Components of Salvia miltiorrhiza and Panax notoginseng against OGD/R-treated injury in Pericytes via regulating PI3K/AKT and JNK/ERK/P38 signaling pathways

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

Salvianolic acid B, Salvianolic acid D, Notoginsenoside R1, Ginsenoside Rb1, and Ginsenoside Rg1 protect pericytes from ischemic injury by inhibiting oxidative stress and apoptosis via PI3K/AKT/mTOR and JNK/ERK/P38 pathways.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

This preprint evaluated whether specific components of Salvia miltiorrhiza and Panax notoginseng—salvianolic acid B and D and several ginsenosides and notoginsenoside—protect mouse cerebrovascular pericytes from oxygen-glucose deprivation/reoxygenation injury, using CCK-8 viability, ROS/SOD assays, flow cytometry for apoptosis, scratch migration assays, and western blot for PI3K/AKT/mTOR and JNK/ERK/P38 pathway proteins plus angiogenesis-related factors (VEGF, Ang-1, PDGFR-β). The reported results were that the tested components increased pericyte viability, reduced oxidative stress, decreased apoptosis markers (Bcl-2/Bax shifts and reduced cleaved caspase-3), promoted migration, and upregulated Ang-1, PDGFR-β, and VEGF while activating PI3K/AKT/mTOR and inhibiting JNK/ERK/P38 signaling. A key limitation explicitly acknowledged by the authors is that the work is an under-review, non-peer-reviewed preprint. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Salvia miltiorrhiza (SAL) and Panax notoginseng (PNS) is widely used for the treatment of ischemic stroke. However, what components of SAL and PNS protect brain microvascular pericytes after ischemic stroke remains unclear. We evaluated protective effects and mechanisms of the components of SAL and PNS in pericytes subjected to oxygen-glucose deprivation /reoxygenation (OGD/R). Pericytes were subjected to OGD/R. Cell Counting Kit-8 (CCK-8) was performed to evaluate cell viability. ROS and SOD kits were performed to detect oxidative stress. Flow cytometry was performed to analyze cells apoptosis. Scratch assay was performed to evaluate cells migration. Western blot was performed to detected expression of apoptosis proteins, VEGF, Ang-1, PDGFRβ, PI3K/AKT and JNK/ERK/P38 signaling pathways. Results showed Salvianolic acid B (Sal B), Salvianolic acid B (Sal D), Notoginsenoside R1(R1), Ginsenoside Rb1 (Rb1) and Ginsenoside Rg1 (Rg1) increased cell viability of pericytes subjected to OGD/R, reduced the level of ROS and increased the expression of SOD. The components reduced cells apoptosis, increased the proteins level of Bcl-2/Bax, reduced the level of Cleaved caspased3/caspase3, increased cells migration and enhanced the levels of Ang-1, PDGFR-β and VEGF. The components could activate PI3K/AKT/mTOR pathway, inhibit JNK/ERK/P38 pathway. Studies found that Sal B, Sal D, R1, Rb1 and Rg1 inhibited oxidative stress and apoptosis, increased release of pro-angiogenic regulators of pericytes-related to PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways. This provides a candidate basis for the development of monomeric drugs for treatment of ischemic stroke.
Full text 115,604 characters · extracted from preprint-html · click to expand
Components of Salvia miltiorrhiza and Panax notoginseng against OGD/R-treated injury in Pericytes via regulating PI3K/AKT and JNK/ERK/P38 signaling pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Components of Salvia miltiorrhiza and Panax notoginseng against OGD/R-treated injury in Pericytes via regulating PI3K/AKT and JNK/ERK/P38 signaling pathways Tong Zhang, Wenjie Liu, Juan Yang, Haiying Xu, Jin Sun, Bing Liang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1984984/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Salvia miltiorrhiza (SAL) and Panax notoginseng (PNS) is widely used for the treatment of ischemic stroke. However, what components of SAL and PNS protect brain microvascular pericytes after ischemic stroke remains unclear. We evaluated protective effects and mechanisms of the components of SAL and PNS in pericytes subjected to oxygen-glucose deprivation /reoxygenation (OGD/R). Pericytes were subjected to OGD/R. Cell Counting Kit-8 (CCK-8) was performed to evaluate cell viability. ROS and SOD kits were performed to detect oxidative stress. Flow cytometry was performed to analyze cells apoptosis. Scratch assay was performed to evaluate cells migration. Western blot was performed to detected expression of apoptosis proteins, VEGF, Ang-1, PDGFRβ, PI3K/AKT and JNK/ERK/P38 signaling pathways. Results showed Salvianolic acid B (Sal B), Salvianolic acid B (Sal D), Notoginsenoside R1(R1), Ginsenoside Rb1 (Rb1) and Ginsenoside Rg1 (Rg1) increased cell viability of pericytes subjected to OGD/R, reduced the level of ROS and increased the expression of SOD. The components reduced cells apoptosis, increased the proteins level of Bcl-2/Bax, reduced the level of Cleaved caspased3/caspase3, increased cells migration and enhanced the levels of Ang-1, PDGFR-β and VEGF. The components could activate PI3K/AKT/mTOR pathway, inhibit JNK/ERK/P38 pathway. Studies found that Sal B, Sal D, R1, Rb1 and Rg1 inhibited oxidative stress and apoptosis, increased release of pro-angiogenic regulators of pericytes-related to PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways. This provides a candidate basis for the development of monomeric drugs for treatment of ischemic stroke. Pericytes OGD/R Oxidative stress Apoptosis Angiogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Ischemic stroke, which accounts for 85% of strokes, is a disease that severely damages the central nervous system (CNS) (Cordonnier et al. 2018 ). It greatly threatens human health and aggravates the burden of the social medical system (Amarenco et al. 2020 ). Ischemic stroke involves the death of brain tissue caused by insufficient supply of blood and oxygen which is due to the blood flow reduced or obstructed. There are a various of pathophysiological events will occur, such as impaired brain microcirculation, microvascular dysfunction, destruction of the blood-brain barrier (BBB) and inadequate energy supply to neurons, etc (Cheng et al. 2018 ). Pericytes, as one of the main cells of CNS (Daneman and Prat 2015 ), are typical multifunctional parietal cells. Pericytes have been reported perform several important functions in the brain, including maintaining the development and stability of the BBB, regulating vascular stability, angiogenesis, cerebral blood flow and removing toxic neuro substances, etc (Brown et al. 2019 ; Geranmayeh et al. 2019 ). The protection of pericytes may be a new therapeutic direction for improving ischemic stroke. Therefore, we sought to find the active ingredients of protective pericytes in the treatment of ischemic stroke. Salvia miltiorrhiza (SAL) is mainly composed of Sal B, Sal D, Lithospermic acid (La) and Caffeic acid (Ca), among which Sal B accounts for the largest proportion, up to 61.9% (Wang et al. 2017a ). Panax notoginseng (PNS) is composed of Rb1, Rg1, R1, Ginsenoside Rd (Rd) and Ginsenoside Re (Re) (Gui et al. 2013). Researches showed the SAL main component, Sal B, reduced the treatment of cerebral infarction with significant effect (Ling et al. 2018 ). the PNS component, Rb1, played a protective role in focal cerebral neuronal injury rats subjected to I/R through inhibiting HMGB1 inflammatory signal (Liu et al. 2018 ). Rg1 had the effects of anti-oxidation, anti-aging and enhancing the memory of brain-damaged mice, reducing neuronal apoptosis (Chu et al. 2019 ; Xie et al. 2018 ). R1 could effectively improve blood supply to infarcts which was mainly realized by scavenging free radicals and blocking calcium ion channels (Wang et al. 2017b ). However, the effects and mechanisms of these components on pericytes remain to be studied. Previous research of our group showed that the combination of SAL and PNS increased cerebral blood flow, reduce oxidative stress response, maintain the integrity of the blood-brain barrier and recover neurological injury in rats after I/R injury (Wang et al. 2018a ; Yuan et al. 2022 ). However, it is not clear what components of SAL and PNS exert the anti-I/R injury effects. We cultured mouse cerebrovascular pericytes (MBVP)-an immortallised cell line in vitro to further clarify the role of the active components of SAL and PNS in the treatment of ischemic stroke and elucidate the mechanisms, in order to provide more experimental basis for clinical practice. Materials And Methods Drugs Sal D (Batch No. P22N9F75815) was provided by Shanghai yuanye Bio-Technology Co, Ltd (Shanghai, China). Sal B (Batch No.18062901), Fa (Batch No.17092501), La (Batch No.18042602), Ra (Batch No.18030901), Ca (Batch No.171228041), R1(Batch No.18052908), Rb1 (Batch No.18082204), Rg1(Batch No.18071601), Rd (Batch No.18011503) and Re (Batch No.18062501) were provided by Chengdu Feipude Biotechnology Co, Ltd (Chengdu, China). Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re were dissolved in sterile water. They were diluted with DMEM to the final concentration. Pericytes culture MBVP were obtained from BeNa Culture Collection (Beijing, China, BNCC 342014) cultured in MBVP growth media (89%DMEM+ 10% FBS+1% penicillin and streptomycin (Gibco, New York, USA)). The cells were placed in a 37℃incubator containing 5% CO 2 . When the cells grew to 80% - 90%, they were passed for subsequent experiments. Oxygen–glucose deprivation, drug treatments MBVP were washed with PBS (Solarbio, Beijing, Chain) and cultured in glucose-free DMEM (Gibco, New York, USA). Then placed MBVP in 37°C anoxic chamber (Stemcell, Vancouver, Canada) which was filled with 95 % N 2 and 5 % CO 2 for 6 h. After hypoxia, medium of the OGD/R group was changed to DMEM (Gibco, New York, USA). Medium of the treatment group was changed to the DMEM (Gibco, New York, USA) containing drugs of Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re. And then cultured at 37℃ incubator containing 5% CO 2 for 18 h. The control group was cultured in DMEM for 24 h in 37℃incubator with 5% CO 2 . Detection of cell viability Cells were cultured in 96-plates and exposed to OGD 4 h followed by reoxygenation 20 h (OGD4h /R20h). Then, cell viability was measured using Cell Counting Kit-8 (CCK-8, CK04, Japan). DMEM with 10% CCK-8 solution was added to the cells which were washed once with HBSS. Cells were placed in 37 °C incubator for 30-60 mins. The absorbance was measured at 450 nm using a microplate analyzer (Infinite F50, Switzerland). Lactic dehydrogenase (LDH) release was measured using LKolate Dehydrogenase Assay Kit after OGD 4 h followed by reoxygenation 20 h (CK12, Japan). bEnd.3 cells supernatant were collected and centrifuged (4℃, 1000 rpm, 5min). 50µl of each sample and 50µl of reaction mixture was pipetted into a 96-well plate. The absorbance of the plates was measured at 490 nm with a microplate analyzer (Infinite F50, Switzerland). Detection of SOD and ROS The MBVP were seeded in 96-well plates, OGD 6 h/R 18 h were performed after the cells fused. Then, Superoxide Dismutase (SOD) and Reactive Oxygen Species (ROS) of MBVP in each group were detected according to the manufacturer’s instructions of SOD Activity Kit (Nanjing Jiancheng Bioengineering Institute, Nangjing, Chain) and ROS Assay Kit (Beyotime Institute of Biotechnoligy, Shanghai, Chain). Flow Cytometry MBVP were dissociated with trypsin after OGD/R. The cells were collected after centrifuged at 500g for 5 min, and washed with pre-cooling PBS for 2 times. After re-suspended by binding buffer, the MBVP were labeled with V-FITC and PI was for 10 min. The cells were suspended by binding buffer and detected by Flow Cytometry. The assay was performed according to manufacturer’s instructions of Annexin V-FITC/PI Cell Apoptosis Detection Kit (40302ES60, Yeasen Biotechnology, Shanghai, China). Scratch assay MBVP were seeded in 6-well plates, OGD 6 h/R 18 h were performed after the cells fused. Then, 200 μL pipette tips were used to make the scratch gap. Photos were taken at the following 12 h, 24 h and 48 h. Quantitative analysis was conducted with Image J software,as previously described (Fu et al. 2019). Wound healing rate(WH)= [the wound area at time ( 12h,24h,48h-) its initial area( 0h)]/ its initial area(0 h) × 100%. Western blotting After OGD 6 h reperfusion for 18 h, the proteins were extracted from the 6-well plate using RIPA lysis buffer and were quantified according to the instructions of the BCA kit (23227, Thermo Fisher Scientific). The treated sample was added to a 4%-12% SDS-PAGE gel to separate the proteins by size. The separated proteins transferred to PVDF membranes were scaled with 5% skim milk. The antibodies JNK (ab124956, Abcam, Cambridge, USA), p-JNK (ab47337, Abcam), Caspase-3 (ab13847, Abcam), PI3K(ab151549, Abcam), p-mTOR (ab84400, Abcam), mTOR (ab32028, Abcam), PDGFR-β (ab32570, Abcam), VEGF (ab32152, Abcam), Cleaved-Caspase-3 (9661S, CST, Bostom, USA), AKT (4691S, CST), p-AKT(4060S, CST), p-P38 (4511S, CST), P38(8690S, CST), p-ERK(4370, CST), ERK(12950, CST), Bcl-2 (3498S, CST), β-actin (4967S, CST), Bax (14796S, CST), Ang-1 (BS2829, Bioword, USA) were diluted in PBS at a ratio of 1:1000. PDVF membranes were incubated overnight in antibodies at 4 ° C. Membranes were washed with TBST, and incubate with goat anti-rabbit or oat anti-mouse (zsgb-bio, Beijing, China) horseradish peroxidase for 1h. The blots were observed with Amersham imager 600 (GE Healthcare, Chicago, US), the gray value was analyzed by Image J software. Real-Time PCR After OGD 6 h reperfusion for 18 h, the total RNA was extracted from the 6-well plate using the TRIzol® reagent (Invitrogen/Life Technologies, Carlsbad, CA). The cDNA reverse transcription kit (Applied Biosystems, Foster City, USA) was used to generate cDNA. The mRNA was carried out using SYBR Green PCR Mix Kit (CWBIO, Jiangsu, Chain) with 7500 sequence detection system (Applied Biosystems, Foster City, USA). The mRNA level was normalized to β-actin level, old change calculated according to the threshold cycle (Ct) =2(− ΔΔCt) of the treated cells with respect to target amplification. Specific primers which were designed by Nanjing Jiancheng Institute of Biology (shanghai, China) are listed in Table 1. Table 1 Primer sequences Genes Primer/Probe sequences(5’to3’) β-actin F 5’-GTAAAGACCTCTATGCCAACA-3’ R 5’-GGACTCATCGTACTCCTGCT-3’ Ang-1 F 5’- CACAGGGACAGCAGGCAAACAG -3’ R 5’- CACAGGCATCGAACCACCAACC -3’ VEGF F 5’- CACAGGGACAGCAGGCAAACAG -3’ R 5’- CACAGGCATCGAACCACCAACC -3’ PDGFR-β F 5’- CACCTTCTTGCAGCGACACTCC -3’ R 5’- TCCATGTAGCCACCGTCACTCTC -3’ Statistical Analysis Between different groups were performed by one-way ANOVA analysis with Tukey’s multiple comparison test using SPSS 18.0 statistical software. Data are presented as mean±SEM from at least three independent experiments. P <0.05 was considered as significant. Results Components of SAL and PNS increased the viability of MBVP subjected to OGD/R First, we evaluated the cells viability and LDH release of MBVP subjected to OGD 4 h/R20 h, OGD 6 h/R18 h and OGD 8 h/R16 h to screen optimal hypoxia/reoxygenation time. The results showed that OGD 6 h/R18 h damaged MBVP properly and met experimental requirements ( vs Control, P <0.05, Fig 1A-B). Therefore, OGD 6 h/R18 h was selected to establish the model mimicking I/R injury. We detected the effects of Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re (0.1 μM-10 μM) on the cell viability of MBVP. The results showed it had no significant difference ( vs Control, Fig 1C). Sal B, Sal D, R1, Rb1 and Rg1 (10 μM) could significantly increase the cell viability of MBVP subjected to OGD6 h/R18 h ( P <0.05, Fig1D). Furthermore, we observed the cell morphology under inverted phase contrast microscope, it was showed that Sal B, Sal D, R1, Rb1 and Rg1 (10 μM) could reduce cells shrinkage and intercellular space of the MBVP subjected to OGD6 h/R18 h ( vs OGD/R, P <0.05, Fig 2). Components of SLA and PNS alleviated oxidative stress of MBVP subjected to OGD/R I/R leads to oxidative stress, resulting in a large accumulation of ROS in cells, which damages cell structure and function (Pizzino et al. 2017). Next, we detected the expression of ROS and SOD in MBVP subjected to OGD/R. The results showed OGD/R group increased the fluorescence intensity of ROS in MBVP ( vs Control, P <0.001, Fig 3A). Sal B, Sal D, R1, Rb1 and Rg1 decreased the fluorescence intensity of ROS ( vs OGD/R, P <0.05, Fig 3A). OGD/R group decreased the activity of SOD in MBVP ( vs Control, P <0.001, Fig 3B). Sal B, Sal D, R1, Rb1 and Rg1 increased the activity of SOD and revealed anti-oxidation in MBVP subjected to OGD/R ( vs OGD/R, P <0.05, Fig 3B). Components of SAL and PNS inhibit the apoptosis of MBVP subjected to OGD/R Oxidative stress damage disrupts intracellular ion homeostasis and induces pericytes death (Malko and Jiang 2020). Therefore, we determined the apoptosis of MBVP subjected to OGD/R. The results illustrated OGD/R group increased the apoptosis cells of MBVP ( vs Control, P <0.05, Fig 4A). Sal B, Sal D, R1and Rb1 could significantly reduce the apoptosis cells in MBVP ( vs OGD/R, P <0.05, Fig 4A). Sal B, Sal D, R1, Rb1and Rg1 reduced the protein level of Cleaved caspase-3/ caspase-3 ( vs OGD/R, P <0.05, Fig 4B). Sal D, R1, Rb1and Rg1 increased the protein level of Bcl-2/ Bax ( vs OGD/R, P <0.05, Fig 4C). Components of SAL and PNS promoted the migration of MBVP subjected to OGD/R Next, we evaluated the effects of Sal B, Sal D, R1, Rb1 and Rg1 promoted the cell migration of MBVP subjected to OGD/R. Researches indicated OGD/R group significantly reduced the capacity of the cell migration of MBVP ( vs Control, P <0.05, Fig 5A-B). R1 increased the capacity of the cell migration of MBVP after reoxygenation for 12 h, 24 h ( vs OGD/R, P <0.05, Fig 5A-B). R1and Rb1 increased the capacity of the migration Of MBVP at the time of reoxygenation for 48 h ( vs OGD/R, P <0.05,Fig 5A-B). Components of SAL and PNS promoted the angiogenesis proteins expression of MBVP subjected to OGD/R We also assessed the expression of the Ang-1, VEGF and PDGFR-β by RT-PCR and WB. The results indicated that OGD/R group decreased the level of Ang-1, VEGF and PDGFR-β in MBVP (mRNA: vs Control, P <0.05, Fig 6A). Sal B, Sal D, R1, Rb1 and Rg1 increased the level of Ang-1; Sal B, R1 and Rb1 increased the level of VEGF; Sal B, R1 and Rb1 increased the level of PDGFR-β (mRNA: vs OGD/R, P <0.05, Fig 6A). R1, Rb1 and Rg1 increased the protein expression of Ang-1(vs OGD/R, P<0.05, Fig 6B-C). Sal D, Rb1 and Rg1 increased the protein expression of VEGF ( vs OGD/R, P <0.05, Fig 6B, 6D). Sal B, Rb1and Rg1 increased the protein expression of PDGFR-β ( vs OGD/R, P <0.05, Fig 6B, 6E). Components of SAL and PNS regulate PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways To clarify the mechanism of Sal B, Sal D, R1, Rb1 and Rg1 protecting MBVP subjected to OGD/R, we detected the PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways. Rg1 increased the level of PI3K ( vs OGD/R, P <0.05, Fig 7A). Sal B, Sal D, R1 and Rg1 increased the level of p-AKT ( vs OGD/R, P <0.05, Fig 7B). Sal B and Sal D increased the level of p-mTOR ( vs OGD/R, P <0.05, Fig 7C). Sal B, Sal D, R1, Rb1 and Rg1 reduced the level of p-JNK ( vs OGD/R, P <0.05, Fig 7D). R1, Rb1 and Rg1 increased the level of p-ERK ( vs OGD/R, P <0.05, Fig 7E). Sal B, Sal D, R1and Rg1 reduced the level of p-P38 ( vs OGD/R, P <0.05, Fig 7F). Discussion In recent years, the research focus of cerebral ischemia has gradually shifted from neurons to other neurovascular unit (NVU) cells. Pericytes, as an important component of NVU, have been paid more and more attention. Ischemic stroke causes pericytes to contract, apoptosis, and detach from blood vessels, resulting in reduced capillary blood flow, BBB damage, and nervous system damage (Yang et al. 2017 ). Therefore, pericyte protection is a new direction in the treatment of ischemic stroke. SAL and PNS are the active ingredients of Salvia miltiorrhiza radix et rhizpma and and Notoginseng radix et rhizome (Liang et al. 2016 ). Studies shown SAL can prevent thrombosis, remove free radicals, promote tissue repair, reduce cerebral infarction area, promote angiogenesis and nerve function recovery (Li et al. 2017 ; Zhang et al. 2017 ). PNS have the effects of anti-inflammatory, anti-oxidation, maintain BBB integrity, protective nervous system in the treatment of ischemia stroke (Pan et al. 2022 ; Zhou et al. 2021 ). Sal B as the one of the main components of SAL plays anti-apoptosis and neuroprotective role in I/R rats (Fan et al. 2018 ). Sal D alleviates I/R injury in rats by inhibiting inflammatory response (Zhang et al. 2020 ). R1, Rb1, Rg1, Rd and Re accounted for more than 90% of PNS (Qu et al. 2020 ). Studies have shown that Rg1 reduced oxidative stress injury of neurons by activating miR-144/Nrf2/ARE pathway (Chu et al. 2019 ). R1could reduce the area of cerebral infarction, and regulate BBB permeability after ischemic stroke (Liu et al. 2021 ). Rb1 promoted axonal regeneration in stroke mice (Gao et al. 2020 ). Due to the importance of pericytes in NVU, this study established MBVP injury model subjected to OGD/R to explore the protective effects of SAL and PNS components-Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re. And it was found that 10 µM of Sal B, Sal D, R1, Rb1, Rg1 certainly increased the cell vitality and improved cell damage of MBVP subjected to OGD/R. During ischemia, oxidative stress response is induced and a large amount of harmful ROS is produced (Simpkins et al. 2016 ). The accumulation of ROS causes cellular dysfunction, which promotes the further development of the disease. However, SOD could limit ROS accumulation and regulate ROS related cellular functional signals (Wang et al. 2018b ). Therefore, we evaluated the expression of ROS and SOD in MBVP after OGD/R. Results showed that Sal B, Sal D, R1, Rb1 and Rg1 could increase the expression of SOD and reduce ROS fluorescence intensity in MBVP subjected to OGD/R. Oxidative stress can lead to apoptosis of pericytes after I/R injury. Pericytes apoptosis results in pericytes loss and BBB destruction, resulting in nervous system damage and cognitive dysfunction (Wu et al. 2020 ). Apoptosis is involved in the Caspase family and Bcl-2 family. In this study, Sal B, Sal D, R1, Rb1 and Rg1 inhibited the apoptosis rate of MBVP subjected to OGD/R. Furthermore, Sal B, Sal D, R1, Rb1 and Rg1 increased the level of Bcl-2 protein and decrease the level of Bax and Caspase-3 proteins in MBVP. Sal B, Sal D, R1, Rb1 and Rg1 played a protective role against OGD/R injury through anti-apoptosis. Pericytes can participate in angiogenesis after ischemic stroke by regulating Ang-1, PDGF-β/PDGFR-β and Ang/Tie signaling pathways (Sweeney et al. 2016 ). Vascular endothelial growth factor (VEGF) which regulate vasculogenesis and angiogenesis was important in the recovery of ischemic stroke (Du et al. 2020 ; Geiseler and Morland 2018 ). Ang-1, a vascular-specific growth factor secreted by pericytes, can bind to Tie-2 of endothelial cells to maintain vascular integrity under stress (Caporali et al. 2017 ; Fujiwara-Sumiyoshi et al. 2021 ). Pericytes can secrete VEGF to induce increased expression of Ang-1, thus promoting angiogenesis (Caporarello et al. 2019 ). Platelet-derived growth factor receptor (PDGFR-β) is an important symbol growth factor for pericytes. It specifically binds to platelet-derived growth factor (PDGF-BB) secreted by endothelial cells to promote the migration, proliferation and attachment of pericytes, maintaining the integrity of BBB and vascular stability, which is another important pathway for pericytes to regulate angiogenesis (Shen et al. 2019 ; Smyth et al. 2022 ). In this study, Sal B, Sal D, R1, Rb1 and Rg1 could up-regulating Ang-1 expression of MBVP after OGD/R injury. Sal B, R1and Rb1 could up-regulating VEGF. Sal B, Rb1and Rg1 could up-regulating PDGFR-β. R1, Rb1and R1 and Rb1 promote MBVP migration subjected to OGD/R. These results suggest that Sal D and Rg1 may regulate angiogenesis by activating Ang-1 signaling pathway. Rb1 may regulate angiogenesis after stroke by activating PDGFR-β signaling pathway to promote pericyte migration after OGD/R injury. PI3K/AKT/mTOR signaling pathway affects the pathological process of stroke by regulating cell migration, proliferation, oxidative stress and apoptosis (Gu et al. 2022 ). Activation of PI3K/AKT/mTOR signaling pathway can inhibit cell apoptosis, protect central nervous system cells and delay the delay the pathological process of stroke (Mulherkar and Tolias 2020 ; Takase and Regenhardt 2021 ). JNK/ERK/P38 signaling pathway plays an important role in regulating cell apoptosis after I/R injury. Activation of JNK/ERK/P38 signaling pathway can lead to inflammation, and apoptosis can aggravate I/R injury (Shvedova et al. 2018 ). We found that Sal B, Sal D, R1, Rb1 and Rg1 could increase the level of PI3K, p-AKT and p-mTOR, activate the PI3K/AKT/mTOR pathway, reduce the level of p-JNK and p-P38, inhibit the JNK/ERK/P38 pathway. This study showed that the active components of SAL and PNS, Sal B, Sal D, R1, Rb1 and Rg1 could inhibit the oxidative damage and apoptosis of pericytes subjected to OGD/R injury, regulate the signal transduction of pericytes to promote angiogenesis, and protect pericytes, so as to exert the neuroprotective role. The mechanisms may be related to PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathway. However, it is still necessary to further explore the specific effects of the two signaling pathways involved in Sal B, Sal D, R1, Rb1 and Rg1 in inhibiting oxidative stress injury, anti-apoptosis and promoting pericyte angiogenesis signal transduction species. The effect and mechanisms of the components of SAL and PNS on MBVP induced by OGD/R are summarized in Table 2. It was concluded that the components of SAL and PNS could exert antioxidant and anti-apoptotic effects. The active components of PNS increased the expression of proangiogenic factors in pericytes, while the components of SAL had a weak effect on this aspect. These results indicate that Sal B, Sal D, R1, Rb1 and Rg1 are potential drugs for the treatment of ischemic stroke and provide candidates for subsequent monomeric drug development. However, it is still necessary to further clarify the role and mechanisms of Sal B, Sal D, R1, Rb1 and Rg1 by cultured primary mouse microvascular pericytes or human brain microvascular pericytes and in vivo experiments. Table 2 The protective mechanisms of the components of SAL and PNS against MBVP subjected to OGD/R. Detection index The components of SAL and PNS (vs OGD/R:- P >0.05, + P< 0.05, ++ P< 0.01, +++ P< 0.01 Sal B Sal D R1 Rb1 Rg1 Cell viability ++ ++ + ++ ++ ROS Level +++ ++ ++ ++ +++ SOD activity ++ +++ + + ++ Cell apoptosis + + + + - Cleave Capase3/Caspase3 + +++ +++ +++ + Bcl-2/Bax - + +++ +++ +++ migration of MBVP - - + + - Ang-1 - - + ++ + VEGF - + - + + PDGFR-β + - - + + PI3K - - - - + p-AKT/AKT +++ ++ ++ - + p-mTOR/MTOR + + - - - p-JNK/JNK +++ +++ +++ ++ ++ p-ERK/ERK - - + + + p-P38/P38 +++ +++ + - - Declarations Author contributions Tong Zhang wrote the manuscript text; Wenjie Liu and Qing Yuan designed the experiments; Tong Zhang and Wenjie Liu analyzed and explained the data; Tong Zhang, Haiying Xu, Jin Sun and Bing Liang prepared the draft manuscript; Lijuan Chai, Qing Yuan and Limin Hu edited the Article; Yushuang Cao, Lichen Guo, Xinyuan Du, Lijuan Chai and Limin Hu reviewed and revised the paper. Competing interests All authors declare he/she has no conflicts of interest. Funding This research was supported by grants from the National Natural Sciences Foundation of China (81573644). References Amarenco P, Kim JS, Labreuche J, Charles H, Giroud M, Lee BC, Mahagne MH, Nighoghossian N, Gabriel Steg P, Vicaut É, Bruckert E (2020) Benefit of Targeting a LDL (Low-Density Lipoprotein) Cholesterol < 70 mg/dL During 5 Years After Ischemic Stroke. Stroke 51(4):1231–1239 Brown LS, Foster CG, Courtney JM, King NE, Howells DW, Sutherland BA (2019) Pericytes and Neurovascular Function in the Healthy and Diseased Brain. Frontiers in cellular neuroscience 13:282 Caporali A, Martello A, Miscianinov V, Maselli D, Vono R, Spinetti G (2017) Contribution of pericyte paracrine regulation of the endothelium to angiogenesis. Pharmacology & therapeutics 171:56–64 Caporarello N, D'Angeli F, Cambria MT, Candido S, Giallongo C, Salmeri M, Lombardo C, Longo A, Giurdanella G, Anfuso CD, Lupo G (2019) Pericytes in Microvessels: From "Mural" Function to Brain and Retina Regeneration. International journal of molecular sciences 20(24):6351 Cheng J, Korte N, Nortley R, Sethi H, Tang Y, Attwell D (2018) Targeting pericytes for therapeutic approaches to neurological disorders. Acta Neuropathol 136(4):507–523 Chu SF, Zhang Z, Zhou X, He WB, Chen C, Luo P, Liu DD, Ai QD, Gong HF, Wang ZZ, Sun HS, Feng ZP, Chen NH (2019) Ginsenoside Rg1 protects against ischemic/reperfusion-induced neuronal injury through miR-144/Nrf2/ARE pathway. Acta Pharmacol Sin 40(1):13–25 Cordonnier C, Demchuk A, Ziai W, Anderson CS (2018) Intracerebral haemorrhage: current approaches to acute management. Lancet (London, England) 392(10154):1257–1268. Daneman R, Prat A (2015) The blood-brain barrier. Cold Spring Harbor perspectives in biology 7(1):a020412 Du J, Yin G, Hu Y, Shi S, Jiang J, Song X, Zhang Z, Wei Z, Tang C, Lyu H (2020) Coicis semen protects against focal cerebral ischemia-reperfusion injury by inhibiting oxidative stress and promoting angiogenesis via the TGFβ/ALK1/Smad1/5 signaling pathway. Aging 13(1):877–893 Fan Y, Luo Q, Wei J, Lin R, Lin L, Li Y, Chen Z, Lin W, Chen Q (2018) Mechanism of salvianolic acid B neuroprotection against ischemia/reperfusion induced cerebral injury. Brain research 1679:125–133. Fu B, Zeng Q, Zhang Z, Qian M, Chen J, Dong W, Li M (2019) Epicatechin Gallate Protects HBMVECs from Ischemia/Reperfusion Injury through Ameliorating Apoptosis and Autophagy and Promoting Neovascularization. Oxidative medicine and cellular longevity 2019:7824684 Fujiwara-Sumiyoshi S, Ueda Y, Fujikawa M, Osaki M, Yamanaka N, Matsumoto T (2021) Mucopolysaccharide polysulfate promotes microvascular stabilization and barrier integrity of dermal microvascular endothelial cells via activation of the angiopoietin-1/Tie2 pathway. Journal of dermatological science 103(1):25–32 Gao X, Zhang X, Cui L, Chen R, Zhang C, Xue J, Zhang L, He W, Li J, Wei S, Wei M, Cui H (2020) Ginsenoside Rb1 Promotes Motor Functional Recovery and Axonal Regeneration in Post-stroke Mice through cAMP/PKA/CREB Signaling Pathway. Brain research bulletin 154:51–60 Geiseler SJ, Morland C (2018) The Janus Face of VEGF in Stroke. International journal of molecular sciences 19(5): 1362. Geranmayeh MH, Rahbarghazi R, Farhoudi M (2019) Targeting pericytes for neurovascular regeneration. Cell communication and signaling: CCS 17(1):26 Gu C, Zhang Q, Li Y, Li R, Feng J, Chen W, Ahmed W, Soufiany I, Huang S, Long J, Chen L (2022) The PI3K/AKT Pathway-The Potential Key Mechanisms of Traditional Chinese Medicine for Stroke. Frontiers in medicine 9:900809 Li Y, Zhang X, Cui L, Chen R, Zhang Y, Zhang C, Zhu X, He T, Shen Z, Dong L, Zhao J, Wen Y, Zheng X, Li P (2017) Salvianolic acids enhance cerebral angiogenesis and neurological recovery by activating JAK2/STAT3 signaling pathway after ischemic stroke in mice. Journal of neurochemistry 143(1):87–99 Liang WY, Chen WJ, Yang GH, Zhu D, Mao X, Shao YY, Wu LF, Zhang XX, Zhang LZ (2016) [Research progress on salvianolic acids of Salvia miltiorrhiza]. Zhongguo Zhong yao za zhi = Zhongguo zhongyao zazhi = China journal of Chinese materia medica 41(5):806–812 Ling C, Liang J, Zhang C, Li R, Mou Q, Qin J, Li X, Wang J (2018) Synergistic Effects of Salvianolic Acid B and Puerarin on Cerebral Ischemia Reperfusion Injury. Molecules (Basel, Switzerland) 23(3):564 Liu A, Zhu W, Sun L, Han G, Liu H, Chen Z, Zhuang L, Jiang W, Xue X (2018) Ginsenoside Rb1 administration attenuates focal cerebral ischemic reperfusion injury through inhibition of HMGB1 and inflammation signals. Experimental and therapeutic medicine 16(4):3020–3026 Liu B, Li Y, Han Y, Wang S, Yang H, Zhao Y, Li P, Wang Y (2021) Notoginsenoside R1 intervenes degradation and redistribution of tight junctions to ameliorate blood-brain barrier permeability by Caveolin-1/MMP2/9 pathway after acute ischemic stroke. Phytomedicine: international journal of phytotherapy and phytopharmacology 90:153660 Malko P, Jiang LH (2020) TRPM2 channel-mediated cell death: An important mechanism linking oxidative stress-inducing pathological factors to associated pathological conditions. Redox biology 37:101755 Mulherkar S, Tolias KF (2020) RhoA-ROCK Signaling as a Therapeutic Target in Traumatic Brain Injury. Cells 9(1):245 Pan YW, Wu DP, Liang HF, Tang GY, Fan CL, Shi L, Ye WC, Li MM (2022) Total Saponins of Panax notoginseng Activate Akt/mTOR Pathway and Exhibit Neuroprotection in vitro and in vivo against Ischemic Damage. Chinese journal of integrative medicine 28(5):410–418 Pizzino G, Irrera N, Cucinotta M, Pallio G, Mannino F, Arcoraci V, Squadrito F, Altavilla D, Bitto A (2017) Oxidative Stress: Harms and Benefits for Human Health. Oxidative medicine and cellular longevity 2017:8416763 Qu J, Xu N, Zhang J, Geng X, Zhang R (2020) Panax notoginseng saponins and their applications in nervous system disorders: a narrative review. Annals of translational medicine 8(22):1525 Shen J, Xu G, Zhu R, Yuan J, Ishii Y, Hamashima T, Matsushima T, Yamamoto S, Takatsuru Y, Nabekura J, Sasahara M (2019) PDGFR-β restores blood-brain barrier functions in a mouse model of focal cerebral ischemia. Journal of cerebral blood flow and metabolism: official journal of the International Society of Cerebral Blood Flow and Metabolism 39(8):1501–1515 Shvedova M, Anfinogenova Y, Atochina-Vasserman EN, Schepetkin IA, Atochin DN (2018) c-Jun N-Terminal Kinases (JNKs) in Myocardial and Cerebral Ischemia/Reperfusion Injury. Frontiers in pharmacology 9:715 Simpkins AN, Dias C, Leigh R (2016) Identification of Reversible Disruption of the Human Blood-Brain Barrier Following Acute Ischemia. Stroke 47(9):2405–2408 Smyth LCD, Highet B, Jansson D, Wu J, Rustenhoven J, Aalderink M, Tan A, Li S, Johnson R, Coppieters N, Handley R, Narayan P, Singh-Bains MK, Schweder P, Turner C, Mee EW, Heppner P, Correia J, Park TI, Curtis MA, Faull RLM, Dragunow M (2022) Characterisation of PDGF-BB:PDGFRβ signalling pathways in human brain pericytes: evidence of disruption in Alzheimer's disease. Communications biology 5(1):235 Sweeney MD, Ayyadurai S, Zlokovic BV (2016) Pericytes of the neurovascular unit: key functions and signaling pathways. Nature neuroscience 19(6):771–783 Takase H, Regenhardt RW (2021) Motor tract reorganization after acute central nervous system injury: a translational perspective. Neural regeneration research 16(6):1144–1149 Wang F, He Q, Wang J, Yuan Q, Guo H, Chai L, Wang S, Hu L, Zhang Y (2017a) Neuroprotective effect of salvianolate lyophilized injection against cerebral ischemia in type 1 diabetic rats. BMC complementary and alternative medicine 17(1):258 Wang FJ, Wang SX, Chai LJ, Zhang Y, Guo H, Hu LM (2018a) Xueshuantong injection (lyophilized) combined with salvianolate lyophilized injection protects against focal cerebral ischemia/reperfusion injury in rats through attenuation of oxidative stress. Acta Pharmacol Sin 39(6):998–1011 Wang Y, Branicky R, Noë A, Hekimi S (2018b) Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. The Journal of cell biology 217(6):1915–1928 Wang Y, Tu L, Li Y, Chen D, Liu Z, Hu X, Wang S (2017b) Notoginsenoside R1 Alleviates Oxygen-Glucose Deprivation/Reoxygenation Injury by Suppressing Endoplasmic Reticulum Calcium Release via PLC. Scientific reports 7(1):16226 Wu Q, Yuan X, Li B, Han R, Zhang H, Xiu R (2020) Salvianolic Acid Alleviated Blood-Brain Barrier Permeability in Spontaneously Hypertensive Rats by Inhibiting Apoptosis in Pericytes via P53 and the Ras/Raf/MEK/ERK Pathway. Drug design, development and therapy 14:1523–1534 Xie W, Zhou P, Sun Y, Meng X, Dai Z, Sun G, Sun X (2018) Protective Effects and Target Network Analysis of Ginsenoside Rg1 in Cerebral Ischemia and Reperfusion Injury: A Comprehensive Overview of Experimental Studies. Cells 7(12):270 Yang S, Jin H, Zhu Y, Wan Y, Opoku EN, Zhu L, Hu B (2017) Diverse Functions and Mechanisms of Pericytes in Ischemic Stroke. Current neuropharmacology 15(6):892–905 Yuan Q, Wang FJ, Jia ZZ, Zhang T, Sun J, Du XY, Wang SX, Chai LJ, Hu LM (2022) Xueshuantong injection combined with Salvianolate lyophilized injection improves the synaptic plasticity against focal cerebral ischemia/reperfusion injury in rats through PI3K/AKT/mTOR and RhoA/ROCK pathways. Brain research 1787:147923 Zhang W, Song J, Li W, Kong D, Liang Y, Zhao X, Du G (2020) Salvianolic Acid D Alleviates Cerebral Ischemia-Reperfusion Injury by Suppressing the Cytoplasmic Translocation and Release of HMGB1-Triggered NF-κB Activation to Inhibit Inflammatory Response. Mediators of inflammation 2020:9049614 Zhang Y, Zhang X, Cui L, Chen R, Zhang C, Li Y, He T, Zhu X, Shen Z, Dong L, Zhao J, Wen Y, Zheng X, Li P (2017) Salvianolic Acids for Injection (SAFI) promotes functional recovery and neurogenesis via sonic hedgehog pathway after stroke in mice. Neurochemistry international 110:38–48 Zhou D, Cen K, Liu W, Liu F, Liu R, Sun Y, Zhao Y, Chang J, Zhu L (2021) Xuesaitong exerts long-term neuroprotection for stroke recovery by inhibiting the ROCKII pathway, in vitro and in vivo. J Ethnopharmacol 272:113943 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 04 Oct, 2022 Reviews received at journal 03 Oct, 2022 Reviewers agreed at journal 28 Sep, 2022 Reviewers invited by journal 26 Aug, 2022 Editor assigned by journal 26 Aug, 2022 Submission checks completed at journal 26 Aug, 2022 First submitted to journal 22 Aug, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1984984","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":131841248,"identity":"40388a6e-aaff-47c4-91fb-7540b6578bb2","order_by":0,"name":"Tong Zhang","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Zhang","suffix":""},{"id":131841249,"identity":"d6d4b9f5-234f-46dc-b6c4-9d331cf20036","order_by":1,"name":"Wenjie Liu","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenjie","middleName":"","lastName":"Liu","suffix":""},{"id":131841251,"identity":"c497c921-0ff5-4895-8bda-ace2ba2d9195","order_by":2,"name":"Juan Yang","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Yang","suffix":""},{"id":131841253,"identity":"c3f01224-ebe5-4e42-a4dd-a4c6324c6b46","order_by":3,"name":"Haiying Xu","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Haiying","middleName":"","lastName":"Xu","suffix":""},{"id":131841257,"identity":"216e76a0-0644-42f2-b9fa-b48c1bce9930","order_by":4,"name":"Jin Sun","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jin","middleName":"","lastName":"Sun","suffix":""},{"id":131841259,"identity":"37ee43b6-25c4-4b1e-af42-d36f03e6b5a7","order_by":5,"name":"Bing Liang","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bing","middleName":"","lastName":"Liang","suffix":""},{"id":131841260,"identity":"b71619fa-acf6-40c5-ac66-e2cf6af39233","order_by":6,"name":"Yushuang Cao","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yushuang","middleName":"","lastName":"Cao","suffix":""},{"id":131841261,"identity":"b5724ab7-fd12-4b27-ac8b-69fefeefbdaa","order_by":7,"name":"Lichen Guo","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lichen","middleName":"","lastName":"Guo","suffix":""},{"id":131841265,"identity":"da303fac-a5f2-49cf-8688-4b1e887ddc1e","order_by":8,"name":"Xinyuan Du","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xinyuan","middleName":"","lastName":"Du","suffix":""},{"id":131841266,"identity":"1a0ea72f-5025-4996-989c-50b9edeec764","order_by":9,"name":"Lijuan Chai","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lijuan","middleName":"","lastName":"Chai","suffix":""},{"id":131841268,"identity":"12bfd0d8-facf-41c9-a56b-2974032cb01c","order_by":10,"name":"Qing Yuan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYPACCQYG9gYGAyjPAK9ahBaew0ClCcRrAelKBhLEaDG4kfzsMU+ZRZ585PsDxbw/7KIZ2Ju3STDU3MGjJc3ccMY5iWLD28kMxjwJybkNPMfKJBiOPcOjJcFM4mObROLG2WAtB3IbJHLMJBgbDuPRkv5NIhGkZeZhqBb5N4S05EBsmS/BDLOFB78WyTNvyiSBfkncwJNsYDgnLTm3jSet2CLhGG4tfMfTt0nzlNUlzm8/+MzgjY1dbj/74Y03PtTg1qJwAESyAV14gIHNAMqGxQ92IN8AVQZkMD/Ao3AUjIJRMApGMAAANXdTJJl5UcMAAAAASUVORK5CYII=","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Qing","middleName":"","lastName":"Yuan","suffix":""},{"id":131841269,"identity":"13d0ab40-cf1c-4873-8762-13446d6d855d","order_by":11,"name":"Limin Hu","email":"","orcid":"","institution":"Tianjin University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Limin","middleName":"","lastName":"Hu","suffix":""}],"badges":[],"createdAt":"2022-08-22 06:44:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1984984/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1984984/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":25850674,"identity":"96a6f287-64c0-4630-bdbd-e3d078ef2b15","added_by":"auto","created_at":"2022-08-30 16:16:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":283684,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSal B, Sal D, R1, Rb1 and Rg1 increased the cell viability of MBVP subjected to OGD 6 h /R18 h.\u003c/strong\u003e MBVP were cultured in 96-well plates. (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eCell viability in MBVP subjected to OGD 4 h/R20 h, OGD 6 h/R18 h and OGD 8 h/R16 h.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eThe value of LDH released in MBVP subjected to OGD 4 h/R20 h, OGD 6 h/R18 h and OGD 8 h/R16 h.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eC\u003c/strong\u003e) The value of the cell viability in MBVP treated with Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re (0.1 μM-10 μM) for 24 h. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eCell viability in MBVP subjected to OGD 6 h/R 18 h. Data are expressed as mean±SEM, n=3 in each group, (##\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs \u003c/em\u003eControl; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs \u003c/em\u003eOGD/R).\u003c/p\u003e","description":"","filename":"floatimage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/43c3cef5ee3a4c87143baa1c.jpg"},{"id":25850675,"identity":"4cf7e79a-fb34-444f-9e18-56f659606324","added_by":"auto","created_at":"2022-08-30 16:16:58","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":258927,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChange in morphology of MBVP treated with Sal B, Sal D, R1, Rb1 and Rg1 followed by OGD6 h/R18 h\u003c/strong\u003e. Scale bar:100μm.\u003c/p\u003e","description":"","filename":"floatimage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/0aa899e1f54965535266dc25.jpg"},{"id":25849806,"identity":"bd011270-5db7-45e3-b4c8-f253147290a5","added_by":"auto","created_at":"2022-08-30 16:06:58","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":136644,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSal B, Sal D, R1, Rb1 and Rg1 regulated the expression of ROS and SOD in MBVP subjected to OGD/R.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) The level of ROS in MBVP. (\u003cstrong\u003eB\u003c/strong\u003e) The activity of SOD in MBVP. Data are expressed as mean±SEM, n=3 in each group, (###\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 \u003cem\u003evs \u003c/em\u003eControl; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 \u003cem\u003evs \u003c/em\u003eOGD/R).\u003c/p\u003e","description":"","filename":"floatimage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/608fc528010965a11792432b.jpg"},{"id":25849805,"identity":"f5425a7c-96d4-4eed-9b9f-47634d78f96e","added_by":"auto","created_at":"2022-08-30 16:06:58","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":433690,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSal B, Sal D, R1, Rb1 and Rg1 reduced apoptosis and related proteins expression of MBVP subjected to OGD/R\u003c/strong\u003e. (\u003cstrong\u003eA\u003c/strong\u003e) Flow cytometry evaluated the apoptosis of MBVP. (\u003cstrong\u003eB-C\u003c/strong\u003e) WB evaluated the expression of Cleaved-caspase-3/ Caspase-3 and Bcl-2/ Bax in MBVP. Data are expressed as mean±SEM, n=3 in each group, (#\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, ##\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs \u003c/em\u003eControl; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, ***\u0026lt;0.001 \u003cem\u003evs \u003c/em\u003eOGD/R).\u003c/p\u003e","description":"","filename":"floatimage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/d10678cedf90ede96a591426.jpg"},{"id":25850412,"identity":"5fcf0643-1701-49bf-91a9-8baf0e7411bc","added_by":"auto","created_at":"2022-08-30 16:11:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":314568,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSal B, Sal D, R1, Rb1 and Rg1 promoted the migration of MBVP subjected to OGD/R.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) The migration image of MBVP which was detected employing wound healing. (\u003cstrong\u003eB\u003c/strong\u003e) The migration rate of MBVP after reoxygenation for 12 h, 24 h and 48h. Scale bar:100μm. Data are expressed as mean±SEM, n=3 in each group, (###\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs \u003c/em\u003eControl; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, \u003cem\u003evs \u003c/em\u003eOGD/R).\u003c/p\u003e","description":"","filename":"floatimage5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/3f4642413642d136ca5ef7d4.jpg"},{"id":25850410,"identity":"a70df721-c701-4627-9f43-f16d5acce33e","added_by":"auto","created_at":"2022-08-30 16:11:58","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":449736,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSal B, Sal D, R1, Rb1 and Rg1 increased the angiogenesis proteins expression of MBVP subjected to OGD/R.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eRT-PCR detected the expression of Ang-1, VEGF and PDGFR-β. (\u003cstrong\u003eB\u003c/strong\u003e) Image of representative the WB expression of Ang-1, VEGF and PDGFR-β. (\u003cstrong\u003eC\u003c/strong\u003e) Quantitative analysis of Ang-1. (\u003cstrong\u003eD\u003c/strong\u003e) Quantitative analysis of VEGF. (\u003cstrong\u003eE\u003c/strong\u003e) Quantitative analysis of PDGFR-β. Data are expressed as mean±SEM, n=3 in each group, (#\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, ##P\u0026lt;0.01, ###, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001 \u003cem\u003evs \u003c/em\u003eControl; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***P \u0026lt;0.001\u003cem\u003evs \u003c/em\u003eOGD/R).\u003c/p\u003e","description":"","filename":"floatimage6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/b74157eb5cd373aa91f78575.jpg"},{"id":25849809,"identity":"ddf448ef-b680-4d5c-a793-9da8d4654e4f","added_by":"auto","created_at":"2022-08-30 16:06:58","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":313749,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSal B, Sal D, R1, Rb1 and Rg1 regulated PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Image and quantitative analysis of PI3K. (\u003cstrong\u003eB\u003c/strong\u003e) Image and quantitative analysis of p-AKT/AKT. (\u003cstrong\u003eC\u003c/strong\u003e) Image and quantitative analysis of p-mTOR/mTOR. (\u003cstrong\u003eD\u003c/strong\u003e) Image and quantitative analysis of p-JNK/JNK. (\u003cstrong\u003eE\u003c/strong\u003e) Image and quantitative analysis of p-ERK/ERK. (\u003cstrong\u003eF\u003c/strong\u003e) Image and quantitative analysis of p-P38/P38. Data are expressed as mean±SEM, n=3 in each group, (#\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, ##P\u0026lt;0.01 \u003cem\u003evs \u003c/em\u003eControl; *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***P \u0026lt;0.001\u003cem\u003evs \u003c/em\u003eOGD/R).\u003c/p\u003e","description":"","filename":"floatimage7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/2d36ad0da450bceccf0cf12b.jpg"},{"id":25850712,"identity":"60f703bd-3c4f-4674-bea9-8a07fbba069f","added_by":"auto","created_at":"2022-08-30 16:17:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1395646,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1984984/v1/5e340b93-5f35-49e1-b256-6fc743a0fd08.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Components of Salvia miltiorrhiza and Panax notoginseng against OGD/R-treated injury in Pericytes via regulating PI3K/AKT and JNK/ERK/P38 signaling pathways","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIschemic stroke, which accounts for 85% of strokes, is a disease that severely damages the central nervous system (CNS) (Cordonnier et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It greatly threatens human health and aggravates the burden of the social medical system (Amarenco et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Ischemic stroke involves the death of brain tissue caused by insufficient supply of blood and oxygen which is due to the blood flow reduced or obstructed. There are a various of pathophysiological events will occur, such as impaired brain microcirculation, microvascular dysfunction, destruction of the blood-brain barrier (BBB) and inadequate energy supply to neurons, etc (Cheng et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePericytes, as one of the main cells of CNS (Daneman and Prat \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), are typical multifunctional parietal cells. Pericytes have been reported perform several important functions in the brain, including maintaining the development and stability of the BBB, regulating vascular stability, angiogenesis, cerebral blood flow and removing toxic neuro substances, etc (Brown et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Geranmayeh et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The protection of pericytes may be a new therapeutic direction for improving ischemic stroke. Therefore, we sought to find the active ingredients of protective pericytes in the treatment of ischemic stroke.\u003c/p\u003e \u003cp\u003eSalvia miltiorrhiza (SAL) is mainly composed of Sal B, Sal D, Lithospermic acid (La) and Caffeic acid (Ca), among which Sal B accounts for the largest proportion, up to 61.9% (Wang et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017a\u003c/span\u003e). Panax notoginseng (PNS) is composed of Rb1, Rg1, R1, Ginsenoside Rd (Rd) and Ginsenoside Re (Re) (Gui et al. 2013). Researches showed the SAL main component, Sal B, reduced the treatment of cerebral infarction with significant effect (Ling et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). the PNS component, Rb1, played a protective role in focal cerebral neuronal injury rats subjected to I/R through inhibiting HMGB1 inflammatory signal (Liu et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Rg1 had the effects of anti-oxidation, anti-aging and enhancing the memory of brain-damaged mice, reducing neuronal apoptosis (Chu et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Xie et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). R1 could effectively improve blood supply to infarcts which was mainly realized by scavenging free radicals and blocking calcium ion channels (Wang et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2017b\u003c/span\u003e). However, the effects and mechanisms of these components on pericytes remain to be studied.\u003c/p\u003e \u003cp\u003ePrevious research of our group showed that the combination of SAL and PNS increased cerebral blood flow, reduce oxidative stress response, maintain the integrity of the blood-brain barrier and recover neurological injury in rats after I/R injury (Wang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2018a\u003c/span\u003e; Yuan et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, it is not clear what components of SAL and PNS exert the anti-I/R injury effects. We cultured mouse cerebrovascular pericytes (MBVP)-an immortallised cell line in vitro to further clarify the role of the active components of SAL and PNS in the treatment of ischemic stroke and elucidate the mechanisms, in order to provide more experimental basis for clinical practice.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eDrugs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSal D (Batch No. P22N9F75815) was provided by Shanghai yuanye Bio-Technology Co, Ltd (Shanghai, China). Sal B (Batch No.18062901), Fa (Batch No.17092501), La (Batch No.18042602), Ra (Batch No.18030901), Ca (Batch No.171228041), R1(Batch No.18052908), Rb1 (Batch No.18082204), Rg1(Batch No.18071601), Rd (Batch No.18011503) and Re (Batch No.18062501) were provided by Chengdu Feipude Biotechnology Co, Ltd (Chengdu, China). Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re were dissolved in sterile water. They were diluted with DMEM to the final concentration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePericytes culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMBVP were obtained from BeNa Culture Collection (Beijing, China, BNCC 342014) cultured in MBVP growth media (89%DMEM+ 10% FBS+1% penicillin and streptomycin (Gibco, New York, USA)). The cells were placed in a 37℃incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e. When the cells grew to 80% - 90%, they were passed for subsequent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOxygen\u0026ndash;glucose deprivation, drug treatments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;MBVP were washed with PBS (Solarbio, Beijing, Chain) and cultured in glucose-free DMEM (Gibco, New York, USA). Then placed MBVP in 37\u0026deg;C anoxic chamber (Stemcell, Vancouver, Canada) which was filled with 95 % N\u003csub\u003e2\u003c/sub\u003e and 5 % CO\u003csub\u003e2\u003c/sub\u003e for 6 h. After hypoxia, medium of the OGD/R group was changed to DMEM (Gibco, New York, USA). Medium of the treatment group was changed to the DMEM (Gibco, New York, USA) containing drugs of\u0026nbsp;Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re. And then cultured at 37℃ incubator containing 5% CO\u003csub\u003e2\u0026nbsp;\u003c/sub\u003efor 18 h. The control group was cultured in DMEM for 24 h in 37℃incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of cell viability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were cultured in 96-plates and exposed to OGD 4 h followed by reoxygenation 20 h (OGD4h /R20h). Then, cell viability was measured using Cell Counting Kit-8 (CCK-8, CK04, Japan). DMEM with 10% CCK-8 solution was added to the cells which were washed once with HBSS. Cells were placed in 37 \u0026deg;C incubator for 30-60 mins. The absorbance was measured at 450 nm using a microplate analyzer (Infinite F50, Switzerland). Lactic dehydrogenase (LDH) release was measured using LKolate Dehydrogenase Assay Kit after OGD 4 h followed by reoxygenation 20 h (CK12, Japan). bEnd.3 cells supernatant were collected and centrifuged (4℃, 1000 rpm, 5min). 50\u0026micro;l of each sample and 50\u0026micro;l of reaction mixture was pipetted into a 96-well plate. The absorbance of the plates was measured at 490 nm with a microplate analyzer (Infinite F50, Switzerland).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of SOD and ROS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe MBVP were seeded in 96-well plates, OGD 6 h/R 18 h\u0026nbsp;were performed after the cells fused. Then, Superoxide Dismutase (SOD) and Reactive Oxygen Species (ROS) of MBVP in each group were detected according to the manufacturer\u0026rsquo;s instructions of SOD Activity Kit (Nanjing Jiancheng Bioengineering Institute, Nangjing, Chain) and ROS Assay Kit (Beyotime Institute of Biotechnoligy, Shanghai, Chain).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow Cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMBVP were dissociated with trypsin after OGD/R. The cells were collected after centrifuged at 500g for 5 min, and washed with pre-cooling PBS for 2 times. After re-suspended by binding buffer, the MBVP were labeled with V-FITC and PI was for 10 min. The cells were suspended by binding buffer and detected by Flow Cytometry. The assay was performed according to manufacturer\u0026rsquo;s instructions of Annexin V-FITC/PI Cell Apoptosis Detection Kit (40302ES60, Yeasen Biotechnology, Shanghai, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScratch assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMBVP were seeded in 6-well plates, OGD 6 h/R 18 h were performed after the cells fused. Then, 200 \u0026mu;L pipette tips were used to make the scratch gap. Photos were taken at the following 12 h, 24 h and 48 h. Quantitative analysis was conducted with Image J software,as previously described (Fu et al. 2019). Wound healing rate(WH)= [the wound area at time ( 12h,24h,48h-) its initial area( 0h)]/ its initial area(0 h) \u0026times;\u0026thinsp;100%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter OGD 6 h reperfusion for 18 h, the proteins were extracted from the 6-well plate using RIPA lysis buffer and were quantified according to the instructions of the BCA kit (23227, Thermo Fisher Scientific). The treated sample was added to a 4%-12% SDS-PAGE gel to separate the proteins by size. The separated proteins transferred to PVDF membranes were scaled with 5% skim milk. The antibodies JNK (ab124956, Abcam, Cambridge, USA), p-JNK (ab47337, Abcam), Caspase-3 (ab13847, Abcam), PI3K(ab151549, Abcam), p-mTOR (ab84400, Abcam), mTOR (ab32028, Abcam), PDGFR-\u0026beta; (ab32570, Abcam), VEGF (ab32152, Abcam), Cleaved-Caspase-3 (9661S, CST, Bostom, USA), AKT (4691S, CST), p-AKT(4060S, CST), p-P38 (4511S, CST), P38(8690S, CST), p-ERK(4370, CST), ERK(12950, CST), Bcl-2 (3498S, CST), \u0026beta;-actin (4967S, CST), Bax (14796S, CST), Ang-1 (BS2829, Bioword, USA) were diluted in PBS at a ratio of 1:1000. PDVF membranes were incubated overnight in antibodies at 4 \u0026deg; C. Membranes were washed with TBST, and incubate with goat anti-rabbit or oat anti-mouse (zsgb-bio, Beijing, China) horseradish peroxidase for 1h. The blots were observed with Amersham imager 600 (GE Healthcare, Chicago, US), the gray value was analyzed by Image J software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-Time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter OGD 6 h reperfusion for 18 h, the total RNA was extracted from the 6-well plate using the TRIzol\u0026reg; reagent (Invitrogen/Life Technologies, Carlsbad, CA). The cDNA reverse transcription kit (Applied Biosystems, Foster City, USA) was used to generate cDNA. The mRNA was carried out using SYBR Green PCR Mix Kit (CWBIO, Jiangsu, Chain) with 7500 sequence detection system (Applied Biosystems, Foster City, USA). The mRNA level was normalized to \u0026beta;-actin level, old change calculated according to the threshold cycle (Ct) =2(\u0026minus; \u0026Delta;\u0026Delta;Ct) of the treated cells with respect to target amplification. Specific primers which were designed by Nanjing Jiancheng Institute of Biology (shanghai, China) are listed in Table 1.\u003c/p\u003e\n\u003cp\u003eTable 1 Primer sequences\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.91710758377425%\"\u003e\n \u003cp\u003eGenes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.08289241622575%\"\u003e\n \u003cp\u003ePrimer/Probe sequences(5\u0026rsquo;to3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.91710758377425%\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.08289241622575%\"\u003e\n \u003cp\u003eF 5\u0026rsquo;-GTAAAGACCTCTATGCCAACA-3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo;-GGACTCATCGTACTCCTGCT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.91710758377425%\"\u003e\n \u003cp\u003eAng-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.08289241622575%\"\u003e\n \u003cp\u003eF 5\u0026rsquo;- CACAGGGACAGCAGGCAAACAG -3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo;- CACAGGCATCGAACCACCAACC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.91710758377425%\"\u003e\n \u003cp\u003eVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.08289241622575%\"\u003e\n \u003cp\u003eF 5\u0026rsquo;- CACAGGGACAGCAGGCAAACAG -3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo;- CACAGGCATCGAACCACCAACC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.91710758377425%\"\u003e\n \u003cp\u003ePDGFR-\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"59.08289241622575%\"\u003e\n \u003cp\u003eF 5\u0026rsquo;- CACCTTCTTGCAGCGACACTCC -3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo;- TCCATGTAGCCACCGTCACTCTC -3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBetween different groups were performed by one-way ANOVA analysis with Tukey\u0026rsquo;s multiple comparison test using SPSS 18.0 statistical software. Data are presented as mean\u0026plusmn;SEM from at least three independent experiments. \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 was considered as significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eComponents of\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;SAL and PNS increased the viability of MBVP subjected to OGD/R\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst, we evaluated the cells viability and LDH release of MBVP subjected to OGD 4 h/R20 h, OGD 6 h/R18 h and OGD 8 h/R16 h to screen optimal hypoxia/reoxygenation time. The results showed that OGD 6 h/R18 h damaged MBVP properly and met experimental requirements (\u003cem\u003evs\u003c/em\u003e Control, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 1A-B). Therefore, OGD 6 h/R18 h was selected to establish the model mimicking I/R injury. We detected the effects of Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re (0.1 \u0026mu;M-10 \u0026mu;M) on the cell viability of MBVP. The results showed it had no significant difference (\u003cem\u003evs\u003c/em\u003e Control, Fig 1C). Sal B, Sal D, R1, Rb1 and Rg1 (10 \u0026mu;M) could significantly increase the cell viability of MBVP subjected to OGD6 h/R18 h (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig1D). Furthermore, we observed the cell morphology under inverted phase contrast microscope, it was showed that Sal B, Sal D, R1, Rb1 and Rg1 (10 \u0026mu;M) could reduce cells shrinkage and intercellular space of the MBVP subjected to OGD6 h/R18 h (\u003cem\u003evs\u0026nbsp;\u003c/em\u003eOGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eComponents of SLA and PNS alleviated oxidative stress of MBVP subjected to OGD/R\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI/R leads to oxidative stress, resulting in a large accumulation of ROS in cells, which damages cell structure and function (Pizzino et al. 2017). Next, we detected the expression of ROS and SOD in MBVP subjected to OGD/R. The results showed OGD/R group increased the fluorescence intensity of ROS in MBVP (\u003cem\u003evs\u003c/em\u003e Control, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, Fig 3A). Sal B, Sal D, R1, Rb1 and Rg1 decreased the fluorescence intensity of ROS (\u003cem\u003evs\u0026nbsp;\u003c/em\u003eOGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 3A). OGD/R group decreased the activity of SOD in MBVP (\u003cem\u003evs\u003c/em\u003e Control, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, Fig 3B). Sal B, Sal D, R1, Rb1 and Rg1 increased the activity of SOD and revealed anti-oxidation in MBVP subjected to OGD/R (\u003cem\u003evs\u0026nbsp;\u003c/em\u003eOGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 3B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eComponents of SAL and PNS inhibit the apoptosis of MBVP subjected to OGD/R\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOxidative stress damage disrupts intracellular ion homeostasis and induces pericytes death (Malko and Jiang 2020). Therefore, we determined the apoptosis of MBVP subjected to OGD/R. The results illustrated OGD/R group increased the apoptosis cells of MBVP (\u003cem\u003evs\u003c/em\u003e Control, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 4A). Sal B, Sal D, R1and Rb1 could significantly reduce the apoptosis cells in MBVP (\u003cem\u003evs\u0026nbsp;\u003c/em\u003eOGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 4A). Sal B, Sal D, R1, Rb1and Rg1 reduced the protein level of Cleaved caspase-3/ caspase-3 (\u003cem\u003evs\u0026nbsp;\u003c/em\u003eOGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 4B). Sal D, R1, Rb1and Rg1 increased the protein level of Bcl-2/ Bax (\u003cem\u003evs\u0026nbsp;\u003c/em\u003eOGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 4C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eComponents of SAL and PNS promoted the migration of MBVP subjected to OGD/R\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, we evaluated the effects of Sal B, Sal D, R1, Rb1 and Rg1 promoted the cell migration of MBVP subjected to OGD/R. Researches indicated OGD/R group significantly reduced the capacity of the cell migration of MBVP (\u003cem\u003evs\u003c/em\u003e Control, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 5A-B). R1 increased the capacity of the cell migration of MBVP after reoxygenation for 12 h, 24 h (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 5A-B). R1and Rb1 increased the capacity of the migration Of MBVP at the time of reoxygenation for 48 h (\u003cem\u003evs\u003c/em\u003e OGD/R,\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05,Fig 5A-B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eComponents of SAL and PNS promoted the angiogenesis proteins expression of MBVP subjected to OGD/R\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe also assessed the expression of the Ang-1, VEGF and PDGFR-\u0026beta; by RT-PCR and WB. The results indicated that OGD/R group decreased the level of Ang-1, VEGF and PDGFR-\u0026beta; in MBVP (mRNA: \u003cem\u003evs\u003c/em\u003e Control, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 6A). Sal B, Sal D, R1, Rb1 and Rg1 increased the level of Ang-1; Sal B, R1 and Rb1 increased the level of VEGF; Sal B, R1 and Rb1 increased the level of PDGFR-\u0026beta; (mRNA: \u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 6A). R1, Rb1 and Rg1 increased the protein expression of Ang-1(vs OGD/R, P\u0026lt;0.05, Fig 6B-C). Sal D, Rb1 and Rg1 increased the protein expression of VEGF (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 6B, 6D). Sal B, Rb1and Rg1 increased the protein expression of PDGFR-\u0026beta; (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 6B, 6E).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eComponents of SAL and PNS regulate PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo clarify the mechanism of Sal B, Sal D, R1, Rb1 and Rg1 protecting MBVP subjected to OGD/R, we detected the PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways. Rg1 increased the level of PI3K (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 7A). Sal B, Sal D, R1 and Rg1 increased the level of p-AKT (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 7B). Sal B and Sal D increased the level of p-mTOR (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 7C). Sal B, Sal D, R1, Rb1 and Rg1 reduced the level of p-JNK (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 7D). R1, Rb1 and Rg1 increased the level of p-ERK (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 7E). Sal B, Sal D, R1and Rg1 reduced the level of p-P38 (\u003cem\u003evs\u003c/em\u003e OGD/R, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, Fig 7F).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent years, the research focus of cerebral ischemia has gradually shifted from neurons to other neurovascular unit (NVU) cells. Pericytes, as an important component of NVU, have been paid more and more attention. Ischemic stroke causes pericytes to contract, apoptosis, and detach from blood vessels, resulting in reduced capillary blood flow, BBB damage, and nervous system damage (Yang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, pericyte protection is a new direction in the treatment of ischemic stroke.\u003c/p\u003e \u003cp\u003eSAL and PNS are the active ingredients of Salvia miltiorrhiza radix et rhizpma and and Notoginseng radix et rhizome (Liang et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Studies shown SAL can prevent thrombosis, remove free radicals, promote tissue repair, reduce cerebral infarction area, promote angiogenesis and nerve function recovery (Li et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). PNS have the effects of anti-inflammatory, anti-oxidation, maintain BBB integrity, protective nervous system in the treatment of ischemia stroke (Pan et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Sal B as the one of the main components of SAL plays anti-apoptosis and neuroprotective role in I/R rats (Fan et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Sal D alleviates I/R injury in rats by inhibiting inflammatory response (Zhang et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). R1, Rb1, Rg1, Rd and Re accounted for more than 90% of PNS (Qu et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Studies have shown that Rg1 reduced oxidative stress injury of neurons by activating miR-144/Nrf2/ARE pathway (Chu et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). R1could reduce the area of cerebral infarction, and regulate BBB permeability after ischemic stroke (Liu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Rb1 promoted axonal regeneration in stroke mice (Gao et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Due to the importance of pericytes in NVU, this study established MBVP injury model subjected to OGD/R to explore the protective effects of SAL and PNS components-Sal B, Sal D, Fa, La, Ra, Ca, R1, Rb1, Rg1, Rd and Re. And it was found that 10 \u0026micro;M of Sal B, Sal D, R1, Rb1, Rg1 certainly increased the cell vitality and improved cell damage of MBVP subjected to OGD/R.\u003c/p\u003e \u003cp\u003eDuring ischemia, oxidative stress response is induced and a large amount of harmful ROS is produced (Simpkins et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The accumulation of ROS causes cellular dysfunction, which promotes the further development of the disease. However, SOD could limit ROS accumulation and regulate ROS related cellular functional signals (Wang et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2018b\u003c/span\u003e). Therefore, we evaluated the expression of ROS and SOD in MBVP after OGD/R. Results showed that Sal B, Sal D, R1, Rb1 and Rg1 could increase the expression of SOD and reduce ROS fluorescence intensity in MBVP subjected to OGD/R.\u003c/p\u003e \u003cp\u003eOxidative stress can lead to apoptosis of pericytes after I/R injury. Pericytes apoptosis results in pericytes loss and BBB destruction, resulting in nervous system damage and cognitive dysfunction (Wu et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Apoptosis is involved in the Caspase family and Bcl-2 family. In this study, Sal B, Sal D, R1, Rb1 and Rg1 inhibited the apoptosis rate of MBVP subjected to OGD/R. Furthermore, Sal B, Sal D, R1, Rb1 and Rg1 increased the level of Bcl-2 protein and decrease the level of Bax and Caspase-3 proteins in MBVP. Sal B, Sal D, R1, Rb1 and Rg1 played a protective role against OGD/R injury through anti-apoptosis.\u003c/p\u003e \u003cp\u003ePericytes can participate in angiogenesis after ischemic stroke by regulating Ang-1, PDGF-β/PDGFR-β and Ang/Tie signaling pathways (Sweeney et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Vascular endothelial growth factor (VEGF) which regulate vasculogenesis and angiogenesis was important in the recovery of ischemic stroke (Du et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Geiseler and Morland \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Ang-1, a vascular-specific growth factor secreted by pericytes, can bind to Tie-2 of endothelial cells to maintain vascular integrity under stress (Caporali et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Fujiwara-Sumiyoshi et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Pericytes can secrete VEGF to induce increased expression of Ang-1, thus promoting angiogenesis (Caporarello et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Platelet-derived growth factor receptor (PDGFR-β) is an important symbol growth factor for pericytes. It specifically binds to platelet-derived growth factor (PDGF-BB) secreted by endothelial cells to promote the migration, proliferation and attachment of pericytes, maintaining the integrity of BBB and vascular stability, which is another important pathway for pericytes to regulate angiogenesis (Shen et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Smyth et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this study, Sal B, Sal D, R1, Rb1 and Rg1 could up-regulating Ang-1 expression of MBVP after OGD/R injury. Sal B, R1and Rb1 could up-regulating VEGF. Sal B, Rb1and Rg1 could up-regulating PDGFR-β. R1, Rb1and R1 and Rb1 promote MBVP migration subjected to OGD/R. These results suggest that Sal D and Rg1 may regulate angiogenesis by activating Ang-1 signaling pathway. Rb1 may regulate angiogenesis after stroke by activating PDGFR-β signaling pathway to promote pericyte migration after OGD/R injury.\u003c/p\u003e \u003cp\u003ePI3K/AKT/mTOR signaling pathway affects the pathological process of stroke by regulating cell migration, proliferation, oxidative stress and apoptosis (Gu et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Activation of PI3K/AKT/mTOR signaling pathway can inhibit cell apoptosis, protect central nervous system cells and delay the delay the pathological process of stroke (Mulherkar and Tolias \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Takase and Regenhardt \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). JNK/ERK/P38 signaling pathway plays an important role in regulating cell apoptosis after I/R injury. Activation of JNK/ERK/P38 signaling pathway can lead to inflammation, and apoptosis can aggravate I/R injury (Shvedova et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We found that Sal B, Sal D, R1, Rb1 and Rg1 could increase the level of PI3K, p-AKT and p-mTOR, activate the PI3K/AKT/mTOR pathway, reduce the level of p-JNK and p-P38, inhibit the JNK/ERK/P38 pathway.\u003c/p\u003e \u003cp\u003eThis study showed that the active components of SAL and PNS, Sal B, Sal D, R1, Rb1 and Rg1 could inhibit the oxidative damage and apoptosis of pericytes subjected to OGD/R injury, regulate the signal transduction of pericytes to promote angiogenesis, and protect pericytes, so as to exert the neuroprotective role. The mechanisms may be related to PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathway.\u003c/p\u003e \u003cp\u003eHowever, it is still necessary to further explore the specific effects of the two signaling pathways involved in Sal B, Sal D, R1, Rb1 and Rg1 in inhibiting oxidative stress injury, anti-apoptosis and promoting pericyte angiogenesis signal transduction species. The effect and mechanisms of the components of SAL and PNS on MBVP induced by OGD/R are summarized in Table\u0026nbsp;2. It was concluded that the components of SAL and PNS could exert antioxidant and anti-apoptotic effects. The active components of PNS increased the expression of proangiogenic factors in pericytes, while the components of SAL had a weak effect on this aspect.\u003c/p\u003e \u003cp\u003eThese results indicate that Sal B, Sal D, R1, Rb1 and Rg1 are potential drugs for the treatment of ischemic stroke and provide candidates for subsequent monomeric drug development. However, it is still necessary to further clarify the role and mechanisms of Sal B, Sal D, R1, Rb1 and Rg1 by cultured primary mouse microvascular pericytes or human brain microvascular pericytes and in vivo experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e The protective mechanisms of the components of SAL and PNS against MBVP subjected to OGD/R.\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.079159935379643%\"\u003e\n \u003cp\u003eDetection index\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" width=\"70.92084006462035%\"\u003e\n \u003cp\u003eThe components of SAL and PNS\u003c/p\u003e\n \u003cp\u003e(vs OGD/R:-\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05, \u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u0026nbsp;P\u0026lt;\u003c/em\u003e0.05, \u003cstrong\u003e++\u003c/strong\u003e\u003cem\u003e\u0026nbsp;P\u0026lt;\u003c/em\u003e0.01, \u003cstrong\u003e+++\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cem\u003eP\u0026lt;\u003c/em\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003eSal B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003eSal D\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003eR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003eRb1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003eRg1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eCell viability\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eROS Level\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eSOD activity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eCell apoptosis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eCleave Capase3/Caspase3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eBcl-2/Bax\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003emigration of MBVP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eAng-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003eVEGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ePDGFR-\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ePI3K\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ep-AKT/AKT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ep-mTOR/MTOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ep-JNK/JNK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ep-ERK/ERK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"29.032258064516128%\"\u003e\n \u003cp\u003ep-P38/P38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.64516129032258%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.129032258064516%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.870967741935484%\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.161290322580646%\"\u003e\n \u003cp\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTong Zhang wrote the manuscript text; Wenjie Liu and Qing Yuan designed the experiments; Tong Zhang and Wenjie Liu analyzed and explained the data; Tong Zhang, Haiying Xu, Jin Sun and Bing Liang prepared the draft manuscript; Lijuan Chai, Qing Yuan and Limin Hu edited the Article; Yushuang Cao, Lichen Guo, Xinyuan Du, Lijuan Chai and Limin Hu reviewed and revised the paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003eAll authors declare he/she has no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by grants from the National Natural Sciences Foundation of China (81573644).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAmarenco P, Kim JS, Labreuche J, Charles H, Giroud M, Lee BC, Mahagne MH, Nighoghossian N, Gabriel Steg P, Vicaut \u0026Eacute;, Bruckert E (2020) Benefit of Targeting a LDL (Low-Density Lipoprotein) Cholesterol \u0026lt; 70 mg/dL During 5 Years After Ischemic Stroke. Stroke 51(4):1231\u0026ndash;1239\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown LS, Foster CG, Courtney JM, King NE, Howells DW, Sutherland BA (2019) Pericytes and Neurovascular Function in the Healthy and Diseased Brain. Frontiers in cellular neuroscience 13:282\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaporali A, Martello A, Miscianinov V, Maselli D, Vono R, Spinetti G (2017) Contribution of pericyte paracrine regulation of the endothelium to angiogenesis. Pharmacology \u0026amp; therapeutics 171:56\u0026ndash;64\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaporarello N, D'Angeli F, Cambria MT, Candido S, Giallongo C, Salmeri M, Lombardo C, Longo A, Giurdanella G, Anfuso CD, Lupo G (2019) Pericytes in Microvessels: From \"Mural\" Function to Brain and Retina Regeneration. International journal of molecular sciences 20(24):6351\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng J, Korte N, Nortley R, Sethi H, Tang Y, Attwell D (2018) Targeting pericytes for therapeutic approaches to neurological disorders. Acta Neuropathol 136(4):507\u0026ndash;523\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu SF, Zhang Z, Zhou X, He WB, Chen C, Luo P, Liu DD, Ai QD, Gong HF, Wang ZZ, Sun HS, Feng ZP, Chen NH (2019) Ginsenoside Rg1 protects against ischemic/reperfusion-induced neuronal injury through miR-144/Nrf2/ARE pathway. Acta Pharmacol Sin 40(1):13\u0026ndash;25\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCordonnier C, Demchuk A, Ziai W, Anderson CS (2018) Intracerebral haemorrhage: current approaches to acute management. Lancet (London, England) 392(10154):1257\u0026ndash;1268.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaneman R, Prat A (2015) The blood-brain barrier. Cold Spring Harbor perspectives in biology 7(1):a020412\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu J, Yin G, Hu Y, Shi S, Jiang J, Song X, Zhang Z, Wei Z, Tang C, Lyu H (2020) Coicis semen protects against focal cerebral ischemia-reperfusion injury by inhibiting oxidative stress and promoting angiogenesis via the TGFβ/ALK1/Smad1/5 signaling pathway. Aging 13(1):877\u0026ndash;893\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Luo Q, Wei J, Lin R, Lin L, Li Y, Chen Z, Lin W, Chen Q (2018) Mechanism of salvianolic acid B neuroprotection against ischemia/reperfusion induced cerebral injury. Brain research 1679:125\u0026ndash;133.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu B, Zeng Q, Zhang Z, Qian M, Chen J, Dong W, Li M (2019) Epicatechin Gallate Protects HBMVECs from Ischemia/Reperfusion Injury through Ameliorating Apoptosis and Autophagy and Promoting Neovascularization. Oxidative medicine and cellular longevity 2019:7824684\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujiwara-Sumiyoshi S, Ueda Y, Fujikawa M, Osaki M, Yamanaka N, Matsumoto T (2021) Mucopolysaccharide polysulfate promotes microvascular stabilization and barrier integrity of dermal microvascular endothelial cells via activation of the angiopoietin-1/Tie2 pathway. Journal of dermatological science 103(1):25\u0026ndash;32\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao X, Zhang X, Cui L, Chen R, Zhang C, Xue J, Zhang L, He W, Li J, Wei S, Wei M, Cui H (2020) Ginsenoside Rb1 Promotes Motor Functional Recovery and Axonal Regeneration in Post-stroke Mice through cAMP/PKA/CREB Signaling Pathway. Brain research bulletin 154:51\u0026ndash;60\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeiseler SJ, Morland C (2018) The Janus Face of VEGF in Stroke. International journal of molecular sciences 19(5): 1362.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeranmayeh MH, Rahbarghazi R, Farhoudi M (2019) Targeting pericytes for neurovascular regeneration. Cell communication and signaling: CCS 17(1):26\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu C, Zhang Q, Li Y, Li R, Feng J, Chen W, Ahmed W, Soufiany I, Huang S, Long J, Chen L (2022) The PI3K/AKT Pathway-The Potential Key Mechanisms of Traditional Chinese Medicine for Stroke. Frontiers in medicine 9:900809\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Zhang X, Cui L, Chen R, Zhang Y, Zhang C, Zhu X, He T, Shen Z, Dong L, Zhao J, Wen Y, Zheng X, Li P (2017) Salvianolic acids enhance cerebral angiogenesis and neurological recovery by activating JAK2/STAT3 signaling pathway after ischemic stroke in mice. Journal of neurochemistry 143(1):87\u0026ndash;99\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang WY, Chen WJ, Yang GH, Zhu D, Mao X, Shao YY, Wu LF, Zhang XX, Zhang LZ (2016) [Research progress on salvianolic acids of Salvia miltiorrhiza]. Zhongguo Zhong yao za zhi = Zhongguo zhongyao zazhi = China journal of Chinese materia medica 41(5):806\u0026ndash;812\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLing C, Liang J, Zhang C, Li R, Mou Q, Qin J, Li X, Wang J (2018) Synergistic Effects of Salvianolic Acid B and Puerarin on Cerebral Ischemia Reperfusion Injury. Molecules (Basel, Switzerland) 23(3):564\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu A, Zhu W, Sun L, Han G, Liu H, Chen Z, Zhuang L, Jiang W, Xue X (2018) Ginsenoside Rb1 administration attenuates focal cerebral ischemic reperfusion injury through inhibition of HMGB1 and inflammation signals. Experimental and therapeutic medicine 16(4):3020\u0026ndash;3026\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu B, Li Y, Han Y, Wang S, Yang H, Zhao Y, Li P, Wang Y (2021) Notoginsenoside R1 intervenes degradation and redistribution of tight junctions to ameliorate blood-brain barrier permeability by Caveolin-1/MMP2/9 pathway after acute ischemic stroke. Phytomedicine: international journal of phytotherapy and phytopharmacology 90:153660\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalko P, Jiang LH (2020) TRPM2 channel-mediated cell death: An important mechanism linking oxidative stress-inducing pathological factors to associated pathological conditions. Redox biology 37:101755\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulherkar S, Tolias KF (2020) RhoA-ROCK Signaling as a Therapeutic Target in Traumatic Brain Injury. Cells 9(1):245\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan YW, Wu DP, Liang HF, Tang GY, Fan CL, Shi L, Ye WC, Li MM (2022) Total Saponins of Panax notoginseng Activate Akt/mTOR Pathway and Exhibit Neuroprotection in vitro and in vivo against Ischemic Damage. Chinese journal of integrative medicine 28(5):410\u0026ndash;418\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePizzino G, Irrera N, Cucinotta M, Pallio G, Mannino F, Arcoraci V, Squadrito F, Altavilla D, Bitto A (2017) Oxidative Stress: Harms and Benefits for Human Health. Oxidative medicine and cellular longevity 2017:8416763\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu J, Xu N, Zhang J, Geng X, Zhang R (2020) Panax notoginseng saponins and their applications in nervous system disorders: a narrative review. Annals of translational medicine 8(22):1525\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen J, Xu G, Zhu R, Yuan J, Ishii Y, Hamashima T, Matsushima T, Yamamoto S, Takatsuru Y, Nabekura J, Sasahara M (2019) PDGFR-β restores blood-brain barrier functions in a mouse model of focal cerebral ischemia. Journal of cerebral blood flow and metabolism: official journal of the International Society of Cerebral Blood Flow and Metabolism 39(8):1501\u0026ndash;1515\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShvedova M, Anfinogenova Y, Atochina-Vasserman EN, Schepetkin IA, Atochin DN (2018) c-Jun N-Terminal Kinases (JNKs) in Myocardial and Cerebral Ischemia/Reperfusion Injury. Frontiers in pharmacology 9:715\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimpkins AN, Dias C, Leigh R (2016) Identification of Reversible Disruption of the Human Blood-Brain Barrier Following Acute Ischemia. Stroke 47(9):2405\u0026ndash;2408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmyth LCD, Highet B, Jansson D, Wu J, Rustenhoven J, Aalderink M, Tan A, Li S, Johnson R, Coppieters N, Handley R, Narayan P, Singh-Bains MK, Schweder P, Turner C, Mee EW, Heppner P, Correia J, Park TI, Curtis MA, Faull RLM, Dragunow M (2022) Characterisation of PDGF-BB:PDGFRβ signalling pathways in human brain pericytes: evidence of disruption in Alzheimer's disease. Communications biology 5(1):235\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSweeney MD, Ayyadurai S, Zlokovic BV (2016) Pericytes of the neurovascular unit: key functions and signaling pathways. Nature neuroscience 19(6):771\u0026ndash;783\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakase H, Regenhardt RW (2021) Motor tract reorganization after acute central nervous system injury: a translational perspective. Neural regeneration research 16(6):1144\u0026ndash;1149\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F, He Q, Wang J, Yuan Q, Guo H, Chai L, Wang S, Hu L, Zhang Y (2017a) Neuroprotective effect of salvianolate lyophilized injection against cerebral ischemia in type 1 diabetic rats. BMC complementary and alternative medicine 17(1):258\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang FJ, Wang SX, Chai LJ, Zhang Y, Guo H, Hu LM (2018a) Xueshuantong injection (lyophilized) combined with salvianolate lyophilized injection protects against focal cerebral ischemia/reperfusion injury in rats through attenuation of oxidative stress. Acta Pharmacol Sin 39(6):998\u0026ndash;1011\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Branicky R, No\u0026euml; A, Hekimi S (2018b) Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. The Journal of cell biology 217(6):1915\u0026ndash;1928\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Tu L, Li Y, Chen D, Liu Z, Hu X, Wang S (2017b) Notoginsenoside R1 Alleviates Oxygen-Glucose Deprivation/Reoxygenation Injury by Suppressing Endoplasmic Reticulum Calcium Release via PLC. Scientific reports 7(1):16226\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Q, Yuan X, Li B, Han R, Zhang H, Xiu R (2020) Salvianolic Acid Alleviated Blood-Brain Barrier Permeability in Spontaneously Hypertensive Rats by Inhibiting Apoptosis in Pericytes via P53 and the Ras/Raf/MEK/ERK Pathway. Drug design, development and therapy 14:1523\u0026ndash;1534\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie W, Zhou P, Sun Y, Meng X, Dai Z, Sun G, Sun X (2018) Protective Effects and Target Network Analysis of Ginsenoside Rg1 in Cerebral Ischemia and Reperfusion Injury: A Comprehensive Overview of Experimental Studies. Cells 7(12):270\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang S, Jin H, Zhu Y, Wan Y, Opoku EN, Zhu L, Hu B (2017) Diverse Functions and Mechanisms of Pericytes in Ischemic Stroke. Current neuropharmacology 15(6):892\u0026ndash;905\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Q, Wang FJ, Jia ZZ, Zhang T, Sun J, Du XY, Wang SX, Chai LJ, Hu LM (2022) Xueshuantong injection combined with Salvianolate lyophilized injection improves the synaptic plasticity against focal cerebral ischemia/reperfusion injury in rats through PI3K/AKT/mTOR and RhoA/ROCK pathways. Brain research 1787:147923\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Song J, Li W, Kong D, Liang Y, Zhao X, Du G (2020) Salvianolic Acid D Alleviates Cerebral Ischemia-Reperfusion Injury by Suppressing the Cytoplasmic Translocation and Release of HMGB1-Triggered NF-κB Activation to Inhibit Inflammatory Response. Mediators of inflammation 2020:9049614\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Zhang X, Cui L, Chen R, Zhang C, Li Y, He T, Zhu X, Shen Z, Dong L, Zhao J, Wen Y, Zheng X, Li P (2017) Salvianolic Acids for Injection (SAFI) promotes functional recovery and neurogenesis via sonic hedgehog pathway after stroke in mice. Neurochemistry international 110:38\u0026ndash;48\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou D, Cen K, Liu W, Liu F, Liu R, Sun Y, Zhao Y, Chang J, Zhu L (2021) Xuesaitong exerts long-term neuroprotection for stroke recovery by inhibiting the ROCKII pathway, in vitro and in vivo. J Ethnopharmacol 272:113943\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-molecular-neuroscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jomn","sideBox":"Learn more about [Journal of Molecular Neuroscience](https://www.springer.com/journal/12031)","snPcode":"12031","submissionUrl":"https://submission.nature.com/new-submission/12031/3","title":"Journal of Molecular Neuroscience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Pericytes, OGD/R, Oxidative stress, Apoptosis, Angiogenesis","lastPublishedDoi":"10.21203/rs.3.rs-1984984/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1984984/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Salvia miltiorrhiza (SAL) and Panax notoginseng (PNS) is widely used for the treatment of ischemic stroke. However, what components of SAL and PNS protect brain microvascular pericytes after ischemic stroke remains unclear. We evaluated protective effects and mechanisms of the components of SAL and PNS in pericytes subjected to oxygen-glucose deprivation /reoxygenation (OGD/R). Pericytes were subjected to OGD/R. Cell Counting Kit-8 (CCK-8) was performed to evaluate cell viability. ROS and SOD kits were performed to detect oxidative stress. Flow cytometry was performed to analyze cells apoptosis. Scratch assay was performed to evaluate cells migration. Western blot was performed to detected expression of apoptosis proteins, VEGF, Ang-1, PDGFRβ, PI3K/AKT and JNK/ERK/P38 signaling pathways. Results showed Salvianolic acid B (Sal B), Salvianolic acid B (Sal D), Notoginsenoside R1(R1), Ginsenoside Rb1 (Rb1) and Ginsenoside Rg1 (Rg1) increased cell viability of pericytes subjected to OGD/R, reduced the level of ROS and increased the expression of SOD. The components reduced cells apoptosis, increased the proteins level of Bcl-2/Bax, reduced the level of Cleaved caspased3/caspase3, increased cells migration and enhanced the levels of Ang-1, PDGFR-β and VEGF. The components could activate PI3K/AKT/mTOR pathway, inhibit JNK/ERK/P38 pathway. Studies found that Sal B, Sal D, R1, Rb1 and Rg1 inhibited oxidative stress and apoptosis, increased release of pro-angiogenic regulators of pericytes-related to PI3K/AKT/mTOR and JNK/ERK/P38 signaling pathways. This provides a candidate basis for the development of monomeric drugs for treatment of ischemic stroke.","manuscriptTitle":"Components of Salvia miltiorrhiza and Panax notoginseng against OGD/R-treated injury in Pericytes via regulating PI3K/AKT and JNK/ERK/P38 signaling pathways","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-08-30 16:06:55","doi":"10.21203/rs.3.rs-1984984/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-10-04T14:01:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-10-03T13:14:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7b436af8-6522-46ae-ae4d-3e203ee0fc75","date":"2022-09-28T14:14:35+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-08-26T15:12:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-08-26T07:18:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-08-26T07:18:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Molecular Neuroscience","date":"2022-08-22T06:40:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-molecular-neuroscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jomn","sideBox":"Learn more about [Journal of Molecular Neuroscience](https://www.springer.com/journal/12031)","snPcode":"12031","submissionUrl":"https://submission.nature.com/new-submission/12031/3","title":"Journal of Molecular Neuroscience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"823723d3-fb17-4426-be52-768e38681fd2","owner":[],"postedDate":"August 30th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-11-10T05:14:27+00:00","versionOfRecord":[],"versionCreatedAt":"2022-08-30 16:06:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1984984","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1984984","identity":"rs-1984984","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00