Real-Time PCR–Based Detection of Mycoplasma agalactiae in Sheep Bulk Tank Milk to Support Flock-Level Epidemiology | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Real-Time PCR–Based Detection of Mycoplasma agalactiae in Sheep Bulk Tank Milk to Support Flock-Level Epidemiology Carla Cacciotto, Tania Carta, Franca Mannu, Rosanna Zobba, Emanuela Bazzoni, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8829239/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract This study presents the development and large-scale field application of a real-time PCR assay designed for the detection of Mycoplasma agalactiae in bulk tank milk from dairy sheep farms. The assay demonstrated high analytical specificity and sensitivity, enabling reliable identification of low levels of target DNA typically present in bulk milk samples. Following analytical validation, the test was used to estimate within-herd prevalence and was applied in a regional surveillance program encompassing more than 900 sheep farms across Sardinia, Italy. The findings reveal widespread but often low-prevalence circulation of M. agalactiae within Sardinian flocks. The real-time PCR assay proved effective for identifying infected herds through a non-invasive, cost-efficient sampling matrix, underscoring its value as a practical tool for early detection and herd-level surveillance. This approach provides a scalable framework for monitoring contagious agalactia in areas with high densities of small-ruminant farms and supports the establishment of sustainable milk-based surveillance systems. Sheep mastitis milk quality control contagious agalactia molecular diagnosis Figures Figure 1 Figure 2 Figure 3 INTRODUCTION Contagious agalactia (CA) is a significant infectious disease of global concern affecting small ruminants and it is classified as a notifiable disease by the World Organization for Animal Health.(Agnone et al. 2013 ; Migliore et al. 2021 ) CA sensu stricto is caused by Mycoplasma agalactiae ( M. agalactiae ), a small wall-less bacterium belonging to the class Mollicutes . Clinically, CA is predominantly characterized by mastitis, resulting in a marked reduction in milk yield, and is frequently associated with other symptoms including keratoconjunctivitis, arthritis, and, less commonly, abortion. Due to its high morbidity (up to 100%), CA exerts a substantial economic burden on the small ruminant dairy sector, particularly in regions where this form of livestock production represents a major component of the agricultural economy, such as Sardinia.(De Azevedo et al. 2006 ; Migliore et al. 2021 ) Being a CA endemic region, Sardinia represents a critical area for the study and control of CA due to its dense population of small ruminants and the dominance of milk-oriented production systems. The island hosts approximately 3,019,108 sheep and 281,569 goats, representing 57.13% and 41.67% of the national totals, respectively. Sardinian farms contribute 68.92% of Italy’s sheep milk and 57.30% of Italian goat milk production and account for approximately 10% of total ovine milk output in Europe. The annual regional production of sheep and goat cheese is estimated at around 60,000 tons, with nearly 30,000 tons certified under the Protected Designation of Origin (PDO) label (Laore, 2019, Dati sull’allevamento ovino, caprino e bovino da latte in Sardegna, https://www.sardegnaagricoltura.it/documenti/14_43_20200904094410.pdf ). CA has been introduced in Sardinia since 1980, with recurring outbreaks in the following decades, causing considerable losses in milk production, animal welfare issues, and long-term economic consequences. The control of CA remains challenging, primarily due to the persistent nature of M. agalactiae within herds and its transmission through direct contact, contaminated milk, and fomites.(Loria et al. 2019 ) Current prophylactic measures and available vaccines have demonstrated limited efficacy in preventing the transmission and spread of M. agalactiae. (Corrales et al. 2007 ; Loria et al. 2019 ) Furthermore, CA often follows a cyclical pattern of remission and recrudescence, with asymptomatic windows during which infected animals can continue shedding mycoplasmas in milk at low bacterial loads.(Bergonier et al. 1997 ; Addis et al. 2011 ) In this context, the development of reliable diagnostic tools is essential for the effective management of CA. The standard diagnostic approach relies on the isolation of the pathogen which, although cost-effective and technically accessible, is time-consuming and may require additional analyses for species confirmation. In recent years, several molecular and serological methods have been developed for both direct and indirect detection of M. agalactiae , including endpoint and real-time PCR assays as well as ELISA-based diagnostics.(Dedieu et al. 1995 ; Tola et al. 1996 ; Rosati et al. 2000 ; Greco et al. 2001 ; Fusco et al. 2007 ; Lorusso et al. 2007 ; Becker et al. 2012 ) However, widespread implementation of these methods at the individual animal level remains limited due to their relatively high cost and the large flock sizes, which can comprise up to 1,000 sheep. The use of bulk tank milk (BTM) could offer a practical and cost-effective strategy suitable for large-scale implementation of dairy herd health surveillance systems supporting CA control and eradication programs.(Nobrega et al. 2023 ; Rowe et al. 2024 ) This study describes the development of a highly sensitive real-time PCR assay for the detection of M. agalactiae in BTM samples collected from sheep farms in Sardinia, enabling reliable identification of infection even in herds exhibiting low M. agalactiae prevalence. Following analytical validation of its specificity and sensitivity, the assay was employed in a large-scale epidemiological survey conducted on ovine farms in Sardinia. Implications for the development of regional surveys and for the implementation of broader BTM-based molecular surveillance systems at national and international levels are also discussed. MATERIALS AND METHODS Sample collection Individual and bulk tank milk samples were provided by the Laore Laboratory (formerly ARAS, Associazione Regionale Allevatori della Sardegna, Regional Breeders Association of Sardinia), which conducts routine quality control testing. Samples were collected between spring 2014 and spring 2015 from 924 sheep farms (7.3% of all sheep farms in Sardinia). Moreover, BTM and 62 individual milk samples were obtained from a sheep farm located in Ottana (Nuoro, Sardinia). DNA extraction Total DNA was extracted from 300 µL of individual or BTM with the MagMAX™ Express Magnetic Particle Processors (Applied Biosystems) using the dedicated kit and following vendor’s recommendations. DNA was then quantified with a NanoDrop Lite Spectrophotometer (Thermo Fisher) and stored at -20°C until further analysis. DNA from mycoplasmas was extracted with the DNeasy® Blood & Tissue Kit (Qiagen) following vendor’s recommendations. Primers and probes design Sequences of the M. agalactiae p48 gene from the PG2 T type strain and different field isolates were retrieved from the GenBank (Supplementary file 1) and aligned using the MUSCLE online tool ( https://www.ebi.ac.uk/jdispatcher/msa/muscle).(Madeira et al. 2024) Specific primers and the TaqMan™ MGB probe were designed on a conserved region of the p48 gene by using the Primer Express Software v2.0 (Applied Biosystems). The Ovis aries β-actin gene (NC_056077.1:39220697–39224085) was used as housekeeping gene and primers and probe were designed with the same tool. Primers and probes sequences are reported in Table 1 . Table 1 Primers used in this work Target gene Name Sequence (5’→3’) Position Amplicon size p48 MAGP48/F TTCAGGAACACCTCAAGCTACTACA 825–849 76 bp p48 MAGP48/R TGAACCAGCAACAGGGTAAGAA 879–900 76 bp p48 MAGP48/Probe 6-FAM-TAACTCTGTGGTTAAAGCT 855–873 76 bp β-actin β-ACT/F CGTCCGTGACATCAAGGAGAA 2054–2074 60 bp β-actin β-ACT/R GCCATCTCCTGCTCGAAGTC 2094–2113 60 bp β-actin β-ACT/Probe HEX- TCTGCTACGTGGCCC 2077–2091 60 bp Real-time PCR Real-time PCR was conducted using the Luna® Universal Probe qPCR Master Mix (New England Biolabs) according to the manufacturer’s instructions. Briefly, multiplex ( p48 + β-actin ) or singleplex (only p48 ) reaction mixtures were prepared as follows: 10 µL of 2X Luna® Universal Probe qPCR Mix, 0.4 µM each primer, 0.2 µM of each probe, 5 µL of template DNA (50 ng/µL), and nuclease-free water to reach the 20 µL final volume. The amplification was conducted in a Rotor-Gene Q instrument (Qiagen) using the following thermal cycling conditions: initial denaturation at 95°C for 1 min followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec. Fluorescence was detected using green or yellow channel with gain set to 5 for p48 and β-actin detection, respectively. Data analysis was performed using the Rotor-Gene Q Software version 2.3.1.49, setting the fluorescence threshold at 0.032 after the Noise Slope Correction. All samples were tested in triplicate and appropriate positive, negative, and no template controls (NTC) were included in all experiments. p48 real-time PCR specificity and sensitivity To evaluate specificity, genomic DNA was extracted from 3 M. agalactiae field isolates and from various other Mycoplasma species of the M. hominis group or infecting small ruminants ( M. spumans , M. arthritidis , M. bovis , M. capricolum , M. gypis , M. hominis , M. mycoides , M. salivarium , and M. conjunctivae ). Twenty ng replicates (3) of genomic DNA were tested by p48 real-time PCR. Positive amplicons were Sanger-sequenced. The pVAX1/ p48 plasmid(Chessa et al. 2009 ) was used to generate a quantitative standard curve. Serial 10-fold dilutions ranging from 1x10⁷ copies to a single copy of the target sequence were prepared in TE buffer to generate a standard curve. Dilutions were analysed in triplicate by real-time PCR and the limit of detection (LOD) was determined. To evaluate the performance of the assay throughout the entire workflow, the same plasmid dilutions were spiked into 300 µL aliquots of pasteurized milk. DNA was extracted as described above and then subjected to real-time PCR under the same conditions used for the standard curve. The sensitivity of the method was also assessed in relation to within-herd M. agalactiae prevalence, with the aim of determining the minimum number of infected sheep contributing to BTM required for a positive BTM test result. Briefly, BTM and 62 individual milk samples coming from the Ottana herd were tested by real-time PCR and classified as negative (not determined, ND), positive (Ct ≤ 35), or borderline (Ct > 35). The prevalence of M. agalactiae was calculated. Three different simulated BTM samples (namely M1, M2, and M3) were prepared by mixing positive and negative samples in order to reach the real prevalence in the herd, previously calculated by testing the 63 individual samples. The same negative samples were used for all 3 mixes, while the positive samples were chosen randomly for each mix. Simulated and real BTM samples were diluted to 1:5, 1:10, 1:25, 1:50 in M. agalactiae -negative milk. All these samples were subjected to DNA extraction and p48 real-time PCR, as previously described. Statistical analysis and graphics were generated with the GraphPad Prism 5.04 software. Epidemiological investigation DNA samples obtained from 930 BTM samples collected from 930 sheep farms in Sardinia, were tested by M. agalactiae p48 -based real-time PCR. Samples were classified as negative (ND), positive (Ct ≤ 35), or borderline (Ct > 35). The online tool Map Maker ( https://maps.co/gis/ ) was used to georeference the screened farms, integrate the corresponding results, and generate the GIS map. RESULTS Specificity and sensitivity assessment The specificity of the p48 real-time PCR assay was evaluated by testing DNA from multiple non-target Mycoplasma species together with 3 M. agalactiae field isolates. M. spumans, M. arthritidis, M. bovis, M. capricolum, M. gypis, M. hominis, M. mycoides, M. salivarium , and M. conjunctivae were always PCR negative, while all M. agalactiae field isolates generated a positive signal in real-time PCR (data not shown). Moreover, the specificity of the amplicon was confirmed by Sanger sequencing. No amplification was observed in NTCs, confirming the absence of artifacts or primers dimers. To evaluate p48 real-time PCR sensitivity, 10-fold serial dilutions (1×10⁷ to 1 copy per reaction) of the pVAX1/ p48 plasmid were prepared both in TE buffer and in milk. Standard curves were generated and linearity was observed across the dilution series in both matrices (Fig. 1 ), with R² values of 0.998 and 0.986 for the TE buffer and milk preparations, respectively. Ct values were consistently higher in milk than in TE buffer. Samples were considered positive with Ct ≤ 35 while samples with 35 < Ct ≤ 40 were classified as borderline. The limit of detection (LOD) was determined at 10 copies per reaction in both matrices. At this concentration, the assay yielded mean Ct values of 32.68 (± 1.09 SD) in TE buffer and 33.30 (± 0.59 SD) in milk, with low coefficients of variation (3.3% and 1.8%, respectively). The minimum number of infected sheep contributing to BTM required for a positive BTM test result was evaluated. First, the M. agalactiae prevalence was determined within the Ottana herd by testing 62 individual milk samples. Real-time PCR identified 26 (41.93%) positive, 3 (4.84%) borderline, and 33 (53.23%) negative samples, establishing M. agalactiae prevalence in this flock at approximately 42%. Starting from these data, 3 mixes (namely M1, M2, and M3) were created simulating 3 BTM samples with 42% prevalence. Dilutions of the BTM and M1, M2, and M3 were obtained and tested by real-time PCR (see Materials and Methods). Figure 2 shows the relationship between estimated prevalence (varying from 42% to 0.84%) and Ct values obtained from dilutions of both simulated and real BTM samples. Similar trends were observed across all samples, with BTM, M1, and M2 showing comparable Ct values across the considered prevalence levels. In contrast, M3 consistently exhibited lower Ct values, suggesting a higher concentration of M. agalactiae . The LOD was established at 1.68% prevalence, even if an amplification signal was constantly detected also with prevalence < 1%. Epidemiological investigation The newly developed real-time PCR assay was used to perform an epidemiological survey on M. agalactiae in Sardinia. We screened 924/12,560 (7.3%) ovine flocks, located across 156 municipalities. Among the tested flocks, 34 (3.68%) tested positive for M. agalactiae , 19 (2.06%) yielded borderline results, and 871 (94.26%) tested negative. The geographical distribution of the total sampled farms and the positive and borderline flocks is shown in Fig. 3 . Data confirmed that M. agalactiae is geographically widespread in Sardinia. The herd-level prevalence was estimated at 3.68%. DISCUSSION Contagious agalactia (CA) remains one of the most significant infectious diseases affecting small ruminant dairy systems worldwide, particularly in endemic regions of the Mediterranean area. The chronic and recurrent nature of M. agalactiae infections, coupled with its ability to persist and be shed intermittently in milk, pose major challenges for disease control and eradication. Traditional bacteriological culture, although specific, is laborious and time-consuming, and its diagnostic sensitivity is often limited by intermittent bacterial shedding and overgrowth of contaminants.(Bergonier et al. 1997 ; Loria et al. 2019 ) Molecular techniques, and especially real-time PCR, have emerged as powerful tools for the rapid and specific detection of M. agalactiae ,(Lorusso et al. 2007 ; Becker et al. 2012 ) yet their widespread application at the individual-animal level remains limited due to the high cost in large flocks.(Nobrega et al. 2023 ) The present study aimed to overcome these constraints by developing and validating a novel p48 -based real-time PCR assay for the detection of M. agalactiae in bulk tank milk (BTM). The assay demonstrated high analytical specificity, as no amplification was observed in DNA from phylogenetically related Mycoplasma species. The absence of false-positive signals or primers dimer artifacts confirmed the robustness of the assay design. The assay exhibited high analytical sensitivity, with a limit of detection (LOD) of 10 copies per reaction in both TE buffer and milk matrices. The slightly higher Ct values observed in milk compared with TE buffer likely reflect moderate DNA loss during extraction. At the herd level, the assay successfully detected M. agalactiae DNA in both simulated and real BTM samples, even at a within-herd prevalence as low as 1.68%. This result is highly relevant from a diagnostic perspective, since M. agalactiae prevalence in lactating ewes during CA outbreaks can range from 1% to 50%.(Bergonier et al. 1997 ) The consistent amplification profiles obtained from simulated and real BTM samples indicate a high degree of assay reproducibility and robustness under field conditions, where heterogeneity in milk yield and pathogen shedding is expected.(Addis et al. 2011 ) This high sensitivity suggests that the assay could serve as an early-warning tool for herd-level screening, detecting infection even in subclinical or pre-epidemic phases. The large-scale application of this diagnostic method in Sardinia provided valuable epidemiological insights. The detection of M. agalactiae in 3.68% flocks confirms that the pathogen remains endemic in the region, albeit at relatively low levels outside outbreak periods. These findings are consistent with earlier reports of persistent, low-level circulation of M. agalactiae in Mediterranean small ruminants.(De la Fe et al. 2005 ; Ariza-Miguel et al. 2012 ; Migliore et al. 2021 ) Sardinia’s dense dairy sheep population, uniform management systems, and well-established milk collection network make it an ideal setting for implementing BTM-based molecular surveillance. Importantly, BTM testing represents a cost-effective and logistically feasible approach for large-scale monitoring of CA. Compared with individual milk testing, BTM analysis integrates milk from the entire herd, providing a representative assessment of infection status while significantly reducing costs.(Rowe et al. 2024 ) This strategy can be readily integrated into existing milk quality and somatic cell count monitoring programs, enhancing early detection capacity and supporting regional control efforts. The adoption of molecular BTM testing could thus strengthen CA surveillance programs, both in endemic regions such as Sardinia and in other European and Mediterranean countries where CA remains a notifiable disease.(Bergonier et al. 1997 ) In conclusion, the p48 real-time PCR assay described here exhibits high specificity, sensitivity, and reproducibility, making it a valuable tool for the detection of M. agalactiae in BTM. Its demonstrated capacity to identify infection at low prevalence highlights its utility for early detection, herd-level surveillance, and control of CA. Integration of this assay into existing milk monitoring frameworks could substantially improve diagnostic efficiency and contribute to the long-term management and reduction of CA in small ruminant populations. CONCLUSIONS The real-time PCR assay developed in this study showed high specificity, sensitivity, and reproducibility for detecting M. agalactiae in BTM, with reliable detection at low within-herd prevalence levels. Field application in Sardinia confirmed low but widespread circulation of M. agalactiae , consistent with endemic conditions. These findings support the assay’s utility for early detection during CA herd-level surveillance. Integrating BTM monitoring into diagnostic routine offers a cost-effective, scalable approach to CA control, particularly in high-density production areas with established milk quality infrastructure. This work provides a foundation for broader adoption of BTM-based molecular surveillance strategies at international level, effective monitoring of herd health status, optimization of prophylactic measures, and establishment of a permanent veterinary surveillance system for this economically and socio-medically impactful pathology. Declarations ACKNOWLEDGMENTS This work was funded by the Agritech National Research Center and received funding from the European Union Next-GenerationEU (PIANO NAZIONALE DI RIPRESA E RESILIENZA (PNRR) – MISSIONE 4 COMPONENTE 2, INVESTIMENTO 1.4 – D.D. 1032 17/06/2022, CN00000022). AUTHOR CONTRIBUTION A.A., C.C. and M.P. designed the study; T.C., I.I., and D.M. collected the samples; C.C., T.C., R.Z., M.B., F.M., I.I., and D.M. performed the experiments; A.A. and C.C. analyzed the data; A.A. and C.C. wrote the manuscript; M.P., T.C., F.T., and M.P.. revised the manuscript. COMPETING INTEREST STATEMENT The authors declare no competing or financial interests. References Addis MF, Pisanu S, Ghisaura S et al (2011) Proteomics and pathway analyses of the milk fat globule in sheep naturally infected by Mycoplasma agalactiae provide indications of the in vivo response of the mammary epithelium to bacterial infection. Infect Immun 79:3833–3845. https://doi.org/10.1128/IAI.00040-11 Agnone A, La Manna M, Sireci G et al (2013) A comparison of the efficacy of commercial and experimental vaccines for contagious agalactia in sheep. Small Ruminant Res. https://doi.org/10.1016/j.smallrumres.2012.12.022 Ariza-Miguel J, Rodríguez-Lázaro D, Hernández M (2012) A survey of Mycoplasma agalactiae in dairy sheep farms in Spain. BMC Vet Res 8:1–7. https://doi.org/10.1186/1746-6148-8-171/FIGURES/3 Becker CAM, Ramos F, Sellal E et al (2012) Development of a multiplex real-time PCR for contagious agalactia diagnosis in small ruminants. J Microbiol Methods 90:73–79. https://doi.org/10.1016/J.MIMET.2012.04.020 Bergonier D, Berthelot X, Poumarat F (1997) Contagious agalactia of small ruminants: Current knowledge concerning epidemiology, diagnosis and control. OIE Revue Scientifique et Technique 16:848–873. https://doi.org/10.20506/RST.16.3.1062 Chessa B, Pittau M, Puricelli M et al (2009) Genetic immunization with the immunodominant antigen P48 of Mycoplasma agalactiae stimulates a mixed adaptive immune response in BALBc mice. Res Vet Sci. https://doi.org/10.1016/j.rvsc.2008.09.010 Corrales JC, Esnal A, De la Fe C et al (2007) Contagious agalactia in small ruminants. Small Ruminant Res. https://doi.org/10.1016/j.smallrumres.2006.09.010 De Azevedo EO, De Alcântara MDB, Do Nascimento ER et al (2006) Contagious agalactia by Mycoplasma agalactiae in small ruminants in Brazil: first report. Brazilian J Microbiol 37:576–581. https://doi.org/10.1590/S1517-83822006000400033 De la Fe C, Assunção P, Antunes T et al (2005) Microbiological survey for Mycoplasma spp. in a contagious agalactia endemic area. Vet J 170:257–259. https://doi.org/10.1016/J.TVJL.2004.05.002 Dedieu L, Mady V, Lefevre P-C (1995) Development of two PCR assays for the identification of mycoplasmas causing contagious agalactia. FEMS Microbiol Lett 129:243–249. https://doi.org/10.1111/J.1574-6968.1995.TB07587.X Fusco M, Corona L, Onni T et al (2007) Development of a sensitive and specific enzyme-linked immunosorbent assay based on recombinant antigens for rapid detection of antibodies against Mycoplasma agalactiae in sheep. Clin Vaccine Immunol. https://doi.org/10.1128/CVI.00439-06 Greco G, Corrente M, Martella V et al (2001) A multiplex-PCR for the diagnosis of contagious agalactia of sheep and goats. Mol Cell Probes 15:21–25. https://doi.org/10.1006/mcpr.2000.0337 Loria GR, Puleio R, Filioussis G et al (2019) Contagious agalactia: costs and control revisited. Rev Sci Tech 38:695–702. https://doi.org/10.20506/RST.38.3.3018 Lorusso A, Decaro N, Greco G et al (2007) A real-time PCR assay for detection and quantification of Mycoplasma agalactiae DNA. J Appl Microbiol 103:918–923. https://doi.org/10.1111/J.1365-2672.2007.03324.X Madeira F, Madhusoodanan N, Lee J et al (2024) The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res 52:W521–W525. https://doi.org/10.1093/NAR/GKAE241 Migliore S, Puleio R, Nicholas RAJ, Loria GR (2021) Mycoplasma agalactiae: The Sole Cause of Classical Contagious Agalactia? Animals 2021, Vol 11, Page 1782 11:1782. https://doi.org/10.3390/ANI11061782 Nobrega DB, French JE, Kelton DF (2023) A scoping review of the testing of bulk milk to detect infectious diseases of dairy cattle: Diseases caused by bacteria. J Dairy Sci 106:1986–2006. https://doi.org/10.3168/JDS.2022-22395 Rosati S, Robino P, Fadda M et al (2000) Expression and antigenic characterization of recombinant Mycoplasma agalactiae P48 major surface protein. Vet Microbiol. https://doi.org/10.1016/S0378-1135(99)00164-9 Rowe S, House JK, Zadoks RN (2024) Milk as diagnostic fluid for udder health management. Aust Vet J 102:5–10. https://doi.org/10.1111/AVJ.13290 Tola S, Idini G, Manunta D et al (1996) Rapid and specific detection of Mycoplasma agalactiae by polymerase chain reaction. Vet Microbiol. https://doi.org/10.1016/0378-1135(96)00023-5 Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial1.txt Supplementary file 1 contains nucleotide sequences of the M. agalactiae p48 gene from the PG2 T type strain and different field isolates Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 17 Feb, 2026 Editor assigned by journal 16 Feb, 2026 Submission checks completed at journal 16 Feb, 2026 First submitted to journal 09 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8829239","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":592744464,"identity":"7c8a0cf6-ef96-4c0a-9041-54820e600dea","order_by":0,"name":"Carla Cacciotto","email":"","orcid":"","institution":"University of Sassari","correspondingAuthor":false,"prefix":"","firstName":"Carla","middleName":"","lastName":"Cacciotto","suffix":""},{"id":592744465,"identity":"82d90a09-6c59-49ee-9dd3-7b9b00afa435","order_by":1,"name":"Tania Carta","email":"","orcid":"","institution":"University of Sassari","correspondingAuthor":false,"prefix":"","firstName":"Tania","middleName":"","lastName":"Carta","suffix":""},{"id":592744466,"identity":"e0109e79-396e-4187-a2f5-e4818a00ee94","order_by":2,"name":"Franca Mannu","email":"","orcid":"","institution":"Nurex s.r.l.","correspondingAuthor":false,"prefix":"","firstName":"Franca","middleName":"","lastName":"Mannu","suffix":""},{"id":592744467,"identity":"7729f1f0-b8da-4d69-9d0f-69909fa501a7","order_by":3,"name":"Rosanna Zobba","email":"","orcid":"","institution":"University of Sassari","correspondingAuthor":false,"prefix":"","firstName":"Rosanna","middleName":"","lastName":"Zobba","suffix":""},{"id":592744468,"identity":"7b531ccc-cd40-4a18-987b-16206277011d","order_by":4,"name":"Emanuela Bazzoni","email":"","orcid":"","institution":"University of Sassari","correspondingAuthor":false,"prefix":"","firstName":"Emanuela","middleName":"","lastName":"Bazzoni","suffix":""},{"id":592744469,"identity":"fdf9d4c4-0a8a-449c-a05f-923c63c5e030","order_by":5,"name":"Ignazio Ibba","email":"","orcid":"","institution":"Laore Sardegna","correspondingAuthor":false,"prefix":"","firstName":"Ignazio","middleName":"","lastName":"Ibba","suffix":""},{"id":592744470,"identity":"c8f6495b-5fd0-40cf-a650-ca2f7303d63f","order_by":6,"name":"Danilo Muggianu","email":"","orcid":"","institution":"Laore Sardegna","correspondingAuthor":false,"prefix":"","firstName":"Danilo","middleName":"","lastName":"Muggianu","suffix":""},{"id":592744471,"identity":"f6825882-f0a8-466b-885e-80b7b00eca57","order_by":7,"name":"Francesco Turrini","email":"","orcid":"","institution":"Nurex s.r.l.","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Turrini","suffix":""},{"id":592744472,"identity":"a88a520b-32c3-44df-b521-7dcc9f612153","order_by":8,"name":"Marco Pittau","email":"","orcid":"","institution":"University of Sassari","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Pittau","suffix":""},{"id":592744473,"identity":"f134de4c-bcc9-455b-805e-5aab7f2fd95d","order_by":9,"name":"Vincenzo Carcangiu","email":"","orcid":"","institution":"University of Sassari","correspondingAuthor":false,"prefix":"","firstName":"Vincenzo","middleName":"","lastName":"Carcangiu","suffix":""},{"id":592744474,"identity":"9bc75f3b-3d45-4f52-868b-26a52fbeb44d","order_by":10,"name":"Alberto Alberti","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDACdh4QKSHHwMDYAGIQoYUZpCVBwhimhQg9EC0MiQ1QPmEt/M28Bx9X/rBI33C7ufnjDwaLOoJaJA7zJRueSZDI3XDnYJs0D1EOO8xjJtkA0nIjsY2ZKL/IH+Yx/wnUkm5wIxHkMCK0GABtYQRqSQBqaZAgymGGQL9INqRJGM4EOkyax0BCsoGQFrnjvQc/NtjUyfPdSH/88UdFHT9BW9DdSaqGUTAKRsEoGAVYAQD08jTbIeOjGQAAAABJRU5ErkJggg==","orcid":"","institution":"University of Sassari","correspondingAuthor":true,"prefix":"","firstName":"Alberto","middleName":"","lastName":"Alberti","suffix":""}],"badges":[],"createdAt":"2026-02-09 10:38:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8829239/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8829239/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104605515,"identity":"f97059a5-664a-4ab5-a752-36eb904b0be1","added_by":"auto","created_at":"2026-03-13 23:49:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":113301,"visible":true,"origin":"","legend":"\u003cp\u003eSensitivity of the \u003cem\u003eM. agalactiae\u003c/em\u003e \u003cem\u003ep48\u003c/em\u003e-based real-time PCR. (A) Standard curves of pVAX1/\u003cem\u003ep48\u003c/em\u003ediluted in TE buffer (empty squares) or milk (black circles). (B) Mean Ct values (3 replicates) of pVAX1/\u003cem\u003ep48\u003c/em\u003e serial dilutions in TE or in milk matrix. Data are expressed as Ct values ± SD.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8829239/v1/03541887359f672e2e8d8801.png"},{"id":104605517,"identity":"5556258c-6a19-4ed9-9ba8-a11db6349a7c","added_by":"auto","created_at":"2026-03-13 23:49:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":109355,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Mean Ct values obtained for simulated BTM dilutions at different estimated prevalence (%). Dashed lines represent the SD. (B) Mean Ct values obtained by real-time PCR for serial dilutions of the BTM and the 3 simulated mixes (M1, M2, and M3).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8829239/v1/9a74051c9df35fbbceb7e158.png"},{"id":104605518,"identity":"49414c11-345e-4c63-9e26-c8b97ad6dc67","added_by":"auto","created_at":"2026-03-13 23:49:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":998956,"visible":true,"origin":"","legend":"\u003cp\u003eGeographical distribution of sheep dairy farms included in the screening across Sardinia. Blue dots indicate screened farms; positive (red) and borderline (yellow) farms are reported.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8829239/v1/362e3697364cb108a89a96cb.png"},{"id":104782323,"identity":"812d8db0-773f-4f16-9374-923077da786d","added_by":"auto","created_at":"2026-03-17 07:57:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1758786,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8829239/v1/94bf69cb-595b-49ca-b4bf-55446ecacb0c.pdf"},{"id":104605516,"identity":"2030fe1e-7a98-46a1-9f8d-57a9f744080a","added_by":"auto","created_at":"2026-03-13 23:49:32","extension":"txt","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":41312,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary file 1 contains nucleotide sequences of the \u003cem\u003eM. agalactiae\u003c/em\u003e \u003cem\u003ep48\u003c/em\u003e gene from the PG2\u003csup\u003eT\u003c/sup\u003e type strain and different field isolates\u003c/p\u003e","description":"","filename":"Supplementarymaterial1.txt","url":"https://assets-eu.researchsquare.com/files/rs-8829239/v1/9e93d45fda29146d0f9b70ba.txt"}],"financialInterests":"No competing interests reported.","formattedTitle":"Real-Time PCR–Based Detection of Mycoplasma agalactiae in Sheep Bulk Tank Milk to Support Flock-Level Epidemiology","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eContagious agalactia (CA) is a significant infectious disease of global concern affecting small ruminants and it is classified as a notifiable disease by the World Organization for Animal Health.(Agnone et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Migliore et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) CA \u003cem\u003esensu stricto\u003c/em\u003e is caused by \u003cem\u003eMycoplasma agalactiae\u003c/em\u003e (\u003cem\u003eM. agalactiae\u003c/em\u003e), a small wall-less bacterium belonging to the class \u003cem\u003eMollicutes\u003c/em\u003e. Clinically, CA is predominantly characterized by mastitis, resulting in a marked reduction in milk yield, and is frequently associated with other symptoms including keratoconjunctivitis, arthritis, and, less commonly, abortion. Due to its high morbidity (up to 100%), CA exerts a substantial economic burden on the small ruminant dairy sector, particularly in regions where this form of livestock production represents a major component of the agricultural economy, such as Sardinia.(De Azevedo et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Migliore et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) Being a CA endemic region, Sardinia represents a critical area for the study and control of CA due to its dense population of small ruminants and the dominance of milk-oriented production systems. The island hosts approximately 3,019,108 sheep and 281,569 goats, representing 57.13% and 41.67% of the national totals, respectively. Sardinian farms contribute 68.92% of Italy\u0026rsquo;s sheep milk and 57.30% of Italian goat milk production and account for approximately 10% of total ovine milk output in Europe. The annual regional production of sheep and goat cheese is estimated at around 60,000 tons, with nearly 30,000 tons certified under the Protected Designation of Origin (PDO) label (Laore, 2019, Dati sull\u0026rsquo;allevamento ovino, caprino e bovino da latte in Sardegna, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.sardegnaagricoltura.it/documenti/14_43_20200904094410.pdf\u003c/span\u003e\u003cspan address=\"https://www.sardegnaagricoltura.it/documenti/14_43_20200904094410.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). CA has been introduced in Sardinia since 1980, with recurring outbreaks in the following decades, causing considerable losses in milk production, animal welfare issues, and long-term economic consequences.\u003c/p\u003e \u003cp\u003eThe control of CA remains challenging, primarily due to the persistent nature of \u003cem\u003eM. agalactiae\u003c/em\u003e within herds and its transmission through direct contact, contaminated milk, and fomites.(Loria et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) Current prophylactic measures and available vaccines have demonstrated limited efficacy in preventing the transmission and spread of \u003cem\u003eM. agalactiae.\u003c/em\u003e(Corrales et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Loria et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) Furthermore, CA often follows a cyclical pattern of remission and recrudescence, with asymptomatic windows during which infected animals can continue shedding mycoplasmas in milk at low bacterial loads.(Bergonier et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Addis et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2011\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eIn this context, the development of reliable diagnostic tools is essential for the effective management of CA. The standard diagnostic approach relies on the isolation of the pathogen which, although cost-effective and technically accessible, is time-consuming and may require additional analyses for species confirmation. In recent years, several molecular and serological methods have been developed for both direct and indirect detection of \u003cem\u003eM. agalactiae\u003c/em\u003e, including endpoint and real-time PCR assays as well as ELISA-based diagnostics.(Dedieu et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Tola et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Rosati et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Greco et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Fusco et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Lorusso et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Becker et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) However, widespread implementation of these methods at the individual animal level remains limited due to their relatively high cost and the large flock sizes, which can comprise up to 1,000 sheep. The use of bulk tank milk (BTM) could offer a practical and cost-effective strategy suitable for large-scale implementation of dairy herd health surveillance systems supporting CA control and eradication programs.(Nobrega et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Rowe et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThis study describes the development of a highly sensitive real-time PCR assay for the detection of \u003cem\u003eM. agalactiae\u003c/em\u003e in BTM samples collected from sheep farms in Sardinia, enabling reliable identification of infection even in herds exhibiting low \u003cem\u003eM. agalactiae\u003c/em\u003e prevalence. Following analytical validation of its specificity and sensitivity, the assay was employed in a large-scale epidemiological survey conducted on ovine farms in Sardinia. Implications for the development of regional surveys and for the implementation of broader BTM-based molecular surveillance systems at national and international levels are also discussed.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003e Individual and bulk tank milk samples were provided by the Laore Laboratory (formerly ARAS, Associazione Regionale Allevatori della Sardegna, Regional Breeders Association of Sardinia), which conducts routine quality control testing. Samples were collected between spring 2014 and spring 2015 from 924 sheep farms (7.3% of all sheep farms in Sardinia). Moreover, BTM and 62 individual milk samples were obtained from a sheep farm located in Ottana (Nuoro, Sardinia).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDNA extraction\u003c/h3\u003e\n\u003cp\u003eTotal DNA was extracted from 300 \u0026micro;L of individual or BTM with the MagMAX\u0026trade; Express Magnetic Particle Processors (Applied Biosystems) using the dedicated kit and following vendor\u0026rsquo;s recommendations. DNA was then quantified with a NanoDrop Lite Spectrophotometer (Thermo Fisher) and stored at -20\u0026deg;C until further analysis.\u003c/p\u003e \u003cp\u003eDNA from mycoplasmas was extracted with the DNeasy\u0026reg; Blood \u0026amp; Tissue Kit (Qiagen) following vendor\u0026rsquo;s recommendations.\u003c/p\u003e\n\u003ch3\u003ePrimers and probes design\u003c/h3\u003e\n\u003cp\u003eSequences of the \u003cem\u003eM. agalactiae p48\u003c/em\u003e gene from the PG2\u003csup\u003eT\u003c/sup\u003e type strain and different field isolates were retrieved from the GenBank (Supplementary file 1) and aligned using the MUSCLE online tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/jdispatcher/msa/muscle).(Madeira et al. 2024)\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/jdispatcher/msa/muscle).(Madeira et al. 2024)\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e Specific primers and the TaqMan\u0026trade; MGB probe were designed on a conserved region of the \u003cem\u003ep48\u003c/em\u003e gene by using the Primer Express Software v2.0 (Applied Biosystems). The \u003cem\u003eOvis aries β-actin\u003c/em\u003e gene (NC_056077.1:39220697\u0026ndash;39224085) was used as housekeeping gene and primers and probe were designed with the same tool. Primers and probes sequences are reported in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this work\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePosition\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmplicon size\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMAGP48/F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCAGGAACACCTCAAGCTACTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e825\u0026ndash;849\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e76 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMAGP48/R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAACCAGCAACAGGGTAAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e879\u0026ndash;900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e76 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMAGP48/Probe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6-FAM-TAACTCTGTGGTTAAAGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e855\u0026ndash;873\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e76 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eβ-ACT/F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTCCGTGACATCAAGGAGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2054\u0026ndash;2074\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eβ-ACT/R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCATCTCCTGCTCGAAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2094\u0026ndash;2113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eβ-ACT/Probe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHEX- TCTGCTACGTGGCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2077\u0026ndash;2091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eReal-time PCR\u003c/h3\u003e\n\u003cp\u003e Real-time PCR was conducted using the Luna\u0026reg; Universal Probe qPCR Master Mix (New England Biolabs) according to the manufacturer\u0026rsquo;s instructions. Briefly, multiplex (\u003cem\u003ep48\u003c/em\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eβ-actin\u003c/em\u003e) or singleplex (only \u003cem\u003ep48\u003c/em\u003e) reaction mixtures were prepared as follows: 10 \u0026micro;L of 2X Luna\u0026reg; Universal Probe qPCR Mix, 0.4 \u0026micro;M each primer, 0.2 \u0026micro;M of each probe, 5 \u0026micro;L of template DNA (50 ng/\u0026micro;L), and nuclease-free water to reach the 20 \u0026micro;L final volume. The amplification was conducted in a Rotor-Gene Q instrument (Qiagen) using the following thermal cycling conditions: initial denaturation at 95\u0026deg;C for 1 min followed by 40 cycles of 95\u0026deg;C for 15 sec and 60\u0026deg;C for 30 sec. Fluorescence was detected using green or yellow channel with gain set to 5 for \u003cem\u003ep48\u003c/em\u003e and \u003cem\u003eβ-actin\u003c/em\u003e detection, respectively. Data analysis was performed using the Rotor-Gene Q Software version 2.3.1.49, setting the fluorescence threshold at 0.032 after the Noise Slope Correction.\u003c/p\u003e \u003cp\u003eAll samples were tested in triplicate and appropriate positive, negative, and no template controls (NTC) were included in all experiments.\u003c/p\u003e \u003cp\u003e \u003cb\u003ep48\u003c/b\u003e \u003cb\u003ereal-time PCR specificity and sensitivity\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo evaluate specificity, genomic DNA was extracted from 3 \u003cem\u003eM. agalactiae\u003c/em\u003e field isolates and from various other \u003cem\u003eMycoplasma\u003c/em\u003e species of the \u003cem\u003eM. hominis\u003c/em\u003e group or infecting small ruminants (\u003cem\u003eM. spumans\u003c/em\u003e, \u003cem\u003eM. arthritidis\u003c/em\u003e, \u003cem\u003eM. bovis\u003c/em\u003e, \u003cem\u003eM. capricolum\u003c/em\u003e, \u003cem\u003eM. gypis\u003c/em\u003e, \u003cem\u003eM. hominis\u003c/em\u003e, \u003cem\u003eM. mycoides\u003c/em\u003e, \u003cem\u003eM. salivarium\u003c/em\u003e, and \u003cem\u003eM. conjunctivae\u003c/em\u003e). Twenty ng replicates (3) of genomic DNA were tested by \u003cem\u003ep48\u003c/em\u003e real-time PCR. Positive amplicons were Sanger-sequenced.\u003c/p\u003e \u003cp\u003eThe pVAX1/\u003cem\u003ep48\u003c/em\u003e plasmid(Chessa et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) was used to generate a quantitative standard curve. Serial 10-fold dilutions ranging from 1x10⁷ copies to a single copy of the target sequence were prepared in TE buffer to generate a standard curve. Dilutions were analysed in triplicate by real-time PCR and the limit of detection (LOD) was determined. To evaluate the performance of the assay throughout the entire workflow, the same plasmid dilutions were spiked into 300 \u0026micro;L aliquots of pasteurized milk. DNA was extracted as described above and then subjected to real-time PCR under the same conditions used for the standard curve.\u003c/p\u003e \u003cp\u003eThe sensitivity of the method was also assessed in relation to within-herd \u003cem\u003eM. agalactiae\u003c/em\u003e prevalence, with the aim of determining the minimum number of infected sheep contributing to BTM required for a positive BTM test result. Briefly, BTM and 62 individual milk samples coming from the Ottana herd were tested by real-time PCR and classified as negative (not determined, ND), positive (Ct\u0026thinsp;\u0026le;\u0026thinsp;35), or borderline (Ct\u0026thinsp;\u0026gt;\u0026thinsp;35). The prevalence of \u003cem\u003eM. agalactiae\u003c/em\u003e was calculated. Three different simulated BTM samples (namely M1, M2, and M3) were prepared by mixing positive and negative samples in order to reach the real prevalence in the herd, previously calculated by testing the 63 individual samples. The same negative samples were used for all 3 mixes, while the positive samples were chosen randomly for each mix. Simulated and real BTM samples were diluted to 1:5, 1:10, 1:25, 1:50 in \u003cem\u003eM. agalactiae\u003c/em\u003e-negative milk. All these samples were subjected to DNA extraction and \u003cem\u003ep48\u003c/em\u003e real-time PCR, as previously described. Statistical analysis and graphics were generated with the GraphPad Prism 5.04 software.\u003c/p\u003e\n\u003ch3\u003eEpidemiological investigation\u003c/h3\u003e\n\u003cp\u003eDNA samples obtained from 930 BTM samples collected from 930 sheep farms in Sardinia, were tested by \u003cem\u003eM. agalactiae p48\u003c/em\u003e-based real-time PCR. Samples were classified as negative (ND), positive (Ct\u0026thinsp;\u0026le;\u0026thinsp;35), or borderline (Ct\u0026thinsp;\u0026gt;\u0026thinsp;35). The online tool Map Maker (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://maps.co/gis/\u003c/span\u003e\u003cspan address=\"https://maps.co/gis/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to georeference the screened farms, integrate the corresponding results, and generate the GIS map.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSpecificity and sensitivity assessment\u003c/h2\u003e \u003cp\u003eThe specificity of the \u003cem\u003ep48\u003c/em\u003e real-time PCR assay was evaluated by testing DNA from multiple non-target \u003cem\u003eMycoplasma\u003c/em\u003e species together with 3 \u003cem\u003eM. agalactiae\u003c/em\u003e field isolates. \u003cem\u003eM. spumans, M. arthritidis, M. bovis, M. capricolum, M. gypis, M. hominis, M. mycoides, M. salivarium\u003c/em\u003e, and \u003cem\u003eM. conjunctivae\u003c/em\u003e were always PCR negative, while all \u003cem\u003eM. agalactiae\u003c/em\u003e field isolates generated a positive signal in real-time PCR (data not shown). Moreover, the specificity of the amplicon was confirmed by Sanger sequencing. No amplification was observed in NTCs, confirming the absence of artifacts or primers dimers.\u003c/p\u003e \u003cp\u003eTo evaluate \u003cem\u003ep48\u003c/em\u003e real-time PCR sensitivity, 10-fold serial dilutions (1\u0026times;10⁷ to 1 copy per reaction) of the pVAX1/\u003cem\u003ep48\u003c/em\u003e plasmid were prepared both in TE buffer and in milk. Standard curves were generated and linearity was observed across the dilution series in both matrices (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003e), with R\u0026sup2; values of 0.998 and 0.986 for the TE buffer and milk preparations, respectively. Ct values were consistently higher in milk than in TE buffer. Samples were considered positive with Ct\u0026thinsp;\u0026le;\u0026thinsp;35 while samples with 35\u0026thinsp;\u0026lt;\u0026thinsp;Ct\u0026thinsp;\u0026le;\u0026thinsp;40 were classified as borderline. The limit of detection (LOD) was determined at 10 copies per reaction in both matrices. At this concentration, the assay yielded mean Ct values of 32.68 (\u0026plusmn;\u0026thinsp;1.09 SD) in TE buffer and 33.30 (\u0026plusmn;\u0026thinsp;0.59 SD) in milk, with low coefficients of variation (3.3% and 1.8%, respectively).\u003c/p\u003e \u003cp\u003eThe minimum number of infected sheep contributing to BTM required for a positive BTM test result was evaluated. First, the \u003cem\u003eM. agalactiae\u003c/em\u003e prevalence was determined within the Ottana herd by testing 62 individual milk samples. Real-time PCR identified 26 (41.93%) positive, 3 (4.84%) borderline, and 33 (53.23%) negative samples, establishing \u003cem\u003eM. agalactiae\u003c/em\u003e prevalence in this flock at approximately 42%. Starting from these data, 3 mixes (namely M1, M2, and M3) were created simulating 3 BTM samples with 42% prevalence. Dilutions of the BTM and M1, M2, and M3 were obtained and tested by real-time PCR (see Materials and Methods). Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the relationship between estimated prevalence (varying from 42% to 0.84%) and Ct values obtained from dilutions of both simulated and real BTM samples. Similar trends were observed across all samples, with BTM, M1, and M2 showing comparable Ct values across the considered prevalence levels. In contrast, M3 consistently exhibited lower Ct values, suggesting a higher concentration of \u003cem\u003eM. agalactiae\u003c/em\u003e. The LOD was established at 1.68% prevalence, even if an amplification signal was constantly detected also with prevalence\u0026thinsp;\u0026lt;\u0026thinsp;1%.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEpidemiological investigation\u003c/h3\u003e\n\u003cp\u003eThe newly developed real-time PCR assay was used to perform an epidemiological survey on \u003cem\u003eM. agalactiae\u003c/em\u003e in Sardinia. We screened 924/12,560 (7.3%) ovine flocks, located across 156 municipalities. Among the tested flocks, 34 (3.68%) tested positive for \u003cem\u003eM. agalactiae\u003c/em\u003e, 19 (2.06%) yielded borderline results, and 871 (94.26%) tested negative. The geographical distribution of the total sampled farms and the positive and borderline flocks is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Data confirmed that \u003cem\u003eM. agalactiae\u003c/em\u003e is geographically widespread in Sardinia. The herd-level prevalence was estimated at 3.68%.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eContagious agalactia (CA) remains one of the most significant infectious diseases affecting small ruminant dairy systems worldwide, particularly in endemic regions of the Mediterranean area. The chronic and recurrent nature of \u003cem\u003eM. agalactiae\u003c/em\u003e infections, coupled with its ability to persist and be shed intermittently in milk, pose major challenges for disease control and eradication. Traditional bacteriological culture, although specific, is laborious and time-consuming, and its diagnostic sensitivity is often limited by intermittent bacterial shedding and overgrowth of contaminants.(Bergonier et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Loria et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) Molecular techniques, and especially real-time PCR, have emerged as powerful tools for the rapid and specific detection of \u003cem\u003eM. agalactiae\u003c/em\u003e,(Lorusso et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Becker et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) yet their widespread application at the individual-animal level remains limited due to the high cost in large flocks.(Nobrega et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThe present study aimed to overcome these constraints by developing and validating a novel \u003cem\u003ep48\u003c/em\u003e-based real-time PCR assay for the detection of \u003cem\u003eM. agalactiae\u003c/em\u003e in bulk tank milk (BTM). The assay demonstrated high analytical specificity, as no amplification was observed in DNA from phylogenetically related \u003cem\u003eMycoplasma\u003c/em\u003e species. The absence of false-positive signals or primers dimer artifacts confirmed the robustness of the assay design. The assay exhibited high analytical sensitivity, with a limit of detection (LOD) of 10 copies per reaction in both TE buffer and milk matrices. The slightly higher Ct values observed in milk compared with TE buffer likely reflect moderate DNA loss during extraction.\u003c/p\u003e \u003cp\u003eAt the herd level, the assay successfully detected \u003cem\u003eM. agalactiae\u003c/em\u003e DNA in both simulated and real BTM samples, even at a within-herd prevalence as low as 1.68%. This result is highly relevant from a diagnostic perspective, since \u003cem\u003eM. agalactiae\u003c/em\u003e prevalence in lactating ewes during CA outbreaks can range from 1% to 50%.(Bergonier et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) The consistent amplification profiles obtained from simulated and real BTM samples indicate a high degree of assay reproducibility and robustness under field conditions, where heterogeneity in milk yield and pathogen shedding is expected.(Addis et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) This high sensitivity suggests that the assay could serve as an early-warning tool for herd-level screening, detecting infection even in subclinical or pre-epidemic phases.\u003c/p\u003e \u003cp\u003eThe large-scale application of this diagnostic method in Sardinia provided valuable epidemiological insights. The detection of \u003cem\u003eM. agalactiae\u003c/em\u003e in 3.68% flocks confirms that the pathogen remains endemic in the region, albeit at relatively low levels outside outbreak periods. These findings are consistent with earlier reports of persistent, low-level circulation of \u003cem\u003eM. agalactiae\u003c/em\u003e in Mediterranean small ruminants.(De la Fe et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Ariza-Miguel et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Migliore et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) Sardinia\u0026rsquo;s dense dairy sheep population, uniform management systems, and well-established milk collection network make it an ideal setting for implementing BTM-based molecular surveillance.\u003c/p\u003e \u003cp\u003eImportantly, BTM testing represents a cost-effective and logistically feasible approach for large-scale monitoring of CA. Compared with individual milk testing, BTM analysis integrates milk from the entire herd, providing a representative assessment of infection status while significantly reducing costs.(Rowe et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) This strategy can be readily integrated into existing milk quality and somatic cell count monitoring programs, enhancing early detection capacity and supporting regional control efforts. The adoption of molecular BTM testing could thus strengthen CA surveillance programs, both in endemic regions such as Sardinia and in other European and Mediterranean countries where CA remains a notifiable disease.(Bergonier et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1997\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eIn conclusion, the \u003cem\u003ep48\u003c/em\u003e real-time PCR assay described here exhibits high specificity, sensitivity, and reproducibility, making it a valuable tool for the detection of \u003cem\u003eM. agalactiae\u003c/em\u003e in BTM. Its demonstrated capacity to identify infection at low prevalence highlights its utility for early detection, herd-level surveillance, and control of CA. Integration of this assay into existing milk monitoring frameworks could substantially improve diagnostic efficiency and contribute to the long-term management and reduction of CA in small ruminant populations.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eThe real-time PCR assay developed in this study showed high specificity, sensitivity, and reproducibility for detecting \u003cem\u003eM. agalactiae\u003c/em\u003e in BTM, with reliable detection at low within-herd prevalence levels. Field application in Sardinia confirmed low but widespread circulation of \u003cem\u003eM. agalactiae\u003c/em\u003e, consistent with endemic conditions. These findings support the assay\u0026rsquo;s utility for early detection during CA herd-level surveillance. Integrating BTM monitoring into diagnostic routine offers a cost-effective, scalable approach to CA control, particularly in high-density production areas with established milk quality infrastructure. This work provides a foundation for broader adoption of BTM-based molecular surveillance strategies at international level, effective monitoring of herd health status, optimization of prophylactic measures, and establishment of a permanent veterinary surveillance system for this economically and socio-medically impactful pathology.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the Agritech National Research Center and received funding from the European Union Next-GenerationEU (PIANO NAZIONALE DI RIPRESA E RESILIENZA (PNRR) \u0026ndash; MISSIONE 4 COMPONENTE 2, INVESTIMENTO 1.4 \u0026ndash; D.D. 1032 17/06/2022, CN00000022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.A., C.C. and M.P. designed the study; T.C., I.I., and D.M. collected the samples; C.C., T.C., R.Z., M.B., F.M., I.I., and D.M. performed the experiments; A.A. and C.C. analyzed the data; A.A. and C.C. wrote the manuscript; M.P., T.C., F.T., and M.P.. revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCOMPETING INTEREST STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing or financial interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAddis MF, Pisanu S, Ghisaura S et al (2011) Proteomics and pathway analyses of the milk fat globule in sheep naturally infected by Mycoplasma agalactiae provide indications of the in vivo response of the mammary epithelium to bacterial infection. Infect Immun 79:3833\u0026ndash;3845. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/IAI.00040-11\u003c/span\u003e\u003cspan address=\"10.1128/IAI.00040-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgnone A, La Manna M, Sireci G et al (2013) A comparison of the efficacy of commercial and experimental vaccines for contagious agalactia in sheep. Small Ruminant Res. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.smallrumres.2012.12.022\u003c/span\u003e\u003cspan address=\"10.1016/j.smallrumres.2012.12.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAriza-Miguel J, Rodr\u0026iacute;guez-L\u0026aacute;zaro D, Hern\u0026aacute;ndez M (2012) A survey of Mycoplasma agalactiae in dairy sheep farms in Spain. BMC Vet Res 8:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1746-6148-8-171/FIGURES/3\u003c/span\u003e\u003cspan address=\"10.1186/1746-6148-8-171/FIGURES/3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBecker CAM, Ramos F, Sellal E et al (2012) Development of a multiplex real-time PCR for contagious agalactia diagnosis in small ruminants. J Microbiol Methods 90:73\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.MIMET.2012.04.020\u003c/span\u003e\u003cspan address=\"10.1016/J.MIMET.2012.04.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBergonier D, Berthelot X, Poumarat F (1997) Contagious agalactia of small ruminants: Current knowledge concerning epidemiology, diagnosis and control. OIE Revue Scientifique et Technique 16:848\u0026ndash;873. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20506/RST.16.3.1062\u003c/span\u003e\u003cspan address=\"10.20506/RST.16.3.1062\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChessa B, Pittau M, Puricelli M et al (2009) Genetic immunization with the immunodominant antigen P48 of Mycoplasma agalactiae stimulates a mixed adaptive immune response in BALBc mice. Res Vet Sci. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.rvsc.2008.09.010\u003c/span\u003e\u003cspan address=\"10.1016/j.rvsc.2008.09.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorrales JC, Esnal A, De la Fe C et al (2007) Contagious agalactia in small ruminants. Small Ruminant Res. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.smallrumres.2006.09.010\u003c/span\u003e\u003cspan address=\"10.1016/j.smallrumres.2006.09.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Azevedo EO, De Alc\u0026acirc;ntara MDB, Do Nascimento ER et al (2006) Contagious agalactia by Mycoplasma agalactiae in small ruminants in Brazil: first report. Brazilian J Microbiol 37:576\u0026ndash;581. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S1517-83822006000400033\u003c/span\u003e\u003cspan address=\"10.1590/S1517-83822006000400033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe la Fe C, Assun\u0026ccedil;\u0026atilde;o P, Antunes T et al (2005) Microbiological survey for Mycoplasma spp. in a contagious agalactia endemic area. Vet J 170:257\u0026ndash;259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.TVJL.2004.05.002\u003c/span\u003e\u003cspan address=\"10.1016/J.TVJL.2004.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDedieu L, Mady V, Lefevre P-C (1995) Development of two PCR assays for the identification of mycoplasmas causing contagious agalactia. FEMS Microbiol Lett 129:243\u0026ndash;249. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/J.1574-6968.1995.TB07587.X\u003c/span\u003e\u003cspan address=\"10.1111/J.1574-6968.1995.TB07587.X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFusco M, Corona L, Onni T et al (2007) Development of a sensitive and specific enzyme-linked immunosorbent assay based on recombinant antigens for rapid detection of antibodies against Mycoplasma agalactiae in sheep. Clin Vaccine Immunol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/CVI.00439-06\u003c/span\u003e\u003cspan address=\"10.1128/CVI.00439-06\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreco G, Corrente M, Martella V et al (2001) A multiplex-PCR for the diagnosis of contagious agalactia of sheep and goats. Mol Cell Probes 15:21\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/mcpr.2000.0337\u003c/span\u003e\u003cspan address=\"10.1006/mcpr.2000.0337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoria GR, Puleio R, Filioussis G et al (2019) Contagious agalactia: costs and control revisited. Rev Sci Tech 38:695\u0026ndash;702. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20506/RST.38.3.3018\u003c/span\u003e\u003cspan address=\"10.20506/RST.38.3.3018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLorusso A, Decaro N, Greco G et al (2007) A real-time PCR assay for detection and quantification of Mycoplasma agalactiae DNA. J Appl Microbiol 103:918\u0026ndash;923. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/J.1365-2672.2007.03324.X\u003c/span\u003e\u003cspan address=\"10.1111/J.1365-2672.2007.03324.X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadeira F, Madhusoodanan N, Lee J et al (2024) The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res 52:W521\u0026ndash;W525. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/NAR/GKAE241\u003c/span\u003e\u003cspan address=\"10.1093/NAR/GKAE241\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMigliore S, Puleio R, Nicholas RAJ, Loria GR (2021) Mycoplasma agalactiae: The Sole Cause of Classical Contagious Agalactia? Animals 2021, Vol 11, Page 1782 11:1782. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ANI11061782\u003c/span\u003e\u003cspan address=\"10.3390/ANI11061782\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNobrega DB, French JE, Kelton DF (2023) A scoping review of the testing of bulk milk to detect infectious diseases of dairy cattle: Diseases caused by bacteria. J Dairy Sci 106:1986\u0026ndash;2006. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3168/JDS.2022-22395\u003c/span\u003e\u003cspan address=\"10.3168/JDS.2022-22395\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosati S, Robino P, Fadda M et al (2000) Expression and antigenic characterization of recombinant Mycoplasma agalactiae P48 major surface protein. Vet Microbiol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0378-1135(99)00164-9\u003c/span\u003e\u003cspan address=\"10.1016/S0378-1135(99)00164-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRowe S, House JK, Zadoks RN (2024) Milk as diagnostic fluid for udder health management. Aust Vet J 102:5\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/AVJ.13290\u003c/span\u003e\u003cspan address=\"10.1111/AVJ.13290\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTola S, Idini G, Manunta D et al (1996) Rapid and specific detection of Mycoplasma agalactiae by polymerase chain reaction. Vet Microbiol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0378-1135(96)00023-5\u003c/span\u003e\u003cspan address=\"10.1016/0378-1135(96)00023-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Sheep mastitis, milk quality control, contagious agalactia, molecular diagnosis","lastPublishedDoi":"10.21203/rs.3.rs-8829239/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8829239/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study presents the development and large-scale field application of a real-time PCR assay designed for the detection of \u003cem\u003eMycoplasma agalactiae\u003c/em\u003e in bulk tank milk from dairy sheep farms. The assay demonstrated high analytical specificity and sensitivity, enabling reliable identification of low levels of target DNA typically present in bulk milk samples. Following analytical validation, the test was used to estimate within-herd prevalence and was applied in a regional surveillance program encompassing more than 900 sheep farms across Sardinia, Italy. The findings reveal widespread but often low-prevalence circulation of \u003cem\u003eM. agalactiae\u003c/em\u003e within Sardinian flocks. The real-time PCR assay proved effective for identifying infected herds through a non-invasive, cost-efficient sampling matrix, underscoring its value as a practical tool for early detection and herd-level surveillance. This approach provides a scalable framework for monitoring contagious agalactia in areas with high densities of small-ruminant farms and supports the establishment of sustainable milk-based surveillance systems.\u003c/p\u003e","manuscriptTitle":"Real-Time PCR–Based Detection of Mycoplasma agalactiae in Sheep Bulk Tank Milk to Support Flock-Level Epidemiology","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-13 23:49:27","doi":"10.21203/rs.3.rs-8829239/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-17T12:50:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-16T15:09:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-16T15:06:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"Veterinary Research Communications","date":"2026-02-09T09:59:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"veterinary-research-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"verc","sideBox":"Learn more about [Veterinary Research Communications](https://www.springer.com/journal/11259)","snPcode":"11259","submissionUrl":"https://submission.nature.com/new-submission/11259/3","title":"Veterinary Research Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d0300bbb-2530-466d-a7cd-7676e7addd2e","owner":[],"postedDate":"March 13th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-13T23:49:27+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-13 23:49:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8829239","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8829239","identity":"rs-8829239","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.