Epigenetic Modulation of IL-7 and IL-10: Toward Personalized Immune Therapies in Viral Epidemics

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-04 · read from full text

This paper measured DNA methylation at IL-7, IL-8, and IL-10 in peripheral blood from 145 hospitalized COVID-19 patients stratified by severity (ward vs ICU), using bisulfite conversion followed by PCR and gel electrophoresis, with methylation “beta values” as readouts. IL-7 was significantly hypermethylated, with higher methylation in ICU patients, and this ICU-associated difference persisted after adjustment for age, mortality, and malignancy; IL-10 was significantly hypomethylated, while IL-8 showed no significant methylation difference between severity groups. The authors note preliminary, assay-level constraints, and that they excluded patients taking epigenetically active medications to reduce confounding (12/157 excluded). This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 45,232 characters · extracted from preprint-html · click to expand
Epigenetic Modulation of IL-7 and IL-10: Toward Personalized Immune Therapies in Viral Epidemics | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 8 July 2025 V1 Latest version Share on Epigenetic Modulation of IL-7 and IL-10: Toward Personalized Immune Therapies in Viral Epidemics Author : Zerrin Yulugkural [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.175197084.49874772/v1 Published Journal of Immunology Research Version of record Peer review timeline 299 views 155 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Background The severity of viral epidemics is influenced by host immune responses, including cytokine production. Epigenetic mechanisms, particularly DNA methylation, regulate gene expression and may contribute to cytokine dysregulation. This study investigates the methylation status of IL-7, IL-8, and IL-10 in patients with varying disease severity to assess their role in immune regulation. Methods A total of 157 COVID-19 patients were initially evaluated. Twelve patients were excluded due to the use of epigenetically active medications, resulting in a final cohort of 145 patients (91 ward, 54 ICU). Peripheral blood samples were collected for total DNA isolation followed by bisulfite conversion. DNA methylation levels of IL-7, IL-8, and IL-10 were assessed using PCR and gel electrophoresis. Methylation beta values were calculated to evaluate the degree of gene-specific hyper/hypomethylation. Results IL-7 was significantly hypermethylated (0.835, p<0.001), with higher levels in ICU patients (0.863, p=0.001). This difference remained after adjusting for age, mortality, and malignancy, none of which were independent predictors. A significant interaction between age and ICU status indicated group-specific modulation. IL-10 was significantly hypomethylated (0.243, p<0.001), while IL-8 methylation showed no significant difference (p=0.373). ICU patients had higher mortality (26% vs. 5.5%, p<0.001). Conclusion IL-7 hypermethylation may suppress T-cell function, contributing to severe disease, while IL-10 hypomethylation suggests an immunosuppressive response. These findings provide insight into the epigenetic regulation of immune responses during viral epidemics and may inform targeted immunotherapies. Epigenetic Modulation of IL-7 and IL-10: Toward Personalized Immune Therapies in Viral Epidemics Zerrin Yulugkural 1 , Mustafa Yildiz 2 , Ertugrul Topcu 1 , Habibe Tülin Elmaslar Mert 1 , Alp Temiz 3,4 1 Department of Infectious Diseases and Clinical Microbiology, Trakya University, Edirne, Turkey 2 Department of Biophysics, Trakya University, Edirne, Turkey 3 Department of Medicine 3 - Rheumatology and Immunology, Friedrich-Alexander-Universität Erlangen-Nürnberg and Uniklinikum Erlangen, Erlangen, Germany 4 Deutsches Zentrum für Immuntherapie (DZI), Friedrich-Alexander-Universität Erlangen-Nürnberg and Uniklinikum Erlangen Correspondence to: Dr. Zerrin Yulugkural, MD Department of Infectious Diseases and Clinical Microbiology Trakya University 22030, Edirne, Turkey E-mail: [email protected] Background The severity of viral epidemics is influenced by host immune responses, including cytokine production. Epigenetic mechanisms, particularly DNA methylation, regulate gene expression and may contribute to cytokine dysregulation. This study investigates the methylation status of IL-7, IL-8, and IL-10 in patients with varying disease severity to assess their role in immune regulation. Methods A total of 157 COVID-19 patients were initially evaluated. Twelve patients were excluded due to the use of epigenetically active medications, resulting in a final cohort of 145 patients (91 ward, 54 ICU). Peripheral blood samples were collected for total DNA isolation followed by bisulfite conversion. DNA methylation levels of IL-7, IL-8, and IL-10 were assessed using PCR and gel electrophoresis. Methylation beta values were calculated to evaluate the degree of gene-specific hyper/hypomethylation. Results IL-7 was significantly hypermethylated (0.835, p<0.001), with higher levels in ICU patients (0.863, p=0.001). This difference remained after adjusting for age, mortality, and malignancy, none of which were independent predictors. A significant interaction between age and ICU status indicated group-specific modulation. IL-10 was significantly hypomethylated (0.243, p<0.001), while IL-8 methylation showed no significant difference (p=0.373). ICU patients had higher mortality (26% vs. 5.5%, p<0.001). Conclusion IL-7 hypermethylation may suppress T-cell function, contributing to severe disease, while IL-10 hypomethylation suggests an immunosuppressive response. These findings provide insight into the epigenetic regulation of immune responses during viral epidemics and may inform targeted immunotherapies. Keywords: DNA Methylation, Cytokines, Epigenesis, Genetic, Immune Response, Epidemics. INTRODUCTION History records not only the developments, achievements, wars, and their consequences driven primarily by human actions, but also the stories of epidemics caused by microorganisms that share the world as a habitat, significantly impact societies, and lead to serious consequences. The COVID-19 disease, which most recently emerged at the end of 2019, has spread rapidly all over the world and has turned into a pandemic and is still continuing its effect (1). COVID-19 can progress to acute respiratory distress syndrome (ARDS) and has led to significant mortality, particularly in the initial phases of the pandemic (2). Disease severity depends on factors such as viral load, age, sex and underlying health status, as well as the immune responses of the host (3, 4). The virus triggers various immune responses by interacting with the cellular and molecular components of the immune system. Among these, the overproduction of proinflammatory cytokines and the activation of immune cells are critical (5). CD4+ and CD8+ T cells are crucial in mounting virus-specific immune responses. Their activation leads to antiviral effects, including controlling viral replication, regulating inflammation, and clearing infected cells. However, an overactive immune response, characterized by excessive cytokine production, can result in tissue damage. In severe COVID-19 cases, this excessive response, often termed a ”cytokine storm,” can lead to life-threatening conditions such as ARDS (6). Epigenetic mechanisms, particularly DNA methylation, may also be involved in the body’s response to SARS-CoV-2 infection. DNA methylation is a heritable modification where methyl groups are added to cytosine bases in the DNA sequence. This alteration can regulate gene expression, affecting cellular functions (7, 8). Understanding the molecular and immune mechanisms in COVID-19 may provide insights into the disease’s progression and help identify at-risk groups. This knowledge is crucial for public health planning and resource allocation during pandemics. Mechanisms such as the activation of CD4+ and CD8+ T cells and the production of proinflammatory cytokines allow the immune system, both innate and acquired, to mount an antiviral response. These responses are essential for controlling viral replication, curbing the spread of the virus, and clearing infected cells (9, 10). However, in some cases, tissue damage from the virus can lead to the overproduction of cytokines, which in turn triggers the activation of macrophages and granulocytes—key players in inflammation (1, 11). In SARS-CoV-2 infection, this exaggerated immune response, referred to as a cytokine storm, has been observed in clinical and imaging findings, particularly in severe COVID-19 cases that lead to ARDS (1). Patients with varying degrees of COVID-19 severity exhibit differences in their chemokine and cytokine profiles. Elevated plasma levels of interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), granulocyte colony-stimulating factor (G-CSF), monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory proteins (MIP)-1A and MIP-1B, and interleukins such as IL-1β, IL-7, IL-8, and IL-10 have been detected in SARS-CoV-2 positive individuals (11). Interleukin-7 (IL-7) is crucial for T-cell survival and proliferation, playing a significant role in immune regulation during viral infections (12, 13). Clinical trials have investigated IL-7 as a potential therapy to restore T-cell counts and enhance immune function in COVID-19 patients (14). IL-8, responsible for recruiting neutrophils to the lungs to fight the virus, can also contribute to lung inflammation when overproduced, leading to ARDS (15, 16). Meanwhile, IL-10 helps prevent immune-mediated tissue damage by suppressing proinflammatory cytokines. However, excessive IL-10 can weaken the immune response, allowing the virus to persist and possibly contributing to long COVID (17). Epigenetic changes, such as DNA methylation, influence gene expression without altering the genetic code and may be inherited (18). These modifications play a role in several biological processes, including cell differentiation, aging, and disease (19). DNA methylation typically occurs at CpG islands and is associated with gene silencing or reduced expression (20). Epigenetic mechanisms, including DNA methylation, can influence cytokine production by modulating gene expression. DNA methylation patterns in cytokine gene promoters directly affect transcriptional activity, with hypermethylation often leading to reduced gene expression and hypomethylation promoting increased expression. Maintaining an appropriate balance of these processes is critical for proper immune function (21). Investigating the epigenetic and immune responses in COVID-19 patients through molecular methods can provide valuable insights. Analysing gene regions that encode specific cytokines and observing CpG islands in these regions can help determine the genetic coding that regulates cytokine production (22). This analysis could allow for the creation of detailed profiles of cytokine-related gene regions in patients with varying degrees of COVID-19 severity, helping to predict clinical outcomes (23). Additionally, reassessing antiviral treatment duration and determining patient eligibility for suppressive therapy -either to counteract excessive immune responses or to address immunosuppression- may guide treatment strategies. Understanding these molecular mechanisms is crucial for effective disease management. MATERIALS and METHODS Clinical Samples and Data Collection A total of 157 COVID-19 patients were included in this study. Age, sex, and comorbidities such as hypertension, renal failure, malignancy, immunosuppressive therapy, coronary artery disease were reviewed and obtained from the patients’ medical records. To ensure valid IL-7, IL-8, and IL-10 epigenetic analyses, patients on medications with known epigenetic effects were excluded. This applied to 12 out of 157 patients. These drugs, including rituximab, methotrexate, cyclophosphamide, venetoclax, bortezomib, lenalidomide, platinum-based chemotherapeutic agents like cisplatin, carboplatin and oxaliplatin, paclitaxel, and trastuzumab, significantly alter DNA methylation, histone modifications, and cytokine gene expression. Rituximab affects cytokine expression through IL-10 inhibition and B-cell epigenetic reprogramming (24, 25). Methotrexate modifies DNA methylation and suppresses inflammatory cytokines (26). Cyclophosphamide shifts immune responses by altering cytokine expression (27). Venetoclax and platinum-based agents induce genome-wide methylation changes contributing to drug resistance (28, 29). Lenalidomide modulates histone modifications (30), while trastuzumab influencing immune responses (31). Given these substantial epigenetic effects, exclusion of these medications was necessary to minimize confounding and ensure reliable study results. Blood samples for DNA analysis were taken during routine laboratory tests in the intensive care unit and the COVID-19 wards managed by the University Faculty of Medicine, Department of Infectious Diseases, without the need for additional invasive procedures. None of the patients were vaccinated. Patients were admitted to the intensive care unit (ICU) based on criteria applied by Trakya University Faculty of Medicine Hospital. These criteria included a respiratory rate of ≥30 breaths per minute, signs of dyspnea and respiratory distress, oxygen saturation below 90% despite receiving ≥5 L/min nasal oxygen support, or a partial oxygen pressure (PaO2) below 70 mmHg under the same conditions. Additional criteria encompassed a PaO2/FiO2 ratio 4 mmol/L, bilateral infiltrations or multilobar involvement on chest imaging, hypotension (systolic blood pressure 40 mmHg from baseline, or mean arterial pressure <65 mmHg), and signs of impaired tissue perfusion. Furthermore, patients with organ dysfunction (such as abnormal renal or liver function tests, thrombocytopenia, or confusion), immunosuppressive conditions, uncontrolled multiple comorbidities, elevated troponin levels, or arrhythmias were also considered for ICU admission. These criteria were implemented as part of routine clinical practice to ensure standardized admission decisions. This study was approved by the Republic of Turkey Ministry of Health’s COVID-19 Scientific Research Platform (Form Name: -2020-12-18T11_54_07) and received approval from the University Faculty of Medicine Scientific Research Ethics Committee (TUTF-BAEK) under Protocol Code TUTF-BAEK 2020/440, Decision No. 20/06, dated December 7, 2020. All procedures were carried out in accordance with the principles outlined in the Declaration of Helsinki, Good Clinical Practice Guidelines, and TUTF-BAEK Guidelines. Written informed consent was obtained from all patients or their legal proxies prior to their participation in the study. Total DNA Isolation DNA was purified from blood samples using the Thermo Fisher Purelink® Genomic DNA Mini Kit following the manufacturer’s protocol. Briefly, 200 µl of blood lysate was mixed with 20 µl Proteinase K and 200 µl Lysis Buffer, vortexed, and incubated at 56°C for 10 minutes. After adding 200 µl ethanol, the lysate was transferred to spin columns and centrifuged. Washing steps were performed with Wash Buffer I and II, and DNA was eluted with Elution Buffer. DNA quantity and purity were assessed using the NanoDrop™ 2000c spectrophotometer. Bisulfite Conversion Protocol Bisulfite conversion was performed using the Thermo Scientific™ EpiJET™ Bisulfite Conversion Kit. DNA samples (200 ng) were adjusted to 20 µL with water, then 120 µL of Modification Reagent was added. Samples were mixed, centrifuged, and placed in a thermal cycler. Protocol A (98°C for 10 min, 60°C for 150 min) was used for denaturation and conversion. The converted DNA was purified using Binding, Wash, and Desulfonation Buffers, then eluted with Elution Buffer. DNA was quantified using UV absorbance measurements and stored at -20°C for further use. PCR Amplification Amplification of bisulfite-converted DNA was conducted using AmpliTaq Gold™ 360 Master Mix. PCR reactions were prepared with 2 µl of eluted DNA and primers specific for methylated (M) and unmethylated (U) sequences, where F denotes the forward primer and R denotes the reverse primer, as follows: IL-7 M F: TGAGTAGGTGTATGTATAGTAGACGG and R: CAAACTAAATTATTAAAAACGAACGA. IL-7 U F: GAGTAGGTGTATGTATAGTAGATGG and R: CAAACTAAATTATTAAAAACAAACAA. IL-8 M F: AAAATTTTCGTTATATTTCG and R: TCCGATAACTTTTTATATCAT. IL-8 U F: AAATTTTTGTTATATTTTG and R: TCCAATAACTTTTTATATCAT. IL-10 M F: TTTATAGTTGAGGGTTTTTGCG and R: TTTATAGTTGAGGGTTTTTGCG. IL-10 U F: TGAATGAGAATTTATAGTTGAGG and R: TTTCAATTTTTACATCATAAAC. The PCR conditions included an initial denaturation at 95°C for 5 minutes, followed by 10 cycles of 95°C for 1 minute, 58°C for 1.5 minutes, and 72°C for 1 minute, and then 30 cycles of 95°C for 1 minute, 58°C for 1 minute, and 72°C for 1 minute, with a final extension at 72°C for 5 minutes. Gel Electrophoresis PCR products were analysed using agarose gel electrophoresis. A 2% agarose gel was prepared with TBE buffer and stained with Safeview™ Classic dye. DNA samples were mixed with Orange G loading dye, loaded onto the gel, and electrophoresed. Gels were visualized using a UV transilluminator, and band intensities were analysed with GelAnalyzer 19.1 software to calculate methylation percentages. Statistical Analysis Methylation levels were assessed and compared as beta values. The methylation beta value was calculated as β = M / (M + U + 100), where M represents methylated band densities, U represents unmethylated band densities, and 100 is a constant. We filtered out samples where the combined methylated and unmethylated (M+U) band densities were less than 100. This step was necessary because low M+U band densities can introduce significant noise and skew logarithmic calculations. By excluding these samples, we ensured that minor fluctuations didn’t cause large variances, leading to more accurate results. To address the challenges of indeterminate forms caused by zero values in band densities, Laplace smoothing was applied. This approach enabled the calculation of meaningful values within the [0,1] range, enhancing the robustness of the results and the credibility of the study. Given the bounded nature of methylation beta values and their often skewed or bimodal distribution, assumptions of normality and homoscedasticity required for parametric tests were not met; therefore, non-parametric statistical methods were employed. Specifically, the Wilcoxon one-sample median test was employed to assess whether the methylation levels for each interleukin (IL) group differed significantly from 0.5, which represents a baseline indicating no hyper- or hypomethylation. Additionally, the Wilcoxon rank-sum test was used to compare methylation levels between the ICU and ward groups for each IL. To control for effect size, the rank-biserial correlation (r rb ) was calculated, providing a robust evaluation of the strength and direction of the relationship between the groups. Analyses were conducted using the R Statistical language (version 4.4.1; R Core Team, 2024) on Windows 10 x64 (build 19045), using the packages ggrain, janitor, lubridate, Hmisc, ggpubr, report, tibble, FSA, ggstatsplot, table1, dlookr, gtsummary, cardx, ggplot2, forcats, stringr, tidyverse, readxl, dplyr, purrr, readr, tidyr, colorspace, and kableExtra. Statistical significance was accepted at p < 0.05. RESULTS Patient Characteristics A total of 157 patients were initially evaluated, of which 12 patients were excluded due to receiving medications with substantial epigenetic effects, leaving 145 patients included in the final analysis. Among these, 91 patients were treated in the ward, and 54 required Intensive Care Unit (ICU) admission based on clinical criteria (Figure 1). The mean age of ICU patients was significantly higher at 70 (SD = 16) years compared to 58 (SD = 14) years for ward patients (p < 0.001). Sex distribution was comparable between groups, with females comprising 53% in the ward group and 50% in the ICU group (p = 0.7). Hypertension was significantly more prevalent among ICU patients (63% vs. 43% in ward; p = 0.019). Other comorbidities (renal insufficiency, coronary artery disease, and immunosuppressive therapy) were numerically higher in ICU patients but not statistically significant. Malignancy was significantly more common in ICU patients (20% vs. 7.7% in ward; p = 0.025). Finally, the ICU group experienced a markedly higher mortality rate (26% vs. 5.5% in ward; p < 0.001) (Table 1). Cytokine Methylation Overview Methylation levels of IL-7, IL-8, and IL-10 were evaluated using the Wilcoxon signed-rank test, as the Shapiro-Wilk test confirmed non-normal distributions (p < 0.001 for each). IL-7 displayed significant hypermethylation, with a median methylation level of 0.835 (n = 126; p < 0.001) and a very large positive effect size (rrb = 0.99, 95% CI: 0.99–1.00) (Figure 2A). IL-8 methylation showed no significant deviation from 0.5 (median = 0.538, p = 0.986; rrb = –0.002, 95% CI: –0.22 to 0.216) (Figure 2C). Conversely, IL-10 exhibited significant hypomethylation, with a median of 0.243 (p < 0.001) and a large negative effect size (rrb = –0.736, 95% CI: –0.83 to –0.60) (Figure 2E). Comparisons by Clinical Group Comparing methylation between ward and ICU patients revealed a significant difference in IL-7. The ICU group showed higher median IL-7 methylation (0.863) versus the ward group (0.835; p = 0.001) with a moderate negative effect size (rrb = –0.348, 95% CI: –0.516 to –0.154) (Figure 2B). In contrast, IL-8 methylation did not differ significantly between ward (median = 0.556) and ICU patients (0.528; p = 0.373) (Figure 2D), and IL-10 methylation showed no difference between ward (median = 0.224) and ICU patients (0.327; p = 0.37) (Figure 2F). Age, Mortality, Malignancy, and IL-7 Methylation To assess whether the observed IL-7 methylation difference between ICU and ward patients could be attributed to age, mortality, or malignancy, a series of linear regression models were constructed. Two linear regression models were used to explore the association between age and IL-7 methylation. The first model included ICU status and age as independent, additive predictors, assuming that the effect of age on methylation does not depend on ICU status. In this model, ICU patients tended to have higher IL-7 methylation than ward patients (β = 0.051, p = 0.018), while age was not a significant predictor (p = 0.21). The second model included an interaction term between ICU status and age to test whether the effect of age on methylation depends on clinical setting. This interaction was statistically significant (p = 0.042), indicating that the effect of age differed by group: IL-7 methylation increased with age in ward patients but decreased with age in ICU patients. This crossover interaction suggests that the relationship between age and IL-7 methylation is modified by clinical severity. In a separate model evaluating the impact of mortality, ICU status again remained significantly associated with IL-7 hypermethylation (p < 0.001). Mortality was not a significant predictor (p = 0.29), and no significant interaction was observed between ICU status and mortality (p = 0.67). These findings indicate that mortality does not account for the ICU-associated methylation difference. Finally, malignancy—which was more prevalent in ICU patients—was also considered. ICU status remained a significant predictor of IL-7 hypermethylation after adjusting for malignancy (β = 0.063, p = 0.002), while malignancy itself showed no significant association (p = 0.98). An additional model including an interaction term between ICU status and malignancy showed a non-significant trend (p = 0.093), but malignancy alone remained non-significant (p = 0.20). Taken together, these models consistently show that the elevated IL-7 methylation observed in ICU patients is not explained by age, mortality, or malignancy. Instead, it appears to reflect disease severity–related epigenetic modulation specific to critical illness. DISCUSSION Our study’s descriptive statistics offer valuable insights into patient characteristics. ICU patients were significantly older than those treated in the ward, with a mean age of 70 years compared to 58 years (p < 0.001). This age difference underscores the higher vulnerability of older patients to severe COVID-19, aligning with existing literature that identifies age as a critical risk factor for severe outcomes (32). Additionally, while the distribution of sex was comparable between the ward and ICU groups, the presence of certain comorbidities, particularly hypertension and malignancy, was significantly higher among ICU patients. This finding emphasizes the role of comorbid conditions in exacerbating the severity of COVID-19 and highlights the need for close monitoring of such patients. Furthermore, the stark difference in mortality rates between the ICU and ward groups (26% vs. 5.5%) underscores the critical impact of disease severity on patient outcomes. These descriptive statistics provide a foundational context for understanding the subsequent findings on cytokine methylation and their potential implications for disease progression and patient management. Hypermethylation of IL-7 was observed in our patients, and those requiring ICU care showed particularly high methylation levels. IL-7 hypermethylation leads to gene silencing and reduces cytokine production. Reduced IL-7 production may worsen patient outcomes, possibly necessitating ICU admission. IL-7 is under investigation as an immunotherapy for infectious diseases. Clinical trials are exploring its potential to restore T-cell counts, improve immune function in COVID-19 patients, and enhance viral defense (14). Some reports have shown that serum IL-7 levels are significantly higher in severe COVID-19 cases compared to moderate ones (33) and that IL-7 levels in ICU patients are significantly elevated (1). Although IL-7 methylation levels and patient age both differed significantly between ICU and ward groups, our regression analyses demonstrate that age does not account for the observed methylation difference. ICU status remained a significant predictor of IL-7 hypermethylation even after adjusting for age, and age alone was not independently associated with methylation levels. Moreover, a significant interaction between ICU status and age revealed a group-specific pattern: while older age was linked to higher IL-7 methylation in ward patients, the opposite trend was seen in ICU patients. This crossover effect suggests that age influences IL-7 methylation differently depending on clinical severity, supporting the idea of distinct epigenetic responses in critically ill individuals. Similarly, neither mortality nor malignancy—despite being more frequent in ICU patients—explained the methylation differences. ICU status retained its strong association with IL-7 hypermethylation after accounting for each variable, and no significant interactions were found. Collectively, these findings indicate that the increased IL-7 methylation in ICU patients is not confounded by age, mortality, or malignancy, and instead likely reflects epigenetic modulation linked directly to the biological processes underlying severe COVID-19. The difference in IL-7 methylation between ICU and ward groups was not mediated by mortality, as death was not a significant predictor and showed no interaction with ICU status. This suggests that the ICU-related increase in methylation is independent of survival outcome. In contrast to IL-7, our analysis revealed no significant difference in IL-8 methylation levels, with a median value of 0.54, indicating a balanced methylation status. This suggests that IL-8 expression may not be directly influenced by methylation changes in the context of COVID-19. Clinically, IL-8 is recognized for its role in recruiting neutrophils to infection sites, which is crucial in the early immune response but can also contribute to excessive inflammation and lung damage in severe cases. Despite the balanced methylation status, serum IL-8 levels have been reported to be elevated in severe cases, potentially due to regulatory mechanisms independent of methylation. For instance, IL-8 levels were higher in non-severe cases compared to severe cases (34). Additionally, several inflammatory cytokines were elevated in severe cases compared to non-severe cases, with IL-8 and IL-10 showing notable differences (11). However, serum IL-8 concentrations in severe cases were lower than in moderate cases, though the difference was not statistically significant (33). The absence of significant methylation differences between ICU and ward patients further supports the notion that IL-8’s contribution to disease severity is likely due to post-transcriptional regulation or other immune modulators rather than epigenetic changes. Our study demonstrated significant hypomethylation of IL-10, with a median methylation level of 0.24, particularly among ICU patients. Hypomethylation is typically associated with increased gene expression, which aligns with the elevated IL-10 serum levels observed in severe COVID-19 cases. For instance, serum concentrations of IL-10 were reported to be higher in non-severe cases compared to severe cases (34). IL-10 is an anti-inflammatory cytokine that plays a dual role in modulating immune responses by limiting excessive inflammation to prevent tissue damage. However, in the context of COVID-19, increased IL-10 levels due to hypomethylation may contribute to an overly immunosuppressive environment, potentially allowing the virus to persist and leading to worse outcomes in critically ill patients. This immunosuppressive state may also help explain the persistence of symptoms observed in ”long COVID” patients, where chronic inflammation and immune dysregulation are common features (17). This study has several limitations. First, the sample size, although sufficient for statistical analysis, may not fully capture the variability in DNA methylation patterns across diverse populations. Larger, multi-center studies are needed to validate these findings. Second, while DNA methylation was assessed in peripheral blood samples, methylation patterns may differ in lung tissues or other immune-related compartments, potentially limiting direct conclusions on local inflammatory responses. Third, this study focused only on IL-7, IL-8, and IL-10 methylation, and other cytokine-related epigenetic modifications were not analyzed, which may provide additional insights into immune dysregulation. Additionally, factors such as genetic background, prior infections, and environmental influences were not accounted for, which could impact methylation status. Finally, while we excluded patients receiving medications with known epigenetic effects, other unmeasured factors may still contribute to methylation variability. Future studies incorporating longitudinal sampling and functional assays are necessary to further elucidate the role of epigenetic modifications in immune responses during viral epidemics. CONCLUSION This study demonstrates significant differences in cytokine methylation profiles between patients with varying disease severity during viral epidemics. IL-7 hypermethylation, particularly in ICU patients, suggests reduced immune function, while IL-10 hypomethylation may contribute to excessive immune suppression. These epigenetic modifications may play a crucial role in disease progression, influencing immune regulation and patient outcomes. Given the increased prevalence of older age, hypertension, and malignancy among ICU patients, targeted approaches integrating both epigenetic and clinical risk factors could improve disease management. Future research should explore the functional impact of these modifications and assess their potential as biomarkers for risk stratification and personalized treatment strategies in viral epidemic settings. TABLES AND FIGURES Table 1: Baseline Characteristics of Patients by ICU Admission Status Age 58 (14) 70 (16) <0.001 Sex 0.7 Female 48 (53%) 27 (50%) Male 43 (47%) 27 (50%) Hypertension 39 (43%) 34 (63%) 0.019 Diabetes Mellitus 29 (32%) 12 (22%) 0.2 Renal Insufficiency 6 (6.7%) 8 (15%) 0.11 Coronary Artery Disease 17 (19%) 15 (28%) 0.2 Immunosuppressive Therapy 10 (11%) 7 (13%) 0.7 Malignancy 7 (7.7%) 11 (20%) 0.025 Mortality 5 (5.5%) 14 (26%) <0.001 1 Mean (SD); n (%) 2 Wilcoxon rank sum test; Pearson’s Chi-squared test Figure 1: CONSORT flow diagram. Of 157 patients assessed, 12 were excluded. The final cohort (n = 145) included 91 ward-treated and 54 ICU-admitted patients. Figure 2: Comparison of Beta Values for IL-7, IL-8, and IL-10 Between Ward and ICU Patients Panels (A), (C), and (E) show histograms of beta values for IL-7, IL-8, and IL-10, respectively. The red dashed lines represent the median values, and the blue dashed lines indicate a reference threshold. Panels (B), (D), and (F) display violin plots comparing beta values between patients in the ward and ICU groups for IL-7, IL-8, and IL-10, respectively. Statistical results from the Wilcoxon rank-sum test (W) and the rank-biserial correlation (r) are provided in each plot. The red horizontal dashed lines in the violin plots indicate the overall median beta value for each cytokine. Ethics approval and consent to participate This study was approved by the Republic of Turkey Ministry of Health’s COVID-19 Scientific Research Platform (Form Name: -2020-12-18T11_54_07) and received approval from the University Faculty of Medicine Scientific Research Ethics Committee (TUTF-BAEK) under Protocol Code TUTF-BAEK 2020/440, Decision No. 20/06, dated December 7, 2020. All procedures were carried out in accordance with the principles outlined in the Declaration of Helsinki, Good Clinical Practice Guidelines, and TUTF-BAEK Guidelines. Written informed consent was obtained from all patients or their legal proxies prior to their participation in the study. Availability of data and materials Data and analysis scripts are available from the corresponding author upon reasonable request. Patient and public involvement No patients were involved in the design of this study. Competing interests None to declare. Funding The conduction of this study was supported by Trakya University Scientific Research Projects Unit -Turkey (Grant Number: 2022/106) Authors’ contributions Study design: ZY, AT. Data collection: ZY, MY, ET, HTEM, AT. Laboratory: MY, AT. Writing of the manuscript: all authors. Statistical Analysis: AT. Tables and figures: AT. Supervision, resources, and funding: ZY GS, AT. Acknowledgements This study was financially supported by the Trakya University Scientific Research Projects Unit, Turkey (TÜBAP 2022/106). Alp Temiz was supported by the YÖK (The Council of Higher Education, CoHE) 100/2000 PhD Scholarship Program from September 14, 2020, to February 15, 2023. We sincerely thank all our participants for their valuable contributions to this study. REFERENCES 1. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497-506.2. Wang H, Paulson KR, Pease SA, Watson S, Comfort H, Zheng P, et al. Estimating excess mortality due to the COVID-19 pandemic: a systematic analysis of COVID-19-related mortality, 2020–21. The Lancet. 2022;399(10334):1513-36.3. Liu Y, Yang Y, Zhang C, Huang F, Wang F, Yuan J, et al. Clinical and biochemical indexes from 2019-nCoV infected patients linked to viral loads and lung injury. Sci China Life Sci. 2020;63(3):364-74.4. Bean J, Kuri-Cervantes L, Pennella M, Betts MR, Meyer NJ, Hassan WM. Multivariate indicators of disease severity in COVID-19. Scientific Reports. 2023;13(1):5145.5. Li Q, Wang Y, Sun Q, Knopf J, Herrmann M, Lin L, et al. Immune response in COVID-19: what is next? Cell Death & Differentiation. 2022;29(6):1107-22.6. Tang Y, Liu J, Zhang D, Xu Z, Ji J, Wen C. Cytokine Storm in COVID-19: The Current Evidence and Treatment Strategies. Front Immunol. 2020;11:1708.7. Chlamydas S, Papavassiliou AG, Piperi C. Epigenetic mechanisms regulating COVID-19 infection. Epigenetics. 2021;16(3):263-70.8. Shirvaliloo M. Epigenomics in COVID-19; the link between DNA methylation, histone modifications and SARS-CoV-2 infection. Epigenomics. 2021;13(10):745-50.9. Ivashkiv LB, Donlin LT. Regulation of type I interferon responses. Nat Rev Immunol. 2014;14(1):36-49.10. Li G, Fan Y, Lai Y, Han T, Li Z, Zhou P, et al. Coronavirus infections and immune responses. J Med Virol. 2020;92(4):424-32.11. Qin C, Zhou L, Hu Z, Zhang S, Yang S, Tao Y, et al. Dysregulation of Immune Response in Patients With Coronavirus 2019 (COVID-19) in Wuhan, China. Clin Infect Dis. 2020;71(15):762-8.12. Mackall CL, Fry TJ, Gress RE. Harnessing the biology of IL-7 for therapeutic application. Nature Reviews Immunology. 2011;11(5):330-42.13. Barata JT, Durum SK, Seddon B. Flip the coin: IL-7 and IL-7R in health and disease. Nature Immunology. 2019;20(12):1584-93.14. Park JH, Lee SW, Choi D, Lee C, Sung YC. Harnessing the Power of IL-7 to Boost T Cell Immunity in Experimental and Clinical Immunotherapies. Immune Netw. 2024;24(1):e9.15. Cesta MC, Zippoli M, Marsiglia C, Gavioli EM, Mantelli F, Allegretti M, et al. The Role of Interleukin-8 in Lung Inflammation and Injury: Implications for the Management of COVID-19 and Hyperinflammatory Acute Respiratory Distress Syndrome. Front Pharmacol. 2021;12:808797.16. Bendib I, Beldi-Ferchiou A, Schlemmer F, Surenaud M, Maitre B, Plonquet A, et al. Alveolar compartmentalization of inflammatory and immune cell biomarkers in pneumonia-related ARDS. Critical Care. 2021;25(1):23.17. Carlini V, Noonan DM, Abdalalem E, Goletti D, Sansone C, Calabrone L, et al. The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Frontiers in Immunology. 2023;14.18. Fitz-James MH, Cavalli G. Molecular mechanisms of transgenerational epigenetic inheritance. Nature Reviews Genetics. 2022;23(6):325-41.19. Kumari P, Khan S, Wani IA, Gupta R, Verma S, Alam P, et al. Unravelling the Role of Epigenetic Modifications in Development and Reproduction of Angiosperms: A Critical Appraisal. Front Genet. 2022;13:819941.20. Lim W-J, Kim KH, Kim J-Y, Jeong S, Kim N. Identification of DNA-Methylated CpG Islands Associated With Gene Silencing in the Adult Body Tissues of the Ogye Chicken Using RNA-Seq and Reduced Representation Bisulfite Sequencing. Frontiers in Genetics. 2019;10.21. Dhar GA, Saha S, Mitra P, Nag Chaudhuri R. DNA methylation and regulation of gene expression: Guardian of our health. The Nucleus. 2021;64(3):259-70.22. Abbas AK, Lichtman AH, Pillai S, Baker DL, Baker A. Cellular and molecular immunology. Ninth edition. ed. Philadelphia, PA: Elsevier; 2018. x, 565 pages p.23. Neufeldt CJ, Cerikan B, Cortese M, Frankish J, Lee J-Y, Plociennikowska A, et al. SARS-CoV-2 infection induces a pro-inflammatory cytokine response through cGAS-STING and NF-κB. Communications Biology. 2022;5(1):45.24. Alas S, Emmanouilides C, Bonavida B. Inhibition of interleukin 10 by rituximab results in down-regulation of bcl-2 and sensitization of B-cell non-Hodgkin’s lymphoma to apoptosis. Clin Cancer Res. 2001;7(3):709-23.25. Tomita A. Genetic and Epigenetic Modulation of CD20 Expression in B-Cell Malignancies: Molecular Mechanisms and Significance to Rituximab Resistance. Journal of Clinical and Experimental Hematopathology. 2016;56(2):89-99.26. Bergström B, Carlsten H, Ekwall A-KH. Methotrexate inhibits effects of platelet-derived growth factor and interleukin-1β on rheumatoid arthritis fibroblast-like synoviocytes. Arthritis Research & Therapy. 2018;20(1).27. Matar P, Rozados V, Gervasoni S, Scharovsky G. Th2/Th1 switch induced by a single low dose of cyclophosphamide in a rat metastatic lymphoma model. Cancer Immunology, Immunotherapy. 2001;50:588-96.28. Granau A, Andersen P, Jakobsen T, Kristensen S, Mogensen B, Guldbergsen DC, et al. P1259: CHARACTERIZATION OF VENETOCLAX RESISTANCE IN CELL MODELS OF MANTLE CELL LYMPHOMA. HemaSphere. 2022;6.29. Dasari S, Tchounwou P. Cisplatin in cancer therapy: molecular mechanisms of action. European journal of pharmacology. 2014;740:364-78.30. Escoubet-Lozach L, Lin I-L, Jensen-Pergakes K, Brady HA, Gandhi AK, Schafer PH, et al. Pomalidomide and Lenalidomide Induce p21WAF-1 Expression in Both Lymphoma and Multiple Myeloma through a LSD1-Mediated Epigenetic Mechanism. Cancer Research. 2009;69(18):7347-56.31. Tamura K, Shimizu C, Hojo T, Akashi-Tanaka S, Kinoshita T, Yonemori K, et al. FcγR2A and 3A polymorphisms predict clinical outcome of trastuzumab in both neoadjuvant and metastatic settings in patients with HER2-positive breast cancer. Ann Oncol. 2011;22(6):1302-7.32. Pijls BG, Jolani S, Atherley A, Derckx RT, Dijkstra JIR, Franssen GHL, et al. Demographic risk factors for COVID-19 infection, severity, ICU admission and death: a meta-analysis of 59 studies. BMJ Open. 2021;11(1):e044640.33. Wang G-L, Gao H-X, Wang Y-L, Wei X, Liu Y-Z, Lu J-H, et al. Serum IP-10 and IL-7 levels are associated with disease severity of coronavirus disease 2019. Cytokine. 2021;142:155500.34. Merza MY, Hwaiz RA, Hamad BK, Mohammad KA, Hama HA, Karim AY. Analysis of cytokines in SARS-CoV-2 or COVID-19 patients in Erbil city, Kurdistan Region of Iraq. PLoS One. 2021;16(4):e0250330. Information & Authors Information Version history V1 Version 1 08 July 2025 Peer review timeline Published Journal of Immunology Research Version of Record 8 Jan 2026 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords coronavirus cytokines disease control epidemiology genetics immune responses pandemics pathogenesis respiratory tract virus classification Authors Affiliations Zerrin Yulugkural [email protected] Trakya Universitesi Tip Fakultesi View all articles by this author Metrics & Citations Metrics Article Usage 299 views 155 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Zerrin Yulugkural. Epigenetic Modulation of IL-7 and IL-10: Toward Personalized Immune Therapies in Viral Epidemics. Authorea . 08 July 2025. DOI: https://doi.org/10.22541/au.175197084.49874772/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.175197084.49874772/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9feab82ffc931640',t:'MTc3OTI3MzU4Nw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00