Harnessing MicroRNAs to Attenuate Aspergillus fumigatus Virulence: A New Paradigm in Antifungal Therapy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Harnessing MicroRNAs to Attenuate Aspergillus fumigatus Virulence: A New Paradigm in Antifungal Therapy Tatsuya Inukai, Rikuto Watanabe, Yoshiki Murakami, Horacio Cabral, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6274481/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 May, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Aspergillus fumigatus , which causes aspergillosis, has developed resistance to azole antifungal agents in recent years. As only three main classes of antifungal drugs are available, the development of novel therapeutic strategies is crucial. We aimed to control the expression of virulence factors by introducing microRNAs (miRNAs) into fungi as an innovative therapeutic approach. To test our hypothesis, we selected miRNA mimics targeting alb1 , which is involved in the synthesis of melanin, a virulence factor of A. fumigatus , and transfected them into the protoplast of the fungus, which resulted in a 2-fold reduction in alb1 expression. Next, we created a 3×HA-tagged Alb1 protein (Alb1-HAp)-expressing strain and confirmed the regulation of translation using western blotting with an anti-HA antibody. The protein amount of Alb1-HAp was reduced by one-third after the introduction of the miRNA. Moreover, the reduction in melanin after miRNA transfection promoted the killing of fungus by hydrogen peroxide-induced oxidative stress and sensitized the fungus to neutrophil attack. Additionally, by loading miRNAs into a fungus-targeted delivery system, we demonstrated the potential of transferring miRNAs into intact fungal cells in vitro . These results indicate the potential of miRNAs to regulate target virulence factors in fungi, leading to the development of novel therapies. Biological sciences/Microbiology/Fungi Physical sciences/Nanoscience and technology/Nanomedicine/Drug delivery Aspergillus fumigatus Drug Delivery Systems MicroRNAs (miRNAs) RNA therapeutics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION Aspergillus spp. are widespread in the environment, with Aspergillus fumigatus being the primary pathogen that causes invasive aspergillosis. Invasive aspergillosis is estimated to occur annually in > 2.1 million patients with underlying diseases, with a mortality rate of > 80% [ 1 ]. However, the available antifungal drugs have moderate efficacy, and A. fumigatus is resistant to azoles [ 2 ]. The importance of this issue has recently been recognized after the World Health Organization listed A. fumigatus as the most important fungal pathogen that poses a public health threat in the fungal priority pathogen list [ 3 ]. Therefore, there is an urgent need to develop treatments based on mechanisms that differ from those of the existing drugs. MicroRNAs (miRNAs) are short RNAs of approximately 20–23 nucleotides that control gene expression in many cellular processes [ 4 , 5 ]. miRNAs are involved in RNA interference (RNAi), and various therapeutic developments that use them for cancer and infectious diseases are underway [ 6 , 7 ]. RNAi treatments are attractive therapeutic options for fungi [ 8 ]. For example, RNAi systems are present in the closely related species Aspergillus nudulans and Aspergillus flavas [ 9 – 11 ]. Furthermore, in A. fumigatus , double-stranded RNA reduced the expression of target genes, suggesting the potential use of RNAi systems in this fungus [ 12 , 13 ]. In the cross-talk between fungi and other species, fungal gene expression is regulated by the transfer of miRNAs through extracellular vesicles released by other organisms [ 14 – 17 ]. Although exosomes have been found to move between species of A. fumigatus , there have been no reports indicating that their miRNAs affected the regulation of gene expression [ 18 ]. Although RNAi mechanisms are powerful tools that are thought to be able to suppress fungal growth and have potential therapeutic applications, the delivery of RNA to the fungus is a challenge. A drug-delivery system (DDS) is a promising carrier for RNA transport. Liposomes and PEG-poly(amino acid)-based micelles are DDS platforms that have long been clinically investigated [ 19 ]. Additionally, these DDS materials have good biocompatibility, low immunogenicity, and can encapsulate medical compounds to enhance their in vivo performance [ 19 – 21 ]. We have successfully constructed micelles based on PEG-poly(amino acid) copolymers to create DDS devices comparable to the size of fungal exosomes. These devices have the property of high fungus-specific accumulation and accessibility to fungi owing to the flexibility of chemical modification of the surface structure and the binding of the dectin-1 molecule [ 22 ]. Additionally, the devices can be loaded with nucleic-acid molecules used for RNAi. Taking advantage of these properties, DDS devices can be loaded with nucleic acids, enabling the transport of nucleic acid molecules to fungi, which is expected to regulate fungal gene expression. Herein, we introduced miRNA mimics targeting alb1 , which is involved in melanin synthesis, a virulence factor of A. fumigatus , and has been employed as a target for RNAi in previous reports and confirmed that it suppresses target expression [ 23 – 26 ]. Furthermore, we confirmed the reduction of resistance to hydrogen peroxide H 2 O 2 stress and the improvement of elimination ability by neutrophils due to the decreased expression of the target gene by miRNA introduction. Finally, we attempted to introduce miRNA mimics into the intact fungi with cell walls using our created DDS devices and observed phenotypic changes in which miRNAs were introduced, and alb1 expression was suppressed. RESULTS Human miRNA candidate against alb1 of A. fumigatus Candidate human miRNAs used were selected using miRbase [27], based on the alb1 exon-only sequence information of strain Af293, a genome strain of A. fumigatus in the FungiDB (https://fungidb.org/fungidb/app). The selected candidate miRNAs are shown in Table 3. Two candidate miRNAs, hsa-miR-3667-5p and hsa-miR-4738-3p, were predicted to have the highest complementarity with the alb1 exon-only sequence (Fig. 1). Confocal microscopic image of miRNA uptake in A. fumigatus Next, fluorescence-labeled miRNA mimics of hsa-miR-3667-5p were prepared to confirm whether the candidate miRNAs had been transfected, and their introduction into the protoplasts was observed. We confirmed that miRNAs were introduced into the protoplasts, and miRNA fluorescence was observed in protoplasts or mycelia 3 h or 24 h after miRNA introduction (Fig. 2). miRNA mimics regulated targeted gene expression and transcription The target gene expression in the mycelium was evaluated using reverse transcription-PCR 3 h and 12 h after the introduction of the two miRNAs and negative-control miRNA. At 3 h after transfection, alb1 expression was unchanged compared with that in the untransfected strain. At 12 h after miRNA transfection, the expression of target alb1 decreased 3.7-fold at 10 nM and 2.1-fold at 40 nM of hsa-miR-3667-5p and decreased 1.1-fold at 10 nM and 1.9-fold at 40 nM of hsa-miR-4738-3p but was not affected by the negative-control miRNA (Fig. 3A). Additionally, we evaluated whether miRNA transfection can lead to the translational regulation of the target gene. To quantify the protein translated from the target gene, we generated an Alb1_HA strain in which a 3×HA-tag was fused to the target protein (Supplementary Methods). The strains were compared to each condition using western blotting with an anti-HA antibody. Transfection of hsa-miR-3667-5p into the Alb1-HA strain resulted in a 0.3-fold decrease in Alb1-HAp, confirming translational regulation (Fig. 3B). miRNA mimic-regulated conidia promoted decreased resistance to hydrogen peroxide and elimination by neutrophils To confirm the quality of the formed conidia, we evaluated their antioxidant capacity in response to 1.1 mM hydrogen peroxide (H 2 O 2 ) and their fungus-killing ability via neutrophils isolated from mice. Conidia harvested from the miRNA-untransfected AfS35 strain and the negative-control miRNA-transfected AfS35 strain showed no effect on CFUs, with or without exposure to 1.1 mM H 2 O 2 . In conidia harvested from AfS35 cells transfected with the respective miRNAs, a 20–25% reduction in CFUs was observed upon exposure to H 2 O 2 (Fig. 4A). The CFUs of harvested conidia from the AfS35 strain without miRNA decreased by 38% when co-cultured with neutrophils. When the AfS35 strain was transfected with hsa-miR-3667-5p and hsa-miR-4738-3p, and the harvested conidia were co-cultured with neutrophils for 3 h, the CFUs decreased by 58% and 59%, respectively (Fig. 4B). This suggests that partial and complete regulation (knockout) of alb1 reduces the intrinsic antioxidant capacity and enhances antifungal killing by mouse neutrophils. In other words, miRNA transfection regulates the quality of conidiation by decreasing the expression and translation of target factors. miRNA introduction into intact fungi using a Dectin1-installed micelle-loaded miRNA However, to apply RNAi technology for the treatment of fungal diseases, it is necessary to introduce miRNAs into intact fungi, where the cell wall is present. We have developed polyethylene glycol (PEG)-poly(amino acid)-based micelles, including PEG-poly(L-lysine), as effective DDS nanocarriers. Additionally, we recently developed Dectin-1-installed-polymeric micelles based on PEG-amino acid block copolymers; this carrier has the property of specifically binding to the surface of the mycelium [22]. Therefore, we aimed to introduce miRNAs into intact fungi using Dectin-1-installed micelle-loaded miRNAs of comparable size to extracellular vesicles. Using this device, miRNAs were detected in the cytoplasm of A. fumigatus with cell walls (Fig. 5A). We found that the introduction of miRNAs by this device reduced CFUs of harvested conidia by approximately 50% after exposure to 1.1 mM H 2 O 2 compared with the untransfected strain and Dectin-1-installed micelle-unloaded miRNA (Fig. 5B). DISCUSSION Currently, antifungal drugs utilized in the treatment of aspergillosis comprise three classes of compounds: two that target ergosterol (azoles and polyenes) and another (echinocandins) that inhibits the synthesis of β-1,3 glucan, an important component of the cell wall. Furthermore, in recent years, azole-resistant Aspergillus spp. have emerged from the environment and patients [ 2 ]. Hence, there is a concern about being further limited to a few antifungal drugs. To resolve this problem, we attempted to control the expression of virulence factors by using RNAi as a new candidate for therapeutic agents. By introducing two miRNA mimics, we were able to reduce the expression level of the target and obtained results that support the existence of an RNAi system in this fungus, which has been confirmed previously. However, although the mechanism of RNAi has been confirmed and RNAi-based expression control has been shown to be a powerful tool for Aspergillus spp. infection, the challenge has been to enable RNA delivery [ 8 ]. Herein, we showed that polymeric micelles enable the introduction of miRNA into the intact cell wall of A. fumigatus . Because alb1 was reported as a target for gene suppression by the RNAi system in A. fumigatus , we also selected candidate miRNA mimics targeting alb1 and introduced them into protoplasts [ 25 , 26 ]. The two miRNA mimics showed reduced expression of target genes and target proteins, but no effects were noted on target transcription and translation when negative-control miRNA (Fig. 3 A, B). The miRNA-transfected strains did not change to white colonies, a phenotype similar to that of Δalb1 gene deletion (Supplementary Fig. 1), but instead showed a phenotype involving reduced resistance to hydrogen peroxide, increased susceptibility to neutrophil exclusion and decreased melanin function, which are properties associated with resistance to oxidative stress (Fig. 4 ). The therapeutic application of RNAi systems against Aspergillus spp. has been avoided because of the difficulties in transporting bared nucleic acids into the cytoplasm of Aspergillus [ 8 ]. However, despite the presence of cell walls, tracking of miRNAs through exosome-like vesicles has been observed in some plants and some fungi [ 15 , 16 , 28 ]. There have also been reports suggesting that exosomes released by fungi are transferred between A. fumigatus [ 18 ]. We prepared micelles comparable to the size of exosomes released by fungi [ 29 ] and loaded labeled miRNA mimics into the micelles [ 22 , 30 , 31 ], and we investigated whether it is possible to introduce miRNA into Aspergillus with intact cell walls by loading miRNA mimics into micelles. Green fluorescence in the cytoplasm was not observed in the fungi un-transfected or transfected only with the miRNA unloaded DDS device; fluorescence in the cytoplasm was observed only in the fungi treated with labeled miRNA mimics in the DDS device (Fig. 5 ). In other words, the possibility that this was a stress response (autofluorescence) due to the treatment herein was ruled out; indeed, the fluorescence of the RNA fluorescently labeled using vesicles was confirmed in the compartment inside the cell wall, suggesting that the nucleic acid molecules passed through the cell wall. One limitation of this study is that off-target effects must be considered for RNAi-based methods. We observed phenotypes associated with reduced gene expression and translation upon introducing the miRNA against alb1 . However, there was a concern about the off-target effect of miRNA introduction. Therefore, we attempted the method reported by Halder et al. [ 16 ], which has been reported to demonstrate direct binding of the introduced miRNA to the target mRNA; however, we were unable to replicate this result (data not shown). For effective treatment using RNAi, it is necessary to study the turnover of miRNAs and the appropriate dosage and frequency of administration in vivo. The pharmacokinetics of the micelle itself used herein are well understood and its safety is assured, making it an excellent carrier option; however, understanding the development of toxicity to the host due to the introduction of miRNAs is necessary [ 19 – 21 ]. Addressing these issues is expected to bring us closer to therapeutic applications; however, clarification of the mechanisms, such as how nucleic acids are taken up into the fungi by using vesicles, is likely to be the focus of basic biology in the future. In conclusion, we attempted to regulate the expression of fungal virulence factors using microRNAs (miRNAs). We confirmed that miRNAs can be introduced into intact fungi using DDS-based carriers. This research provides a new therapeutic concept by controlling the expression of pathogenic factors in fungi using miRNAs. METHODS Ethics All animal experiments were approved by the Animal Experiment Committee of Tokyo Medical University and were conducted in accordance with animal experiment regulations. Strains and culture conditions Strains and primers used in this study are listed in Table 1 and Table 2, respectively. The construction of the deletion and complementation strains as well as conditions of the media used in this study are described in the Supplementary Material. Plasmid preparation and construction The preparation and construction of plasmids are described in the Supplementary Material. Conidia preparation Conidia from each strain were stored in a deep freezer at −80°C in phosphate-buffered saline (PBS) containing 20% glycerol. Fresh conidia were harvested after 4 days of culturing in conidial suspensions at 37°C in PDA medium with PBS containing 0.1% Tween 80. The conidia were passed through a 40-µm EASYstrainer (Greiner Bio-One Co. Ltd., Tokyo, Japan) to remove hyphae. Conidia concentrations in the prepared suspensions were measured using a hemocytometer. miRNA mimics and fluorescence labeling The selection of miRNAs was performed using miRbase (miRbase.org) [27], based on the alb1 sequence information of strain Af293, the A. fumigatus genome standard strain in the FungiDB (https://fungidb.org/fungidb/app). Two human miRNAs with low e-values were selected based on their high index of complementation and binding. The mirVana TM miRNA mimic of hsa-miR-3667-5p 5′-UGAAACUGGAGCGCCUGGAGGA-3′, hsa-miR-4738-3p 5′-AAAGACCCAUUGGAGGAGAAGGU-3′ and Negative Control #1 were purchased from Thermo Fisher Scientific. We added 50 μL of Tracker Reconstitution Solution, supplied with the kit, to Label IT Tracker Reagent (Takara Bio Inc., Shiga, Japan), and the suspension was vortexed to dissolve completely. Then, miRNA was added to Label IT Reagent and incubated at 37°C for 1 h. After ethanol precipitation treatment, the fluorescence-labeled nucleic acids were collected. Transfection of miRNA mimics and microscopy The miRNA mimics were co-incubated with the protoplasts in PEG 4000. The Dectin-1 device-loaded miRNA was co-incubated with mycelium in RPMI 1640 medium (Invitrogen Japan, Tokyo, Japan) for 6–12 h. The protoplasts or mycelia were grown in µ-Dish 35 mm (ibidi GmbH, Gräfelfing, Germany). The cell wall was stained with ×500 Calcofluor White stain (Sigma-Aldrich Japan, Tokyo, Japan) for 30 min at 15–25°C. Subsequently, the cells were washed thrice using PBS. The samples were embedded in SlowFade™ Diamond Antifade Mountant (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) with added 4′,6-diamidino-2-phenylindole to counterstain the nuclei. Observations were captured using a confocal laser microscope LSM700 (Carl Zeiss, Oberkochen, Germany). RNA extraction from A. fumigatus Mycelia were grown in RPMI 1640 medium at 37°C under 5% CO 2 conditions. After incubation, mycelia were homogenized using zirconia beads. Total RNA was extracted from the homogenized solution using TRIzol™ Reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol. The extracted RNA was purified using the RNeasy Mini Kit (QIAGEN) and treated with DNase using an RNase-free DNase Set (QIAGEN). Reverse transcription-PCR analysis of mRNA expression cDNA was synthesized by reverse transcription reaction of 500 ng of total RNA using the SuperScript VILO cDNA Synthesis Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. The synthesized cDNA was used as a template, and a combination of primers RT-alb1FW and RT-alb1REV [26] (Table 2) was used with TB Green ® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara Bio Inc., Shiga, Japan) for reverse transcription-PCR of the target gene using Mx3000P qPCR System (Agilent Technologies Japan, Ltd., Tokyo, Japan). Relative quantification of the gene of interest was performed using beta-actin as an endogenous control and the ΔΔCT algorithm. Protein extraction and western blot analysis After miRNA transfection, the Alb1_HA strain was cultured overnight at 37°C under shaking conditions using a YG liquid medium, and the mycelia were collected. The mycelium was lyophilized, and Sample Buffer Solution with Reducing Reagent (6×) for sodium dodecyl-sulphate polyacrylamide gel electrophoresis (SDS-PAGE) (NACALAI TESQUE, Inc., Kyoto, Japan) was used. The sample buffer was heated at 100°C for 5 min, and SDS-PAGE was performed using SuperSep™Ace, 10–20% (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). After transfer to Immun-Blot PVDF Membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA), the membrane was blocked with PVDF Blocking Reagent for Can Get Signal (TOYOBO Co., Ltd., Osaka, Japan). Then, the membrane was washed with TBS-T (0.01% Tween 20) and incubated with an anti-HA-tag antibody (sc-7392; Santa Cruz Biotechnology, TX, USA) at a final concentration of 1 µg/mL in Can Get Signal solution 1 (TOYOBO Co., Ltd., Osaka, Japan) at 4°C overnight. After washing thrice with TBS-T, the secondary antibody (anti-mouse IgG, HRP-linked antibody #7076; Cell Signalling Technology, Danvers, MA , USA) was diluted 15,000-fold using Can Get Signal solution 2 (TOYOBO Co., Ltd., Osaka, Japan) and reacted for 1 h at room temperature. Subsequently, the membrane was washed thrice with TBS-T and reacted with ImmunoStar LD (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). The chemiluminescence signals were detected using C-DiGit western blot imaging (LI-COR Corporate, Lincoln, NE, USA). A relative comparison of signals was performed using Image Studio for the C-DiGit software. Hydrogen peroxide oxidative susceptibility assay Approximately 1.0 × 10 4 conidia were suspended in 10 mL of 1.1 mM hydrogen peroxide (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) and rotated at room temperature for 24 h. Subsequently, 10 µL of the diluted solution was inoculated in triplicate onto PDA plates and incubated at 37°C for 24 h. The colonies were visually measured. Neutrophil killing assay Neutrophils were collected using the Neutrophil Isolation Kit (Funakoshi Co., Ltd., Tokyo, Japan). We injected 1 mL of 7.5% Sodium Caseinate Solution Assay Reagent into the abdominal cavity of C57/B6 J mice. After 24 h, 5 mL of PBS was injected into the peritoneal cavity of the mice, and the peritoneal fluid was collected. The collected peritoneal fluid was treated with Neutrophil Isolation Medium and Red Blood Cell Lysis Buffer using Percoll Gradient Assay Reagent to isolate neutrophils. Subsequently, 1.0 × 10 5 aliquots were prepared using RPMI liquid medium and co-cultured for 3 h with an equal number of neutrophils. After co-cultivation, colonies were inoculated onto PDA plates and incubated at 37°C for 24 h; colonies were visually measured. The sterilization rate was expressed as the percentage decrease in CFU in the presence of neutrophils, with CFU in the absence of neutrophils as the control. The mice used were C57BL/6J, male, 5 weeks old, purchased from CLEA Japan, Inc. All mice used for the treatment and other experiments were acclimated for at least 1 week. Dectin-1-installed micelle-loaded miRNA preparation Dectin-1 Recombinant Human Dectin-1/CLEC7A Protein (hFc Tag) (Sino Biological Japan Inc., Kanagawa, Japan) was conjugated to a DBCO-PEG4-NHS linker for attachment to N 3 -PEG-poly(L-lysine) (pLL). Dectin-1 (100 μg) was dissolved in 50 mM NaHCO 3 buffer (pH 8.6), which was exchanged twice in a 10k vivaspin tube. Ultrafiltration was conducted at 830× g for 4 min. The DBCO-PEG4-NHS linker (10 mg/mL, 5 μg) was added to the solution and incubated at 4°C for 12 h. Then, the solution was purified with HEPES buffer in a 10k vivaspin tube. Ultrafiltration was conducted at 3000 rpm for 4 min for purification. To prepare miRNA-loaded nanocarriers, N 3 -PEG(12k)-pLL was dissolved in pH 8.5 HEPES buffer at 2 mg/mL concentration. Then, 140 μL of the solution was added to the miRNA solution (10 μg of miRNA was dissolved in 200 μL of nuclease-free water) and incubated for an hour at 25°C. After incubation, a total of 300 μL of MeO-PEG-pLL(CAA) solution (2 mg/mL) was added; 15 μL was added every 5 min. After 12 h of incubation, the micelle solution was filtered through a 0.22-μm PVDF syringe filter. Statistical analysis Statistical analyses of biological replicates of reverse transcription-PCR data and percent killing data were performed using one-way analysis of variance (ANOVA), followed by Sidak/Dunnett’s multiple comparison tests. Analysis of hydrogen peroxide oxidative susceptibility assay data was performed using a two-way ANOVA, followed by Sidak’s multiple comparison tests. All analyses were performed using the GraphPad Prism 7 software (GraphPad Software Inc., San Diego, CA, USA). Declarations Data Availability All data generated or analysed during this study are included in this published article and its supplementary information files. Acknowledgments: We would like to thank the Center for Diversity at Tokyo Medical University for supporting this study (TMUCD-202401). Funding: This work was supported by JSPS KAKENHI Grant Numbers 24K19271 (TI). Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Transparency declarations: All authors: None to declare. Author contributions: TI, RW, YM, HC: Performed research and analyzed data. TI, YM, HC, MK, SN: Conceptualization. TI, HC, SN: Writing-original draft. Data availability statement: Data will be made available on request. References Denning, D. W. Global incidence and mortality of severe fungal disease. Lancet Infect. Dis. 24, e428–e438 (2024) (DOI 10.1016/S1473-3099(23)00692-8) (PubMed: 38224705) Burks, C., Darby, A., Gómez Londoño, L., Momany, M. & Brewer, M. T. Azole-resistant Aspergillus fumigatus in the environment: identifying key reservoirs and hotspots of antifungal resistance. PLOS Pathog. 17, e1009711 (2021) (DOI 10.1371/journal.ppat.1009711) (PubMed: 34324607) WHO fungal priority pathogens list to guide research, development, and public health action, 2022, Available from: https://www.who.int/publications/i/item/9789240060241 Bartel, B. MicroRNAs directing siRNA biogenesis. Nat. Struct. Mol. Biol. 12, 569–571 (2005) (DOI 10.1038/nsmb0705-569) (PubMed: 15999111) Bartel, D. P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297 (2004) (DOI 10.1016/s0092-8674(04)00045-5) (PubMed: 14744438) Borna, H., Imani, S., Iman, M. & Azimzadeh Jamalkandi, S. Therapeutic face of RNAi: in vivo challenges. Expert Opin. Biol. Ther. 15, 269–285 (2015) (DOI 10.1517/14712598.2015.983070) (PubMed: 25399911) Sayyed, A. A. et al . Role of miRNAs in cancer diagnostics and therapy: A recent update. Curr. Pharm. Des. 28, 471–487 (2022) (DOI 10.2174/1381612827666211109113305) (PubMed: 34751112) Bruch, A., Kelani, A. A. & Blango, M. G. RNA-based therapeutics to treat human fungal infections. Trends Microbiol. 30, 411–420 (2022) (DOI 10.1016/j.tim.2021.09.007) (PubMed: 34635448) Khatri, M. & Rajam, M. V. Targeting polyamines of Aspergillus nidulans by siRNA specific to fungal ornithine decarboxylase gene. Med. Mycol. 45, 211–220 (2007) (DOI 10.1080/13693780601158779) (PubMed: 17464842) Nami, S. et al . The utilization of RNA silencing technology to mitigate the voriconazole resistance of Aspergillus flavus; Lipofectamine-based delivery. Adv. Pharm. Bull. 7, 53–59 (2017) (DOI 10.15171/apb.2017.007) (PubMed: 28507937) Raruang, Y. et al . Targeting the Aspergillus flavus p2c gene through host-induced gene silencing reduces A. flavus infection and aflatoxin contamination in transgenic maize. Front. Plant Sci. 14, 1150086 (2023) (DOI 10.3389/fpls.2023.1150086) (PubMed: 37229129) Mouyna, I., Henry, C., Doering, T. L. & Latgé, J. P. Gene silencing with RNA interference in the human pathogenic fungus Aspergillus fumigatus. FEMS Microbiol. Lett. 237, 317–324 (2004) (DOI 10.1016/j.femsle.2004.06.048) (PubMed: 15321679) Jöchl, C., Loh, E., Ploner, A., Haas, H. & Hüttenhofer, A. Development-dependent scavenging of nucleic acids in the filamentous fungus Aspergillus fumigatus. RNA Biol. 6, 179–186 (2009) (DOI 10.4161/rna.6.2.7717) (PubMed: 19246986) Croston, T. L., Lemons, A. R., Beezhold, D. H. & Green, B. J. MicroRNA regulation of host immune responses following fungal exposure. Front. Immunol. 9, 170 (2018) (DOI 10.3389/fimmu.2018.00170) (PubMed: 29467760) Das Gupta, M. et al . Aspergillus fumigatus induces microRNA-132 in human monocytes and dendritic cells. Int. J. Med. Microbiol. 304, 592–596 (2014) (DOI 10.1016/j.ijmm.2014.04.005) (PubMed: 24841251) Halder, L. D. et al . Candida albicans induces cross-kingdom miRNA trafficking in human monocytes to promote fungal growth. mBio 13, e0356321 (2021) (DOI 10.1128/mbio.03563-21) (PubMed: 35132877) Wang, Y., Cui, C., Wang, G., Li, Y. & Wang, S. Insects defend against fungal infection by employing microRNAs to silence virulence-related genes. Proc. Natl Acad. Sci. U. S. A. 118, e2023802118 (2021) (DOI 10.1073/pnas.2023802118) (PubMed: 33941699) Bitencourt, T. A. et al . Fungal extracellular vesicles are involved in intraspecies intracellular communication. mBio 13, e0327221 (2022) (DOI 10.1128/mbio.03272-21) (PubMed: 35012355) Cabral, H. & Kataoka, K. Progress of drug-loaded polymeric micelles into clinical studies. J. Control. Release 190, 465–476 (2014) (DOI 10.1016/j.jconrel.2014.06.042) (PubMed: 24993430) Petrini, M. et al . Effects of surface charge, PEGylation and functionalization with Dipalmitoylphosphatidyldiglycerol on liposome-cell interactions and local drug delivery to solid tumors via thermosensitive liposomes. Int. J. Nanomedicine 16, 4045–4061 (2021) (DOI 10.2147/IJN.S305106) (PubMed: 34163158) Kataoka, K. et al . Doxorubicin-loaded poly(ethylene glycol)-poly(beta-benzyl-L-aspartate) copolymer micelles: their pharmaceutical characteristics and biological significance. J. Control. Release 64, 143–153 (2000) (DOI 10.1016/s0168-3659(99)00133-9) (PubMed: 10640653) Inukai, T., Chen, P., Kokuba, H., Cabral, H. & Nakamura, S. A novel fungal-targeted drug delivery system dectin-1-targeted-PEG-amino acid polymer block enhances antifungal activity and reduces cytotoxicity of amphotericin B. J. Drug Deliv. Sci. Technol. 100, Article 106073 (2024) (DOI 10.1016/j.jddst.2024.106073) Tsai, H. F., Chang, Y. C., Washburn, R. G., Wheeler, M. H. & Kwon-Chung, K. J. The developmentally regulated alb1 gene of Aspergillus fumigatus : its role in modulation of conidial morphology and virulence. J. Bacteriol. 180, 3031–3038 (1998) (DOI 10.1128/JB.180.12.3031-3038.1998) (PubMed: 9620950) Jahn, B. et al . Isolation and characterization of a pigmentless-conidium mutant of Aspergillus fumigatus with altered conidial surface and reduced virulence. Infect. Immun. 65, 5110–5117 (1997) (DOI 10.1128/iai.65.12.5110-5117.1997) (PubMed: 9393803) Enayati, S., Azizi, M., Aminollahi, E., Ranjvar Shahrivar, M. & Khalaj, V. T7-RNA polymerase dependent RNAi system in Aspergillus fumigatus : a proof of concept study. FEMS Microbiol. Lett. 363, fnw029 (2016) (DOI 10.1093/femsle/fnw029) (PubMed: 26850443) Khalaj, V., Eslami, H., Azizi, M., Rovira-Graells, N. & Bromley, M. Efficient downregulation of alb1 gene using an AMA1-based episomal expression of RNAi construct in Aspergillus fumigatus . FEMS Microbiol. Lett. 270, 250–254 (2007) (DOI 10.1111/j.1574-6968.2007.00680.x) (PubMed: 17343676) Kozomara, A., Birgaoanu, M. & Griffiths-Jones, S. miRBase: from microRNA sequences to function. Nucleic Acids Res. 47, D155–D162 (2019) (DOI 10.1093/nar/gky1141) (PubMed: 30423142) Samuel, M., Bleackley, M., Anderson, M. & Mathivanan, S. Extracellular vesicles including exosomes in cross kingdom regulation: a viewpoint from plant-fungal interactions. Front. Plant Sci. 6, Article 766 (2015) (DOI 10.3389/fpls.2015.00766) (PubMed: 26442078) Rizzo, J., Taheraly, A. & Janbon, G. Structure, composition and biological properties of fungal extracellular vesicles. Microlife 2, uqab009 (2021) (DOI 10.1093/femsml/uqab009) (PubMed: 37223252) Bae, Y. & Kataoka, K. Intelligent polymeric micelles from functional poly(ethylene glycol)-poly(amino acid) block copolymers. Adv. Drug Deliv. Rev. 61, 768–784 (2009) (DOI 10.1016/j.addr.2009.04.016) (PubMed: 19422866) Yang, W., Chen, P., Boonstra, E., Hong, T. & Cabral, H. Polymeric micelles with pH-responsive cross-linked core enhance in vivo mRNA delivery. Pharmaceutics 14, 1205 (2022) (DOI 10.3390/pharmaceutics14061205) (PubMed: 35745778) Szewczyk, E. et al. Fusion PCR and gene targeting in Aspergillus nidulans . Nat. Protoc. 1, 3111–3120 (2006) (DOI 10.1038/nprot.2006.405) (PubMed: 17406574) Tables Table 1. Strains used in this study Strain Parent Genotype Reference or source AfS35 D141 akuAΔ ::loxP From FGSC Δalb1 AfS35 alb1Δ :: hph This study Alb1_HA Δalb1 alb1Δ :: alb1 -3×HA, ptrA This study Table 2. Sequences of primers used in this study Primer Sequence (5′-3′) Description source LFH1 TGTAGCGCCCTCAATGCAACATGC This study LFH2 GGCGAGTGGTTTGCGCGGCGTGA This study LFH3 TGGGGTGAGTTCCTAGGTTTGGGG This study LFH4 GGCATGACTAGGCTCATCTCCACC This study LFH5 GGAACTCATGGCCGTGGCCATG This study LFH6 TGGGGTGAGTTCCTAGGTTTGGGG This study Discheck5 AATCAAAGCATGTCGATCCTGTGG This study Discheck3 TGGCATTCTTAACTGTATCTGTAC This study ptrAlast150seq TCCACATGCATATGTAAATG This study Alb1-hph-F GAGGCCACTCAGGCCGATATCACC This study Alb1-hph-R CTGGCCTAGATGGCCGTCGACAAC This study RT-alb1-FW CAACTCGATTGGGCTCTTTG [26] RT-alb1-REV TAGCCCATTTGCTGTCGTTG [26] RT-tubrin-FW CTTGGATGACGGGTGATTG [26] RT-tubrin-REV TGGGAGGATATAGGTCGAAC [26] Table 3. miRNA candidates miRNA score e-value hsa-miR-4738-3p 76 3.3 hsa-miR-4757-5p 73 5.8 hsa-miR-5708 73 5.8 hsa-miR-6869-5p 74 4.8 hsa-miR-1247-5p 72 7 hsa-miR-4660 73 5.8 hsa-miR-4500 71 8.5 hsa-miR-3667-5p 77 2.7 hsa-miR-1322 72 7 Additional Declarations No competing interests reported. Supplementary Files revisedsupplementaryinformation.pdf Cite Share Download PDF Status: Published Journal Publication published 19 May, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 30 Apr, 2025 Reviews received at journal 21 Apr, 2025 Reviews received at journal 11 Apr, 2025 Reviewers agreed at journal 08 Apr, 2025 Reviewers agreed at journal 02 Apr, 2025 Reviewers invited by journal 02 Apr, 2025 Editor assigned by journal 02 Apr, 2025 Editor invited by journal 02 Apr, 2025 Submission checks completed at journal 27 Mar, 2025 First submitted to journal 27 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6274481","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":446378112,"identity":"be029542-ed43-4d5f-88e2-b8aaa9247387","order_by":0,"name":"Tatsuya Inukai","email":"","orcid":"","institution":"Tokyo Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tatsuya","middleName":"","lastName":"Inukai","suffix":""},{"id":446378113,"identity":"ef5e8085-be95-4a51-b918-20d2b79da979","order_by":1,"name":"Rikuto Watanabe","email":"","orcid":"","institution":"Tokyo Medical University","correspondingAuthor":false,"prefix":"","firstName":"Rikuto","middleName":"","lastName":"Watanabe","suffix":""},{"id":446378114,"identity":"eb096701-4c91-46af-9ddf-6b4eee9ce7c3","order_by":2,"name":"Yoshiki Murakami","email":"","orcid":"","institution":"Tokyo Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yoshiki","middleName":"","lastName":"Murakami","suffix":""},{"id":446378116,"identity":"52344b4b-3cc0-44bb-962d-f33ece52800a","order_by":3,"name":"Horacio Cabral","email":"","orcid":"","institution":"The University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Horacio","middleName":"","lastName":"Cabral","suffix":""},{"id":446378118,"identity":"4f5f1d82-d3f4-4543-baf5-dd11c1ec32ac","order_by":4,"name":"Masahiko Kuroda","email":"","orcid":"","institution":"Tokyo Medical University","correspondingAuthor":false,"prefix":"","firstName":"Masahiko","middleName":"","lastName":"Kuroda","suffix":""},{"id":446378119,"identity":"9c18b535-d466-4989-b2b3-dd5433404600","order_by":5,"name":"Shigeki Nakamura","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEUlEQVRIiWNgGAWjYDACCcYGEGXAz8DADBVKABFshLVIthGvBUIZGBxD1YIbyM9ubn7xcYedsfH95sPGPBUM0fzsCYwffjDw5eHSYnDnYJvlzDPJZmbH2JKTec4w5M7secAs2cPAVoxTi0RimzFvG7ON2TEe48O8bf9zN9xIYJAG+iWxAZfDZgC1/G2rtzFuA2thyN1/I4H5Nz4tDDcSmx8zth02M2DjMU4GadkgkcCG1xaDG4ltjL1tx40ljqUlG84B+mXGmYdtlj0GuP0iPyP98YefbdWG/c2HD0u8qWDI7W9PPnzjR8UxnCEGBGwSMBYTD5gCRa7BsQQ8Wpg/wFiMPxCiNfi0jIJRMApGwcgCABxsVmOOqLwTAAAAAElFTkSuQmCC","orcid":"","institution":"Tokyo Medical University","correspondingAuthor":true,"prefix":"","firstName":"Shigeki","middleName":"","lastName":"Nakamura","suffix":""}],"badges":[],"createdAt":"2025-03-21 06:08:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6274481/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6274481/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-02742-0","type":"published","date":"2025-05-19T15:57:36+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81206135,"identity":"3c85066c-e82d-4938-8220-972514c214db","added_by":"auto","created_at":"2025-04-23 12:13:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":215090,"visible":true,"origin":"","legend":"\u003cp\u003eHuman miRNA candidate against \u003cem\u003ealb1\u003c/em\u003e of \u003cem\u003eAspergillus fumigatus\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe schematic diagram shows the exon-only sequence (6441 nucleotides) of \u003cem\u003ealb1\u003c/em\u003eof \u003cem\u003eA. fumigatus\u003c/em\u003e, with each sequence complemented by the two candidate miRNAs highlighted, indicating complementation between each miRNA and the target gene.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/56426404168cf2e52e58c647.png"},{"id":81206139,"identity":"07e12ceb-69d1-464b-9550-5a833ce6a55a","added_by":"auto","created_at":"2025-04-23 12:13:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":141932,"visible":true,"origin":"","legend":"\u003cp\u003eConfocal microscopic image of miRNA uptake in \u003cem\u003eAspergillus fumigatus\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e(A) Three hours after introducing fluorescence-labeled miRNAs into the protoplasts, the cells were fixed and photographed using a confocal laser microscope. Bar: 20 µm. (B) Mycelia were photographed 24 h after the introduction of fluorescence-labelled miRNAs. miRNAs indicated fluorescence images of fluorescein, and nuclei indicated fluorescence images of 4′,6-diamidino-2-phenylindole. Bar: 10 µm.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/27900456c1599bf2730a670c.png"},{"id":81206392,"identity":"ceb1c7dc-6e22-4de7-a7ec-68642f43d32f","added_by":"auto","created_at":"2025-04-23 12:21:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":79855,"visible":true,"origin":"","legend":"\u003cp\u003emiRNA mimics regulated targeted gene expression and transcription\u003c/p\u003e\n\u003cp\u003e(A) Expression of \u003cem\u003ealb1\u003c/em\u003e was examined at 12 h after the introduction of negative-control miRNA, hsa-miR-3667-5p or hsa-miR-4738-3p. The graph represents mean ± SEM. Statistical analysis: one-way ANOVA, ns = not significant, asterisk * or *** = \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001, respectively. (B) At 24 h after the introduction of negative-control miRNA, hsa-miR-3667-5p and hsa-miR-4738-3p, Alb1-HAp was evaluated using western blotting with the anti-HA antibody; relative ratios are shown.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/18cc720f45db6ade4f7fe71f.png"},{"id":81206151,"identity":"58a04c1c-fb50-4351-b4dc-b0a5d03f853b","added_by":"auto","created_at":"2025-04-23 12:13:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":36204,"visible":true,"origin":"","legend":"\u003cp\u003emiRNA mimic-regulated conidia promoted decreased resistance to hydrogen peroxide and elimination by neutrophils.\u003c/p\u003e\n\u003cp\u003e(A) Conidia harvested from each strain were treated with or without 1.1 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 24 h, incubated on PDA, and CFUs were measured. The graph represents mean ± SEM. Statistical analysis: two-way ANOVA, ns = not significant, asterisk * or ** = \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 or \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, respectively. (B) CFUs were measured when each harvested conidia under each condition were co-incubated with or without neutrophils isolated from mice. The percentage decrease in CFU due to neutrophil co-culture is shown as the percent killing. The graph represents mean ± SEM. Statistical analysis: one-way ANOVA.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/2053bcd6af84889f3cffd167.png"},{"id":81206138,"identity":"a3ffd0d8-91ea-4c22-abe5-c2d279560056","added_by":"auto","created_at":"2025-04-23 12:13:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":131725,"visible":true,"origin":"","legend":"\u003cp\u003emiRNA introduction into intact fungi using a Dectin1-installed micelle-loaded miRNA.\u003c/p\u003e\n\u003cp\u003e(A) Mycelia were photographed 24 h after the introduction of fluorescence-labeled miRNA-loaded nanodevices. miRNA indicates fluorescence images of fluorescein, and the cell wall indicates fluorescence images of Calcofluor White stain. Bar: 10 µm. (B) Conidia harvested from each strain were treated with or without 1.1 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 24 h, incubated on PDA, and CFUs were measured. The graph represents mean ± SEM. Statistical analysis: two-way ANOVA, ns = not significant, asterisks * or ** = \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, or \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01, respectively.\u003c/p\u003e\n\u003cp\u003eAbbreviations: ANOVA, analysis of variance; SEM, standard error of the mean, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, hydrogen peroxide; PDA, potato dextrose agar\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/5a253e60449758c4406a19ca.png"},{"id":83460018,"identity":"d02a9a75-7f75-47b1-918b-c782410177d1","added_by":"auto","created_at":"2025-05-26 16:09:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1678540,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/793dd4dc-83d0-4a63-b824-676b5ed23ff4.pdf"},{"id":81206393,"identity":"0973ef42-6219-4d51-ad71-b07144798906","added_by":"auto","created_at":"2025-04-23 12:21:18","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":367126,"visible":true,"origin":"","legend":"","description":"","filename":"revisedsupplementaryinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6274481/v1/0e5b5cd8b59e3509034e9a5c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Harnessing MicroRNAs to Attenuate Aspergillus fumigatus Virulence: A New Paradigm in Antifungal Therapy","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003e \u003cem\u003eAspergillus\u003c/em\u003e spp. are widespread in the environment, with \u003cem\u003eAspergillus fumigatus\u003c/em\u003e being the primary pathogen that causes invasive aspergillosis. Invasive aspergillosis is estimated to occur annually in \u0026gt;\u0026thinsp;2.1\u0026nbsp;million patients with underlying diseases, with a mortality rate of \u0026gt;\u0026thinsp;80% [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. However, the available antifungal drugs have moderate efficacy, and \u003cem\u003eA. fumigatus\u003c/em\u003e is resistant to azoles [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The importance of this issue has recently been recognized after the World Health Organization listed \u003cem\u003eA. fumigatus\u003c/em\u003e as the most important fungal pathogen that poses a public health threat in the fungal priority pathogen list [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, there is an urgent need to develop treatments based on mechanisms that differ from those of the existing drugs.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are short RNAs of approximately 20\u0026ndash;23 nucleotides that control gene expression in many cellular processes [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. miRNAs are involved in RNA interference (RNAi), and various therapeutic developments that use them for cancer and infectious diseases are underway [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. RNAi treatments are attractive therapeutic options for fungi [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. For example, RNAi systems are present in the closely related species \u003cem\u003eAspergillus nudulans\u003c/em\u003e and \u003cem\u003eAspergillus flavas\u003c/em\u003e [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Furthermore, in \u003cem\u003eA. fumigatus\u003c/em\u003e, double-stranded RNA reduced the expression of target genes, suggesting the potential use of RNAi systems in this fungus [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In the cross-talk between fungi and other species, fungal gene expression is regulated by the transfer of miRNAs through extracellular vesicles released by other organisms [\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Although exosomes have been found to move between species of \u003cem\u003eA. fumigatus\u003c/em\u003e, there have been no reports indicating that their miRNAs affected the regulation of gene expression [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Although RNAi mechanisms are powerful tools that are thought to be able to suppress fungal growth and have potential therapeutic applications, the delivery of RNA to the fungus is a challenge.\u003c/p\u003e \u003cp\u003eA drug-delivery system (DDS) is a promising carrier for RNA transport. Liposomes and PEG-poly(amino acid)-based micelles are DDS platforms that have long been clinically investigated [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, these DDS materials have good biocompatibility, low immunogenicity, and can encapsulate medical compounds to enhance their in vivo performance [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. We have successfully constructed micelles based on PEG-poly(amino acid) copolymers to create DDS devices comparable to the size of fungal exosomes. These devices have the property of high fungus-specific accumulation and accessibility to fungi owing to the flexibility of chemical modification of the surface structure and the binding of the dectin-1 molecule [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Additionally, the devices can be loaded with nucleic-acid molecules used for RNAi. Taking advantage of these properties, DDS devices can be loaded with nucleic acids, enabling the transport of nucleic acid molecules to fungi, which is expected to regulate fungal gene expression.\u003c/p\u003e \u003cp\u003eHerein, we introduced miRNA mimics targeting \u003cem\u003ealb1\u003c/em\u003e, which is involved in melanin synthesis, a virulence factor of \u003cem\u003eA. fumigatus\u003c/em\u003e, and has been employed as a target for RNAi in previous reports and confirmed that it suppresses target expression [\u003cspan additionalcitationids=\"CR24 CR25\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Furthermore, we confirmed the reduction of resistance to hydrogen peroxide H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e stress and the improvement of elimination ability by neutrophils due to the decreased expression of the target gene by miRNA introduction. Finally, we attempted to introduce miRNA mimics into the intact fungi with cell walls using our created DDS devices and observed phenotypic changes in which miRNAs were introduced, and \u003cem\u003ealb1\u003c/em\u003e expression was suppressed.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eHuman miRNA candidate against \u003cem\u003ealb1\u003c/em\u003e of \u003cem\u003eA. fumigatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCandidate human miRNAs used were selected using miRbase [27], based on the \u003cem\u003ealb1\u003c/em\u003e exon-only sequence information of strain Af293, a genome strain of \u003cem\u003eA. fumigatus\u003c/em\u003e in the FungiDB (https://fungidb.org/fungidb/app). The selected candidate miRNAs are shown in Table 3. Two candidate miRNAs, hsa-miR-3667-5p and hsa-miR-4738-3p, were predicted to have the highest complementarity with the alb1 exon-only sequence (Fig. 1). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConfocal microscopic image of miRNA uptake in \u003cem\u003eA. fumigatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, fluorescence-labeled miRNA mimics of hsa-miR-3667-5p were prepared to confirm whether the candidate miRNAs had been transfected, and their introduction into the protoplasts was observed. We confirmed that miRNAs were introduced into the protoplasts, and miRNA fluorescence was observed in protoplasts or mycelia 3 h or 24 h after miRNA introduction (Fig. 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emiRNA mimics regulated targeted gene expression and transcription\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The target gene expression in the mycelium was evaluated using reverse transcription-PCR 3 h and 12 h after the introduction of the two miRNAs and negative-control miRNA. At 3 h after transfection, \u003cem\u003ealb1\u003c/em\u003e expression was unchanged compared with that in the untransfected strain. At 12 h after miRNA transfection, the expression of target \u003cem\u003ealb1\u003c/em\u003e decreased 3.7-fold at 10 nM and 2.1-fold at 40 nM of hsa-miR-3667-5p and decreased 1.1-fold at 10 nM and 1.9-fold at 40 nM of hsa-miR-4738-3p but was not affected by the negative-control miRNA (Fig. 3A). Additionally, we evaluated whether miRNA transfection can lead to the translational regulation of the target gene. To quantify the protein translated from the target gene, we generated an Alb1_HA strain in which a 3\u0026times;HA-tag was fused to the target protein (Supplementary Methods). The strains were compared to each condition using western blotting with an anti-HA antibody. Transfection of hsa-miR-3667-5p into the Alb1-HA strain resulted in a 0.3-fold decrease in Alb1-HAp, confirming translational regulation (Fig. 3B). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emiRNA mimic-regulated conidia promoted decreased resistance to hydrogen peroxide and elimination by neutrophils\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm the quality of the formed conidia, we evaluated their antioxidant capacity in response to 1.1 mM hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) and their fungus-killing ability via neutrophils isolated from mice. Conidia harvested from the miRNA-untransfected AfS35 strain and the negative-control miRNA-transfected AfS35 strain showed no effect on CFUs, with or without exposure to 1.1 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. In conidia harvested from AfS35 cells transfected with the respective miRNAs, a 20\u0026ndash;25% reduction in CFUs was observed upon exposure to H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u0026nbsp;\u003c/sub\u003e(Fig. 4A). The CFUs of harvested conidia from the AfS35 strain without miRNA decreased by 38% when co-cultured with neutrophils. When the AfS35 strain was transfected with hsa-miR-3667-5p and hsa-miR-4738-3p, and the harvested conidia were co-cultured with neutrophils for 3 h, the CFUs decreased by 58% and 59%, respectively (Fig. 4B). This suggests that partial and complete regulation (knockout) of \u003cem\u003ealb1\u003c/em\u003e reduces the intrinsic antioxidant capacity and enhances antifungal killing by mouse neutrophils. In other words, miRNA transfection regulates the quality of conidiation by decreasing the expression and translation of target factors.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emiRNA introduction into intact fungi using a Dectin1-installed micelle-loaded miRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHowever, to apply RNAi technology for the treatment of fungal diseases, it is necessary to introduce miRNAs into intact fungi, where the cell wall is present. We have developed polyethylene glycol (PEG)-poly(amino acid)-based micelles, including PEG-poly(L-lysine), as effective DDS nanocarriers. Additionally, we recently developed Dectin-1-installed-polymeric micelles based on PEG-amino acid block copolymers; this carrier has the property of specifically binding to the surface of the mycelium [22]. Therefore, we aimed to introduce miRNAs into intact fungi using Dectin-1-installed micelle-loaded miRNAs of comparable size to extracellular vesicles. Using this device, miRNAs were detected in the cytoplasm of \u003cem\u003eA. fumigatus\u003c/em\u003e with cell walls (Fig. 5A). We found that the introduction of miRNAs by this device reduced CFUs of harvested conidia by approximately 50% after exposure to 1.1 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e compared with the untransfected strain and Dectin-1-installed micelle-unloaded miRNA (Fig. 5B).\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eCurrently, antifungal drugs utilized in the treatment of aspergillosis comprise three classes of compounds: two that target ergosterol (azoles and polyenes) and another (echinocandins) that inhibits the synthesis of β-1,3 glucan, an important component of the cell wall. Furthermore, in recent years, azole-resistant \u003cem\u003eAspergillus\u003c/em\u003e spp. have emerged from the environment and patients [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Hence, there is a concern about being further limited to a few antifungal drugs. To resolve this problem, we attempted to control the expression of virulence factors by using RNAi as a new candidate for therapeutic agents. By introducing two miRNA mimics, we were able to reduce the expression level of the target and obtained results that support the existence of an RNAi system in this fungus, which has been confirmed previously. However, although the mechanism of RNAi has been confirmed and RNAi-based expression control has been shown to be a powerful tool for \u003cem\u003eAspergillus\u003c/em\u003e spp. infection, the challenge has been to enable RNA delivery [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Herein, we showed that polymeric micelles enable the introduction of miRNA into the intact cell wall of \u003cem\u003eA. fumigatus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eBecause \u003cem\u003ealb1\u003c/em\u003e was reported as a target for gene suppression by the RNAi system in \u003cem\u003eA. fumigatus\u003c/em\u003e, we also selected candidate miRNA mimics targeting \u003cem\u003ealb1\u003c/em\u003e and introduced them into protoplasts [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The two miRNA mimics showed reduced expression of target genes and target proteins, but no effects were noted on target transcription and translation when negative-control miRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). The miRNA-transfected strains did not change to white colonies, a phenotype similar to that of Δalb1 gene deletion (Supplementary Fig.\u0026nbsp;1), but instead showed a phenotype involving reduced resistance to hydrogen peroxide, increased susceptibility to neutrophil exclusion and decreased melanin function, which are properties associated with resistance to oxidative stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe therapeutic application of RNAi systems against \u003cem\u003eAspergillus\u003c/em\u003e spp. has been avoided because of the difficulties in transporting bared nucleic acids into the cytoplasm of \u003cem\u003eAspergillus\u003c/em\u003e [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, despite the presence of cell walls, tracking of miRNAs through exosome-like vesicles has been observed in some plants and some fungi [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. There have also been reports suggesting that exosomes released by fungi are transferred between \u003cem\u003eA. fumigatus\u003c/em\u003e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. We prepared micelles comparable to the size of exosomes released by fungi [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and loaded labeled miRNA mimics into the micelles [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and we investigated whether it is possible to introduce miRNA into \u003cem\u003eAspergillus\u003c/em\u003e with intact cell walls by loading miRNA mimics into micelles. Green fluorescence in the cytoplasm was not observed in the fungi un-transfected or transfected only with the miRNA unloaded DDS device; fluorescence in the cytoplasm was observed only in the fungi treated with labeled miRNA mimics in the DDS device (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). In other words, the possibility that this was a stress response (autofluorescence) due to the treatment herein was ruled out; indeed, the fluorescence of the RNA fluorescently labeled using vesicles was confirmed in the compartment inside the cell wall, suggesting that the nucleic acid molecules passed through the cell wall.\u003c/p\u003e \u003cp\u003eOne limitation of this study is that off-target effects must be considered for RNAi-based methods. We observed phenotypes associated with reduced gene expression and translation upon introducing the miRNA against \u003cem\u003ealb1\u003c/em\u003e. However, there was a concern about the off-target effect of miRNA introduction. Therefore, we attempted the method reported by Halder et al. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], which has been reported to demonstrate direct binding of the introduced miRNA to the target mRNA; however, we were unable to replicate this result (data not shown). For effective treatment using RNAi, it is necessary to study the turnover of miRNAs and the appropriate dosage and frequency of administration in vivo. The pharmacokinetics of the micelle itself used herein are well understood and its safety is assured, making it an excellent carrier option; however, understanding the development of toxicity to the host due to the introduction of miRNAs is necessary [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Addressing these issues is expected to bring us closer to therapeutic applications; however, clarification of the mechanisms, such as how nucleic acids are taken up into the fungi by using vesicles, is likely to be the focus of basic biology in the future.\u003c/p\u003e \u003cp\u003eIn conclusion, we attempted to regulate the expression of fungal virulence factors using microRNAs (miRNAs). We confirmed that miRNAs can be introduced into intact fungi using DDS-based carriers. This research provides a new therapeutic concept by controlling the expression of pathogenic factors in fungi using miRNAs.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cp\u003e\u003cstrong\u003eEthics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the Animal Experiment Committee of Tokyo Medical University and were conducted in accordance with animal experiment regulations.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStrains and culture conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStrains and primers used in this study are listed in Table 1 and Table 2, respectively. The construction of the deletion and complementation strains as well as conditions of the media used in this study are described in the Supplementary Material.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlasmid preparation and construction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe preparation and construction of plasmids are described in the Supplementary Material.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConidia preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConidia from each strain were stored in a deep freezer at \u0026minus;80\u0026deg;C in phosphate-buffered saline (PBS) containing 20% glycerol. Fresh conidia were harvested after 4 days of culturing in conidial suspensions at 37\u0026deg;C in PDA medium with PBS containing 0.1% Tween 80. The conidia were passed through a 40-\u0026micro;m EASYstrainer (Greiner Bio-One Co. Ltd., Tokyo, Japan) to remove hyphae. Conidia concentrations in the prepared suspensions were measured using a hemocytometer.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emiRNA mimics and fluorescence labeling\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe selection of miRNAs was performed using miRbase (miRbase.org) [27], based on the \u003cem\u003ealb1\u003c/em\u003e sequence information of strain Af293, the \u003cem\u003eA. fumigatus\u003c/em\u003e genome standard strain in the FungiDB (https://fungidb.org/fungidb/app). Two human miRNAs with low e-values were selected based on their high index of complementation and binding. The mirVana\u003csup\u003eTM\u003c/sup\u003e miRNA mimic of hsa-miR-3667-5p 5\u0026prime;-UGAAACUGGAGCGCCUGGAGGA-3\u0026prime;, hsa-miR-4738-3p 5\u0026prime;-AAAGACCCAUUGGAGGAGAAGGU-3\u0026prime; and Negative Control #1 were purchased from Thermo Fisher Scientific. We added 50 \u0026mu;L of Tracker Reconstitution Solution, supplied with the kit, to Label IT Tracker Reagent (Takara Bio Inc., Shiga, Japan), and the suspension was vortexed to dissolve completely. Then, miRNA was added to Label IT Reagent and incubated at 37\u0026deg;C for 1 h. After ethanol precipitation treatment, the fluorescence-labeled nucleic acids were collected.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransfection of miRNA mimics and microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe miRNA mimics were co-incubated with the protoplasts in PEG 4000. The Dectin-1 device-loaded miRNA was co-incubated with mycelium in RPMI 1640 medium (Invitrogen Japan, Tokyo, Japan) for 6\u0026ndash;12 h. The protoplasts or mycelia were grown in \u0026micro;-Dish 35 mm (ibidi GmbH, Gr\u0026auml;felfing, Germany). The cell wall was stained with \u0026times;500 Calcofluor White stain (Sigma-Aldrich Japan, Tokyo, Japan) for 30 min at 15\u0026ndash;25\u0026deg;C. Subsequently, the cells were washed thrice using PBS. The samples were embedded in SlowFade\u0026trade; Diamond Antifade Mountant (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) with added 4\u0026prime;,6-diamidino-2-phenylindole to counterstain the nuclei. Observations were captured using a confocal laser microscope LSM700 (Carl Zeiss, Oberkochen, Germany).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction from \u003cem\u003eA. fumigatus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMycelia were grown in RPMI 1640 medium at 37\u0026deg;C under 5% CO\u003csub\u003e2\u003c/sub\u003e conditions. After incubation, mycelia were homogenized using zirconia beads. Total RNA was extracted from the homogenized solution using TRIzol\u0026trade; Reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer\u0026rsquo;s protocol. The extracted RNA was purified using the RNeasy Mini Kit (QIAGEN) and treated with DNase using an RNase-free DNase Set (QIAGEN).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription-PCR analysis of mRNA expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ecDNA was synthesized by reverse transcription reaction of 500 ng of total RNA using the SuperScript VILO cDNA Synthesis Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer\u0026rsquo;s instructions. The synthesized cDNA was used as a template, and a combination of primers RT-alb1FW and RT-alb1REV [26] (Table 2) was used with TB Green\u003csup\u003e\u0026reg;\u003c/sup\u003e Premix Ex Taq\u0026trade; II (Tli RNaseH Plus) (Takara Bio Inc., Shiga, Japan) for reverse transcription-PCR of the target gene using Mx3000P qPCR System (Agilent Technologies Japan, Ltd., Tokyo, Japan). Relative quantification of the gene of interest was performed using beta-actin as an endogenous control and the \u0026Delta;\u0026Delta;CT algorithm.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein extraction and western blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter miRNA transfection, the Alb1_HA strain was cultured overnight at 37\u0026deg;C under shaking conditions using a YG liquid medium, and the mycelia were collected. The mycelium was lyophilized, and Sample Buffer Solution with Reducing Reagent (6\u0026times;) for sodium dodecyl-sulphate polyacrylamide gel electrophoresis (SDS-PAGE) (NACALAI TESQUE, Inc., Kyoto, Japan) was used. The sample buffer was heated at 100\u0026deg;C for 5 min, and SDS-PAGE was performed using SuperSep\u0026trade;Ace, 10\u0026ndash;20% (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). After transfer to Immun-Blot PVDF Membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA), the membrane was blocked with PVDF Blocking Reagent for Can Get Signal (TOYOBO Co., Ltd., Osaka, Japan). Then, the membrane was washed with TBS-T (0.01% Tween 20) and incubated with an anti-HA-tag antibody (sc-7392; Santa Cruz Biotechnology, TX, USA) at a final concentration of 1 \u0026micro;g/mL in Can Get Signal solution 1 (TOYOBO Co., Ltd., Osaka, Japan) at 4\u0026deg;C overnight. After washing thrice with TBS-T, the secondary antibody (anti-mouse IgG, HRP-linked antibody #7076; Cell Signalling Technology, Danvers, MA , USA) was diluted 15,000-fold using Can Get Signal solution 2 (TOYOBO Co., Ltd., Osaka, Japan) and reacted for 1 h at room temperature. Subsequently, the membrane was washed thrice with TBS-T and reacted with ImmunoStar LD (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). The chemiluminescence signals were detected using C-DiGit western blot imaging (LI-COR Corporate, Lincoln, NE, USA). A relative comparison of signals was performed using Image Studio for the C-DiGit software. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHydrogen peroxide oxidative susceptibility assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApproximately 1.0 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e conidia were suspended in 10 mL of 1.1 mM hydrogen peroxide (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) and rotated at room temperature for 24 h. Subsequently, 10 \u0026micro;L of the diluted solution was inoculated in triplicate onto PDA plates and incubated at 37\u0026deg;C for 24 h. The colonies were visually measured.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNeutrophil killing assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNeutrophils were collected using the Neutrophil Isolation Kit (Funakoshi Co., Ltd., Tokyo, Japan). We injected 1 mL of 7.5% Sodium Caseinate Solution Assay Reagent into the abdominal cavity of C57/B6 J mice. After 24 h, 5 mL of PBS was injected into the peritoneal cavity of the mice, and the peritoneal fluid was collected. The collected peritoneal fluid was treated with Neutrophil Isolation Medium and Red Blood Cell Lysis Buffer using Percoll Gradient Assay Reagent to isolate neutrophils. Subsequently, 1.0 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e aliquots were prepared using RPMI liquid medium and co-cultured for 3 h with an equal number of neutrophils. After co-cultivation, colonies were inoculated onto PDA plates and incubated at 37\u0026deg;C for 24 h; colonies were visually measured. The sterilization rate was expressed as the percentage decrease in CFU in the presence of neutrophils, with CFU in the absence of neutrophils as the control. The mice used were C57BL/6J, male, 5 weeks old, purchased from CLEA Japan, Inc. All mice used for the treatment and other experiments were acclimated for at least 1 week. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDectin-1-installed micelle-loaded miRNA preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDectin-1 Recombinant Human Dectin-1/CLEC7A Protein (hFc Tag) (Sino Biological Japan Inc., Kanagawa, Japan) was conjugated to a DBCO-PEG4-NHS linker for attachment to N\u003csub\u003e3\u003c/sub\u003e-PEG-poly(L-lysine) (pLL). Dectin-1 (100 \u0026mu;g) was dissolved in 50 mM NaHCO\u003csub\u003e3\u003c/sub\u003e buffer (pH 8.6), which was exchanged twice in a 10k vivaspin tube. Ultrafiltration was conducted at 830\u0026times;\u003cem\u003eg\u003c/em\u003e for 4 min. The DBCO-PEG4-NHS linker (10 mg/mL, 5 \u0026mu;g) was added to the solution and incubated at 4\u0026deg;C for 12 h. Then, the solution was purified with HEPES buffer in a 10k vivaspin tube. Ultrafiltration was conducted at 3000 rpm for 4 min for purification. To prepare miRNA-loaded nanocarriers, N\u003csub\u003e3\u003c/sub\u003e-PEG(12k)-pLL was dissolved in pH 8.5 HEPES buffer at 2 mg/mL concentration. Then, 140 \u0026mu;L of the solution was added to the miRNA solution (10 \u0026mu;g of miRNA was dissolved in 200 \u0026mu;L of nuclease-free water) and incubated for an hour at 25\u0026deg;C. After incubation, a total of 300 \u0026mu;L of MeO-PEG-pLL(CAA) solution (2 mg/mL) was added; 15 \u0026mu;L was added every 5 min. After 12 h of incubation, the micelle solution was filtered through a 0.22-\u0026mu;m PVDF syringe filter. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses of biological replicates of reverse transcription-PCR data and percent killing data were performed using one-way analysis of variance (ANOVA), followed by Sidak/Dunnett\u0026rsquo;s multiple comparison tests. Analysis of hydrogen peroxide oxidative susceptibility assay data was performed using a two-way ANOVA, followed by Sidak\u0026rsquo;s multiple comparison tests. All analyses were performed using the GraphPad Prism 7 software (GraphPad Software Inc., San Diego, CA, USA).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u0026nbsp;\u003c/strong\u003eWe would like to thank the Center for Diversity at Tokyo Medical University for supporting this study (TMUCD-202401).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was supported by JSPS KAKENHI Grant Numbers 24K19271 (TI).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransparency declarations:\u0026nbsp;\u003c/strong\u003eAll authors: None to declare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u0026nbsp;\u003c/strong\u003eTI, RW, YM, HC: Performed research and analyzed data. TI, YM, HC, MK, SN: Conceptualization. TI, HC, SN: Writing-original draft.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement:\u0026nbsp;\u003c/strong\u003eData will be made available on request.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDenning, D. W. Global incidence and mortality of severe fungal disease. \u003cem\u003eLancet Infect. Dis.\u003c/em\u003e \u003cstrong\u003e24,\u003c/strong\u003e e428\u0026ndash;e438 (2024) (DOI 10.1016/S1473-3099(23)00692-8) (PubMed: 38224705)\u003c/li\u003e\n\u003cli\u003eBurks, C., Darby, A., G\u0026oacute;mez Londo\u0026ntilde;o, L., Momany, M. \u0026amp; Brewer, M. T. Azole-resistant Aspergillus fumigatus in the environment: identifying key reservoirs and hotspots of antifungal resistance. \u003cem\u003ePLOS Pathog.\u003c/em\u003e \u003cstrong\u003e17,\u003c/strong\u003e e1009711 (2021) (DOI 10.1371/journal.ppat.1009711) (PubMed: 34324607)\u003c/li\u003e\n\u003cli\u003eWHO fungal priority pathogens list to guide research, development, and public health action, 2022, Available from: https://www.who.int/publications/i/item/9789240060241\u003c/li\u003e\n\u003cli\u003eBartel, B. MicroRNAs directing siRNA biogenesis. \u003cem\u003eNat. Struct. Mol. Biol.\u003c/em\u003e \u003cstrong\u003e12,\u003c/strong\u003e 569\u0026ndash;571 (2005) (DOI 10.1038/nsmb0705-569) (PubMed: 15999111)\u003c/li\u003e\n\u003cli\u003eBartel, D. P. MicroRNAs: genomics, biogenesis, mechanism, and function. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e116,\u003c/strong\u003e 281\u0026ndash;297 (2004) (DOI 10.1016/s0092-8674(04)00045-5) (PubMed: 14744438)\u003c/li\u003e\n\u003cli\u003eBorna, H., Imani, S., Iman, M. \u0026amp; Azimzadeh Jamalkandi, S. Therapeutic face of RNAi: in vivo challenges. \u003cem\u003eExpert Opin. Biol. Ther.\u003c/em\u003e \u003cstrong\u003e15,\u003c/strong\u003e 269\u0026ndash;285 (2015) (DOI 10.1517/14712598.2015.983070) (PubMed: 25399911)\u003c/li\u003e\n\u003cli\u003eSayyed, A. A. \u003cem\u003eet al\u003c/em\u003e. Role of miRNAs in cancer diagnostics and therapy: A recent update. \u003cem\u003eCurr. Pharm. Des.\u003c/em\u003e \u003cstrong\u003e28,\u003c/strong\u003e 471\u0026ndash;487 (2022) (DOI 10.2174/1381612827666211109113305) (PubMed: 34751112)\u003c/li\u003e\n\u003cli\u003eBruch, A., Kelani, A. A. \u0026amp; Blango, M. G. RNA-based therapeutics to treat human fungal infections. \u003cem\u003eTrends Microbiol.\u003c/em\u003e \u003cstrong\u003e30,\u003c/strong\u003e 411\u0026ndash;420 (2022) (DOI 10.1016/j.tim.2021.09.007) (PubMed: 34635448)\u003c/li\u003e\n\u003cli\u003eKhatri, M. \u0026amp; Rajam, M. V. Targeting polyamines of Aspergillus nidulans by siRNA specific to fungal ornithine decarboxylase gene. \u003cem\u003eMed. Mycol.\u003c/em\u003e \u003cstrong\u003e45,\u003c/strong\u003e 211\u0026ndash;220 (2007) (DOI 10.1080/13693780601158779) (PubMed: 17464842)\u003c/li\u003e\n\u003cli\u003eNami, S. \u003cem\u003eet al\u003c/em\u003e. The utilization of RNA silencing technology to mitigate the voriconazole resistance of Aspergillus flavus; Lipofectamine-based delivery. \u003cem\u003eAdv. Pharm. Bull.\u003c/em\u003e \u003cstrong\u003e7,\u003c/strong\u003e 53\u0026ndash;59 (2017) (DOI 10.15171/apb.2017.007) (PubMed: 28507937)\u003c/li\u003e\n\u003cli\u003eRaruang, Y. \u003cem\u003eet al\u003c/em\u003e. Targeting the Aspergillus flavus p2c gene through host-induced gene silencing reduces A. flavus infection and aflatoxin contamination in transgenic maize. \u003cem\u003eFront. Plant Sci.\u003c/em\u003e \u003cstrong\u003e14,\u003c/strong\u003e 1150086 (2023) (DOI 10.3389/fpls.2023.1150086) (PubMed: 37229129)\u003c/li\u003e\n\u003cli\u003eMouyna, I., Henry, C., Doering, T. L. \u0026amp; Latg\u0026eacute;, J. P. Gene silencing with RNA interference in the human pathogenic fungus Aspergillus fumigatus. \u003cem\u003eFEMS Microbiol. Lett.\u003c/em\u003e \u003cstrong\u003e237,\u003c/strong\u003e 317\u0026ndash;324 (2004) (DOI 10.1016/j.femsle.2004.06.048) (PubMed: 15321679)\u003c/li\u003e\n\u003cli\u003eJ\u0026ouml;chl, C., Loh, E., Ploner, A., Haas, H. \u0026amp; H\u0026uuml;ttenhofer, A. Development-dependent scavenging of nucleic acids in the filamentous fungus Aspergillus fumigatus. \u003cem\u003eRNA Biol.\u003c/em\u003e \u003cstrong\u003e6,\u003c/strong\u003e 179\u0026ndash;186 (2009) (DOI 10.4161/rna.6.2.7717) (PubMed: 19246986)\u003c/li\u003e\n\u003cli\u003eCroston, T. L., Lemons, A. R., Beezhold, D. H. \u0026amp; Green, B. J. MicroRNA regulation of host immune responses following fungal exposure. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e9,\u003c/strong\u003e 170 (2018) (DOI 10.3389/fimmu.2018.00170) (PubMed: 29467760)\u003c/li\u003e\n\u003cli\u003eDas Gupta, M. \u003cem\u003eet al\u003c/em\u003e. Aspergillus fumigatus induces microRNA-132 in human monocytes and dendritic cells. \u003cem\u003eInt. J. Med. Microbiol.\u003c/em\u003e \u003cstrong\u003e304,\u003c/strong\u003e 592\u0026ndash;596 (2014) (DOI 10.1016/j.ijmm.2014.04.005) (PubMed: 24841251)\u003c/li\u003e\n\u003cli\u003eHalder, L. D. \u003cem\u003eet al\u003c/em\u003e. Candida albicans induces cross-kingdom miRNA trafficking in human monocytes to promote fungal growth. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e e0356321 (2021) (DOI 10.1128/mbio.03563-21) (PubMed: 35132877)\u003c/li\u003e\n\u003cli\u003eWang, Y., Cui, C., Wang, G., Li, Y. \u0026amp; Wang, S. Insects defend against fungal infection by employing microRNAs to silence virulence-related genes. \u003cem\u003eProc. Natl Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e118,\u003c/strong\u003e e2023802118 (2021) (DOI 10.1073/pnas.2023802118) (PubMed: 33941699)\u003c/li\u003e\n\u003cli\u003eBitencourt, T. A. \u003cem\u003eet al\u003c/em\u003e. Fungal extracellular vesicles are involved in intraspecies intracellular communication. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e13,\u003c/strong\u003e e0327221 (2022) (DOI 10.1128/mbio.03272-21) (PubMed: 35012355)\u003c/li\u003e\n\u003cli\u003eCabral, H. \u0026amp; Kataoka, K. Progress of drug-loaded polymeric micelles into clinical studies. \u003cem\u003eJ. Control. Release\u003c/em\u003e \u003cstrong\u003e190,\u003c/strong\u003e 465\u0026ndash;476 (2014) (DOI 10.1016/j.jconrel.2014.06.042) (PubMed: 24993430)\u003c/li\u003e\n\u003cli\u003ePetrini, M. \u003cem\u003eet al\u003c/em\u003e. Effects of surface charge, PEGylation and functionalization with Dipalmitoylphosphatidyldiglycerol on liposome-cell interactions and local drug delivery to solid tumors via thermosensitive liposomes. \u003cem\u003eInt. J. Nanomedicine\u003c/em\u003e \u003cstrong\u003e16,\u003c/strong\u003e 4045\u0026ndash;4061 (2021) (DOI 10.2147/IJN.S305106) (PubMed: 34163158)\u003c/li\u003e\n\u003cli\u003eKataoka, K. \u003cem\u003eet al\u003c/em\u003e. Doxorubicin-loaded poly(ethylene glycol)-poly(beta-benzyl-L-aspartate) copolymer micelles: their pharmaceutical characteristics and biological significance. \u003cem\u003eJ. Control. Release\u003c/em\u003e \u003cstrong\u003e64,\u003c/strong\u003e 143\u0026ndash;153 (2000) (DOI 10.1016/s0168-3659(99)00133-9) (PubMed: 10640653)\u003c/li\u003e\n\u003cli\u003eInukai, T., Chen, P., Kokuba, H., Cabral, H. \u0026amp; Nakamura, S. A novel fungal-targeted drug delivery system dectin-1-targeted-PEG-amino acid polymer block enhances antifungal activity and reduces cytotoxicity of amphotericin B. \u003cem\u003eJ. Drug Deliv. Sci. Technol.\u003c/em\u003e \u003cstrong\u003e100,\u003c/strong\u003e Article 106073 (2024) (DOI 10.1016/j.jddst.2024.106073)\u003c/li\u003e\n\u003cli\u003eTsai, H. F., Chang, Y. C., Washburn, R. G., Wheeler, M. H. \u0026amp; Kwon-Chung, K. J. The developmentally regulated alb1 gene of \u003cem\u003eAspergillus fumigatus\u003c/em\u003e: its role in modulation of conidial morphology and virulence. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cstrong\u003e180,\u003c/strong\u003e 3031\u0026ndash;3038 (1998) (DOI 10.1128/JB.180.12.3031-3038.1998) (PubMed: 9620950)\u003c/li\u003e\n\u003cli\u003eJahn, B. \u003cem\u003eet al\u003c/em\u003e. Isolation and characterization of a pigmentless-conidium mutant of Aspergillus fumigatus with altered conidial surface and reduced virulence. \u003cem\u003eInfect. Immun.\u003c/em\u003e \u003cstrong\u003e65,\u003c/strong\u003e 5110\u0026ndash;5117 (1997) (DOI 10.1128/iai.65.12.5110-5117.1997) (PubMed: 9393803)\u003c/li\u003e\n\u003cli\u003eEnayati, S., Azizi, M., Aminollahi, E., Ranjvar Shahrivar, M. \u0026amp; Khalaj, V. T7-RNA polymerase dependent RNAi system in \u003cem\u003eAspergillus fumigatus\u003c/em\u003e: a proof of concept study. \u003cem\u003eFEMS Microbiol. Lett.\u003c/em\u003e \u003cstrong\u003e363,\u003c/strong\u003e fnw029 (2016) (DOI 10.1093/femsle/fnw029) (PubMed: 26850443)\u003c/li\u003e\n\u003cli\u003eKhalaj, V., Eslami, H., Azizi, M., Rovira-Graells, N. \u0026amp; Bromley, M. Efficient downregulation of alb1 gene using an AMA1-based episomal expression of RNAi construct in \u003cem\u003eAspergillus fumigatus\u003c/em\u003e. \u003cem\u003eFEMS Microbiol. Lett.\u003c/em\u003e \u003cstrong\u003e270,\u003c/strong\u003e 250\u0026ndash;254 (2007) (DOI 10.1111/j.1574-6968.2007.00680.x) (PubMed: 17343676)\u003c/li\u003e\n\u003cli\u003eKozomara, A., Birgaoanu, M. \u0026amp; Griffiths-Jones, S. miRBase: from microRNA sequences to function. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cstrong\u003e47,\u003c/strong\u003e D155\u0026ndash;D162 (2019) (DOI 10.1093/nar/gky1141) (PubMed: 30423142)\u003c/li\u003e\n\u003cli\u003eSamuel, M., Bleackley, M., Anderson, M. \u0026amp; Mathivanan, S. Extracellular vesicles including exosomes in cross kingdom regulation: a viewpoint from plant-fungal interactions. \u003cem\u003eFront. Plant Sci.\u003c/em\u003e \u003cstrong\u003e6,\u003c/strong\u003e Article 766 (2015) (DOI 10.3389/fpls.2015.00766) (PubMed: 26442078)\u003c/li\u003e\n\u003cli\u003eRizzo, J., Taheraly, A. \u0026amp; Janbon, G. Structure, composition and biological properties of fungal extracellular vesicles. \u003cem\u003eMicrolife\u003c/em\u003e \u003cstrong\u003e2,\u003c/strong\u003e uqab009 (2021) (DOI 10.1093/femsml/uqab009) (PubMed: 37223252)\u003c/li\u003e\n\u003cli\u003eBae, Y. \u0026amp; Kataoka, K. Intelligent polymeric micelles from functional poly(ethylene glycol)-poly(amino acid) block copolymers. \u003cem\u003eAdv. Drug Deliv. Rev.\u003c/em\u003e \u003cstrong\u003e61,\u003c/strong\u003e 768\u0026ndash;784 (2009) (DOI 10.1016/j.addr.2009.04.016) (PubMed: 19422866)\u003c/li\u003e\n\u003cli\u003eYang, W., Chen, P., Boonstra, E., Hong, T. \u0026amp; Cabral, H. Polymeric micelles with pH-responsive cross-linked core enhance in vivo mRNA delivery. \u003cem\u003ePharmaceutics\u003c/em\u003e \u003cstrong\u003e14, \u003c/strong\u003e1205 (2022) (DOI 10.3390/pharmaceutics14061205) (PubMed: 35745778)\u003c/li\u003e\n\u003cli\u003eSzewczyk, E. \u003cem\u003eet al.\u003c/em\u003e Fusion PCR and gene targeting in \u003cem\u003eAspergillus nidulans\u003c/em\u003e. \u003cem\u003eNat. Protoc.\u003c/em\u003e \u003cstrong\u003e1,\u003c/strong\u003e 3111\u0026ndash;3120 (2006) (DOI 10.1038/nprot.2006.405) (PubMed: 17406574)\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Strains used in this study\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"88%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStrain\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eParent\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenotype\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReference or source\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003eAfS35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eD141\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003e\u003cem\u003eakuA\u0026Delta;\u003c/em\u003e::loxP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003eFrom FGSC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e\u0026Delta;alb1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003eAfS35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003e\u003cem\u003ealb1\u0026Delta;\u003c/em\u003e::\u003cem\u003ehph\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003eAlb1_HA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 15px;\"\u003e\n \u003cp\u003e\u0026Delta;alb1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 37px;\"\u003e\n \u003cp\u003e\u003cem\u003ealb1\u0026Delta;\u003c/em\u003e::\u003cem\u003ealb1\u003c/em\u003e-3\u0026times;HA, \u003cem\u003eptrA\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2. Sequences of primers used in this study\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"549\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;Description source\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eLFH1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTGTAGCGCCCTCAATGCAACATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eLFH2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eGGCGAGTGGTTTGCGCGGCGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eLFH3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTGGGGTGAGTTCCTAGGTTTGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eLFH4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eGGCATGACTAGGCTCATCTCCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eLFH5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eGGAACTCATGGCCGTGGCCATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eLFH6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTGGGGTGAGTTCCTAGGTTTGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eDischeck5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eAATCAAAGCATGTCGATCCTGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eDischeck3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTGGCATTCTTAACTGTATCTGTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eptrAlast150seq\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTCCACATGCATATGTAAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eAlb1-hph-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eGAGGCCACTCAGGCCGATATCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eAlb1-hph-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eCTGGCCTAGATGGCCGTCGACAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eRT-alb1-FW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eCAACTCGATTGGGCTCTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eRT-alb1-REV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTAGCCCATTTGCTGTCGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eRT-tubrin-FW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eCTTGGATGACGGGTGATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eRT-tubrin-REV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 273px;\"\u003e\n \u003cp\u003eTGGGAGGATATAGGTCGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 147px;\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3. miRNA candidates\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"640\" class=\"fr-table-selection-hover\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e\u003cstrong\u003emiRNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e\u003cstrong\u003escore\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ee-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-4738-3p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-4757-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e5.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-5708\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e5.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-6869-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e4.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-1247-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-4660\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e5.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-4500\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e8.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-3667-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e2.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003ehsa-miR-1322\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 213px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Aspergillus fumigatus, Drug Delivery Systems, MicroRNAs (miRNAs), RNA therapeutics","lastPublishedDoi":"10.21203/rs.3.rs-6274481/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6274481/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eAspergillus fumigatus\u003c/em\u003e, which causes aspergillosis, has developed resistance to azole antifungal agents in recent years. As only three main classes of antifungal drugs are available, the development of novel therapeutic strategies is crucial. We aimed to control the expression of virulence factors by introducing microRNAs (miRNAs) into fungi as an innovative therapeutic approach. To test our hypothesis, we selected miRNA mimics targeting \u003cem\u003ealb1\u003c/em\u003e, which is involved in the synthesis of melanin, a virulence factor of \u003cem\u003eA. fumigatus\u003c/em\u003e, and transfected them into the protoplast of the fungus, which resulted in a 2-fold reduction in \u003cem\u003ealb1\u003c/em\u003e expression. Next, we created a 3\u0026times;HA-tagged Alb1 protein (Alb1-HAp)-expressing strain and confirmed the regulation of translation using western blotting with an anti-HA antibody. The protein amount of Alb1-HAp was reduced by one-third after the introduction of the miRNA. Moreover, the reduction in melanin after miRNA transfection promoted the killing of fungus by hydrogen peroxide-induced oxidative stress and sensitized the fungus to neutrophil attack. Additionally, by loading miRNAs into a fungus-targeted delivery system, we demonstrated the potential of transferring miRNAs into intact fungal cells \u003cem\u003ein vitro\u003c/em\u003e. These results indicate the potential of miRNAs to regulate target virulence factors in fungi, leading to the development of novel therapies.\u003c/p\u003e","manuscriptTitle":"Harnessing MicroRNAs to Attenuate Aspergillus fumigatus Virulence: A New Paradigm in Antifungal Therapy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-23 12:13:13","doi":"10.21203/rs.3.rs-6274481/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-04-30T08:45:21+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-21T20:12:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-11T06:55:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"84034370711650279494751664489432502890","date":"2025-04-08T08:15:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"14025664577073833356472906103762933510","date":"2025-04-03T02:23:41+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-02T13:18:07+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-02T11:53:23+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-04-02T11:49:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-03-28T00:24:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-28T00:23:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9cd3ed01-1d8a-4a99-89d9-4dd9251c95c0","owner":[],"postedDate":"April 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":47513128,"name":"Biological sciences/Microbiology/Fungi"},{"id":47513129,"name":"Physical sciences/Nanoscience and technology/Nanomedicine/Drug delivery"}],"tags":[],"updatedAt":"2025-05-26T16:01:23+00:00","versionOfRecord":{"articleIdentity":"rs-6274481","link":"https://doi.org/10.1038/s41598-025-02742-0","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-05-19 15:57:36","publishedOnDateReadable":"May 19th, 2025"},"versionCreatedAt":"2025-04-23 12:13:13","video":"","vorDoi":"10.1038/s41598-025-02742-0","vorDoiUrl":"https://doi.org/10.1038/s41598-025-02742-0","workflowStages":[]},"version":"v1","identity":"rs-6274481","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6274481","identity":"rs-6274481","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.