at":"2023-04-04 21:42:17","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1091226,"visible":true,"origin":"","legend":"\u003cp\u003eNavitoclax decreases wound closure area. A. Representative images of the scratch wound assay at 0 hour (upper) and after 24 hours treatment (bottom), 40X magnification. B: Quantitative analysis of treatment effect on area of wound closure percentage. The results were presented as a mean ± SEM of n=3, *p ≤ 0.05.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/1499e3a680b0f8654d41bb79.jpeg"},{"id":35294256,"identity":"63fedceb-b72f-42da-bfe1-18596a881b8b","added_by":"auto","created_at":"2023-04-04 21:50:17","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":90636,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative analysis of BrdU positive cells percentage after 24 hours of navitoclax treatment. The results were presented as a mean ± SEM of n=6.\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/1f7e74ff31f446eae44577ad.jpeg"},{"id":35293783,"identity":"d7968443-7c25-45aa-931a-76fa67e50069","added_by":"auto","created_at":"2023-04-04 21:42:17","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":107181,"visible":true,"origin":"","legend":"\u003cp\u003eBar graphs demonstrating the effect of IL-3 and navitoclax on target mRNA expressions after 24 hours treatment. The results were presented as a mean ± SEM of n=5 (MMP-3 and BCL-2), n=3 (CXCL-8), *p ≤ 0.05; **p ≤ 0.01; ***p≤ 0.001.\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/c20297cc8ada3af41c6ae003.png"},{"id":39041939,"identity":"53de4ecb-be77-4b7b-baf0-69e33ef195cb","added_by":"auto","created_at":"2023-06-25 18:59:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1209060,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2759691/v1/680c8d8d-8d95-4106-ab66-f590b3639e7a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Navitoclax mediates Interleukin-3 induced human umbilical vein endothelial cells survival and angiogenesis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNeovascularization or new blood vessel development occurs through either angiogenesis, arteriogenesis or vasculogenesis. Angiogenesis is an expansion of the existing vasculature through the sprouting of endothelial cells that drives neovascularization. Activation, migration, proliferation and maturation of unique precursor cells are the underlying processes of this angiogenic sprouting [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This dynamic process is modulated by various growth factors, cytokines as well as extracellular matrix (ECM) activity. Under the physiological situation, angiogenesis helps to repair the damaged tissues [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], re-establish the blood supply to restore nutrients delivery [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and aids the placenta development [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In certain circumstances, however, new vessel regeneration drives the pathogenesis of various life-threatening diseases, including cancer and diabetic retinopathy [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Additionally, recent findings reported that intimal neovascularization within atherosclerotic plaques might promote plaque destabilization and lead to fatal cardiovascular events such as stroke and heart attack [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This is due to abnormal vascular branching, immature and \u0026ldquo;leaky\u0026rdquo; endothelial tube linings that will permit inflammatory mediators as well as blood constituents\u0026rsquo; infiltration into the lesion area [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Regulation of cell survival and proliferation is fundamental in stimulating other signaling proteins and growth factors for new vessel development.\u003c/p\u003e \u003cp\u003eProliferation and migration of endothelial cells contribute to angiogenesis, and this process is regulated by various cytokines, including interleukin-3 (IL-3) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. IL-3 is produced by active T cells, natural killer cells, mast cells and megakaryocytes, where at some point IL-3 will bind to the receptor on the endothelial cells [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Initially, the ability of IL-3 was identified to stimulate the production, development and function of hemopoietic cells, including mast cells, basophils, neutrophils, eosinophils, macrophages and erythrocytes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Nevertheless, the role of IL-3 beyond hematopoiesis was reported, whereby it could regulate endothelial cells proliferation [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], motility and angiogenic response [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] that contributes to chronic inflammation that is related with endothelial cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This evidence was supported by discovering IL-3 receptor (IL-3 R) alpha and beta chains within the plasma membranes of endothelial cells [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. IL-3 was able to sustain immunologically regulated chronic inflammatory response in pathological conditions via endothelial-leukocyte adhesion molecule 1 (ELAM-1) activation [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and endothelial cells motility mediated by IL-3 was demonstrated to recruit platelet-activating factor (PAF) activity [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Additionally, IL-3 and its receptors play an essential role in cancer metastasis as it is secreted by leukemia cells that enhance the survival and proliferation of cancer cells, ultimately contributing to the development of cancer pathology [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Besides, tumor-derived endothelial cells induced by IL-3 autocrine signal exhibited rapid turnover rate and high expression of inflammatory genes that promote vessel growth compared to normal endothelial cells [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Apart from that, IL-3 is involved in cardiovascular disease (CVD) pathology due to its ability to act as pro-inflammatory and pro-angiogenic agents. Evidence reported a potential paracrine signal of IL-3 in CVD via endothelial cell-derived extracellular vesicles release may hinder the cardioprotective effect due to changes in protein cargo [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Furthermore, a previous study showed high expression of IL-3 R alpha within intraplaque neovessels in advanced human carotid plaques, hence revealing the involvement of IL-3 in atherogenesis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Ergo, IL-3 is utilized in this study to establish the in-vitro angiogenesis model that mimics the intraplaque neovascularization process.\u003c/p\u003e \u003cp\u003eInterleukin-8 (IL-8, or CXCL-8) is a chemokine with a distinguishing CXC amino acid pattern that was initially identified for its leukocyte chemotactic activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. CXCL-8 is reported to induce tumorigenic and proangiogenic activities. CXCL-8 has biological activities independent from and in addition to its well-known role in controlling inflammatory reactions. Particularly relevant to cancerCXCL-8 is a potent angiogenesis mediator. There is growing evidence that inflammation and fibroproliferation have a role in the etiology of atherosclerosis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Angiogenesis has also been observed within atherosclerotic plaques, suggesting that it may contribute to the pathophysiology of plaque formation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. CXCL-8 is over-expressed in human coronary artery plaque samples compared to control samples from internal mammary arteries without atherosclerosis, where it co-localized with factor VIII-related antigen expression on endothelial cells in coronary atherectomy specimens and is the major mediator of net angiogenic activity of the plaque in the rat cornea micro-pocket assay [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Therefore, association of CXCL-8 expression with navitoclax effect on the \u003cem\u003ein-vitro\u003c/em\u003e angiogenesis model is going to be determined in this study.\u003c/p\u003e \u003cp\u003eThe expression of matrix metalloproteinase (MMP) has been proposed to involve in the angiogenesis that links to the advancement of plaque growth in atherosclerosis. MMPs are a family of structurally related proteinases that widely known for their ability to degrade extracellular matrix (ECM) and can also process bio-active molecules such as growth factors. However, MMP expression is not conventionally present but is usually controlled by: (1) cytokines, growth factors, and cell\u0026thinsp;\u0026plusmn;\u0026thinsp;cell and cell\u0026thinsp;\u0026plusmn;\u0026thinsp;matrix interactions that control gene expression; (2) activation of its proenzyme form; and (3) the presence of MMP inhibitors namely tissue metalloproteinases (TIMP) inhibitors [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. One study has suggested that human stromelysin promoter variation is associated with the development of coronary atherosclerosis[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Further studies have reported that a stromelysin-1 promoter also known as MMP-3 plays an important role in regulating stromelysin-1 gene expression and may be involved in the pathological development of atherosclerosis [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Furthermore, MMP-3 expression has been associated with cell activity such as migration and causing the development of angiogenesis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. MMPs are suggested as a new biomarker to atherosclerotic plaque instability. Based on the previous findings reported, navitoclax effect on the expression of MMP-3 which is one of the stromelysin group members is worth to be observed.\u003c/p\u003e \u003cp\u003eBCL-2 family proteins have been reported as the intrinsic key modulator of cell survival or death [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. A multicomplex interaction among BCL-2 family proteins, comprised of pro- and anti-apoptotic mediators, will determine cell fate [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Navitoclax displays a pro-apoptotic response towards cancer cells by targeting several BCL-2 family proteins, including BCL-2, Bcl-xL and Bcl-w [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Navitoclax has entered human clinical trials for treating small cell lung cancer [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], chronic lymphocytic leukemia [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], and other lymphoid malignancies [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Recently, it shows promising outcomes in preclinical studies of breast cancer [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and oral tumors [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Apart from that, navitoclax potency as a single agent and in combination with other chemotherapeutic agents was reported to effectively ameliorate cancerprogression in our published review [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In cancer, excessive proliferation of tumor cells and neo-angiogenesis lead to tumor metastasis, thus worsening the situation. Similarly, in atherosclerosis, a new blood vessel formation will deteriorate the plaque stability and cause it to rupture, eventually causing myocardial infarction and thrombosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. High expression of BCL-2 anti-apoptotic proteins is reported in cancer cells, making the tumor resistant to conventional chemotherapy [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Plus, a study on cardiovascular disease demonstrated an abundant expression of BCL-2 pro-survival proteins that contributes to myocyte replication [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Due to that, they are potentially an attractive target for drug development to obstruct cell survival.\u003c/p\u003e \u003cp\u003eThe atherosclerosis pathogenesis is comparable to cancer in abnormal cell proliferation, leading to intraplaque angiogenesis [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Thus, an initiative to include navitoclax in atherosclerosis treatment development is predicted to produce a promising therapeutic outcome. However, most published reports demonstrated the pharmacology and clinical applications of navitoclax only on cancer cells. Hence, there is limited evidence of navitoclax potency in reducing primary cells such as endothelial cells viability mainly. Considering that uncontrolled endothelial cell proliferation is the underlying process of angiogenesis, which leads to atherosclerotic plaque instability, a study to evaluate the navitoclax potency to inhibit the survival of human endothelial cells will be carried out. Subsequently, navitoclax inhibitory effect on endothelial cell angiogenesis is conducted in the presence of IL-3. Additionally, modulation of endothelial cell proliferation and motility by navitoclax is being carried out further to elucidate navitoclax mechanisms in deteriorating \u003cem\u003ein-vitro\u003c/em\u003e blood vessel formation. Lastly, the gene expressions of CXCL-8, MMP-3 and BCL-2 are investigated to determine the association of navitoclax effect with the target gene on each cell biological assays; angiogenesis (CXCL-8), migration (MMP-3), proliferation (BCL-2). We hypothesize that the ability of navitoclax to inhibit human endothelial cells survival is augmented with increasing dosage. Besides, the angiogenesis is diminished by navitoclax through the downregulation of endothelial cell motility and proliferation.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e- \u003cstrong\u003eMaterials and chemical reagent\u003c/strong\u003e\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\n \u003cp\u003eCell culture: Basal endothelial cell medium (ECM) (Cat Number: 1001-b; Sciencell, USA), endothelial cell growth supplement (ECGS) (Cat Number: 1001-b; Sciencell, USA), M199 media (Cat Number: 31100-027; Gibco, USA), collagenase I (Cat No: SCR103; Merk, Jerman), fetal bovine serum (FBS) (Cat No: F7524; Sigma Aldrich, non-USA), penicillin-streptomycin (pen/strep) (Cat No: LM-A4118; Biosera, France), phosphate-buffered saline (PBS) tablet (Cat No: P4417-100; Sigma Aldrich, USA), trypsin-EDTA (0.25% trypsin, 1 mM EDTA) with phenol red (Cat No: 25200-056; Gibco, USA).\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eCell assay: Thiazolyl blue tetrazolium bromide (MTT) powder (Cat No: T-030-1; Gold BioTechnology, USA), navitoclax (Cat No: FN16901; Carbosynth, USA), dimethyl sulfoxide (DMSO) (Cat No: D4540; Sigma Aldrich, USA). Matrigel \u0026trade; reduced with growth factor (Cat. No. 354230, Scientific Lab Supplies), IL-3 (Cat no: AF1418061; R\u0026amp;D systems, USA), basal media of endothelial cells (Cat. No. 354230; Sciencell, USA). The Calbiochem\u0026reg; BrdU Cell Proliferation Assay (Cat no. QIA58-200TEST; Merck, Germany)\u003c/p\u003e\n \u003c/li\u003e\n \u003cli\u003e\n \u003cp\u003eRT-qPCR: innuPREP RNA mini kit 2.0 (Cat no: AJG#845-KS-2040050; Jena Analytics, Germany), ReverTra Ace qPCR Rt Master Mix with gDNA Remover (Cat no: FSQ 301; Toyobo, Japan), Thunderbird SYBR qPCR Mix kit (Cat no: QPS 201; Toyobo, Japan), forward and reverse primers; MMP-3, BCL-2 and CXCL-8.\u003c/p\u003e\n \u003c/li\u003e\n\u003c/ul\u003e\n\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003ei. Primary endothelial cells isolation\u003c/h2\u003e\n \u003cp\u003eEndothelial cells of human umbilical cord veins were detached by following the procedures from previous studies [\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e]. The umbilical cords were obtained from the labor ward of the Department of Obstetrics and Gynaecology, Hospital Canselor Tuanku Mukhriz (HCTM). Ethical approval for this study was given by the Ethical Research Committee of Universiti Kebangsaan Malaysia (Reference number: UKM PPI/111/8/JEP-2020-006), and written consent was obtained from all donors before delivery. The cells were cultured in sterile complete ECM consisting of basal medium, 1% ECGS, 1% pen/strep and 5% FBS. They were stored in a CO\u003csub\u003e2\u003c/sub\u003e incubator at 37˚C containing 5% CO\u003csub\u003e2\u003c/sub\u003e. The media was replaced when it turned yellowish or within 48 hours until the cells reached 80% confluency. The authenticity of HUVEC was confirmed in our lab by the morphology of cobblestone-shaped endothelial cells and CD31 marker expression via immunocytochemistry. HUVEC from passage 3 to passage 5 were used in this study.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003eii. Cell viability assay\u003c/h2\u003e\n \u003cp\u003e3-(4,5-Dimethythiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was conducted to analyze the number of viable cells after the treatment \u003csup\u003e[48,49]\u003c/sup\u003e. Initially, 2 x 10\u003csup\u003e5\u003c/sup\u003e cells/well were seeded in 96 well-plates until 80% confluency. An untreated group and a vehicle group containing 0.01 \u0026micro;M DMSO were included in this study. A range of navitoclax concentrations between 0.2 \u0026micro;M to 3.0 \u0026micro;M was added into the well in triplicates. The cells were placed in a CO\u003csub\u003e2\u003c/sub\u003e incubator at 37˚C for different treatment periods; 18, 24, 48 and 72 hours. After that, the cells were incubated with MTT solution for 3 hours to allow the formation of formazan crystals representing viable cells. Next, dimethyl sulfoxide (DMSO) was added to dissolve the remaining crystals. The absorbance was quantified by using the spectrophotometric plate reader at 570 nm. The equation below was applied to calculate the percentage of cell viability:\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAvAAAAA8CAYAAAAAE46cAAAAAXNSR0IArs4c6QAAIABJREFUeF7t3QWUBM9RBvAK7u7uTgKBoAECIbgHh+Du7u4e3N2CuyY4QYMTIAGCe3B3eD8y9f6dZmZ3dmd2b+e25r17d7c701Jd3fXVV9U9d4q6SgIlgZJASaAkUBIoCZQESgIlgc1I4E6baWk1tCSwLQk8WUT8a0T847aaXa0tCZQESgIlgQuQwGNFxJNGxJ9ExP9cQHuqCRcmgQLwFzYg1ZxbIYGnjYg3i4hviIiH3YoeVSdKAiWBkkBJ4JwSeIKI+ICI+MaI+KUC8ecU/TbqKgC/jXGqVm5HAliTdx+Y9y+OiH/bTtOrpRcqgceLiFeNiN+NiJ+90DZeQrPICOj57oj4+0toULVhVQkgRl4nIr49Iv7wQgHt40TEa0XEb0bEL0fEfyyQAHz2UhHxJhHxsRHxBwvKqkdvoQQKwN/CQa0u3ZgEzKeXHRbcD4mIP13YkkePiOePiL+OiN9vDNZTRcSbRsRdIuIrI+IBC+s55HEOyhtExMtExA9ExNce8vAtuPdFh+jKwyPivhHxdyfuk/F/j4j4xYj40oj45xPXt+XiHzsi3iYi7hYRnzHI7L/P1KFHi4jnGubob0RE1mu+vF5E3CMifniYL+dqk66/ckS8ZkQ8NCK+aKMpfY8bEW809OXzI+Kph/XnRwd5/mc3xk84rFEvHhE/NqyR/7WSHtCtN4+Ivxp0zNrcXmzAcw9z9nciQnv/dkHd9Oc9I8LvT4mIf1hQVj16yyRQAP6WDWh150Yl8IwR8VUR8YkDC7i0MYw+tuk7IuLdIuJvmgJfKCK+ZWBmvnBpRQc+/wwRoc6fj4gPbcDKgcVs8vbHHAzqPQdH7S9O2Itnj4hPioiviYhvi4gEKow5Vh54OBcYxGxzKAGXS7nkBwNmLUACpAFWTO1HDUzoOfKHny8ivjki/j0iXj0ifq8R0tMPQA4ja76sBSbnjANG+CMj4mki4l0HnZnz3KXcQ+feMCJeZFhX/ygiyPPzIuLBgzzHWO5njoivi4ifjoj3WciEt7Iw/63F94qIt4oI7Rm7nmRYm0VgP2IhiH+eiPiwQYc4LefQ50sZ/2rHDgkUgC/1KAmsIwGG5oMHFg4LuHTzqvI+PiIs3oDKOwyMYraWs/BdEfGZA7O2Ti/mlcI4fdaQ0sGwnAtEzmvdae961IGBw6pi4k4F4AGvz44ITP+HDxui9cyaLQrwCsPYL2H35kpKn/UXKOKcXsJ4mx+Amf5/Qdemxx8Az2MMOcT/MrejR95HPm8ZEa8YES82OHjAfAIt80W0BtgzX84J4MkA4BTJweT2jPGRXT7bY88SER8XEdIRRTDIjjw/bdjcaW6MAXgO57dGxK9GxPuuCOCN9RsPTsXbRcQf75AEouMrIuJLIuLrF7SB0yAKd9eIeJeI+MsC8WfTv4uuqAD8RQ9PNW5DEgC07zcA7Z9aod1PN7BMFn9GiuGX25vgqQD8CkI+oohzAXjRF+H3+0TEg5p2AmTvFBGvMqRRncqBaEXzxBHxqREBGGNDzwlAp4ZIPrSoxAMj4r07AM+uvVpEfEJEvH5E/PqJAc8TRcQHRcRPDE73Vw/pDth4VwH4Iyba8AgnTbTRGDuNJeW5BQBPD0WBRAw4EZzxY6/nGNKFPmfllKBj21PPXYAECsBfwCBUEzYvAQwJA/7CA2D4p4U9Mi8x7nLc5dLLcxcKxn7mptgE8FJZfnu4z/1AH+CCpZFm8fbDRihG5Mkj4ssHkOGIS5+985C3j/H98yGK8HMRAZQI979gs2lMhEH+PQZK+NhGMk4LB0Pu//cPrGiGlQE/eahO5MEeyWVNNg0YVL7PpQlJOXiviHjO4R4h8sz39txrDEyiNBLM1g8N95P13Yec12cd2o2R1a42CmKMMGYAKGZUqhNZcLykGGDs7j8wZtJj3CenGQhzEoRoh7p7AP8CQ58ZZ5uX5agC3fYoyIUmX06XMSVvTC09kccLmJMHObYXdvn9h7xfbfmz5kuhe2Baeg3wqo/GS5/kO0tr0lZsK5bexs6fGb4jQ8CXDn360F99Iht9tbdBGSI+2E79xtiKNBj7/Nzz6tCPOw8pXjl+gAZ5GlN5y9hfG/reb2gbWRh77erbYy/H8w76pMufPOQ602FM5ztGxK9EhCNa6Qo2Uls4zHTloyPi1wZZcYC/c2A/gZ5Tph1wtoy3NcDc0z/9zj0wCeCNI72k9+aL/gJ2NifK33/dIfXH3MM80/HUKX22mdFcMmacKOvB90WEtKG3joh7D6eV6Lf6RQSUaU4ZJ/IkQ+lFnBqg2N4KsrFWYOmVbz5pg/0tZOoy35UlDUhKn7lEv/SHbmRqlfxvY2NeSduxR8T6oE3qMb7qUBddxJIbnzFHVJs4adqqjsz/TgbeM9pojXy5YU8OPbNfyBj0DLz1SPTK/KS71hUpavYGWP/U4XNEifx1MtQf93zuMNd6Bt5maeTKSw7t+94hvTDXLu36wGEu/cICPTRHtcMa8rYXlsq20NzV48dKoAD8sZKr50oCd0gA+AGkv2lIa1gqG4YGCPqeAUgBc3JAGWkg25UAHmBzH+MAEAFdAB6Ahr1i1LGRACaA9kyD4WdcAVjGEfBgcBgwYA1Q+MmBOfzBATwx1ELV8ottEAQsGD0G68cHoA9QAH4MDGCl3cCN3FtGVfnYY6c0ZPlACnAmRA4cABWMofsAMwZTuzGpDCEw6G/AlrEGTsjKDwaUwyCtSN4pQ9wCN0aQY/BsAyDh+PhMnQCLMpz2oE7ABfjo7+8BvBQO4e1XGkA/UJEpRsrWVqD1KQawA3SrQ32OGQXeyYtDlRfwAWwZK7Jqv+NoAOcvPciVowbYAHHC9ICecQUWyU3qBvAG+HvO58AYEOUHUMFwApXGgC5JA+EEfdkw1pwNOqXvxpIeAC4Alo3MgKpIkaPujJHxA7wAPX3XBsCanKWzvMUALrM9nBp654cjkGOtLfZ52JTI0ZEOwbEFXo27/tI3qWb0zVhkhIp8ORGcqGzz0nk59jxnizwBcM4zUAtQArH0kf4lgNcPgFseM8dPu80dfZI3T2eNN720SfzlBz205wGTaxw4hMbc2HIW1CNdBxg1R+mZtA1jQo7SsMwJDpO56ocjpjxytGYYS+sEh8icAuqVL02O85TlA8sceGudvmkz3bfmiDogCDjGHHmyoKt+a5exAj79Tc/cpz/GyDzAqPcndnHCONX02XrWRjTcb51MedJx8rSucC7MB7rTptDQP+sGmdF7zhN5cjSNg/HRdvK1YZwcgHgnweinex6lS6GxHnPeyI+e/0gXDdIua8jHDGUvST9D0DhSUlv0e0lZp5gLVeaZJVAA/swCr+punQQs6BgtYJWxA6SXXow7owI0MSaMA5YHewYAtgCe8QNuGGOGHmgFZBhjQEKqBcYJGDbfARtlZvkAeaZoAEUAGYPJ4ABsmLNkwBh6Rtrn2gb0M4AMq9QOhv0lBrDwWwMABXD87cJGaS/gCEgAPUAeQ4mlU57ngUdtVzcQgCHTBgYamNWHpxyAP8OeG8ts8tU+YJJjw6Fowa82MOCYLMYb+GO09ZVBJDvgXjsytxXY5ExwnoCBYwA8uYtacBA4U/qiHMAHaPUZxyQvgI+TRD7pAOR35MyAY1eNYTKXZEBOQJK6ADhAjTOgLHrDsTFWnEHADgAEctzDoQNqfA84pQyNA3lnewC7TKHhwAFgHC/gUzQAWARY6CuWPqMJIgaANB0F6gDAtj3AovEC/EUBOAKcROMInDqBAxsKNNJD/VQ+B7BPoSErzwCJxt+elLHTe+g7Z2WXHQTAORXmyFgZZMNRps/AowgEMGsOGQ/yTADP8TEvtck4khNHDIjm6HKiyIjekzGAitnmYGGAzTkADnDDXps79BSABH7NP9Ep//vc+KsToAVCrR/SUIBbwBRY5zCI0Jg3nD8Ojz4DnuaDtcV8NI7KN++Ubw0xBgA2YG9OqUf/XrspB7lhPdIPa6S1zI8jUc0BesUp0O9MkUldN95kod/tPodk4MnIc8ZF+8iI46NPyuJ4tAAe6UHuHCR9dK+NrtZtukQ3PWN+0meOMcaevnK6zZWcyyJ0+kuv6at2ipL2J+LQB20330QEloBu7eMI6ZNxqROpllrajT9fAH7jA1jNv3EJAFkWeyFvC3p7UswxjWOIAEZOgTO/GWBMFSDOQAGBLYDvN7ECQQw+VtOCz+gAAhZ+3wF8DDgWCrABHNJwYlSxntIUGHcXQIUxZKBzs9jUJlZMIiCurUB5XkAOQ45RBD5bAN+XL2UH+0WmjCJAAiAARD5vDSQACXhzeKR6MMocKsAFy4fx79OZgAXlASdAI4cB4AU421QVAMmYAqwZ/TgWwGsThwFgx+onACZvBh17376oZQmAN7YtYLXxFHDQn0wpomPAGhBHTi2okNrgRBXjD5TuA/D0CzMpYgCsGj9gheyxkQATIC51wtjTxV3t4TgARNrGOeT8mWOcDQxkMsb7ADzHTNswpFMAHoADxIzP1EU2nHLAeWzDsPnDuTBXfa+tmbaUJ0dN5cBbL+i5PnG4jIW5y7HMiEOmRokIAce5v0Y9HARRGk64sQWwyVt/U++nNrGSsTnFgcQ6Z6Qqj67l2GDp8/STBPBt+dh+Dj/ZcKSBcfMcgLfO9NEvQJZDCvznHLA2WCu0mQPZXvsAvHWr3cQqkuV/ayeHuAfwWTbd4Lxx5umk5xLA6wsgbr3jFHFk6KS1swXw/hdVNI/oOp0e20xrPhlX88PzSwC89hsTaT5sRHvS0TG2pp7ZuAQKwG98AKv5Ny4BRszijX1j7JaeeAHgYITlxQIFjCAW2oLNoGCvgNipTayexRpljjqQi6XyP5YNWABIMEoMv3zXtQA8llr9ADxACmSpB8MLNAORjN0hAB5A8Szw3gN4xhOzDEQAnHMYKU4N0IRpJ1OsJOCANXVxBowjkCElStRAvvISBh47Tg5kjwnd936ABKxY8X7T6D4GvgfwQC/nDYspJaZnCPXZ+HD4ODL6DJhwOMh1bQBPb3e1h00CgJcCePMIQw3kAMpL5+XYQqOtACM9VBcHhvwBWA4Lptp+kCkAT+apFyIN5rqoCuea3vtNVnTAOIgGWWdcSwG8lCoRCmVi0Tm9xlwExVygJyJe5goGeh+AB945xBjpMQBvDaNbIiMY8jknqZCrfQIAsDYk6J86hUZfrD9jAF5/RJYA4ExfE00Q6TkGwBsT4N8YcTQ4m2ObpTm0HCuyRFYsBfDWI86DtEfz85R7O27cuFYDdkugAHxpSElgmQQAPsBSTqb8zqUndCiPIcW0Z1oF0Ab4YqmwRg9pALx8VwygC3jA0jPG2DpGS0TAb4Y1c66l1AD0jACwnSk02O582Uym0Oxi4IXFGTFGqU0JAcDk3APewCqQDNyMpdDsY+CBfoYf054pNBhTP+r0PDDQnpMPbLjGGDHPaR/AD9AC1ULomFoGHRAjJ4CE3Pal0JCv/nGsAGCpC5w66REuxy9aZ7VPzje2naHPCwvfHzlqvI2NNBnj00Z1EsBLJQH2csNwptD0AB5okSYg1UW0JvOMOTLGRNuUg4kFZADeqRQaoFg/swzO4aEMvP7uag9AcgiAx5bS9X6sOWhYVXUBbUuB09gqYZzpOLbcvMkIEIAqYiDyQG/JTX601B86kJuh6SD9cr95wskgW+Wa0zaCYsqtCbmvI1NoOOOp++ZzptBMMfCceg6reWkOYMIBQREmETcOAmfP//RxKoVmioG3/mmzKBtiIFNx6GPKRR9EvAB8KTT5uTL7VLd0LEXhRB1EINJBTwAvykCe9NhaYN0kTwC+T6HhOIg4mEvAtrLGUmjmMvCZQmOtsVY8bHDG+vckkIW1u90TscTicBYyPcvav+RNr0vaUc9egAQKwF/AIFQTNi0BCzmAAMTJx13KiADO8iax5rlhlYAwwMLUGD9gANgGUBgOm04ZM+wmoCaFAejFJHMqAHQATygYEwZoSpPwnRNu1MkQALIMDWaw3cSK6ZGfm0Y2U2i0k8GWFgJ0MH7yad2rnmwf4IDlBRAZT4BDegZgg/0TwcgUnT6FJtloaSxyaKVrCCFLbwG2OSIAHHAPTCnTRkLOj36PATdOAbYQSMFMS0VoT7fBTGoPGctvBmySgc8UJwCIHG1CBWrJEJsnBQkABSaAeQBeG6QkaJ/2GxdASvQD0GSI+1Qfzg7H0Mkfyc7SA0AF4JaOAwDKJRfpAAC1G2BSZ74hFnAhGwDOM95MqU5RBW0FdIwL4IOpBry0nwNp/AA7YF+bAU11azs5yBFWBp3LFBqgCKDhgBhjeqcMqSEiL4ATwEsefXvczyEhW/OJzKdSaLComGLjre36DTzlngCRDnLVJxuxl87LsUWK3Dhm2supzjps4jV22GMgXsqGOQuQc+C0EwDHrhtbLDy5inyQgTE2D4E/P+ZOvhPAXCJD5QDE5MyJyk2swLD2ZLpPptBw0NRhMzEnir6ax8pzAfPAobXEPFeGdpnL2G/l0196alz8blNozBfzzr36TgfIg/6KJIrI2euR32u7ekQC3KffYyCejpjv5NwfIynKwcEhT2y99Uw9dDXPgTcu1hzOpnXGnLRe0Glrh++SgTdO9Flb8sSvPoXG2ORpVtZJ0TtzlYPhWXOtjXJxMMw1esBpWXpJAaQ3ZGqOLn3fyNL21PM3KIEC8Dco/Kr6VkhAiJlhspjLkT72yqMobcgDjAAibDpmDYBkGIBloJ4xs3EQQAHUgBmsLpAEjGJolAfgeJZjgZUHGoAdRo0hAiDzyEkGGbAFWB1L6HvGG2gGhhOcMk4Mv+ekeGD2sY+Mv1x5LBymEctHJgybZzgEAD4D7m9lAwnqA9I4LAC3t44yyoAmoAAgA9IYPu3Vzjx+kbyBEQZZdEKdWMzc7Jcgth+TfMEPwAEgJWuWfWbQtRnDSc6ADIcIk6a/HCH9dfydfmDuOQScDOOgrUCw/nG45P4qT/s5YcbB/2nwgdbe0TBe2Edjp44WgHJeACT1GRsOJBkBHWSgTjpAj6zxvgOiyVW90rOMH2BLvzhz2gxgAn76B4jTHX3GYnuFvIgFXTM2nue4cFSMH4BicyDwBjxru88c7SkFQn+0j35g+JUruiBi1bYnNyHb3EnmAJZ+krV+AMJ0Ctgz7+i7v4FYn2NYM01KPjbQunb6DGeB82ZOciDImo4Ah3TBmiB9xliQO8BlDLWfPMwTOdicObqKQc4ToDjAdJx+AefGyGWMOD7mHhDOeQaC7eUwpoA32WobAMsxp/90nWOO9SZ35fnN4dNmTgMdAaTpgPE1nuYhJ4J+ANH24QDp7tXWPGKSo2XcjbV0NjqhHcZV/fTEPAI0OX3akQBbv+iUaBXHa8zZpnfKI0fl56k+HBCEhblAjuThe/eSh/VEu429tuWxpuaKMkRu6Jf5aL0zZ6wFnGKgHPC2Thlbc1kUAHDnGEiJkdvut3HNtcCYkpvxt5+GbqhXLj79XYMtVz+7QLfYAdHHuq5UAgXg1xl4i54FHctlgcQMtv9bTI+5AArMAgMFFO1jkeQvMhz5dkKGcezCpgA+jJ0yGUKLFPaNQXFZIBgL16le2U7/sDiMtYXWZioLFMbJd5i+nmHAyPpem5LpsFFPugH2RTh4Ti70MePRP6ONyX7teq32GnXtKgNgSZn0KTx0iIyBuSm2hi64jmFzlE9PlD/GoAEUefLNUjkYez9jb5PksOhnf6b6VJ3u1/YxXTlWHuSQbVM+YNbPWTrDsPtun7zNZ44B54Re9wAHEJt6lftYv8kOkJ56Zk55c+6ZO8772jOnnF6/yBfgBxIBUs7lKdJn5rRt7J5984UOay+ncmy9119McW7aPrQdHCTzNM9U75/nlAP3+2zNrnq10XrEZo2lFPqeXdPHfaDW2gZM0xXj2W8kTjvF6ZnjqC2V31x5m/8cJ+k8iAypaUtkmvWSA6eBzYQxpmz83HbOvc+8StwwNW7aRn+NPf1iv/v11XfuIR8OnnvyeNC5ban7BgkUgF9PFYSledrSDbCo/f/H1JQbJJ3mgHGYs0BhCbCsWMR8qUlbd56rjdkSPsUwWtQxERgSrKEL6MI+uJSXC6c2WSyXvqxIuULNysaGAMIWaw4EFhMbbIJjMxIY5vFnWBcGOsGSPmGoLJQWDizvrldcHzMWY88wpMYbA4UF7vMf16qnyrleCXAMvexK+D9fWHS90tjdc+sH8C7VhzOP+e7PFi/ZbU8CNvSyV6KP0rqst2ObsS+hZzCVKIzokkgUuypSuJYTyUaz7ZwDtrM9vepU/Zd+ZA0S5ZHiKBVOlKZ1SJAS9kOJRrC90voQgqJEuWFZ+o/oDZKObWfHpZmJJI+d8HSq/tyacgvArzeUAK/FRQg0XwzT/n9MTQwSL1vunDDhnEVLbqS0B4ByDMAbc6Fy0QKRApOL5yw8CsjL6XYJvQp3uoAHXjKvWZiaQyH8v+QSglSn0KKcQ0wNpsUCgXEU/haOlLuZZ6t7RnhfSDSPU2vbYAyEQjGbQrdrOBm7+siZEWbF8gk3T7FaS+RUz163BBhsqVHmrHz3h163OHb2HniwrgEOiImxiFCJb5sSsNYifDC40oYulSxhN23UFWFATAGzazDvOWr5JlgpRQgrdexzDuAI7WKf+rZkBMNcGYsIiiraU4OssuEfUIcLWgCvTYg/dplT4TspeGy1VD823iXdziEM2m0/g2fYacBfqtHSAyC2qdkLWl0AfoHwukdPAeBVYXKYdPsmaTZnH4B3n3E3cXPCjAH4rNvvvE+OH+Bu0sk9PfbKNwt6Xm618jkHcmXlQnKALBQWanmGIgG8dnmXwHKeEDJWP6AjT1a41QbJNRfPvj5OhvaIvMw9xvBYmdVz1ysB89X8sAZUuHlaD8iIrAq43865Ymyxwcb3UsFezlVk2xzC7dCRylO02GC2E0m4CxvAD6IBCD17Kpy5397PpitLtIod61OazCl7DaRV5YsB7XNoATzsY38LB0Adol6Avz0GeeIRIsLpXiLt0gKtY/ZVSDnO42qlXNV1gAQKwD+ysKRt2BhiV7l8L8orpcOmEbISFrKxDiMmHGQneG5eOgTASwXhzdoABJhSYoATsAU+KbaNNMCnMJPNiLxZC4IcRRuObM6yccdEAB4Ba98D8Dbv2KFu97twG7bCZMd0Y7GlpVgAeb5y6HoALwdYKg5PW0RB2ItsTPQ8AiyPCQO4lSm9x/c23dkMlKcbaLuNSu1lc5zQmrQgITQXD19EwIaiHsDbQyCX0IkGvPddqUQYGrK0OctG0KkQOlmrc9dLXLSrPYqxn1pOQZC3bxNW+6KjA6Zg3VoSKAmUBEoCJYFZEoBDbEa3WVca6ZyXQ8EyMIIjQu2Rk3YDxNuQjzQT3bche18EGdZxfC073AJ4dhDRZnN2vlgLdgLURU3cLw3KBne4RJ3sKtzBaRApx973b+KdJZBrvqkA/B2jz2MEkikRsMtjBMx4rJRbCI+X6gQGwBNDTPmkt0j5wAwckkKjfB4tEA/wZkqI/E05ZsA1j5Z3ypMFECk94Gvc7KbnsTrhwibOPNIKgHevkJSTIEwOk8rpB0CwDWzSZNSrHo7CGAMPCKsX+Fe2Ce84L1608smC8+BZANtxhoB3Hi8m9w+YN1nbC2A2oaX5SI958PAlechdB7idIGCznNQdzIHNtvqA9ec0CZW75Bb2YD6P+RPG9GbQqTejOsZOyo7FbddlU6SFa2zjH3lwnEQECsBf80pafS8JlARKAqeXQAJ4pCKCqn3B1a7aEYUwBQAORLPTiLl8qd/UiV1tmVMA3mZ7tlmb4JGMjsBJsAPcwWYjQ9l8NjOjAI6+RVjK6Ych6jpAAgXg7xAWZtlZu8A0FtjFQ81j12zgoPgAsjxUoSnhIiCYRyyX/BAAr3zhKwwuBwHQpfhYbJszscjy1rDSgHACeKw7YJ/eqk1ugKqJIudd+7STR4s9dwmhAZmO7APsTWKRBiz7FIDnQSdzrmzAmqftxSSch0yh0UaAmwxMTjl/XjwCzHNQMOHtlQDbpOZItG+l5LxgCvSJ7NXL0SB7k5xM9MGiIxpisxBg34bejIt2yMXz3NSpJBwwdbh/12UXvaP6xlh/kRpOkuPdCsAfsPDUrSWBkkBJoCRwsASOBfAqEnUWkYdZAGi2S376FMnVN64A/MHDddoHCsA/Qr5SWgBO6TGOZ3KGa3v5HrDEzFP29DCx1P52njSgeiiABx6x+HZgY4NtIhWK4o1yErD6PYDPdklpkV4jLObkhRbA95tYpbjIIzdZgfI1Abz2SNUBrm1SEUazSEjDyZd1tLIE+PWVzLS9PccWuAeKbYCR2iO1iCPBk7d4cHg4WMZJKhHZcV6EAPPC8LuHUyEywkE51TUHwKu/5tmpRqDKLQmUBEoCt1MCjkbOt3FnD5cAeGU4rU1kXcYBgouNnbu/7hgAjxgVcbe5fIyBdwKNKL7oQKXQHKjHBSzuAPD5WusxAE/BsOTOS5eakW/7a8V9SA58+5ycNGw5NlzdJhZW2dUDeM6CU1p870gtABaIBKB3AXjMOeAu3HYKAJ+vCtcmYT0suZd32CHfXwC8/lqcMPC7XkQB0Nu46qQX0RFlO8caMMcmcG6k8gjd5ZUMPHk6wWcKwIsSZOrTrmkjosDx6Z06z9xjYDFETYqBP3DxqdtLAiWBkkBJ4CAJHAvgEVuZ8y6CLbPAu18yJ37OhtspAI9YQzwqF3kotZZ9lk6DPHTajJeYSZeRu8+W2yyL5IMTROFhhvbN4wcJ5VpvLgD/iJEH+oBKDLtUkEyhwby7bCb1PebY2zDbo9wooZSWYwG88+Klo2CuMelSRjLtpAfw+XZGb0aUEgPQj6XQeNEDBtqEMsa8XyDUEZBLU2ik/Nhxrrz03MkPGOZEcBL0QxvGjvpKgG3hwAC0KTTtPMyjqbDt+mhycz7cL1qSr/b2KnIpPXkZswTvNvpOpdC8yPGCAAAdYElEQVRYdEQiMPy7Ln3wBtGxvtQm1mtdOavfJYGSQEng/BJIAC+6DVDbf7bvRB62NG2yDazsN5ANNDtMQ6qr09T2nXA1BeAdmQmPIB+BdZthfYbp9wI6h2o49MOeNnvYpO9KSbXPTdaCvYccgHpnw4H6VAD+DoHZiHG/4Yxz4NOmDuefeoOaMFP/PeYYY25zqPQUJ5rYnAE0S+ugwO3/U2+cyzerYYtNRmA0vWETot3EKm3EGeyALE/W8U7SVni5LQOPkRZRsEOd5w1cy4N3MgwA3G9i1XabTuWZSz8xkfpNrD6Tcy4HnoNDRup3Go0c9DsPG1w5MyIETrwZC83ROW2xaEi1yU2svepiyLWJPOwBsAjZ1Q5wky8Ab/Jj5TklefH87c53nCSZzM3vO3Dq/N/tALzxcdIOedTxdcdIsZ4pCZQESgIlgTkSSADP7rGhbN+uFBj2H4GH9HIAB+yQp82wlV6QJbNAFBnOmWLi4RTMuYi//WvtC6TYZoQcAtT+swcNRKcyEZ/eX+Ee7VUX4g4Jyj5LF0bS2b93yiOf58h2c/cUgH9k5vbuA9vKE803evIO/Y3Z9T1PEzin6M4pt4ERgJXDBTS7VxgJs54v9zFJpHuMTQ4TTJ6Y5ymzt5C6AFVAFEB/yMComwg+A8g5BDxaE8lEcTqMXeUcDZ6y9nImsPh+5JFjqzkBHA59kX7ilBeTilcuB5+3LCIA5HMStFl/hL94+voCoNtoi23HBPhcHRwQm0uF5nalxjhSilwtJsBvf42dE+8e7RRFwJxzOjxPdu1bV+22B/ydDiSt5ZRePVbBmHBW5p4DP/UqdWfKcxhdGH9jfs7rpus/Z1/buqRpSecyb8jcy8Pm5oQubTMGijHkaI+dcrS0/HM8f7fhzafmoDWCc85pti9lzpuj126jNYwj3R6JZ56SczJ+Tvw6J1i46frXlvEh5Tmpy+EE8put9ec46xu5Qw/to5LeydYBjOxl/7Ii899+LPPf0YjauI/Rntt/GOA+Q53q9gbZ/rLmk4n54sCEfRf7wTYnDmB/9q1XbLIfLzfrX25IVo7FRlSKVvfzgp0FzAF3pBjbLC3VCXDItXzLLIDvPhtkrQXaCT/APcnsy1aAn6QhI0i1G7YwH+ek8OyTzdV9XwD+/w85mWCfKd0Yo+p7i4Lvx95cdowSAdtywxm8OYbFRHDtqx+D7wK217zG6tcHG1mdfAME7bosApwAaSw2svbRCaCAM2OBsAi3F0fESTwuqUTAT3tZrDlVHJ88hWfNvrdlcVpEWUQ1OEJz3g7ImHF8nBTEUWoXLiDDdxZBkY5zX1m/E3w4JXN08dxtPEV9Ik8Mi7lNH/cZxKVtYDSxUBwHG7vOCSgRAwDKWgbTXGa4nfeMhcv3S6iHI31Ox0TUToofVhLj2IJ4AE1I3/ohN/fUY9zryE3Xv1Rnj32efgBpLzWsa6feqGiTJtYXsHTuuDUMkSP91Bo9RiyZ/+YhG2xerkn6SClhixBjIsn9msrhlO7KliDDxkB0K3vAmFOgPOu0lJRz6/IuXUBIItFgk6k1xtrgZ+zNsMfq2VU+VwD+Kod91U5LIQJgheksKBajOSyLTS3O2beJBetxCFtnoXX1OXtYBtEHaT0Ww55tWLXjwyKEYcCcSOvZtwmHk6NdjvrEuPSykpJDHj6/CQCf9TOA1wTgsUciUN71IJXtlAYR46cOTiowObY5em09zfLon+gdJi7fO7G0LoCCwwmoCInrDwcFWKJP9g3NcWzXaAdQwwGz/iAAhOXzsjZIueMg3wSAV7+1Qq7vTdS/VL7HPp/pFcaF7p0SwGO8HTYhGm0dRQzlMcdSPDl1YwDe/DcXRWjo8poAXr1SPxE28szHSBHzxd439wL7u+wI4Ct3XRQakBc1qOtKJVAA/koHfsVuY90tfBZBLKac8LmXBSsXdfsPsO3HsL4WaQ6ETatSkJxcs3bUYapP8gKdDAS89Ed+9c/YM2B/AgBl/wS2pz0nvwD8XM1Z975zAnggg5MJxNnPckpnYUz/ABuOs+jPMXOtL3MMwLuHMyTFTYgfu7kmKBobfUwmcC4ixnmQTtg6oQXg150zc0s7F4BP++NIZm8az3SULQD4nC/mpPxx82WK0BL9lpriGGm2cx9pNHec6r4NSqAA/AYH7cKafM9h86uQJcbr0NC803tswgVkpLwc+jxxMN5yLTHv8u+mNgyfQnROvLHXwUk5jrvcdWFhpF8J8duEJLT8gOaBBPBYSwu1TT9AlnQjL93QL6FW7KKUBXJ7+JC6lN8DTlgcIXubju3TABjdx9HCNJG1fGW5uXL3OT2e0TYAD1OlnqyfQcQeqh+LKx9SlEBOpJAv5tPYMSpj5TOqysL6JmDFJNkwrd4Ekpw4TqAwrJA7mQJe2o5Zy1eAp8gYbTIUNncxgDZi2SuB8cN26789H3n8qM/1TTqFvSPCuD2Al3pmrwf5AtlOXPK2Yy9u86zULfLWbron+iKvM0GkiNLUhmbyvusQ5m+N7xx5yHsFiIASaQHGxJX9la6irfl2Z7plbESi7DuhB7kx33z1uX0rImdyUqW8yB22udw+DDoKSBhnaTL0h06Rsx+ymwLwbItN8zao2adyrHM+d86KajhBzBhxHESwONc5DgngOU7erm0vjeghffNZAib6ka9+pz/Kwpr7np6QjRxk89N6Q/844XRG3eYAJ0IkguylE3Duyde8Jzd6bE451k9EjuOR9VsDMKzmL6fH3DfO5uZY+eY7PbafKde93K9FX/xtjeXMmEPa4a2YxgWBIsWFLpFXu27SR/c4othY3n9YM7Q5TwFzmMF9h7nKaTJfrAecJ2uh+dEDeHVbMzHx9JEOkad9U/LUpU1mO8ibbopY0jtyRRiNpY4iRJAjxsdalOtMC+C1y9oqjdFaRJ70coqBN5b2pkl1syZxfI0VmRlTdSJjpG1ZD63J9IVM0oHoGXj1ewu48uiPOSZiRMbkApSThzzzMQebnll/5NObk3PeoDp3DtV9G5NAAfiNDVg19+IkcJdh0QZcgd8pRjWP1QJkLc7evAs4A3T5DOMNcAJemEubkJULQFncgUnG2kbkPIrL/zbsAm6MvHcDMGCcBc4QIAYIAKRAhfZ6eYbTf9QB2AGnDAtD39fPoALI6hcC9qz7GGzA2h4Exp5BA2SUbw8EYyyUDVRilDhWypBOAVQAdyImmfIghYVhTMCnPPcw9NruuDMRiz4EL6oBjHvnQILVPNaMQ0k+ojPC2AwwMO8oWKDNd8CZ9vcpNMqVciGixEFjTI0PEGGPhefIweY0AEv5XqzmewYcmOh1AegjX0ZfW9PIAzn6yHADohwebRNa58TcewD82qGf9xqADN1gzAEQYAjYchwtoAgA0i0AUNuAUXIA2IFG46Z+40GuxtMmd+CW82RTmzYAueQmn9iz8oVFuOgCOUhj61NocpLa40I2nLR0eE4xgclV/+m9OehEKECTo5vpOwngzSnAST4yHaODZKSPwJ9nOBz0DJD2nLkBCJqz6srTrYBJziyniK5xEjmQZJcnb9BvIFRE0LgA72P10xeAWyqS1AgOlvKNPUdXrrPytZvjpyx1cAQATU6k8XMhVYA7cvCZOQWE6lu+s4NzQ1e9NA+IBGatOy1opFfmMD3Ml+KRg7WHfOmwua1dgK52cSTIyP0PGwHwUljyzd30hpyBUn31nPHIM8I5O8C6ss0185z8pPi16ZN0m1NBjzlx1prsRwJ4TgDQqz+IC7K2Dhs79/YpNMrymXlBLtYu/2uzOUwmytIuzg8Hxx4Q42UuWxfsB+kBvDlBj4B+60TrjNjbZV4at6nTZawx1lffc7jr5LNTrCgbKbMA/EYGqpp5sRIApoFaCzJgNHWWLqPKmDN+LgAbEMN4Zh50AkRMGePFAFjUGS7gCfsDkGOtgArGDyNs07UyGDHGUZl5mhG2iYF2P8MDrOfmXwYEyGTQGF9GmVFXPyPDAWjr1z9MM1AEYLjyPQRAgs8YGAw0hl8ZLkCccWOcGVEn3gDA+gMMuvQd8AaEGCa5nQAkeQIZgALA0EYsPAd8Y0Gdcww0kIPysW1AnZNlsHecEKwb0IpJBkgxiByqYwC8U5T0HcjDgEufUg5dAECAjD6Ny74PDgHnAfOb0Sbt9RmZkEc6C+ThHGV1KZ8zpf2Yfg6b3+rmoBl7R7j5HzABtIFnciQXz5ExpyQdF/WwAdhPnwFxgDZ9At4yuiPtB/gDjPQRIAdygU1gdQrAY4cBWnoAMI6d7sFRMod2XXSUrqt/zEEGivSRfrpPu4yLNgOw+pkAnuNBX8gMOw58kZf7zUksKj2lh4AhOXJMgWgg23eO41Om1DlzioMkrcH9ZG4ucbb8Nh/oJJDrOw4WPQa82vrpi3vJ/YFDPzlk5qq5pR7fcVAAYwCdo4cFpgucEN8BluY1oCzKIMpCvmREFvqJELBO2LvkO/pFLmNvzs5zwumXdgHZ6RhYl6wH2oEQIBPOiggQ2QPbPQM/B8Dn2831y7rBMVOO/gDiNtsjLRKkaxMHnJ6KnrSblxPAA/YcNM8ZJzqgjXTfmqTsNgfeWojc4DBpj+iCuSNaYa5qj/VLnXQCUWFtpU8AtvbQsRbAm4uZY29979lz8z0jHfmyo35eeHmg9ZEDoj3nTMG7WCN8rQ0rAH+tI1/9XksCDGaeYMAIt8Yj63AP8AVIAnDmHVAKBAFdDG+C2H4TK4YHKGR4ACwMD3AKYADKADdDwSgBGE7iYJTybcHAodQUxlB4F2BigBgIYK01AGObWPv6kzUGSIAbjDFGuwXwbfn6qo8YLMYY+HBsGwOH3QIK2guIEUVQD8OqfdoAWOl/OgX5TJ6LTL6YOgw1Jpvjwdj24XZGmUyANeDyWABvTLRF3xn5zPEG6oAU4L4/Qaln8BNAkwcAzbmzubm9AE+gHrNJrrkxjw4ADvQI0AawtIV+CMmTGZYO6J0D4NWNOWw3xQHrxiJfnqZcoX8ACvOLicZoTwF4R9ABGUANJ3LMuVWW/u+yRfqsDE5ynx4nmoMtNZfcAxgDqz4DZDlKdGgqBx4YMi5kRPeAMuMGnGJYHYkJrNFVPwAkHXbpn9QUUQuAUD3khRnX3zbvf2oTqzYCh+rnDLmsF+7H7pMzXUoA35dP3+ghZ9XaAZBbF9xHX1qZc/bNefPWuJGldUNKh3XE/OrnC6cTeUAeHEyyAtA5LO2eHyy6upEU2H7z/VgAb14gHDgbHB5rgc+AaoCZUyFXPAF8MvgcT3Oi7fNUDrwyyI3DoQ7rx9gmVvplzZSiSVfyFKME8KKGHANyA8Ct71j0FsBzwjg42seJIjtOT39x6MxZzpS1a4xd5xia40gRzv0a+1jWsoVVzpklUAD+zAKv6m6dBCzwwCtwCsgA2v2VgBEDnG+GZeyALos7Ni1Z1x7AW9QZYmweA4u1lUPtGeyXdAxGiOPgWQYLC5svsMqQa567fyiAV7/0AiBR/YCh1AmsFDCAEdKOQwB8nufvmQz7p8yk4AALjKvfLWuL+R9zkPK9AphRRpbx5xgA6ORqjBg9rCOggi0D9gG+YwG8cSNvRhn4ag0ywwvE9/s5pgB8ygMQAEzaizyAd04iB0yZ+kN3AGgs7akAPEBCpgCFdBxsbjL2GEsgbReA9zznRvunADxQiVnedRlDMh07Zpf8OWP0JI/UA6w5jdj4PNpyCsB7lv4aQ3pBlzJP2phmlEF/sfAcpnzvhLYDXIDssQAeQHf0bW5IVA+gKgVDZCz318wF8Oa36BcHM/UlZWs8pOFxODiM7SldnDNrRg8IORPmO5DMybPGkXU6k5wBoJZecNb0xc8SAJ9sOzYdQSCCke1SN3KidY6OAfCcXXKyBo0BeM4rh82YW4c4Z1hv+tIy8HMAfObOS2szXzkZ1u1e1kgRDDydGgPw5gkyxnw3H0/5ksJbZ6hvY4cKwN/GUa0+nVsCmWMt9YThbS+MpTQWDLLFP4/YBIwxNQAIAGdRBvAs3sAlY+iSs4r54hgw9gwYhsniLwUHOAJa5ZBi2aWSYOClBbgwRxhcDB1mbh+AVz8Ao351qJ/Bwg4CkYArJtTfGLyxFJp9DLwUH+3FsHECXLkWaZ/2Mq7tOfmMOiM6xjgxognE9JNcgAoGLuWfYX1ymZNCk4CPcTce6hYOB6SULZfeuHDOHOmWEQ/9UOdYuoiUEgydSAkZJQOf8mCU863CrTykTUm/yBeTAY4YPmlZHCipOnMZeO33LKa5TaEZY+ABBuOjfOw8HTUOHAdjB4hgAacYeAAU+MfgYh1PsblcpEU0gmzy2Ej6AAgDgOQjBSbHk2NonhhPMgZkMeB5DKw2+k4ky/zkoAB5ACk9wNz6jOz0DyDmCHJuXfsYeKlbxp9+qN+awUkz56TB+FxdWOexFJp9DDzG3Bw1zmTO6UldIhfrkwiDNKhM4aCvrrF0DOPNiQFmzS1pJyKNZGrt0h5jrC7r0pwUGuyxOcPJ4jQBrtYw+kanyJY+qsvcaDd0cl57xzj3gOg7h61lrpOBF6kgYzqcUTvrizYgVloGXv30m7MmosCRm0qhmQPg8xhJoJ38RXCkUVkz2vVMhFaKoMhPH8ExPpwlER/lWX/WeuHUue1l1beSBArAryTIKuaqJcCQMcSMC5a3BSrJYDGWmKzWuFikAWBGArAD4IFjCzSAzFABEpljiw21wQ0jlPnvABZAIS+VMQLyMbmYZgaZ4QVkGERgC+DEzDGYgGGfQjNWv3QbbZVX73sARL4s5kt/AeZk4DO/Xfu1rU+hkRYjHx34ZdAYTmy1z8gPm4mxktfKyNnwB/iSA7Z+6g2/0gAYNREOjkq+UVGKAMBgsxpwwRHChGlfptAYIwCEgSQrQMSYMqTAQb7cBRsH/AKM2g9ocRxEQ8jSeOmHOjHpPdDgtBkXoA/ATBbRMwC98fG5PtKFlAd5A1nGEAARVZEaArCqW33ahPmUSjKVQsM5Uj+WTz3aozz5wRwALHB7drpJzVmRykGPMLf5VmdsrvaIiHiODgPyGWHyrDc8ilJoo7zgU4T7ja32AZXtG5nNK+kpQBu9sNGTU0rGxg2wpVccIz8cGn2gE7mfAcAD0gFY+gX8A/zJPgOh9CgdUfJUhzQo8m2PAswUGqkUbf3kY54A3X7IX1+MvXqVkyk0ynev8UuA16fQmDccFFGITLUTVdAP6wRHAygWedJX+s0xpQfSp8ZAvNxu64U9F9YpQJ7u0kOAUnTPeiA6ZzykGSUDrx/aL62N40c/zEXtoHMcZASIfmbEw/qpDHNM2fTf+mlDtTq1u11H6b+1AnHBwUpnmg4mgDe2wL0+At36Tz99pi/Wb/NDOzkt5Ot/c984WuPoSKbQKJdekRf9n0qh0Tdz1Tph7SRr/+tDf6KOseQ0ujfffJ6GVZus74gIbaajp5hPV23It9b5AvBbG7Fq7yVKALgCgoBRqRqZyyoMC0AAOjZTCsFK7bAYW6wZCaCLEWdsGQULOCNjgyWDxshIDcBi+p7B9D2QgH0Ubmf8bPRi4LGEngH2/c9gMIKMh0s97sH0MhTt672BRgxRXz8wqn6GjKGWwuOUGWDDGsKA5dni+out1Q91uTgg2ESOAKaU4QEi9F/9QuTyrNUNpHvJEQMPRGP6AGFyA7SmzvcHHjD3yeLlxmDtE/1geBlZjg+ngKE3PsbEPdoC5ACqeQIEp4TTpW4/mDOg0NjoG6Cgv8kSYsTIxfM29I4dieo58gN08hhJ7aA/2qCOMXnQIUADWyiqAqSTKzY1QYHcb44c5wUAAhQwuYCS8ddP/QVmyFmuNsBJb0WJjA+gBszlBcQAqMAuppW+ZVSGXshJBkQAXDIGchJcAaDkB7DJh14TcABtytd29ambznG+AE5yBr4AZmME3HMi6IDxJ2fMt7QsOs0RoT/mJhbU3DE3yYPTY4wAJ7JzRKJy6FWCb3ODA8MRNC8ASvsxUgcAeADdeLT1c9bI3ZiLwGgz3TEHzQnjyTmkd6IJdIT+KZ9DbQ4DyOZG6iT9AEitF/pJV0QJgEYsL4eKzmS6H12gs9atMQBvTmkHh8WehdwnAQgbe/PVZ7keAOqcH/3iFKd+aBP9AMTJXLn0WX+Urd1Skegk4E/eACsdNz5kJLJA/n1+ONlwsBAc/TGSoiuYfTrAYTDPyUGakTFy6pJ1SWTO2kiW5oO2kJ/6yQpZQeZ0jgOrf8ZXNINjYxwQKHTd+HjO2kxPpb4YKxcHi25xAMghU4TYDs6RPpBJO184T/SXvMypU79X4RLtbLWpk0AB+FKJksA6EsB8YbYt8ELhLvPLwou1BO6Az8wjZrww2AwVxgmQYDwZBgs38MoASwPxHYMFXDA8GGP1+Q5wALjS8DKqQtIALaNnoQcSMmSf7fG59rSGACjy/VT9+oTZw2ZyWhgegER92qE9/tZf5SYQBP70xb3aoq367XMycAHWHBbfKVv7fa88wCJlMDVaZA0kufrXkeuXeoBN36kHICMrf2eqEPn6H9vnM98z9mQNTAFC2Mw8ftGY5D3GRRv1L58faytGDsgDDtr3BsyRh3EnD46DsQUitZMu+VwZPjcO9IcMXf7P15bri1QDF0BDH405eRhDfWgdD3L1jHGnm8bUfTlWnvM5GWsPnTKGADDQQt6cj6nTmY6dfdrFkVCP+oxNyl2bfGdsfJd6Tkap2+7RXuNFBnROP8hYX33mh5OVqQr66B7yUA49IA/zt20P+ZF5br7UR2PTzu2+fveYN/SIrhob/fGM8pWnbfqrfONkjpkj+pnz3L36ogzjSjeURQbZTu33nH04xidlMOVg6Zt20Kke5GuP9cDcsR7QDXX7rc6UWasfynOP+Uq++kbmZNLOP89oJ5nQH+WnfvV6ozxECKeUs5E6nPpLtsonQzpBfsrSZ5/Rl3b+W6/0mQMLiGuXvpKt59zrGeVrP13SBmXlWq/N/dxSX7tGkr1xIVusuz5yOPsXOXEcOV4iBNj3On3m2JXjFj1XAP4WDWZ15cYlYDMcVsbGK4x7XSWBXgLAFkYbOJF+kXsibpOkgFUMJhYSm2gurMm+3yZZVV/Wk0Cmq4gAYsG3kiNuvohAmC/SH0Vg+tx4EQIRFCz8Vvq13shWSaMSKABfilESWFcCmFXsjbBxe8rDurVUaVuWgBQPqTqiDlIwhOlvi1HGUtpc62hIewjk+xd437K2bqvt8sSl4kgJkm5y6Wuw+SK90NGbuSG4Zdcx/dKW5OBLx2n3mGxrZKq1q0ugAPzqIq0Cr1wCUi6AeBvN5B1XqPPKFWKi+9IC5FBLZ5DzO5XbvzXpyYeWJ2/Dq1D/bXFMtjYO19pebLY9QF5WJUXt0jd7aqu9TDb02z/Tzxcpe+yJgwvk74/tq7nWsb76fheAv3oVKAGsLAFzCoixaUqKhGPS6ioJjEmArsjNlUt/W4Bu5p2vnfNeGlQSmCsB80q+O/Lk0vVQO0Woxtpp/4KN6jZV2+B/6X2ZOz5130oSKAC/kiCrmJJAJwHHKdo42B5tV0IqCZQESgIlgZLAHAnYFOv8eSeOVSR3jsSu7J4C8Fc24NXdkkBJoCRQEigJlARKAiWBbUugAPy2x69aXxIoCZQESgIlgZJASaAkcGUSKAB/ZQNe3S0JlARKAiWBkkBJoCRQEti2BArAb3v8qvUlgZJASaAkUBIoCZQESgJXJoEC8Fc24NXdkkBJoCRQEigJlARKAiWBbUugAPy2x69aXxIoCZQESgIlgZJASaAkcGUSKAB/ZQNe3S0JlARKAiWBkkBJoCRQEti2BArAb3v8qvUlgZJASaAkUBIoCZQESgJXJoEC8Fc24NXdkkBJoCRQEigJlARKAiWBbUugAPy2x69aXxIoCZQESgIlgZJASaAkcGUSKAB/ZQNe3S0JlARKAiWBkkBJoCRQEti2BArAb3v8qvUlgZJASaAkUBIoCZQESgJXJoEC8Fc24NXdkkBJoCRQEigJlARKAiWBbUugAPy2x69aXxIoCZQESgIlgZJASaAkcGUSKAB/ZQNe3S0JlARKAiWBkkBJoCRQEti2BP4X0VwdPFkao74AAAAASUVORK5CYII=\"\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eThe line of the best-fit curve was generated by Graphpad Prism 8.4.3 software, using the non-linear regression (curve fit) of dose vs response. The drug dose that reduced 50% of cell viability (IC\u003csub\u003e50\u003c/sub\u003e) was determined by Prism through the best-fit curve generated.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003eiii. Angiogenesis assay\u003c/h2\u003e\n \u003cp\u003eTube formation assay was conducted to study the endothelial cell angiogenesis by using a \u0026micro;-Slide angiogenesis system. First, 10\u0026micro;l Matrigel \u0026trade; reduced with growth factor was placed in a well and was allowed to polymerize at 37\u0026deg;C for an hour. HUVEC were seeded in the well containing Matrigel at a density of 2 x 10\u003csup\u003e4\u003c/sup\u003e with the treatment of 25ng/ml IL-3 and 0.9 \u0026micro;M navitoclax. Tube formations were allowed to occur for 8 hours, and cell images were captured every 2 hours. The tube formation potential is calculated in each sample as the total length of branching using an Angiogenesis Analyzer plugin from a computer-assisted image analysis system (ImageJ software). Images from at least four random fields at 5x magnification are examined from an independent experiment.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003eiv. Migration assay\u003c/h2\u003e\n \u003cp\u003eThe in-vitro scratch test method was carried out to determine endothelial cell migration after navitoclax treatment by referring to the protocol from previous study [\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e]. 5 x 10\u003csup\u003e4\u003c/sup\u003e cells were seeded in a 24-well plate and incubated until they reached 90% confluency. The cells were then scraped by 200\u0026micro;l pipette tips and the floating cells were washed with PBS immediately. After that, new media with treatment was added into the well. A constant pressure was applied during scraping to reduce variation of wound size. Three wound areas in each well were set and captured using a live inverted microscope at 0 hour until 24 hours. The wound areas were determined using an ImageJ software. Then, the area of wound closure percentage was calculated using this formula;\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAgMAAAA3CAYAAACRr0nFAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAACAMSURBVHhe7d13kGVFFQZwij8tqKKIIkEJupKDKBkFUZEgOSeJkqOIgIKAoJJRCQZyUKKAKBkFFVByzigCghJUcr7Wr5kz9F7uLLO7szgz73xVr3befTd0uv19J3TvZE0ikUgkEomeRoqBRCKRSCR6HCkGEolEIpHocaQYSCQSiUSix5FiIJFIJBKJHkeKgUQikUgkehwpBhKJRCKR6HGkGEgkEolEoseRYiCRSCQSiR5HioFE4v+It956q3nqqaeap59+unnjjTf6jo5OqOuTTz7ZPPvss+XvxIRB+/3zn/9sXnnllb4jvYloh9dee63vSGJikGIg0RMwcZx00knNT3/60+bKK6/sO9o0N91001jfr7322uYnP/lJc/rppzcvv/xy39FJB8/4+te/3kw77bTNrbfe2nd0ZEIb/+xnP2t++MMfNrfffnvf0Xfx/PPPN1tttVWzwAILlEl8OOPNN99szj///DJezjrrrOall14qxx977LHm3HPP7f/+wAMPNMcff3z5+O2DwGmnndbMOOOMpWwjGY8++mhzyimnlPFy3nnn9bdpDWPqggsuaP773//2HXkHxOTPf/7zZtZZZ21+85vf9B1NTAxSDCR6AiYTpDvVVFM1v/3tb8uxt99+u1l33XWbOeecsxAV/OUvf2nmmGOO5jvf+c4HZnH89a9/bT75yU8WYTKcoQ3//e9/930bG8h98803bw477LBCjEsssUTzpz/9qe/Xd3Hbbbc1Sy21VPOPf/yj78jwBLI544wzmimmmKI5+OCD+8cCoTjZZJM1N954Y/n++OOPN8stt1yz8sorN88880w5Nqlh3H7hC19ofvzjH/cdGX5QRt6uV199te/Iu/AbQbX00ksXYePvxRZbrNl+++3Lb4HXX3+92WGHHQrhP/zww31H3wVPmnYnFhITjxQDiZ4B0v3Upz5VCAm4rE3ks88+ez8RP/HEE0UgfFATO/ztb39r5p9//mEtBkzS3/jGN5rddtut78jYOPTQQ5sNNtig/O3cXXfdtVlxxRXfI6h4P5Zddtlh7xkAZLTSSis1J5xwQvnOW7Dttts2H/nIR4rgAaKBt6NL+EwqaN9VVlllWIsB788yyyzTXHPNNX1Hxsbvf//74nkB9TnuuOOKKH/uuef6j5166qnNeuut1yy55JLNI488Uo7XECZZffXVm1//+td9RxITgxQDiVEPE9Jll11WJndEdNRRR5XjPAQHHnhgmVhNRmBi2XvvvctkBHfffXez3XbbNRtttFH5hEXINfm5z32uufjii8v3sHS4O8FE/dnPfrYc9zcLxr8IBUyGm266abnnV7/61eZjH/tYc/PNN5ffavzrX/8q1pMyrLDCCsVlrWw33HBD+c5qveiii/rrZTJVfvdFXDGJssSFSb72ta81X/7yl0s9o44BlpYyHHTQQUUQbbbZZsXyhXPOOaf5+Mc/3owZM6bZeOONSxglwPrThrwpgV/84hdF4MT1gVtuuaW0m+cTDF/60pfGmsyRyLe+9a1mww03bNZaa63Sfgj3nnvuKdbw4YcfXs5zn89//vPN9773vSIs1l9//WaLLbZo/vjHPxYC2XLLLTut0vGB9tl9993L/YB1ShApNy8IPPjgg+VZ4cbmOdl33337y//LX/6y9LlwgnZXXrjjjjua5Zdfvtl///2LBa1NfYyLHXfcsZAcL1WAkGU5u+8222zTfOITn+gfswHtdOeddzY/+MEPSns496GHHiq/HXHEEWWMGK/6lwjWhtromGOOKULOx/OBp+zCCy8s9de3xF6M3RrGl+uNldVWW625/vrri7ufaJx66qlLn2299dbNvffe23fFe6Gdee3WXnvt/mcQxsb8JZdc0nzmM5/p9AyEGPBeHXnkkc1XvvKVsbw4/iXktOs666xT6q1sL774YmlL74i/1VV/er73x3nKffnll5exaIwqv3dDXVznffY7cauMowEpBhKjGiY8kwovAOy3335lkjRxmrDkC+yzzz6FSExK3/72t5urr766nMti50kwoSDKY489tplnnnlKrNMkiozDQjTJLL744mVSAiSODPfcc8+SF0B4sHzc86677mo+/elPl4nZfU26YsDKWkN59thjjyIWnCce7zpxVOVH9gsuuGAhDaJmk002KZOecsJee+1VvoNJDMm4jiufcInQSEDZxPPlTaiPc5wLJmlCwj387T4B91l00UX7LWhA4ur/97//ve/IOzB5zjXXXEWYEGcmXtdqTxMz4tlll13Kb4hJyOaKK64obeE4IgTP12cmZr+dfPLJzcwzz9z86le/KoIM0b7wwgvl3BrOHejTBRO98iEJz0CqxAtrVXmJsxCX2mzNNdcs4035r7vuutLn+tn9v/nNb5a+BOVHSAgIiAbnIhhtob+MU9DfvCyEhPsSIHPPPXd/PweICuPDeHIewjIGgChzf21IMBi7nqX9Q9gQlQsttFC5D6uc2NK3f/jDH0oYi4CpoQ6rrrpqc8ghh5Tv7q3+jut3ZfF+GS8Dta/j2pMQiZwLbW2sEYCe6T5d+RjaicDyHhBhhOBHP/rRIkjcl3AUkvLuE4zGs3cdvI/xLjlXP3q3PVv7ug8hwItoLDnf9fIUgPAlPIwx77i2HOlIMZAYtTCRceHWFreJ2UR63333NTvttFPzn//8pxxjxZskWX5h5bFuF1544X5SEUIwKUaMkvWFoAFZIzLJUMDCXWSRRfqTm0xmiPbPf/5zmYBZMTFBjitMYJIjPkxKP/rRj0p5It6OTFilQHBceuml5T4I0cSIpFjziMAk5z7I+Pvf/36J0ZoIa6iDOrLCeB5YRGHtKysi3nnnncv3GtpQ3VikAWJgvvnmK8+sQfCYVCNMgAiUBbGa/JF/hHEQ2he/+MUyKcMBBxxQxAgoj0k4iIz3RJ4CaxEZqXNtybISkRaC7fqwHsPrU0O/6XOeJZO/cIA28iyiSV9G4ifrH+HqY4gxweoFzzceA4QpMQM8LwQGQQHGlfZXB0SjLaPf1c9922EC5zqHta4MhEb0F0I0NtQDtL9jvAX6zXjxHiBB/+oPhK5PlG3eeectY6INotf41Xa8CASIftNGLPrf/e53fWe+F/oQyWp7ng/QZvrYWNPWcjSIRyLM+K+hr71HxA9YlUO8EyDaqPYkeZZ6es/97d7+jndAuxiH3hNlMUcQFeC+xrj6Ed/uqc6OgfN50rq8FyMJKQYSoxas2naMG0mYdBFMWL0IyzEu2yBzOPHEE/utViAKTDZnnnlm+c597BwwwbTFAMvDZAeey+piLfI+hMUOJhOTbZcYQDjc/iZFlrB7mJzApCnBKuDcmWaaqVig6vLd7363XEcUhQeEJwMB8WKY+GogAJMul7APgncPUD/WGuuvDZM/C7Fua5a/Nm0/gxjgog5PDWFlEkaCSFX+RriUPVMbm4SBMAly85t61mIAsQ31cjsEqwyEl35QH89GtISjMsT4ICZrMeM8oSDXAhGmDQPqU4sBIimEJy8LIYQcCaaw2AHRyWVoiwGCh8vecxCWdo22097Gbk3OiJA1zMVvvBBb3gmhBX3gHRGKcI86ryagfixq9TDujX/kbDwY78RAhB26oCz6M+oFRC3rm8hSJmJXjoZx13bHR5ggxAABQizz7Ok34SjtAcrqXSXilI/48XskxPI+hQeImDL2u+pLaOszYzuMDMd5bYyHkYwUA4lRCRYScmhbeyYCk7sJJqwkkygyQ8jIOsC6YumFhWCSMSmzAEwAXKIIAhC6iSiWe/EumFxMMmCiYpkhPMupPCtI3SQ3yyyzlPBBDcTAuon4POL0jLhO7JqLNBCipo41IwHChBUUsXkuYGVrrwww0REJ2kj9tEnbM8B9De7rWICIQDaEh+PaGLm0gSg9IzwDPCcxQSunSThi4axy9+TxAPdDOOA5a6yxRr+lzc2uju4z1FC3aaaZphBUAOFOP/30RWwFkKvyRthAGyHEICsCC8ED4cWzJLQD+lb5I96NEHkGQJsRGVdddVX5ziploYZXKoB4PT9c34QI7xdoW2OnFgOEBvd8LYARM0LWzzG2jUueifB4BIx5ghcpeh7PiXAGsaLu3hUilFhqi0K5OBIMiTgeB3k9yPT+++/vO+MdECVhsbeh/J4X7ctLwRsnrKE8hFeEYXznAQrC9p6PGTOm/10W3lNeotS4U99aDPCSCNk514egFZoLuI9jPCkjFSkGEqMSLCtWSpelKNYqYY9bN4D0kJKJMMC6OProo0vslBXOCjn77LP7fn2HgLgTTbi8BSZzkz3i5yb/8Ic/XKx5wgChWNboXJMWYjXZIxiTuuVTJqq6vIjBhMyC4eJkCcotMHmbNBG6CY1HIOC5ystjIJENyRAVLCuxTxajzwwzzPCedeomfdYpgmXZc30inZiguY+RNbc3UjHpB5CIOkki4/Zl8bXFhvoQMFNOOWVpV20d2fkECvCkRHsTFCwukz4gHeQj7u58RGrSJrhYt+qEnOtyDQWQILGmbQOe2SXgHNfO2h/REjBB8OLf+ky55R/wahg/RCnikvPA0iZkxcKNCRn3yIeLnNDT9sadWLjxwwIPIGdtp32Mf/c3PjxXyMteFvq0tsT9xsug/Yw//e53/xJtvFgsaqES/UvEBLjJ1ZEoMzZ5EvSl3AN9ZqwjfERLwATUx7i2RLP+aM86x8S4VV/vEY+F6wL+1h/TTTddIXzvGGFhDPDEuJaFT7ATAca0dzHai7iQ4KkNjUXvofYmwngTJD/ySsQY9s46V/vJCTHGCZqAuUJ7E0QjFSkGEqMOyIAbvssyBZYKS6meXBBTm7wCyJ1wMCG0wQLiVjXhu96k5/6sMxaGyc3EyBI2ETnmuSYPk5Xz/e13v7WJzLUmefdh9SIK54YF43i73H5X3poolM/zXOM+6tRVH/eSQOVfz+BtiDg2qK/y1G0XUA+/aY8g8Bqu8Vzl4t1QV9+VKTwFoO2U3/E2TOLKZ/LXZ8rn/LhPeE2GEsqJIGuvg/oZQ13CQxkHKn+0LyIl/Nrl9xx95W996xkB57jW+HJ9jLUa2sU57hn3R4zuo919b3tPeFlcY3xEv0VfsXjjfXG9Pq6hD5xjXES5w4r33XjoGmfKZyzXH2Ogvr+/453xexvK5Def6I/4HvdRduNRGdv11j7q7N6uV1/jRzk8N97dgLZ1H32rzWpoLwKKmG6/jyMF4y0GVLpuoP8ndDRLgCILV9Fwg/ZixVDr4lSDAUuBUq8tkeEILwSXdyhkE6OJoGt8mBjiBXW+6yIBZ6hhYmKB1VZ8IpFITEoIAfKgRM7IUKItwgIEDWFlfm0DP/qtLRgHwniLAe4Uy1IG+4BJCe4nSSZci7G+eziCwrQuuI4vjgtIUry7K1lruIAlQbCIM7MOCAMuRXFQ7kR1DlDfxBCrBAxg13Hfuc9QQ4xfYlQ7/phIJBKTCjwT8huE04YCjCp5IubOdrIoCF8J08gNEaqpcxwIE6EMvwnd1blQA2G8xIDKeqhklq7M5w8SLG4xYQkqIwHiTbFGdTAQr5KwMhyBzHlj6o1neDFiCZUMazFyoGjFj7nQ2iDgZObWccihgLJYjjQpXMaJRCLRBeE0uRztJZDAeJa3UedrgNADD6Z/a5g3nS/3Q1JobFYVENKQnxQJypJTPZsh6RkSKyNhWA6EXJs6FNeF8RIDlr8oFOuvzqxl8UkyIRD8beKPDGyNICmGVdz+z0tiHSklNZCngfuDFek8mcdEAMjAttxFskhkGwM1JYGFaz42j+E25nrXwCxY5VHeaBxldX/XRHxLHEk9QvREvagxHedc63+dJ3EFAdWkppye6b46VTJOvSlLDdnf8fxItEG2tRhAwMjTeeob7QAyWCWD+Ujscq6BIPmI1a7e/tZ/visnIncfbiQJSbEenqXuGfZlbw/QgPaV5V7HzST4xDI77RTjQ5kJm67QgbJItoptSYcKRJcXw/0TiUTig4A5zgqcLiPOHCxpUkJjcIxcDomNlvwOND+a5/FtnZjoGE4RCo1Qq31T7CliVYa53KqKeA5OkUhq3h4XBi0GkDXi5Xo16ZvEI7EIIVryQ30gEUQhE9jviEAilwlaZikBgKy4iB1HpJZcBZHUQDbcHCxLRCbrVcarhpVBzfVu4xH3DPjN0h4ZyxFz9112qMxZZZINyvXC0yGzXNmpM+tp1YuLW0P6O5YuqaNsc26ZyM7mIUGkCI97yHIjEDsXvtDxyu35sl7b1rFORbye7z5CA7GcpxYDOtxzlc/9hGkMIM+xnEi7yGY3YGR7s4jVi1iSTOM8ZbM8iqgxyNzbBiMEhH51ncxzGbb6UDY3q70mfFBm5WD915Chrs4gO1e9lEOmrzGjPQ3KWsT4W31jHXYbkni0szHQ9VGHSFaqIXzUXhkgeUh58pOf/ORnqD74JmCeFTq1YqYL5iChVNzIgLO6AX+NK+RujjSHtsWAZY1WN0VSpHnd0ki5c1YbWY0S8x9jGDdbwTIuDFoMiDnEhh8ebElPvbMbcuK2YMlTKax5li53RUAsGREjZIQRLhPLcLoIwfUqGNmZ1o9afqIhVdRSm1grXgNZEyR+01hEBxUVbnpbdCJ8BI/QYzML5dJo4eJm3daburhOZwPvgjXELGuw9IsqBG1lyVDErHWeNajtMAFXDzUX7hztGeqtFgOxDa16gdCIdkCuxAFRxEvhOYQJ8eDZvBERu7fZiz6T3Qv6hytdX/IAeIY2i7XLvCZ+r5etAQVrcLa3QrXhivprM31pDBAMvCG8FdYtx/7g9eA3Doih+qUKqA/hqK+7Pn5zThvEV1sM8Oi0lzLlJz/5yc+EfiaffPKyUiFgLrJUtt5QrA3nMIAYh/iUgBgXnN8lBsyx5s2YS3GBZcDEgPuby2tjnadgyMSArTORi6QEVqqdzmIfdqi3Bg1Yu42orKt1HcuXGABWn81FVIoLo+t/Q0PiFE5M+CrM2kWGLFblGcj1IZzBgpXZyfpFOqxdpMCC1QlCALPNNttYG0WwjGOjDs93TUAdQwzwaNQ7niHHKCuPBPIOEUOQ6Jy2GED+SJ3Hog1tGRtkWL8bQgO48ln1iBo5s8JZ9jwE6gfIWfvwDIBQBA9MiAFixrr4CG2ohwHDG6KveG6cX4dgwHmeoz3bUC7JnJbf2EjE2mkeAVa8EJFnEYd1ti3xYW30QNmwRI3VB10fS3y63GtdYsB44ULLT37yk5+h+tRzjLmfGMCPA4FBxzDCD/YsCFf+QBhIDNgZlKc9DMQQA+ZfnoF6oyZiQN4Bj++4MCgxoMAyEk32JmgTN+sZ+YWyYTW3xYCkBq5yVl8QOrAabaSCMPzGY9DlWkHiKhUNjuBkiduVCrGY8GO71zbcG8nwWMgJQPi+U03hTZDlTlyE9assXPCRAGLTFmGOAOESdeSWZ+0HidnmFUmCMtm5LogYgSLmtjLTDja/CQKvITwRrnjlsX41nkXE2MGOKvV35D4YIDwSLH2boRgcLH9QR6IrykSwEAMhZrSn72JR+qrurxqOc28RSgNBfxETPDm8P9xi/nWtF6EO6whfxJasbXDDEW6EYtdHfSNmVqMrTJBIJBKTEriQ4csI7YK5ytwp0ZpxEq5+89xAMGcSDfX/++GYPDvcEZ5fwsQOk0ICQsc2UGIsAUOQsRjfB8L7igHEgpQoi3CJIBD/6caHPvShYiFTICZ/hMfiD7BChQ4IBwUSk7ZUIpZ+SXRA2jLtEXU7/kvtSATjlXA9C5NoQNqWTrDqkUXXpE8xIVCWrvMRaTwnEuNYlcIAViUgZNYugue+B2EKBCqMwNWNLIkFSotSQ7zahDuGoAnyFTpwnnuz/rnyeQBY+HVZlUnugs7WDggaUSJOYQ0kiqRZ2kQRF7t2oDz1iUGh/txStt2VxMd15BqDQliAoGGJE0F2rzNQeCoINQPG/dwH5G3oL2JJe8hxqJcIBlyLwCNe1UadP8A74lwWvvP1YQzKeHki2XCooNxCSOEmS4wueG+I3YE8Q6MJ5lqeQ3NhvKeJ4QnzG4OQB7kNY5bH2bwYY9a/uM2cGEZZDTxgXkfy5njGcHAXrsRbPO3C0vg3PPW4j4eb8MC1OIan/P1CEu8rBpCdpAekErF1ngJiwDEuCS5bD3NeO8bMm6ABkJHYuAL5iG2z2t2TBelalW2DuEC8rme1Blzv+YhkIFcLsRFZ8iC8ECsMAoQCi939kVit0nRW/GbDIILAM6kw6z79LVaPeNXf99g/3H2UmwVt0iKaKMH28g4KkVfBM4gBL7z4vvZwbZCxyYAl7Lx6Mx3tq9xRfkIlYCBpY+EJ5ykjgWNARfm1aT1ICDb3UvaBlKSyEFmRE1GDqOENinwQQM4yYnk7KNx4GXh4kHYddxsKqAMRF6IuMWEwZoxB46R+b6z+CI+c8cr96BzjzPs0qUFgCtfZvrce7yMR5k5t533vCheaL3hluYTHlWiW+P+DEWY+E7ZtgxGI58K7GyAgcGaXGOD1xW8xPoQ/GYYBggD/mq/xYQ1zvCWFfpOcPhgMOmcgkajBiyCE0t560wAljmoQGyY9IicGvZUcQgaE0FDDS8Qr0iUuE4MHt6a8D+7I+J8EWR2SennsYmIjFJwT++h/EGANyWmpPZHDDdqP0B2oTbwP3MTEK6ODZ9XYbYNB478GzrDX8AbhJqm8K6l9JCDFQGKCIfzBcpT7MD5wPrVbb1o0lCA0kBUvSGLiIFzETRm5J8Je2hYRh0fHOXJpaq8AAdi2ZNteg9rF77fwUPm3bUEFXOO+vHNEyUBigMXVDmPVz0DQNUl3lTfg+PuJHPeuy+x+cp4kGRNQXWUhhnnuwP25ermMo4wBSdK8A8rhGV1lcbx+vnPq9m5/94z298TEgVeUR7L9n1eNFKQYSEwUhAMio3WwcH4dRhhqmPjkInCRJSYO+knyEeEHVgBZOSMBOP4/ECGn+H/jwXHEZlWKWGcsQbbMVF5NbI3KxWny5D61kxqrSkhR2MHqGZ4nwg4QF3IVgnJf5Ggf+HaYQMhQWEpukRwhyVpB8sKUsrglrQppEDQsch4kYQdlFmcN4cNKF1rzm/oOtIyZi1acWJncg3dMiE4SqzwdOTPCYzX5ald5QbUglosjz6n9Pim31Uieo03qJdU8c4S152ozY17oUd6SLHT5SJ4rbCmerYy+8/QQKkJ3+stzu5Z3JwYHc453QM7VSM1VSjGQGJWQfyGJc3yFSmJssBhZsDKkWbeIUchHUpLkJ9aoxCj5BSD+aX+K2IEU8fIsICcxVaQTy1URokTiWB5MOCAw8c5IgLUfBsiTQZ7xHCRuj452XghyRXrKrZzERrjeTdgI0++8GhJ6Jfki2vhPxNTVMedy4RMggGR9r70ZwBpE+lzESJjYiRitZbMESRckV2snOUcBidbax31qyBwnXHhDwEoayWNI3dJnAknfaGNiR24RWD4sITrEEDEmFBFkJR6tDISLdmuvBksMHtqfIOv6PwRGClIMJEYlWGdUeiR0JiYc8jqEBiS4EQWIFrEgR1Y+URAQNhLfDthfIlatmDBjtQroI6tkYtOtej21Z9iTIjwOvAGx/wcQG11hAmTNCkbuyk0whDBxT5Yxax+UhxcCgUuk5f0gBBAqQSK/RRKtZEkWuZU6tSse3DM8AUQAARPhKc9X37aAAIlglh9bohyQDc7qj4zxALHk2XEfhON7kH/cg4DhoYglzq4jiEMMOI+HI8SAhGZZ56AeKZwnHN4Nwiu8SiMRKQYSoxb+m2SWnokuMeEQA2X9skjDrc3aJhBsjCUBLmCjMVZrAOnZeExeASK1CiX+cxWkJzQQYoBnIJaZsnqRWlhaltPWe5EQIcIXbTGAlG1hjZgttbXDqGeDceA/WrMSKhDLh2WA+wgxWHWkrJ5N3BAKns+r0BYDLHwCSUKt0ANLO9pISIVnoA4PBCQXIv7Y7RSRyx/g1m+LB+1DxETyrSXQ2lgIxUZhdbY4MRViQL/YC4boAfWwPLoWA1b5JCYO+s4+O7Ed/UhFioHEqIVJEIHUrtjE+AN5sHpY+FzvgMi5nJG5paYBme/IP/5TMnkBruX61h8EhCVSYKmuVQgRNkCEMaEibsIhVptwfbOCY5MphMiyrpcVm5S5umMbb9n68grkJEC4/ut9LeQLcM1H0hfiForgESA2oh6ImpXfFgPi/CF+hArsxxL/IRlxILThGm0UFjoEgbDUrRIQMkHUkZtRQ6ikdveHZwBit1Bg2btfeFN4NNSfYHIt0aL9QxxoB+IoMXEwzvRDe9n4SEOKgcSohl0mJUZ17YmQGDxYyIgmyBhZc9sjX8QWQDTc3SxS+QUmyXr7aRY0wiTSEB9ykn9gvxFuf4Soz7i47Q7KsuZ6lSjHy4MEufnF44kOZFxb3ojTmnz7vrPQCRZJgQSNcIGdOwmYukwsZkSvvEIe8gAQq61lhTzURwIgL0PtBQHhD0QtjMDLwIJXZrkMsR8Hr4IkvVoMAPLwDIRMpCDxthdBvYVPCDEeAKLBuTwQhJd9SLQxC58o4JmJnANhBM/WF3Yx5REhDoQL7ETquDbsEiCJwUECq7FMEIx0pBhIjHrYirq9GVZi/ID82+5rxNXlAgdkiozCCq0hkTD2p2A1Iy8ucMf97Tm+I/D4HnBdkB2L2jVtuE4cX5k9X1kIFs+KZ7TL5bjyhgsdXEP8xDP8Fq76GkjetcqpPTwv2sVzlFlZBoLfQ2S14Tr382z1je/KFPsOKKf6dt0j6hD1ivtEOev7JMYfPEexWmakI8VAIpFIJBI9jhQDiUQikUj0OFIMJBKJRCLR40gxkEgkEolEjyPFQCKRSCQSPY4UA4lEIpFI9DhSDCQSiUQi0eNIMZBIJBKJRI8jxUAikUgkEj2OFAOJRCKRSPQ4UgwkEolEItHjSDGQSCQSiUSPI8VAIpFIJBI9jhQDiUQikUj0OFIMJBKJRCLR40gxkEgkEolET6Np/gcwCktRbtBaQgAAAABJRU5ErkJggg==\"\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003ev. Proliferation assay\u003c/h2\u003e\n \u003cp\u003eThis assay was conducted using a colorimetric bromodeoxyuridine (BrdU) cell proliferation assay kit. 2 x 10\u003csup\u003e4\u003c/sup\u003e cells were seeded in 96-well plates and incubated until they reached 90% confluency. Then, new media was added along with the treatment. BrdU Label (1:2000) was added into the well after 4 hours the treatment started to allow 20 hours incubation. After the treatment, the cells were incubated with 200 \u0026micro;l of fixative solution for 30 minutes at room temperature. 1X Anti-BrdU Antibody was incubated with the cells for 1 hour at room temperature. The cells were washed three times with 1X Wash Buffer before adding 1X Peroxidase Goat Anti-Mouse IgG HRP Conjugate for 30 minutes incubation. After that, the washing step was repeated again for three times before flooding the entire plate with distilled water. Substrate Solution was put into the well and incubated for 15 minutes in the dark at room temperature. Lastly, Stop Solution was added before measuring the absorbance at 450\u0026ndash;540 nm using spectrophotometric plate reader. The percentage of BrdU positive cells was calculated using excel.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003evi. RT-qPCR\u003c/h2\u003e\n \u003cp\u003e3 x 10\u003csup\u003e5\u003c/sup\u003e HUVECs were seeded in 6 well plates and the treatments were administered once the cell had reached 90% confluency. RNA extraction was performed using innuPREP RNA mini kit 2.0. The concentration and purity of RNA were read using a nanodrop spectrophotometer machine. Next, PCR reverse transcription process was performed using ReverTra Ace qPCR Rt Master Mix with gDNA Remover to convert 500 \u0026micro;g RNA. For DNAse I reaction process, a mixture of 4x DN Master Mix and \u0026lsquo;gDNA Remover\u0026rsquo; (2 \u0026micro;l), and a balanced volume between RNA sample and RNA-free water (6 \u0026micro;l) were added into a 200 \u0026micro;l tube and incubated in thermal cycler machine (Bio-Rad, Model CFX Connect, USA) for 5 minutes at a temperature of 37 ℃. Next, 2 \u0026micro;l 5x DN Master Mix was added into the tube for DNAse II reaction process whereby the sample was further incubated at 37 ℃ for 15 min and heated at 98 ℃ for 5 min. Samples were stored at -20℃.\u003c/p\u003e\n \u003cp\u003eReal-time qPCR was carried out using the Thunderbird SYBR qPCR Mix kit. The primers to be used in this study are MMP \u0026minus;\u0026thinsp;3, BCL-2, CXCL8 and 36B4 (housekeeping gene). The sequence for the primers can be referred to Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The RT-qPCR reactions consist of 10 \u0026micro;l Thunderbird SYBR qPCR mix, 0.6 \u0026micro;l forward primer (6 pmol), 0.6 \u0026micro;l reverse primer (pmol), 2 \u0026micro;l cDNA (0.5 \u0026micro;g) and 6.8 \u0026micro;l RNA-free water were prepared in 200 \u0026micro;l qPCR tube. The tube was then put into the CFX 96 Real-Time PCR Detection System (Bio-Rad, CA, USA RT-qPCR machine) and the protocol was set as follows; pre-denaturation at 95 ℃ for 60 seconds, 40 cycles of denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 60 seconds; the data collection was set at the annealing step. Lastly, the relative changes in target gene expression were analyzed using the 2\u003csup\u003e\u0026minus;\u0026thinsp;Delta\u0026minus;Delta Ct\u003c/sup\u003e method (2\u003csup\u003e\u0026minus;∆∆Ct\u003c/sup\u003e).\u003c/p\u003e\n \u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer sequence.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer sequence\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProduct Size (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMMP-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward: GATCCTGCTTTGTCCTTTGATGCT\u003c/p\u003e\n \u003cp\u003eReverse: CTGAAGGAAGAGATGGCCAAAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e145\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBCL-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward: GGTGGGGTCATGTGTGTGG\u003c/p\u003e\n \u003cp\u003eReverse: CGGTTCAGGTACTCAGTCATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e89\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCXCL8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward: GAGAGTGATTGAGAGTGGACCAC\u003c/p\u003e\n \u003cp\u003eReverse: CACAACCCTCTGCACCCAGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e112\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e36B4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward: GCCAGCGAAGCCACGCTGCTGAAC\u003c/p\u003e\n \u003cp\u003eReverse: CGAACACCTGCTGGATGACCAGCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003evii. Statistical analysis\u003c/h2\u003e\n \u003cp\u003eResults are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. IBM SPSS statistics version 26 was used to carry out statistical analysis. The mean difference between control and treatment groups was compared statistically using an independent sample t-test. One-way analysis of variance (ANOVA) test was run to compare the mean difference between treatment groups, followed by Tukey post-hoc test. The difference was considered significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eNavitoclax concentration against cell viability\u003c/h2\u003e \u003cp\u003eThe navitoclax effect against HUVEC viability at four different time points (i.e., 18, 24, 48 and 72 hours) were investigated via MTT assay. The navitoclax concentrations used were 0.2 \u0026micro;M, 0.4 \u0026micro;M, 0.6 \u0026micro;M, 0.8 \u0026micro;M, 1.0 \u0026micro;M, 1.5 \u0026micro;M, 2.0 \u0026micro;M and 3.0 \u0026micro;M. There was no significant difference in the cell viability between untreated and vehicle control groups, hence the treated groups were normalized to the untreated group. On the other hand, the mean of cell viability between treated and untreated groups at different treatment periods is significantly different, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The highest navitoclax concentration which is 3.0 \u0026micro;M reduced the 100% cell viability to 73.65\u0026thinsp;\u0026plusmn;\u0026thinsp;9.40%, 12.34\u0026thinsp;\u0026plusmn;\u0026thinsp;6.50%, 0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16% and 2.09\u0026thinsp;\u0026plusmn;\u0026thinsp;1.28% after 18, 24, 48 and 72 hours respectively. Besides, at the lowest navitoclax concentration (i.e., 0.2 \u0026micro;M), the 100% of cell viability decreased more than 50% after 72 hours of treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA graph of log dose against cell survival at different time points was plotted to compare the potency of different treatment periods in reducing cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). As the treatment time increased, the log dose against cell survival curves was shifted to the left. There was a statistically significant mean difference in cell viability between treatment times as determined by one-way ANOVA, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. Regarding the Tukey post-hoc test, the cell viability was significantly reduced in 48 hours (50.18\u0026thinsp;\u0026plusmn;\u0026thinsp;11.55%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and 72 hours (24.45\u0026thinsp;\u0026plusmn;\u0026thinsp;10.12%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) post-treatment compared to the 18 hrs (85.37\u0026thinsp;\u0026plusmn;\u0026thinsp;2.26%, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) post-treatment group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFrom the dose-response graph, IC\u003csub\u003e50\u003c/sub\u003e values for each time point were deduced. The IC\u003csub\u003e50\u003c/sub\u003e value showed a decreasing trend as the treatment period was increased. There was no IC\u003csub\u003e50\u003c/sub\u003e detected after 18 hours treatment; even at the highest concentration used, the cell viability observed was still higher than 50%. However, for 24 hours of treatment, the IC\u003csub\u003e50\u003c/sub\u003e value was identified at 0.91 \u0026micro;M, then after 48 hours was 0.72 \u0026micro;M, and lastly for 72 hours was 0.12 \u0026micro;M. The morphological observation was performed to determine the cell changes before and after the treatment, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. All the control groups show the cobblestone-like structure of HUVEC which indicate healthy and normal cells. Whilst at 0.2 \u0026micro;M, the cells\u0026rsquo; structure was altered and shrunk, especially after 24, 48 and 72 hours of treatment. On top of that, the number of cell shrinkage was elevated dramatically with 3.0 \u0026micro;M navitoclax after 24, 48 and 72 hours of treatment. These findings indicate more cells were dead with navitoclax treatment. Nevertheless, after 18 hours, the number of normal cells were still visible.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the MTT assay result, 0.9 \u0026micro;M navitoclax for 24 hours treatment has been selected for subsequent experiment to determine the regulation of HUVEC angiogenesis and motility.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEstablishment of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ein-vitro\u003c/span\u003e \u003cb\u003eangiogenesis model by IL-3\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe influence of various IL-3 concentrations on the induction of HUVECs tube formation after 6 hours, as measured by the mean total branching length can be depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. The total branching length is represented by the total segments and branches length [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. The images displayed more branches and segments were formed by HUVECs with 25ng/ml. 10ng/ml and 25ng/ml IL-3 generated considerably longer branches than the control quantitatively. However, there was no statistically significant change in the mean total branch length between the three concentrations of IL-3. Nonetheless, the total branch length was greatest at 25ng/ml IL-3. This result shows a model of in-vitro angiogenesis generated by IL-3, one of the principal cytokines known to promote intraplaque angiogenesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNavitoclax inhibits the\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ein-vitro\u003c/span\u003e \u003cb\u003eangiogenesis model\u003c/b\u003e\u003c/p\u003e \u003cp\u003eModulation of IL-3-induced HUVEC tube formation by 0.9 \u0026micro;M navitoclax was observed for 8 hours. All groups began to develop tube formation after two hours of incubation. The blockage of the branches was then observed after 4 hours in the IL-3 with navitoclax treated group and continued to deteriorate until the end of the incubation period (24 hours). Quantification of total branching length was performed after 8 hours treatment since at 24 hours the branches and segments were unlikely to be recognized by imageJ \u0026ndash; Angiogenesis Analyzer. In the presence of navitoclax, as seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e(A), the number of segments and associated branches decreases. In addition, numerous isolated branches were observed, indicating the degeneration of the tube development. Similar to the data shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, 25 ng/ml IL-3 greatly increased tube formation, whereas navitoclax considerably reduced the overall branching length compared to the inducer group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eRegulation of navitoclax on IL-3 induced HUVEC proliferation and migration\u003c/h2\u003e \u003cp\u003eTo observe the cell behavior related to \u003cem\u003ein-vitro\u003c/em\u003e angiogenesis, a migration and proliferation assay was undertaken. After 24 hours of incubation, the wound area in the control and IL-3 groups was not completely covered by cells, as evidenced in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA. Possibly, by extending the incubation period, the entire wound will heal. Quantification of the data (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB) reveals that the control group generated 42% wound closure, whereas IL-3 demonstrated the highest percentage which was 49%. Despite this, there was no statistically significant difference between the control and IL-3 groups, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05. After 24 hours of treatment with navitoclax, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, a small number of cells had moved to the wound site. Around 17% of wound closure was impacted by navitoclax treatment, as seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, whereby p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicates statistical significance in comparison to the control and IL-3 groups. The data demonstrate that after 24 hours of treatment, navitoclax inhibits cell motility, as measured by a decrease in the percentage of wound closure area.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBrdU assay was done to quantify proliferating cells by permitting BrdU marker incorporation into newly produced DNA of actively developing cells. As seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, the data were not statistically significant across all groups. IL-3 increased by 16% after 24 hours of treatment, while navitoclax reduced BrdU-positive cells by just 2% compared to the control group. This result indicates navitoclax had minimal effect on the reduction of proliferating cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eModulation of target genes related to HUVEC angiogenesis and motility by navitoclax\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCell lysate was used to assess mRNA expression levels. Three mRNA targets were chosen as markers for angiogenesis (CXCL-8), migration (MMP-3) and proliferation (BCL-2). In angiogenesis, endothelial cells secrete CXCL-8, a pro-angiogenesis chemokine, to facilitate the formation of tubes. In agreement with the angiogenesis result, CXCL-8 expression in the IL-3 cell lysate was slightly lower than the control, however in the presence of navitoclax, the CXCL-8 level was dramatically enhanced, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001. This may indicate that navitoclax degenerates the branches by inhibiting the secretion of CXCL-8. Subsequently, the activation of MMP-3 levels was correlated with cell migration data, in which the expressions increased significantly in response to IL-3 treatment and were inhibited by navitoclax. Finally, BCL-2 expressions were evaluated to determine the impact of navitoclax on HUVEC survival. Unexpectedly, the BCL-2 concentrations in IL-3 with or without navitoclax were comparable, and slightly lower than the control.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study conducted several optimizations in order to discover an appropriate set of navitoclax concentrations against proliferating endothelial cells (data not shown) with a finalized range between 0.2 \u0026micro;M to 3.0 \u0026micro;M. Different treatment times were performed to evaluate the potency of navitoclax in mediating HUVEC survival over time. This study included two control groups: untreated cells and cells incubated with 0.01 \u0026micro;M DMSO (vehicle control). The vehicle control group did not show a significant effect on cell death. This result would validate the anti-survival impact of navitoclax alone in the treatment group. After 18 hours of navitoclax treatment, more intact cells were still visible. Even though the statistical analysis showed a significant mean difference output between untreated and treated groups, from the dose-response curve plotted, the cell viability was reduced below 80% only at the highest navitoclax concentration used. We proposed it is due to a minimal time for the navitoclax to have an effect on HUVEC and a low range of concentration used. Nevertheless, our study did not proceed with higher navitoclax concentration; thus, the IC\u003csub\u003e50\u003c/sub\u003e for 18 hours treatment could not be identified. An investigation to determine a relevant concentration range of navitoclax for 18 hours treatment is worth conducting. The result can further disclose that the time-dependent navitoclax activity is influenced by the concentration. However, as the treatment time increased with a constant concentration range, the number of intact cells was diminished. After 24, 48 and 72 hours of treatment, the IC\u003csub\u003e50\u003c/sub\u003e values of navitoclax were successfully determined.\u003c/p\u003e \u003cp\u003eOur findings are supported by a previous study that reported approximately 50% reduction of HUVEC viability after 72 hours of 0.1 \u0026micro;M navitoclax treatment though they did not report on the morphological changes [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Our studies also showed a comparable IC\u003csub\u003e50\u003c/sub\u003e value after 72 hours of treatment which was 0.12 \u0026micro;M. After all, this current study demonstrated that the IC\u003csub\u003e50\u003c/sub\u003e value decreases as the treatment time increases. This indicates that the potency of navitoclax in reducing HUVEC viability is escalated over time. The data from the MTT assay conducted in this study would represent the number of living cells that can be detected after navitoclax treatment. This may indirectly indicate the cytotoxicity effect of navitoclax on living cells and illustrate that navitoclax can inhibit metabolically active cells. Yet, endothelial cell apoptosis induced by navitoclax is not clearly determined through this assessment. Hence, an investigation to ascertain the navitoclax apoptotic effect and its mechanism on endothelial cells is worth proceeding.\u003c/p\u003e \u003cp\u003eMost of the navitoclax cytotoxicity studies have been conducted on various cancer cells, including small-cell lung cancer (SCLC) cell lines, leukemia cells, breast cancer cells and neuroblastoma. This drug has been demonstrated to block anti-apoptotic proteins of the Bcl-2 family, which then triggers the downstream signaling of cell death. A different range of navitoclax concentrations were used in cytotoxicity assay against cancer cells subject to navitoclax efficacy. As demonstrated by a previous study, navitoclax treatment was highly efficacious towards head and neck squamous cancer cell lines; hence low dosage range was used starting from 0.0 to 1.5 \u0026micro;M [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In contrast, other tumor cells were less potent against navitoclax treatment; thus, a high concentration range was applied (i.e. 5 \u0026micro;M to 10 \u0026micro;M) for breast cancer cells [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], human oral squamous cell carcinoma-derived cell lines [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] and leukemia cells [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThere is growing evidence for the therapeutic outcome of pro-apoptotic and anti-angiogenic agents on pathological angiogenesis other than cancer, such as advanced atherosclerosis. Angiogenesis in advanced atherosclerosis is primarily regulated by endothelial cells and smooth muscle cells survival as well as motility[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Therefore, a study of navitoclax cytotoxicity via cell viability assay to determine its IC50 value on primary cells (i.e., endothelial cells) is worth being conducted before further investigating its mechanism and pharmacological characteristics. A previous study has reported 10 \u0026micro;M navitoclax exhibited a significant but moderate pro-apoptotic effect against a primary cell which was human mesenchymal stromal cells [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Their results hence reassured the potential of navitoclax treatment to mediate a therapeutic effect against primary cells.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ein-vitro\u003c/em\u003e angiogenesis model would represent the neovascularization that occurs at the intraplaque region hence causing plaque instability and rupture. High expression of IL-3 receptor was detected upon pro-inflammatory agent stimulation such as IL-3, and these receptors were accumulated in coronary atherosclerotic plaques with neovessels development [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The discovery suggested that IL-3 \u0026ndash; induced inflammation is strongly associated with angiogenic response. Besides, IL-3 was shown to mediate the angiogenic response in wound healing and tumor vasculature by activating endothelial cell-derived extracellular vesicles via STAT5 [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] and β-catenin signaling pathway [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] respectively. In view of this evidence, the \u003cem\u003ein-vitro\u003c/em\u003e angiogenesis model induced by IL-3 is justified to imitate the pathological neovascularization that contributes to the progression of atherosclerosis and cancer. The establishment of this model is crucial prior to navitoclax treatment in order to mimic the pathological condition of the disease. Therefore, 25 ng/ml IL-3 was administered with navitoclax to observe the efficacy of navitoclax in ameliorating the disease model.\u003c/p\u003e \u003cp\u003eBased on the MTT assay result, 0.9 M navitoclax was used in the subsequent tests to observe the regulation of navitoclax on the \u003cem\u003ein-vitro\u003c/em\u003e intraplaque angiogenesis model. All studies were conducted with an incubation period of 24 hours, hence the IC50 value at 24 hours was utilized. In addition, the IC50 value employed in this study demonstrates the effectiveness of navitoclax in blocking the formation of \u003cem\u003ein-vitro\u003c/em\u003e blood vessels by half-maximal inhibitory dose. Hence, it is possible to conclude that the inhibition of the subsequent cell biological test was not due to the absence of live cells. As illustrated by the tube formation assay, in the presence of navitoclax, the \u003cem\u003ein-vitro\u003c/em\u003e angiogenesis induced by IL-3 was remarkably suppressed within 8 hours. This finding reveals a novel navitoclax function as anti-angiogenic agent on IL-3 \u0026ndash; induced HUVEC neovascularization through cell motility inhibition. In accordance with the inhibitory effect of navitoclax on HUVEC angiogenesis and migration, the release of CXCL-8 and MMP-3 expression in cell lysates was reduced notably in navitoclax-treated group. Our findings revealed a novel function of navitoclax as anti-angiogenic drug through the regulation of CXCL-8 and MMP-3 expressions. Interestingly, CXCL-8 and MMP-3 levels were also highly expressed in the presence of IL-3 which may suggest the involvement of these molecules in the downstream signaling of IL-3 receptor activation. Nevertheless, current study determined anti-proliferative effect of navitoclax on HUVEC to be minimal and BCL-2 protein involvement was insignificant. On top of that, this is the first \u003cem\u003ein-vitro\u003c/em\u003e study to employ navitoclax as one the pharmacological strategies to ameliorate intraplaque angiogenesis in atherosclerosis. Several drugs have been proposed for this disease model, however, the outcomes are yet to be elucidated. This is due to a lack of \u003cem\u003ein-vivo\u003c/em\u003e disease model and some of the treatments display unappealing effects.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis is among the few studies that reported the navitoclax effect on primary cell viability, which is HUVEC mainly. Navitoclax demonstrated a moderate toxicity result on primary human endothelial cells with a concentration below 3.0 \u0026micro;M indicated by the number of viable cells after 6- and 24-hours treatment time. The potency of navitoclax elevated as the treatment time increased. The action of navitoclax is time- and concentration-dependent on HUVEC. The finding suggested using 0.9 \u0026micro;M navitoclax in 24 hours treatment period is appropriate for further HUVEC \u003cem\u003ein-vitro\u003c/em\u003e study. Research on navitoclax effect in less than 24 hours treatment time will require higher navitoclax concentration, whilst for longer treatment time (i.e., \u0026gt; 24 hours), lower navitoclax dose can be used.\u003c/p\u003e \u003cp\u003eOur results provide the first evidence of navitoclax as an anti-angiogenic agent against IL-3 \u0026ndash; induced HUVEC angiogenesis. Besides, navitoclax effects on matrix metalloproteinases activities and CXCL-8 released to degenerate blood vessel formation were revealed through \u003cem\u003ein-vitro\u003c/em\u003e study. Unexpectedly, this drug showed minimal association with BCL-2 expression and proliferative activity of endothelial cells, as opposed from the cancer study.\u003c/p\u003e \u003cp\u003eAs in general, navitoclax has moderate toxicity effect on the metabolically active endothelial cells. Other than that, with half \u0026ndash; maximal concentration applied, navitoclax is able to significantly inhibit the \u003cem\u003ein-vitro\u003c/em\u003e tube formation and cell migration induced by IL-3 through the downregulation of CXCL-8 and MMP-3 activities. In conclusion, navitoclax is proposed to produce therapeutic outcomes in pathological angiogenesis such as intraplaque angiogenesis in atherosclerosis through its anti-angiogenic properties.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENT\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by a grant from the Ministry of Education, Malaysia (FRGS/1/2019/SKK06/UKM/02/7) and Universiti Kebangsaan Malaysia (UKM). We like to thank the Department of Obstetrics and Gynecology, Universiti Kebangsaan Malaysia Medical Center (PPUKM) for their support in providing human umbilical cord samples. Appreciation also goes to the Department of Physiology, Faculty of Medicine, Universiti Kebangsaan Malaysia for the usage of their equipment and expertise for HUVEC isolation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by a grant from the Ministry of Education, Malaysia (FRGS/1/2019/SKK06/UKM/02/7) and Universiti Kebangsaan Malaysia (UKM).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest, financial or otherwise.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAU and NNMA designed the study conceptualization and supervised the experiment. \u0026nbsp;MFA assisted the umbilical cord collection and isolation process. NSNH conducted the experiment and drafted the manuscript. KDG and NFR edited and reviewed the manuscript. All authors approved the final version of the manuscript.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSimionescu, D. (2012). Vasculogenesis and Angiogenesis - from Embryonic Development to Regenerative Medicine. In S. Dan (Ed.), \u003cem\u003eIntechOpen\u003c/em\u003e. IntechOpen. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5772/1341\u003c/span\u003e\u003cspan address=\"10.5772/1341\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHonnegowda, T. M., Kumar, P., Udupa, E. G. P., Kumar, S., Kumar, U., \u0026amp; Rao, P. (2015). Role of angiogenesis and angiogenesis factors in acute and chronic wound healing. Plastic and Aesthetic Research, \u003cem\u003e2\u003c/em\u003e, 243\u0026ndash;249. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/2347-9264.165438\u003c/span\u003e\u003cspan address=\"10.4103/2347-9264.165438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, J., Zhang, Y., \u0026amp; Kirsner, R. S. (2003). Angiogenesis in wound repair: angiogenic growth factors and the extracellular matrix. Microscopy Research and Technique, \u003cem\u003e60\u003c/em\u003e(1), 107\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/JEMT.10249\u003c/span\u003e\u003cspan address=\"10.1002/JEMT.10249\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaiter, A., Bechor, Z., Kleiman, M., Leshem-Lev, D., Battler, A., \u0026amp; Hardy, B. (2010). Angiogenic Peptides Improve Blood Flow and Promote Capillary Growth in a Diabetic and Ischaemic Mouse Model. European Journal of Vascular and Endovascular Surgery, \u003cem\u003e40\u003c/em\u003e(3), 381\u0026ndash;388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejvs.2010.02.003\u003c/span\u003e\u003cspan address=\"10.1016/j.ejvs.2010.02.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePereira, R. D., De Long, N. E., Wang, R. C., Yazdi, F. T., Holloway, A. C., \u0026amp; Raha, S. (2015). Angiogenesis in the Placenta: The Role of Reactive Oxygen Species Signaling. BioMed Research International, \u003cem\u003e2015\u003c/em\u003e(814543). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2015/814543\u003c/span\u003e\u003cspan address=\"10.1155/2015/814543\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZygmunt, M., Herr, F., M\u0026uuml;nstedt, K., Lang, U., \u0026amp; Liang, O. D. (2003). Angiogenesis and vasculogenesis in pregnancy. European Journal of Obstetrics, Gynecology, and Reproductive Biology, \u003cem\u003e110 Suppl\u003c/em\u003e, 10\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0301-2115(03)00168-4\u003c/span\u003e\u003cspan address=\"10.1016/S0301-2115(03)00168-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFleiner, M., Kummer, M., Mirlacher, M., Sauter, G., Cathomas, G., Krapf, R., \u0026amp; Biedermann, B. C. (2004). Arterial neovascularization and inflammation in vulnerable patients: Early and late signs of symptomatic atherosclerosis. Circulation, \u003cem\u003e110\u003c/em\u003e(18), 2843\u0026ndash;2850. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.CIR.0000146787.16297.E8\u003c/span\u003e\u003cspan address=\"10.1161/01.CIR.0000146787.16297.E8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoma, H., Funatsu, H., Yamashita, H., Kitano, S., Mishima, H. K., \u0026amp; Hori, S. (2002). Regulation of angiogenesis in diabetic retinopathy: Possible balance between vascular endothelial growth factor and endostatin. Archives of Ophthalmology, \u003cem\u003e120\u003c/em\u003e(8), 1075\u0026ndash;1080. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1001/archopht.120.8.1075\u003c/span\u003e\u003cspan address=\"10.1001/archopht.120.8.1075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBentzon, J. F., Otsuka, F., Virmani, R., \u0026amp; Falk, E. (2014). Mechanisms of plaque formation and rupture. Circulation Research, \u003cem\u003e114\u003c/em\u003e(12), 1852\u0026ndash;1866. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCRESAHA.114.302721\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.114.302721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerrotta, P., Veseli, B. E., Veken, B. Van Der, Roth, L., Martinet, W., \u0026amp; Meyer, G. R. Y. De. (2019). Pharmacological strategies to inhibit intra-plaque angiogenesis in atherosclerosis. \u003cem\u003eVascular Pharmacology\u003c/em\u003e, \u003cem\u003e112\u003c/em\u003e(May 2018), 72\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vph.2018.06.014\u003c/span\u003e\u003cspan address=\"10.1016/j.vph.2018.06.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVirmani, R., Kolodgie, F. D., Burke, A. P., Finn, A. V., Gold, H. K., Tulenko, T. N., Wrenn, S. P., \u0026amp; Narula, J. (2005). Atherosclerotic plaque progression and vulnerability to rupture: Angiogenesis as a source of intraplaque hemorrhage. In \u003cem\u003eArteriosclerosis, Thrombosis, and Vascular Biology\u003c/em\u003e (Vol.\u0026nbsp;25, Issue 10, pp.\u0026nbsp;2054\u0026ndash;2061). Lippincott Williams \u0026amp; Wilkins. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.ATV.0000178991.71605.18\u003c/span\u003e\u003cspan address=\"10.1161/01.ATV.0000178991.71605.18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroughton, S. E., Dhagat, U., Hercus, T. R., Nero, T. L., Grimbaldeston, M. A., Bonder, C. S., Lopez, A. F., \u0026amp; Parker, M. W. (2012). The GM-CSF/IL-3/IL-5 cytokine receptor family: From ligand recognition to initiation of signaling. Immunological Reviews, \u003cem\u003e250\u003c/em\u003e(1), 277\u0026ndash;302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1600-065X.2012.01164.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1600-065X.2012.01164.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDentelli, P., Sorbo, L. Del, Rosso, A., Molinar, A., Garbarino, G., Camussi, G., Pegoraro, L., \u0026amp; Brizzi, M. F. (1999). Human IL-3 Stimulates Endothelial Cell Motility and Promotes In Vivo New Vessel Formation. The Journal of Immunology, \u003cem\u003e163\u003c/em\u003e(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHercus, T. R., Dhagat, U., Kan, W. L. T., Broughton, S. E., Nero, T. L., Perugini, M., Sandow, J. J., D\u0026rsquo;Andrea, R. J., Ekert, P. G., Hughes, T., Parker, M. W., \u0026amp; Lopez, A. F. (2013). Signalling by the βc family of cytokines. Cytokine and Growth Factor Reviews, \u003cem\u003e24\u003c/em\u003e(3), 189\u0026ndash;201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cytogfr.2013.03.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cytogfr.2013.03.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrizzi, M. F., Garbarino, G., Rossi, P. R., Pagliardi, G. L., Arduino, C., Avanzi, G. C., \u0026amp; Pegoraro, L. (1993). \u003cem\u003eRapid Publication Interleukin 3 Stimulates Proliferation and Triggers Endothelial-Leukocyte Adhesion Molecule 1 Gene Activation of Human Endothelial Cells Key words: endothelial cells * endo-thelial-leukocyte adhesion molecule 1 * inflammation * inter-leukin 3 * proliferation Introduction\u003c/em\u003e. \u003cem\u003e91\u003c/em\u003e, 2887\u0026ndash;2892.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePenna, C., Femmin\u0026ograve;, S., Tapparo, M., Lopatina, T., Fladmark, K. E., Ravera, F., Comit\u0026agrave;, S., Alloatti, G., Giusti, I., Dolo, V., Camussi, G., Pagliaro, P., \u0026amp; Brizzi, M. F. (2021). The Inflammatory Cytokine IL-3 Hampers Cardioprotection Mediated by Endothelial Cell-Derived Extracellular Vesicles Possibly via Their Protein Cargo. Cells, \u003cem\u003e10\u003c/em\u003e(1), 1\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/CELLS10010013\u003c/span\u003e\u003cspan address=\"10.3390/CELLS10010013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorpelainen, E., Gamble, J., Smith, W., Goodall, G., Qiyu, S., Woodcock, J., Dottore, M., Vadas, M., \u0026amp; Lopez, A. (1993). The receptor for interleukin 3 is selectively induced in human endothelial cells by tumor necrosis factor alpha and potentiates interleukin 8 secretion and neutrophil transmigration. Proceedings of the National Academy of Sciences of the United States of America, \u003cem\u003e90\u003c/em\u003e(23), 11137\u0026ndash;11141. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/PNAS.90.23.11137\u003c/span\u003e\u003cspan address=\"10.1073/PNAS.90.23.11137\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamad Anuar, N. N. (2016). \u003cem\u003eRegulation of Vascular Cells Function by Colony Stimulating Factors\u003c/em\u003e. \u003cem\u003eSeptember\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLombardo, G., Gili, M., Grange, C., Cavallari, C., Dentelli, P., Togliatto, G., Taverna, D., Camussi, G., \u0026amp; Brizzi, M. F. (2017). IL-3R-alpha blockade inhibits tumor endothelial cell-derived extracellular vesicle (EV)-mediated vessel formation by targeting the β-catenin pathway. Oncogene 2017 \u003cem\u003e37:9\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e(9), 1175\u0026ndash;1191. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41388-017-0034-x\u003c/span\u003e\u003cspan address=\"10.1038/s41388-017-0034-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDentelli, P., Rosso, A., Olgasi, C., Camussi, G., \u0026amp; Brizzi, M. F. (2011). IL-3 is a novel target to interfere with tumor vasculature. Oncogene 2011 \u003cem\u003e30:50\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(50), 4930\u0026ndash;4940. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/onc.2011.204\u003c/span\u003e\u003cspan address=\"10.1038/onc.2011.204\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZiegler, M. E., Hatch, M. M. S., Wu, N., Muawad, S. A., \u0026amp; Hughes, C. C. W. (2016). mTORC2 mediates CXCL12-induced angiogenesis. Angiogenesis, \u003cem\u003e19\u003c/em\u003e(3), 359\u0026ndash;371. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10456-016-9509-6\u003c/span\u003e\u003cspan address=\"10.1007/s10456-016-9509-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWihastuti, T. A., Sargowo, D., Tjokroprawiro, A., Permatasari, N., Widodo, M. A., \u0026amp; Soeharto, S. (2014). Vasa vasorum anti-angiogenesis through H2O2, HIF-1α, NF-κB, and iNOS inhibition by mangosteen pericarp ethanolic extract (Garcinia mangostana Linn) in hypercholesterol-diet-given Rattus norvegicus Wistar strain. Vascular Health and Risk Management, \u003cem\u003e10\u003c/em\u003e, 523\u0026ndash;531. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2147/VHRM.S61736\u003c/span\u003e\u003cspan address=\"10.2147/VHRM.S61736\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuillot, N., Kollins, D., Badimon, J. J., Schlondorff, D., \u0026amp; Hutter, R. (2013). Accelerated Reendothelialization, Increased Neovascularization and Erythrocyte Extravasation after Arterial Injury in BAMBI-/- Mice. PLoS ONE, \u003cem\u003e8\u003c/em\u003e(3), 1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0058550\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0058550\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerrotta, P., Pintelon, I., De Vries, M. R., Quax, P. H. A., Timmermans, J. P., De Meyer, G. R. Y., \u0026amp; Martinet, W. (2020). Three-Dimensional Imaging of Intraplaque Neovascularization in a Mouse Model of Advanced Atherosclerosis. Journal of Vascular Research, \u003cem\u003e57\u003c/em\u003e(6), 348\u0026ndash;354. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000508449\u003c/span\u003e\u003cspan address=\"10.1159/000508449\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimonini, A., Moscucci, M., Muller, D. W. M., Bates, E. R., Pagani, F. D., Burdick, M. D., \u0026amp; Strieter, R. M. (2000). IL-8 is an angiogenic factor in human coronary atherectomy tissue. Circulation, \u003cem\u003e101\u003c/em\u003e(13), 1519\u0026ndash;1526. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/01.CIR.101.13.1519\u003c/span\u003e\u003cspan address=\"10.1161/01.CIR.101.13.1519\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaza, S. L., \u0026amp; Cornelius, L. A. (2000). \u003cem\u003eMatrix Metalloproteinases: Pro- and Anti-Angiogenic Activities\u003c/em\u003e. 47\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe, S., Watts, G. F., Mandalia, S., Humphries, S. E., \u0026amp; Henney, A. M. (1995). \u003cem\u003ePreliminary report: genetic variation in the human stromelysin promoter is associated with progression of coronary atherosclerosis\u003c/em\u003e. 209\u0026ndash;215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe, S., Eriksson, P., Hamsten, A., Kurkinen, M., Humphries, S. E., \u0026amp; Henney, A. M. (1996). \u003cem\u003eProgression of Coronary Atherosclerosis Is Associated with a Common Genetic Variant of the Human Stromelysin-1 Promoter Which Results in Reduced Gene Expression *\u003c/em\u003e. \u003cem\u003e271\u003c/em\u003e(22), 13055\u0026ndash;13060.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, J., Zhou, Y., Huang, H.-C., \u0026amp; Mitchison, T. J. (2011). Navitoclax (ABT-263) Accelerates Apoptosis during Drug-Induced Mitotic Arrest by Antagonizing Bcl-xL. Cancer Research, \u003cem\u003e71\u003c/em\u003e(13), 4518\u0026ndash;4526. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.CAN-10-4336\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-10-4336\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuvarna, V., Singh, V., \u0026amp; Murahari, M. (2019). Current overview on the clinical update of Bcl-2 anti-apoptotic inhibitors for cancer therapy. European Journal of Pharmacology, \u003cem\u003e862\u003c/em\u003e, 172655. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejphar.2019.172655\u003c/span\u003e\u003cspan address=\"10.1016/j.ejphar.2019.172655\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamad Anuar, N. N., Nor Hisam, N. S., Liew, S. L., \u0026amp; Ugusman, A. (2020). Clinical Review: Navitoclax as a Pro-Apoptotic and Anti-Fibrotic Agent. Frontiers in Pharmacology, \u003cem\u003e11\u003c/em\u003e(564108), 1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2020.564108\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2020.564108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, J., Jin, S., Abraham, V., Huang, X., Liu, B., Mitten, M. J., Nimmer, P., Lin, X., Smith, M., Shen, Y., Shoemaker, A. R., Tahir, S. K., Zhang, H., Ackler, S. L., Rosenberg, S. H., Maecker, H., Sampath, D., Leverson, J. D., Tse, C., \u0026amp; Elmore, S. W. (2011). The Bcl-2/Bcl-X L /Bcl-w Inhibitor, Navitoclax, Enhances the Activity of Chemotherapeutic Agents In Vitro and In Vivo. Molecular Cancer Therapeutics, \u003cem\u003e10\u003c/em\u003e(12), 2340\u0026ndash;2349. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1535-7163.MCT-11-0415\u003c/span\u003e\u003cspan address=\"10.1158/1535-7163.MCT-11-0415\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTse, C., Shoemaker, A. R., Adickes, J., Anderson, M. G., Chen, J., Jin, S., Johnson, E. F., Marsh, K. C., Mitten, M. J., Nimmer, P., Roberts, L., Tahir, S. K., Xiao, Y., Yang, X., Zhang, H., Fesik, S., Rosenberg, S. H., \u0026amp; Elmore, S. W. (2008). ABT-263: A potent and orally bioavailable Bcl-2 family inhibitor. Cancer Research, \u003cem\u003e68\u003c/em\u003e(9), 3421\u0026ndash;3428. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.CAN-07-5836\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-07-5836\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGandhi, L., Camidge, D. R., De Oliveira, M. R., Bonomi, P., Gandara, D., Khaira, D., Hann, C. L., McKeegan, E. M., Litvinovich, E., Hemken, P. M., Dive, C., Enschede, S. H., Nolan, C., Chiu, Y. L., Busman, T., Xiong, H., Krivoshik, A. P., Humerickhouse, R., Shapiro, G. I., \u0026amp; Rudin, C. M. (2011). Phase I study of navitoclax (ABT-263), a novel bcl-2 family inhibitor, in patients with small-cell lung cancer and other solid tumors. Journal of Clinical Oncology, \u003cem\u003e29\u003c/em\u003e(7), 909\u0026ndash;916. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1200/JCO.2010.31.6208\u003c/span\u003e\u003cspan address=\"10.1200/JCO.2010.31.6208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cem\u003eClinical Cancer Research\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(11), 3163\u0026ndash;3169. https://doi.org/10.1158/1078-0432.CCR-11-3090\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts, A. W., Seymour, J. F., Brown, J. R., Wierda, W. G., Kipps, T. J., Khaw, S. L., Carney, D. A., He, S. Z., Huang, D. C. S., Xiong, H., Cui, Y., Busman, T. A., McKeegan, E. M., Krivoshik, A. P., Enschede, S. H., \u0026amp; Humerickhouse, R. (2012). Substantial susceptibility of chronic lymphocytic leukemia to BCL2 inhibition: Results of a phase I study of navitoclax in patients with relapsed or refractory disease. Journal of Clinical Oncology, \u003cem\u003e30\u003c/em\u003e(5), 488\u0026ndash;496. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1200/JCO.2011.34.7898\u003c/span\u003e\u003cspan address=\"10.1200/JCO.2011.34.7898\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilson, W. H., O\u0026rsquo;Connor, O. A., Czuczman, M. S., LaCasce, A. S., Gerecitano, J. F., Leonard, J. P., Tulpule, A., Dunleavy, K., Xiong, H., Chiu, Y. L., Cui, Y., Busman, T., Elmore, S. W., Rosenberg, S. H., Krivoshik, A. P., Enschede, S. H., \u0026amp; Humerickhouse, R. A. (2010). Navitoclax, a targeted high-affinity inhibitor of BCL-2, in lymphoid malignancies: A phase 1 dose-escalation study of safety, pharmacokinetics, pharmacodynamics, and antitumour activity. The Lancet Oncology, \u003cem\u003e11\u003c/em\u003e(12), 1149\u0026ndash;1159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1470-2045(10)70261-8\u003c/span\u003e\u003cspan address=\"10.1016/S1470-2045(10)70261-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, E. Y., Gong, E. Y., Shin, J. S., Moon, J. H., Shim, H. J., Kim, S. M., Lee, S., Jeong, J., Gong, J. H., Kim, M. J., Lee, D. H., Park, Y. S., Shin, J., Hong, S. W., Kim, Y. S., \u0026amp; Jin, D. H. (2018). Human breast cancer cells display different sensitivities to ABT-263 based on the level of survivin. Toxicology in Vitro, \u003cem\u003e46\u003c/em\u003e, 229\u0026ndash;236. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tiv.2017.09.023\u003c/span\u003e\u003cspan address=\"10.1016/j.tiv.2017.09.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, I. H., Jung, J. Y., Kim, S. H., Yoo, E. S., Cho, N. P., Lee, H., Lee, J. Y., Hong, S. D., Shin, J. A., \u0026amp; Cho, S. D. (2019). ABT-263 exhibits apoptosis-inducing potential in oral cancer cells by targeting C/EBP-homologous protein. Cellular Oncology, \u003cem\u003e42\u003c/em\u003e(3), 357\u0026ndash;368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13402-019-00431-5\u003c/span\u003e\u003cspan address=\"10.1007/s13402-019-00431-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNor Hisam, N. S., Ugusman, A., Rajab, N. F., Ahmad, M. F., Fenech, M., Liew, S. L., \u0026amp; Mohamad Anuar, N. N. (2021). Combination therapy of navitoclax with chemotherapeutic agents in solid tumors and blood cancer: A review of current evidence. Pharmaceutics, \u003cem\u003e13\u003c/em\u003e(9). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pharmaceutics13091353\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics13091353\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cem\u003eJournal of Medicinal Chemistry\u003c/em\u003e, \u003cem\u003e50\u003c/em\u003e(4), 641\u0026ndash;662. https://doi.org/10.1021/jm061152t\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, J., Nie, Z., Lei, Y., Yang, S., \u0026amp; Liu, Z. (2017). The expression of ERβ2, Bcl-xl and Bax in non-small cell lung cancer and associated with prognosis. International Journal of Clinical \u0026amp; Experimental Pathology, \u003cem\u003e10\u003c/em\u003e(9), 10040\u0026ndash;10046. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003c/span\u003e\u003cspan address=\"http://www.ijcep.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLimana, F., Urbanek, K., Chimenti, S., Quaini, F., Leri, A., Kajstura, J., Nadal-Ginard, B., Izumo, S., \u0026amp; Anversa, P. (2002). Bcl-2 overexpression promotes myocyte proliferation. Proceedings of the National Academy of Sciences of the United States of America, \u003cem\u003e99\u003c/em\u003e(9), 6257\u0026ndash;6262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/PNAS.092672899\u003c/span\u003e\u003cspan address=\"10.1073/PNAS.092672899\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoss, J. S., Stagliano, N. E., Donovan, M. J., Breitbart, R. E., \u0026amp; Ginsburg, G. S. (2001). Atherosclerosis and cancer: common molecular pathways of disease development and progression. Annals of the New York Academy of Sciences, \u003cem\u003e947\u003c/em\u003e(1), 271\u0026ndash;293. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/J.1749-6632.2001.TB03949.X\u003c/span\u003e\u003cspan address=\"10.1111/J.1749-6632.2001.TB03949.X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTapia-Vieyra, J. V., Delgado-Coello, B., \u0026amp; Mas-Oliva, J. (2017). Atherosclerosis and Cancer; A Resemblance with Far-reaching Implications. Archives of Medical Research, \u003cem\u003e48\u003c/em\u003e(1), 12\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.ARCMED.2017.03.005\u003c/span\u003e\u003cspan address=\"10.1016/J.ARCMED.2017.03.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUgusman, A., Zakaria, Z., Hui, C. K., \u0026amp; Nordin, N. A. M. M. (2010). Piper sarmentosum increases nitric oxide production in oxidative stress: a study on human umbilical vein endothelial cells. Clinics, \u003cem\u003e65\u003c/em\u003e(7), 709\u0026ndash;714. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S1807-59322010000700010\u003c/span\u003e\u003cspan address=\"10.1590/S1807-59322010000700010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSundar, U. M., Ugusman, A., Chua, H. K., Latip, J., \u0026amp; Aminuddin, A. (2019). Piper sarmentosum promotes endothelial nitric oxide production by reducing asymmetric dimethylarginine in tumor necrosis factor-α-induced human umbilical vein endothelial cells. Frontiers in Pharmacology, \u003cem\u003e10\u003c/em\u003e(SEP), 1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2019.01033\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2019.01033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamid, A., Azmi, M. A., Rajab, N. F., Awang, N., \u0026amp; Jufri, N. F. (2020). Cytotoxic effects of organotin(IV) dithiocarbamate compounds with different functional groups on leukemic cell line, K-562. Sains Malaysiana, \u003cem\u003e49\u003c/em\u003e(6), 1421\u0026ndash;1430. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.17576/jsm-2020-4906-20\u003c/span\u003e\u003cspan address=\"10.17576/jsm-2020-4906-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLatif, M. A., Ibrahim, F. W., Arshad, S. A., Hui, C. K., Jufri, N. F., \u0026amp; Hamid, A. (2019). Cytotoxicity, proliferation and migration rate assessments of human dermal fibroblast adult cells using zingiber zerumbet extract. Sains Malaysiana, \u003cem\u003e48\u003c/em\u003e(1), 121\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.17576/jsm-2019-4801-14\u003c/span\u003e\u003cspan address=\"10.17576/jsm-2019-4801-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishna Vedula, S. R., Ravasio, A., Lim, C. T., \u0026amp; Ladoux, B. (2013). Collective Cell Migration: A Mechanistic Perspective. Physiology, \u003cem\u003e28\u003c/em\u003e, 370\u0026ndash;379. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/physiol.00033.2013\u003c/span\u003e\u003cspan address=\"10.1152/physiol.00033.2013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarpentier, G. (2012). \u003cem\u003eAngiogenesis Analyzer for ImageJ - Gilles Carpentier Research Web Site: Computer Image Analysis\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ\u003c/span\u003e\u003cspan address=\"http://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u0026amp;artpage=4-6\u0026amp;lang=en\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, Y., Tchkonia, T., Fuhrmann-Stroissnigg, H., Dai, H. M., Ling, Y. Y., Stout, M. B., Pirtskhalava, T., Giorgadze, N., Johnson, K. O., Giles, C. B., Wren, J. D., Niedernhofer, L. J., Robbins, P. D., \u0026amp; Kirkland, J. L. (2016). Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors. Aging Cell, \u003cem\u003e15\u003c/em\u003e(3), 428\u0026ndash;435. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/acel.12445\u003c/span\u003e\u003cspan address=\"10.1111/acel.12445\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOw, T. J., Fulcher, C. D., Thomas, C., Broin, P., L\u0026oacute;pez, A., Reyna, D. E., Smith, R. V., Sarta, C., Prystowsky, M. B., Schlecht, N. F., Schiff, B. A., Rosenblatt, G., Belbin, T. J., Harris, T. M., Childs, G. C., Kawachi, N., Guha, C., \u0026amp; Gavathiotis, E. (2019). Optimal targeting of BCL-family proteins in head and neck squamous cell carcinoma requires inhibition of both BCL-xL and MCL-1. Oncotarget, \u003cem\u003e10\u003c/em\u003e(4), 494\u0026ndash;510. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/oncotarget.26563\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.26563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLock, R., Carol, H., Houghton, P. J., Morton, C. L., Anders Kolb, E., Gorlick, R., Patrick Reynolds, C., Maris, J. M., Keir, S. T., Wu, J., \u0026amp; Smith, M. A. (2008). Initial testing (stage 1) of the BH3 mimetic ABT-263 by the pediatric preclinical testing program. Pediatric Blood and Cancer, \u003cem\u003e50\u003c/em\u003e(6), 1181\u0026ndash;1189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/pbc.21433\u003c/span\u003e\u003cspan address=\"10.1002/pbc.21433\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrezella, C., Fernandez-Rebollo, E., Franzen, J., Ventura Ferreira, M. S., Beier, F., \u0026amp; Wagner, W. (2018). Effects of senolytic drugs on human mesenchymal stromal cells. Stem Cell Research and Therapy, \u003cem\u003e9\u003c/em\u003e(1), 1\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-018-0857-6\u003c/span\u003e\u003cspan address=\"10.1186/s13287-018-0857-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLombardo, G., Dentelli, P., Togliatto, G., Rosso, A., Gili, M., Gallo, S., Deregibus, M. C., Camussi, G., \u0026amp; Brizzi, M. F. (2016). Activated Stat5 trafficking Via Endothelial Cell-derived Extracellular Vesicles Controls IL-3 Pro-angiogenic Paracrine Action. Scientific Reports, \u003cem\u003e6\u003c/em\u003e(1), 1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep25689\u003c/span\u003e\u003cspan address=\"10.1038/srep25689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"ABT-263, angiogenesis, cell viability, HUVEC, migration","lastPublishedDoi":"10.21203/rs.3.rs-2759691/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2759691/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNavitoclax is an effective pro-apoptotic agent against cancer cells. Uncontrolled cell survival is a hallmark of pathological angiogenesis in cancer and could promote plaque instability that contributes to atherosclerosis progression owing to intraplaque neovascularization. Cancer cell inhibition by navitoclax can restrain metastasis; therefore, it is possible to reduce endothelial cells survival and is expected to confer a novel therapeutic strategy for advanced atherosclerosis in regards to plaque instability. However, regulation of endothelial cell activity by navitoclax is yet to be examined. This study will analyze navitoclax efficacy in modulating human umbilical vein endothelial cells (HUVEC) viability, proliferation, migration and angiogenesis. Navitoclax concentrations ranging from 0.2 to 3.0\u0026micro;M at four-time points; 18-, 24-, 48- and 72-hours were used for MTT assay. The IC\u003csub\u003e50\u003c/sub\u003e value for 18-hours post-treatment was undefined due to low efficacy at a limited time. While for 24-, 48- and 72-hours, the IC\u003csub\u003e50\u003c/sub\u003e values were 0.91\u0026micro;M, 0.72\u0026micro;M, and 0.12\u0026micro;M, respectively. Navitoclax potency to inhibit HUVEC viability increased as the treatment time elevated. 0.9\u0026micro;M navitoclax for 24 hours treatment was selected for subsequent experiments. Next, 25 ng/ml IL-3 was used to induce the \u003cem\u003ein-vitro\u003c/em\u003e angiogenesis model within 6 hours. Expectedly, navitoclax reduced the tube formation and migration of HUVEC induced by IL-3 in consistent with CXCL-8 released and MMP-3 expression in the cell. However, HUVEC proliferative activity was not affected by navitoclax treatment, as well as the BCL-2 gene expression. Therefore, an anti-angiogenic effect of navitoclax on HUVEC by preventing the cell motility through CXCL-8 and MMP-3 mechanism is determined.\u003c/p\u003e","manuscriptTitle":"Navitoclax mediates Interleukin-3 induced human umbilical vein endothelial cells survival and angiogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-04-04 21:42:12","doi":"10.21203/rs.3.rs-2759691/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b5c442d3-1960-4d0a-8d43-67193341d05d","owner":[],"postedDate":"April 4th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-06-25T18:59:25+00:00","versionOfRecord":[],"versionCreatedAt":"2023-04-04 21:42:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2759691","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2759691","identity":"rs-2759691","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}