Shift in SAR to ISR during the Rice- R. Solani interaction mediated by Streptomyces hyderabadensis confers sheath blight resistance in susceptible genotype | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Shift in SAR to ISR during the Rice- R. Solani interaction mediated by Streptomyces hyderabadensis confers sheath blight resistance in susceptible genotype Arun Y P, Krishnaraj P U, Prashanthi S K, D N Kambrekar, Basavaraj Bagewadi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2421512/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Rice sheath blight disease is caused by the necrotrophic pathogen Rhizoctonia solani Kuhn (teleomorph; Thanatephorus cucumeris ). Several studies have reported the disease suppression mechanisms in resistant varieties based on innate and systemic acquired resistance (SAR) mechanisms. The resistant varieties turn susceptible due to the intelligence of pathogen strains to mimic plant defense signaling mechanisms. An alternative and ecofriendly approach to tackle the negative effects of plant-pathogen interaction is the application of bio-control agents. Actinobacteria is known for production of secondary metabolites under stress that initiates pre-signaling to enable induced immunity at early plant stages to tackle the pathogen attack during the later stages of plant development. The current study is focused on understanding of mechanisms that provide resistance to rice plants against R. solani in presence of actinobacteria, Streptomyces hyderabadensis , based on biochemical and mRNA/transcript level analysis. The sheath blight incidence was significantly reduced and the disease score was maintained at 1 (lesion height less than 10%) compared to pathogen control. Biochemical analysis revealed that the actinobacterial inoculation enhanced the levels of phenyl ammonia lyase, phenol, polyphenol oxidases, catalases and peroxidases during the tripartite interaction that provided initial resistance and protection from ROS generated during pathogen infection through detoxification process. During the interaction, higher expression of chitinase gene, improvement in chlorophyll content by the expression of chlorophyll a-b binding protein, maintenance of plant overall development by maintaining the balance of melatonin production, lower expression of SAR supportive genes (PAL, ICS, GST) at the later intervals, expression of signaling proteins (14-3-3 like protein GF14-E) to activate the defense related proteins and the proteins that supports the SAR to ISR shift (NPR1) in presence of S. hyderabadensis under pathogen pressure of R. solani . Induced systemic resistance (ISR) Systemic acquired resistance (SAR) Signaling mechanisms Plant-Pathogen interaction Actinobacteria Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Rice ( Oryza sativa L.), an important cereal crop and provides stable food supply for the majority of world population (Zhang et al. 2017 ; Samal et al. 2022 ). The biotic and abiotic stresses in rice are the major constraints for yield reduction in rice (Sinha et al. 2018 ). The productivity of rice is affected by several plant pathogens among which, sheath blight pathogen Rhizoctonia solani causes yield loss up to 50 per cent (Molla et al. 2020 ). Sheath blight of rice is the soil-borne disease caused by necrotrophic fungi Rhizoctonia solani Kühn which belongs to the division Basidiomycota (Lee et al. 2021 ). The flexible adaptation of pathogen, lack of resistant varieties due to failure in identifying the single resistance genes corresponds to successive pathogen attack and susceptibility of rice to sheath blight disease (Singh et al. 2019 ). Understanding the ability of plants to develop acquired immunity after pathogen infection and the knowledge about plant immune signaling at molecular level are the challenging tasks during plant pathogen interaction (Klessig et al. 2018 ). In contrast to innate immunity, the concept of induced defense adopted by plants acts as a protective barrier during major stress situations (biotic /abiotic) (Jiang et al. 2016). The systemic acquired resistance (SAR) and induced systemic resistance (ISR) are the major induced defense mechanisms adopted by plants. SAR pathway activates prior to pathogen infection and ISR pathway activates during plant interaction with non-pathogenic rhizobacteria (Panpatte et al. 2020 ). The SAR mechanism is regulated by salicylic acid (SA) pathway and activated during the attack of biotrophic pathogen and the ISR mechanism is regulated by ethylene and jasmonic acid (ET/JA) production pathway and activated during the attack of necrotrophic pathogens in plants. The induced production of salicylic acid and jasmonic acid at relative concentrations can be adapted to reversible shift from SAR to ISR to tailor plant resistance during biotic stresses (Mur et al. 2006 ). The SA and JA mediated defense responses are mutually antagonistic mechanisms and the relative shift from SAR to ISR in plants during the infection of necrotrophic pathogens confers resistance in plants orchestrated by major plant hormones such as abscisic acid, gibberellic acid and brassinosteroids (Li et al. 2019 ). The introduction of biological control agents (BCAs) alters the interaction among plants, pathogens and environments, leading to biological and physical cascades that influence pathogen fitness, plant health and ecological function (He et al. 2021 ). The potential effects of microbes towards enhancing yield level and antagonism towards pests and disease causing microorganisms are being adopted in the new trend of research (Rehman et al. 2018 ). Bio-control agents are the main tool in the present scenario to combat the biotic stress in rice caused by phytopathogens (Firdaus et al. 2020 ). A plethora of bio-control agents such as Bacillus , Pseudomonas and Streptomyces have been potentially characterized based on in vitro experiments and field trials (Prasad et al. 2019 ). Actinobacteria are Gram-positive, morphologically and physiologically very diverse bacteria with a high GC content in their DNA (Undabarrena et al. 2016). Actinobacteria affects plant growth directly through antagonism towards soil-plant pathogens by competitive colonization or biosynthesis of antibiotics and indirectly by nitrogen fixation, siderophore synthesis, phytohormone synthesis and solubilization of minerals to make them available for plant uptake and use (Barka et al. 2016 ). The genus Streptomyces is largest among actinobacteria, predominantly found in soil and various habitats such as marine/mangrove environments and plants (Law et al. 2019 ). Various studies reported the inhibition of sheath blight pathogen Rhizoctonia solani by bio-control agents belonging to Streptomyces spp, Talaromyces spp, Trichoderma harzianum and Bacillus subtilis highlighting the potential nature of secondary metabolite production during pathogen inhibition under in vitro and greenhouse conditions (Suryawanshi et al. 2020 , Abbas et al. 2021 , Rashid et al. 2020 ). The actinobacterial inoculation induces systemic resistance in plants under pathogen stress and facilitates the activation of various stress hormones and detoxification enzymes to maintain the cell redox potential and stabilizes the plant metabolism under biotic stresses (Hata et al. 2021 ; Taha et al. 2021 ). The qRT-PCR analysis is a widely used technique for the analysis of gene expression. Accurate estimation of transcript abundance relies strongly on a normalization that requires the use of reference genes that are stably expressed in the conditions analyzed (Pombo et al. 2019 ). As a complement to RNA-seq, qRT-PCR allows researchers to investigate transcriptional changes between experimental conditions in a more focused manner. It is used routinely to monitor gene expressions in-vitro (Smith et al. 2018 ). The current study hence was focused to understand molecular and biochemical basis of efficient actinobacteria mediated rice defense mechanisms against Rhizoctonia solani infection based on qRT-PCR analysis. Materials And Methods In vitro screening of actinomycetes for antagonistic activity against selected plant pathogens The isolated actinobacterial isolates maintained at Microbial Genetics Lab, Department of Agricultural Microbiology, University of Agricultural Sciences, Dharwad, were screened against Rhizoctonia solani RS4 strain collected from Department of Plant Pathology, UAS Dharwad and confirmed by molecular characterization (MK213724). The antagonistic activity was detected by dual culture test as described by Suryawanshi et al. ( 2020 ). The actinobacterial isolates were streaked in the middle of a plate containing L-Arginine medium. After 4 days of incubation the agar plugs of pathogen grown on PDA plate were placed at the corners of the petriplate and the observation for antagonistic activity were taken after 5 days after incubation at 28 ± 2°C. Molecular Identification Of Potent Actinobacteria The efficient isolate selected based on the dual culture technique was subjected to molecular identification through amplicon sequencing after amplification of 16S rRNA gene using universal primers (27F and 1492R) (Pralhad et al. 2020 ). The amplified PCR products were sent for amplicon sequencing at Eurofins scientific India Pvt. limited. The obtained nucleotide sequences (forward and reverse) were subjected to contig generation using Bioedit software ( https://bioedit.software.informer.com/7.2/ ). The generated contig sequences were subjected to BLAST analysis using NCBI database ( https://blast.ncbi.nlm.nih.gov/Blast ). Greenhouse Experiments The potent actinobacterial isolate selected based on dual culture technique was screened for control of R. solani in infected plants of susceptible rice variety BPT5204 as per the protocol followed by Suryawanshi et al. ( 2020 ), with four treatments (C-Healthy control, A- Streptomyces hyderabadensis , P- Rhizoctonia solani and AP- Rhizoctonia solani + Streptomyces hyderabadensis ) and 10 replications. The selected efficient actinobacterial isolate was applied as seed treatment to paddy seeds. Twenty five grams of seeds were soaked in the suspension culture of actinobacteria grown in Starch Casein Broth (SCB) with concentration of 10 8 CFU/ml and subjected to shaking in a magnetic stirrer for half an hour and dried in a laminar air flow for overnight. The dry seeds were taken forward for sowing. Ten days before sowing, 5ml of 10 8 CFU/ml per 5kg of soil were added to the treatments (A and AP) (Mawang et al. 2020). The paddy seeds were sown in a pot randomly for the seeds to germinate in a wet soil. Then 15 days old seedlings were transplanted to plastic pots of 6 x 6 inch filled with autoclaved and wet soil and compost mixture in 2:1 and used for further experimentation. Inoculation of Rhizoctonia solani (Colonized typha bit inoculation method) The typha ( Typha angustata L.) bit method of inoculation was performed according to Bhaktavatsalam et al. ( 1978 ) with slight modifications. For this, typha shoots were collected and cut into 4.0–5.0 cm bits with the help of sterilized knife. The bits were washed, soaked in distilled water for two hours and dried using tissue paper. The dried typha bits were transferred to a new conical flask and autoclaved twice for two consecutive days. Later, the typha bits were inoculated with three days old actively growing culture of RS4 using cork borer and inoculation loop in sterile condition. The inoculated typha bits were incubated at 28 ± 2°C for 12–15 days or till the time the typha bits were completely covered with fungal mat and sclerotia was formed over it. The fifteen days old typha bits with mycelium and sclerotia were placed between the tillers in both the treatments (P) pathogen inoculated and (AP) pathogen and actinobacterial inoculation for sheath blight disease inoculation. After 30 days of transplantation, the treatments (P and AP) were infected with R. solani by typha bit inoculation method and the sheath samples from all the four treatments were collected for biochemical and qRT-PCR analysis at the interval of 15, 20 and 25 days after pathogen inoculation. The disease reaction was expressed as Relative Lesion height (RLH) = Lesion length (cm)/Plant height (cm) (Sharma et al., 1990 ). The percentage was then used with the scoring table (Supplementary table 1) to determine R. solani effect on rice (Jia et al., 2013 ). The disease reaction of BPT-5204 against Rhizoctonia solani infection was measured in terms of relative lesion height percentage (RLH %) at 15, 20 and 25 days post inoculation (dpi). RLH % was calculated using the following formula according to 0–9 grade scale of Standard Evaluation System (SES) (IRRI, 2002). Biochemical analysis Sheath samples of four treatments were collected from rice plants at different sampling intervals (15, 20 and 25 days) the collected samples were subjected to biochemical analysis based on standard protocols mentioned: peroxidase (Hartee 1955 ), polyphenol oxidase (Mayer et al. 1965 ), phenylalanine ammonia lyase (Ross and Sederoff 1992), catalase activity (Miller, 1959 ) and phenol content (Sadasivan and Manikam 1996). Real Time‑pcr Assays The harvested sheath samples of rice were taken forward for qRT-PCR analysis. Genes involved in plant-pathogen interaction, signal transduction, salicylic acid and jasmonic acid pathways were selected (Table 1 ). Table 1 Primers for qRT-PCR analysis to study the genes expressed during the rice- R. solani interaction in presence and absence of actinobacteria. F- Forward primer, R-Reverse primer Genes Description Primer Sequences Reference House keeping OsEF-1 Oryza sativa elongation factor-1 F-AGTCACATGCTGCCTAAGGTT R-TCACTGCCAGCTTACGGAGG Blanvillain Baufume et al. 2017 Detoxification GST2 Probable glutathione S-transferase F-GGCGACCTCAAGGAGTCAGCA R-CATCATCGGACGGATTAGGCACT Zhang et al. 2015 Photosynthesis related protein CBP Chlorophyll a-b binding protein 2 F-CGTCTCTGCAGGAGAGTGTG R-ACTCGTACATCCATCCACGC Sekhar et al. 2019 Plant growth and development ASMT2-RT Acetylserotonin-O-methyltransferase F-ACTGTGCTGGATCTGCCTCAT R-ACAACATCGGCTGCTGGAAT Hong et al. 2018 Systemic acquired resistance (SAR) 14-3-3 14-3-3 like protein GF14-E F-GCCGCAGCCACTGAGAAAAAC R-TCATACCTCTCGGCCTGCTCT Mirzaei et al. 2012 CHI8 Chitinase 8 F-GTGGAACGAGGGGTAGTTCTG R-TGGTAGTTCGATTGCCCTGTC Richa et al. 2017 ICS Iso-chorismate synthase F-TGTCCCCACAAAGGCATCCTGG R- GGCCCTCAACCTTTAAACATGCC Kyndt et al. 2012 PAL Phenyl ammonia lyase F-CCCTGCCAATCTGCTGAACTA R-GCCGCTATGCAACGAAGAAT Chandler et al. 2015 Induced systemic resistance (ISR) OsNPR1 Ankyrin repeat containing protein NPR1 F-CACGCCTAAGCCTCGGATTA R-TCAGTGAGCAGCATCCTGACT Yuan et al. 2007 The rice sheath samples up to the maximum lesion height were collected on 15, 20 and 25 days after pathogen inoculation and subjected to RNA isolation. RNA isolation was performed using TRIzol reagent (Invitrogen, USA) by following the protocol given by the manufacturer. The genomic DNA contamination was removed Invitrogen TURBO DNA-free Kit was used to remove genomic DNA from the isolated RNA as per the manufacturer’s protocol. Applied Biosystem’s High-Capacity cDNA Reverse Transcription Kit was used for single-stranded cDNA synthesis as per the manufacturer’s protocol. TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus) was used to perform the quantitative real-time PCR (Quant Studio 5, applied biosystems, USA) to analyze the gene expressions of target genes across the treatment samples. A 10 µL reaction mixture consisting of 5 µL TB Green Premix Ex Taq (Tli RNaseH Plus) (2X), 0.2 µL ROX Reference Dye (50X), 3 µL nuclease-free water, 0.5 µL each forward and reverse primers, and 1 µL cDNA (30ng concentration, previously determined through standard PCR), was prepared and loaded into the wells of an optical plate. The thermal cycling conditions used according to the instrument cycling parameters followed by Prashantha et al. ( 2021 ). Annealing temperatures of the specific primers were standardized by gradient PCR (Nexus gradient mastercycler, Eppendorf, Germany). The qRT-PCR was performed in triplicates on the real time-PCR instrument. The differential expression of the replicated count data obtained for the healthy control was further used for clustering the replicated count data and relative fold change expression values. The analysis of CT values obtained from the qRT-PCR were normalized and analyzed with minor modifications as per Zhang et al. 2013 . The difference between the threshold cycle (Ct) values of the gene of interest (GOI) and the housekeeping gene (that acts as the internal reference or normalizing gene) (norm) was calculated (ΔCt value) for the respective templates to normalize the expression values of a targeted gene under study. The ΔΔCt values for target transcripts of treatment samples was calculated for finding their relative expression levels compared to the control Finally, the fold change expression data were obtained using the formula 2 −ΔΔCt . The error bars indicates the standard deviation calculated from three technical replicates on each of two independent biological replications among four treatments (Prashantha et al. 2021 ). Statistical analysis The bar graphs were constructed using Anaconda Package 3 Python 3.9.12. (Anon 2020 ). The principal component plots and correlation heatmaps were constructed using Clustvis software version 2.0 (Metsalu et al. 2015) with default parameters. Results In vitro screening and identification of efficient actinobacterial isolate and confirmation of pathogen virulence The present investigation was conducted to identify the efficient actinobacterial isolate against R. solani under in vitro and greenhouse conditions based on biochemical and gene expression analysis. Based on dual culture technique, three isolates showed unique character in inhibition of pathogen (Fig. 1 (ABCD)). Based on the repeated experiments and phenotypic observations the isolate DBT 64 found successful in imposing stress on pathogen growth and affecting sclerotia formation in plate (Fig. 1 (P and Q)). The isolate DBT 64 was subjected to 16S rRNA sequencing after amplification using universal primers. The obtained contigs of respective isolates were taken forward for BLAST analysis with blastn algorithm in NCBI database and submitted to NCBI database. The results found that the isolate DBT64 was found to be 99% similar to Streptomyces hyderabadensis (ON573299). The initial confirmation of pathogen and its virulent nature (Koch’s postulates) to affect the rice plants to provide exact symptoms was studied prior to greenhouse experiments. The steps in pathogen infection and disease development were shown in the Fig. 2 . The sheath blight symptoms were observed after 16–21 days post inoculation of pathogen through typha bit inoculation method. Effect Of Actinobacterial Inoculation On Rice Growth And Disease Resistance The observations with respect to growth parameters and disease incidence among all the four treatments were recorded at 15, 20 and 25 days after pathogen inoculation (Fig. 3 ). The growth parameters such as shoot length and number of tillers between three intervals were recorded (Fig. 4 ). The shoot length showed significant difference between four treatments. The comparison between P and AP treatments showed that shoot length is compromised significantly in pathogen inoculated rice plants (P) and the growth promotion in actinobacteria and pathogen inoculated (AP) were in accordance to the growth of healthy control rice plants (C) (Fig. 4 A). The number of tillers produced was constant between the day’s intervals (15, 20 and 25) but differed between the treatments. The average tillers produced in healthy control (C) at three intervals (4–5), actinobacteria inoculated (A) (5–6), pathogen control (P) (2–3) and actinobacteria-pathogen inoculated (AP) (4–5) (Fig. 4 B). The contribution of actinobacterial inoculation towards disease incidence was assessed through lesion length formed in two treatments (P and AP). The disease scale was assessed based on lesion length in percentage. The percentage disease incidence at 15, 20 and 25 days in case of pathogen (P) infected rice plants were more than 10% and less than 30%, the disease score was 3 at all the intervals. The percentage disease incidence in case of actinobacteria-pathogen inoculated rice plants were less than 10% hence, disease score was found to be 1 in case of all the intervals of sampling (Fig. 4 C and 4 D). Biochemical Analysis To study the effect of stress molecules in plants that participate and tend to show differential expression during plant stress to maintain cellular homeostasis, the biochemical analysis of five major stress enzymes/compounds such as phenol content, peroxidases, polyphenol oxidases, phenyl ammonia lyases and catalases were studied in different treatments (C, A, P and AP) and at different intervals (15, 20 and 25 dpi). Sheath samples were used to estimate the level of these enzymes produced at different intervals. The principal component analysis of activity of biochemical enzymes at different intervals between the treatments in actinobacteria + pathogen treated samples (AP) compared to pathogen control (P) (Fig. 5 A). The phenyl ammonia lyase activity, peroxidase, phenol content, polyphenol oxidases and catalases activity was significantly increased in case of actinobacteria + pathogen inoculated samples. The activity of PPO was enhanced in healthy control samples, the actinobacteria treatment (A) enhanced the levels of all the biochemical enzymes and phenol contents compared to healthy control (C). The bar graphs representing the levels of biochemical activity between the treatments at different sampling intervals were shown in Fig. 6 . The correlation analysis of biochemical enzymes based on the level of production of biochemical compounds at different intervals and between the treatments showed that the actinobacterial inoculation may facilitate the rice plants to increase its biochemical activity during the pathogen attack that probably contributed to the disease resistance (Fig. 8 A). Qrt-pcr Analysis Based on growth parameters and biochemical analysis, genes related to photosynthesis, detoxification/response to stress, SAR and ISR were selected in rice based on previous studies. The expression fold of genes was calculated against the healthy control (C) after normalizing the CT values with housekeeping gene. The principal component analysis of differential gene expression based on fold change showed significant differences between the treatments (Fig. 5 B). The results of qRT-PCR were shown in the Fig. 7 . The expression of chlorophyll a-b binding protein gene was increased at 15 and 25 days post inoculation due to actinobacterial inoculation. The comparison between pathogen (P) and actinobacteria and pathogen inoculated (AP) the expression was on par at 15 and 20 days but at the later stages the expression increased in actinobacteria-pathogen infected samples compared to pathogen control (3.2 and 3.5 fold) in P and AP treatments respectively. The expression of glutathione-s-transferase gene was found to be 5.8 fold in case of actinobacteria treatment (A) at 15th day sampling but expression was decreased among all the treatments at later stages of observation at different intervals among all the treatments. The expression pattern of iso-chorismate synthase gene was similar to GST gene which was observed only at initial stages up to 2.34 fold at 15 days in case of actinobacteria inoculated sample (A). The expression fold in the treatments P and AP was found to be less than 1 fold at all the intervals of sampling. The ASMT gene was highly expressed (288 fold) in pathogen treated samples at 20 days after pathogen inoculation, showing the imbalance in the cell redox homeostasis in rice due to pathogen attack. The expression of gene corresponding to 14-3-3 like protein which is known to be involved in cellular signaling process under stress in plants was increased at the rate of 3 fold at 15 and 25 days due to actinobacterial inoculation (A). The higher expression levels in between P and AP was found in AP treatment at 25th day sampling. The signaling process was enhanced due to actinobacterial inoculation under pathogen infection. The chitinase gene expression was found to be enhanced by actinobacterial inoculation in presence and absence of pathogen at 15 and 25 days that insist the initial activation of chitinase gene due to the actinobacterial infection. The pathogen treated samples showed chitinase gene expression at 20 and 25 days (1.5 and 1.1) fold respectively. The resistance may be due to the initial activation of chitinase gene due to actinobacterial inoculation prior to pathogen infection. The expression of PAL gene was found 32 fold in case of actinobacteria treated sample, 14 fold in pathogen control (P) and 1.78 fold in case of actinobacteria treated sample at 15 dpi of pathogen. The results correlated with biochemical assay results where effect of PAL during actinobacterial inoculation increased at initial stages (Fig. 6 ). At 15 days interval the expression of NPR gene in case of actinobacteria and pathogen treated (AP) samples was found 3.64 fold, but in case of Pathogen control (P) and actinobacteria treated samples 1.84 and 1.54 fold respectively. The initial activation of NPR gene enhanced the initial defense in rice to combat sheath blight pathogen attack at later stages of growth. The correlation analysis of genes expressed based on the fold change at different intervals and between the treatments showed the differential expression pattern of SAR, ISR and genes involved in plant growth promotion and plant defense against invading plant pathogens which clearly indicates the effect of actinobacterial inoculation prior to disease development in rice (Fig. 8 B). Discussion The molecular and biochemical basis of selection of efficient actinobacterial isolate contributing to plant defense against plant pathogens forms the basis of this study. The overall results from in vitro screening, greenhouse experiments, biochemical analysis and qRT-PCR analysis highlighted the significant effects of actinobacterial presence in the rhizosphere in modulating resistance mechanisms in rice at various stages. The collection of samples and gene expression analysis were done at different intervals to study the effect of sheath blight pathogen attack and understand the differential gene regulation during the compatible interaction. The gene expression studies in rice during the R. solani infection were done at 24, 48 and 72 hours after inoculation and genes corresponding to pathogenesis related, heat shock proteins, signaling mechanisms and others were reported to be differentially expressed in resistant varieties in comparison with susceptible varieties (Zhang et al. 2017 ), (Suryawanshi et al. 2020 ), (Cao et al. 2022 ). The sheath samples were collected at 3 and 5 days post inoculation and the disease symptoms visualized after 15–18 days of pathogen inoculation by typha bit inoculation method (Prashantha et al. 2021 ; Samal et al. 2022 ). To understand the rice plant behavior before infection, during the infection and after the infection, the sampling was done at 15, 20 and 25 days after the pathogen inoculation and to study the effect of the efficient isolate Streptomyces hyderabadensis at the initial and later stages of infection. Hence, the study provides expression based results of major plant genes that involved in plant resistance at later of rice plants which is important to know the fate of rice plants and the extent of actinobacterial contribution in rice plants. The increase in shoot length in actinobacteria treated sample (A) and the samples with sheath blight pathogen pressure and actinobacterial inoculation (AP) provided interesting results with respect to the inoculation of S. hyderabandensis both as seed treatment and soil application. The maximum length of shoot was found upto 80cm and maximum tillers reached upto 5 tillers in actinobacterial treatment. The bio-control agents able to confer dual benefits as both growth promoting in plants and antagonistic against infected plant pathogens (Abbas et al. 2021 ; Rashid et al. 2020 ; Naeimi et al. 2020 ). The inoculation of bio-control agents increased the plant height, shoot length and significant increases in plant growth was observed when compared to healthy control and pathogen control (P). The pathogen infected samples produced on an average of 3 tillers per plant and the plant height was found to be 60cm at 25 days, which is significantly less than health control, pathogen control and actinobacteria + pathogen inoculated samples. The effect of pathogen infection will decrease the plant height and number of tillers (Safari motlagh et al. 2022 ) but actinobacterial inoculation in presence of disease increased at tillers (4 tillers) and in par with healthy control and the plant height upto 70 cm which is more than healthy control and significantly higher than pathogen control. Hence, actinobacterial inoculation benefitted maintaining the normal growth and development of rice plants under pathogen infection. The presence/absence and the extent of control of sheath blight symptom or lesion length are the main parameters to evaluate the effect of biological control in rice plants under R. solani infection (Zhang et al. 2017 ). The lesion length in pathogen treated increased upto 15cm and the disease scale was found to be 3 but in case of actinobacterial treatment under pathogen pressure the maximum lesion height was found to be 8cm at 25 days after inoculation with the disease score of 1. Similar results were reported by (Abbas et al. 2021 ; Rashid et al. 2020 and Naeimi et al. 2020 ) in that the lesion length was decreased due to the inoculation of bio-control agents and can cause significant difference in plant morphological growth and strength of sheath in a way that plant can be cautious about the necrotrophic infection (Naeimi et al. 2020 ). Plants produce phenyl ammonia lyase (PAL) which is derived product of shikimic acid pathway which in turn gets activated through phenyl propanoid pathway and helps plants to produce various secondary metabolites under stress (Hyun et al. 2011 ). The resistant varieties of rice plants were subjected to PAL analysis and it was concluded that PAL activity increase in plants under stress will be a part of major resistance mechanisms in plants (Zhang et al., 2013 , Molla et al. 2020 ). The studies regarding microbial inoculation for sheath blight resistance in rice increased the levels of PAL activity and provided significant decrease in disease incidence (Elsharkawy et al. 2022 , Bashyal et al., 2022 ). Our results depicted that in case of actinobacteria + pathogen inoculated treatment PAL has been enhanced which has been correlated with the previous studies that PAL, content increase contributed to disease resistance in rice. The increase in polyphenol oxidases protects rice plants from oxidative stress and combating reactive oxygen species (ROS) against fungal pathogens (Zhang et al. 2013 ). Our results showed that, the healthy plants possess enough level of PPO expression and under normal conditions, which was enhanced by actinobacterial inoculation but significant decrease in PPO levels under pathogen attack in pathogen inoculated plants. But the level of PPO was found to be increase and intermediate between actinobacteria treated samples and pathogen inoculated samples (P). Hence, the actinobacterial inoculation increased the expression levels of PPO under pathogen attack which correlated with the observation that PPO increased in early blight of tomato when Bacillus subtilis was applied as biocontrol agent in combination with plant fertilizers (Awan and Shoaib, 2019 ). The phenol content in case of actinobacterial inoculation and sheath blight infection was found to be higher compared to other three treatments. The pathogen treatment showed slight higher expression than control and actinobacteria treated samples. Similar results have been reported in case of actinobacteria treatment (AbdElgawad et al. 2019 ) in date palm the application it has increased the phenol content and increased the growth promotion of date palm. Increase in PAL content and phenol content will increase the disease controlling ability in rice under sheath blight attack (Patil et al. 2011 ). The catalase activity was found to be lower in case of healthy control and actinobacteria treated samples. But the activity was increased in pathogen inoculated samples (P and AP). The actinobacterial inoculation doesn’t change expression of catalase when inoculated alone. The pathogen pressure on plant increased the catalytic activity of plant, since the external signaling from actinobacteria inoculation and pathogen mediated signaling resulted in higher rate of catalase activity in rice plants (AP). Similar overview has been provided in studies when bio-control agent was used in plants to confer disease resistance in plants (Xu et al. 2019 ). The study involved use of Streptomyces hygroscopicus increased the catalytic activity of rice interaction with Magnaporthe oryzae . The peroxidase activity was found to be in increasing order of treatments (C < A < P < AP). The maximum activity was found in AP treatment. The pathogen pressure increased the peroxidase activity of plants as defense mechanism but the greater levels of peroxidase activity observed through actinobacterial inoculation. Similar results have been noticed in case of actinobacterial treatment in rice affected with Fusarium fujikoroi (Bakanae disease of rice) that the level of peroxidase activity was increased due to the addition of actinobacteria during pathogen infection (Nawaz et al. 2022 ). The differential levels of stress modulating agents/biochemical enzymes contributed to sheath blight resistance in rice under actinobacterial inoculation. The further focus was to study the gene expression analysis to understand the basis of actinobacterial contribution at molecular level which provided an overview of plant defense involving major mechanisms such as systemic acquired resistance (SAR) and induced systemic resistance (ISR). The expression of chlorophyll a-b binding protein 2 was found to be higher in case of actinobacteria + pathogen (3.8 fold) inoculated sample, followed by pathogen inoculated sample at 25 days after pathogen inoculated sample. More than 1 fold of expression was found in actinobacteria treated sample, similar results was found when actinobacteria ( Streptomyces Spp.) was inoculated against sheath blight disease that increase in the chlorophyll content of leaves was observed (Tamreihao et al. 2016 ). The studies in sheath blight disease based on iTRAQ based proteomics to identify the major mechanisms of resistant varieties against sheath blight showed that increased expression of chlorophyl a-b binding protein 2 during the R. solani infection in resistant varieties (Feng et al. 2022 , Shamim et al. 2022 ). The resistant varieties thus tends to increase chlorophyll content under sheath blight pathogen infection, which correlated well with our results that S. hyderabadensis inoculation increased the expression of chlorophyll a-b binding protein 2. The major groups of Glutathione S-transferase (GST) genes were involved in systemic acquired resistance (SAR) in plants and involved in detoxification process (Kumar et al. 2020 ). The initial inoculation of actinobacteria (A) increased the level of SAR (15 dpi) and then drastically decreased in the later intervals (20 and 25 dpi). This depicts that in rice plants the SAR pathway may be downregulated in presence of pathogen due to actinobacterial inoculation. The actinobacterial inoculation activates the ISR pathway (Ansari et al. 2020 , Ebrahimi-Zarandi et al. 2022 ). The other treatments P and AP have very low expression levels of GST gene. The hypothesis here is, in pathogen control the susceptible variety couldn’t activate the SAR pathway that stimulate the GST expression and perform its role in detoxification process against ROS generated by pathogen infection. Since AP treatment has actinobacterial treatment, the shift in SAR to ISR may happen before 15 days of pathogen inoculation/before noticing the visual pathogen symptoms. The 14-3-3 like protein GF14-E is a eukaryotic specific protein and involves in signal transduction, considered as phospho-sensors which bind to phosphorylated client proteins and alter their functions, it has various roles such as signaling in cell division, response to biotic and abiotic stimuli (Lozano-Durán et al. 2015). The expression level of 14-3-3 like protein GF14 was increased up to 3 fold by actinobacterial treatment (A). The susceptible variety also maintained its efficiency to express the gene in all the intervals but the actinobacterial treatment was found to be effective increasing the expression more than pathogen control (P) in actinobacterial treatment in presence of pathogen (AP). The signaling cascade during the rice-pathogen interaction in presence of actinobacteria was found to be enhanced. The ASMT gene helps to secrete melatonin in plants that maintain the circadian rhythm of plant such that its actual metabolism is balanced at every stage (vegetative and reproductive), in response to spacial and temporal changes in the environment around the plants (Zhou et al. 2021 ). The ASMT enzyme catalyzes the final reaction of melatonin biosynthesis in plants (Kanehisa et al., 2006 ). Recent studies reported that melatonin expression will be higher in case of extreme plant stress (biotic and abiotic stress) that changes the redox potential of cell (Lee et al. 2017 ). It also helps to be a deciding factor during the plant defense and is considered as biological marker to identify the deviation from normal behavior of plants under pathogen infection therefore is known as biological rhythm regulator (Wei et al. 2018 ). Our results found that the pathogen infected sheath, when screened for ASMT expression level had 288.9 fold increase in the expression at 25 days after pathogen inoculation, which depicts the extent of pathogen pressure faced by the rice plants. The actinobacterial treatment under normal conditions (A) showed less than 10 (8.9) fold increase which also indicates the actinobacterial treatment will not induce stress on plants and in both actinobacteria and pathogen inoculation, the fold changes was found to be 21.9 fold which is interesting as there is decrease in 13.7 fold from pathogen (P) treatment and pathogen + actinobacterial treatment. The actinobacteria inoculation prophylactically may help in signaling the rice plants by inducing the systemic resistance against various biotic and abiotic stresses. The chitinases belongs to glycosyl hydrolase family that hydrolyses the glycosidic bonds in chitin, in plants it possess anti-fungal activity (Kumar et al. 2018 ). Chitinases are also considered as PR proteins that degrades chitin during plant fungal interactions (Yang et al. 2022 ). The sheath blight and rice interaction under the influence of Bacillus subtilis as biocontrol increased the expression level of chitinase enzyme and provided resistance to sheath blight disease (Durgadevi et al. 2021 ). Our results showed that in actinobacterial inoculation (A) increased the expression of chitinase gene > 1.5 fold. The expression of chitinase gene were found at 25 days after inoculation in pathogen treated plants but almost zero expression at 15 days, where as in actinobacteria and pathogen treated samples the expression level of 1.3 fold in presence of pathogen (AP) which indicates the actinobacterial initial role in activation of plant chitinase genes. Actinobacteria is considered as intermediate organism which shares the phylogenetic identity between fungi and bacteria (Kaale et al. 2022 ). The actinobacterial inoculation signals the plants as fungi attack to express chitinase activity, but its effect on plants will be beneficial. PAL is the key enzyme in the phenol synthesis pathway, phenol accumulation under biotic and abiotic stress in plants acts as phytoalexins and provides primary inducible defense response against external disturbance to the internal homeostasis of plants (Zhang et al. 2011 ). The fungal biocontrol agents when inoculated to study the resistance of plants against sheath blight disease in rice, the qRT-PCR analysis showed the increased expression of PAL gene and chitinase genes in plants (Bashyal et al. 2022 ). Our results showed that the expression of PAL gene under stress of pathogen (P) was found to be 14 fold. The initial defense level of susceptible variety was found to be significant but in case of actinobacterial treatment under disease attack the expression fold was found to be 32 fold at 15 days post inoculation. The PAL activity is enhanced to provide resistance against sheath blight pathogen. The SAR pathway in P treatment failed which has been enhanced by the activation of ISR pathway by the addition of actinobacteria. The salicylic acid pathway is the derivative of two pathways Iso-chorismate synthase pathway and PAL pathway (Lefevere et al. 2020 ). Iso-chorismate synthase is required for salicylic acid synthesis in plants (Wildermuth et al. 2001 ). Our studies showed the initial activation of ICS gene at 15 days in actinobacteria treated sample at 2.3 fold. But the expression level of ICS gene was not found at later intervals and also the other two treatments (P and AP) in neither of the intervals of sampling. Here, the activation of salicylic acid pathway was found due to actinobacterial treatment (A) as a plant innate response but later converted to ISR. In pathogen treatment (P), the susceptible variety lacks its potential to express SAR genes during infection. In actinobacteria + pathogen treatment (AP), the shift in SAR to ISR pathway before 15 days/ in the initial stages of actinobacterial inoculation may be the reason for the lower expression of ICS genes since it has significance salicylic acid pathway (SAR). The NPR1 gene modulates the cross-talk between salicylate (SAR) and jasmonate (ISR)-dependent defense pathways activation through a precise function in the plant cell cytosol (Spoel et al. 2003 ). The initial signaling pathway of ISR pathway is NPR1 (Panpatte et al. 2020 ). Our results showed the expression of NPR1 gene in all the intervals in actinobacteria treated samples (A). The pathogen treated samples (P) interestingly showed the expression higher than actinobacterial samples (A), the susceptible variety due to the pathogen pressure shifted its defence pathway from SAR to ISR and higher expression of NPR gene upto 2 fold. The previous SAR responsive genes and its lower expression levels (GST, ICS, PAL) showed the failure of SAR pathway and the activation of NPR gene in rice plants at all the intervals and shift in SAR to ISR pathway. The actinobacteria + pathogen treatment (AP) showed the higher expression among all the treatments (3.8 fold). Hence, actinobacterial inoculation was found successful in activating the ISR pathway to help rice plants to defend against the attack of necrotophic pathogen R. solani . The shift in SAR to ISR during the actinobacterial inoculation in rice has been found by the lower expression levels of SAR genes, increased expression of ISR gene (NPR) and other genes contributing to plant growth and development, response to stress, signaling etc. , with the help of biochemical enzymes that maintain the cell homeostasis during the plant stress condition. The major observations and overview of defense mechanisms are summarized and depicted in Fig. 9 . Conclusion The present investigation was undertaken to identify the molecular and biochemical basis of actinobacterial interaction in presence and absence of sheath blight disease in rice. The parallel understanding of tripartite interaction between a plant and bio-control agent in presence of disease is important and provided interesting results in our study. Various conclusions can be drawn such as the green house experiments in rice interaction with actinobacteria in presence of sheath blight pathogen Rhizoctonia solani provided results on growth promotion, maintenance of cellular homeostasis through activation of various detoxification enzymes (peroxidases, catalases, polyphenol oxidases), differential increase in phenol and phenyl ammonia lyase content under stress conditions based on biochemical analysis. The qRT-PCR analysis of genes involved in the maintenance of plant circadian rhythm during normal and stress conditions, plant chlorophyll content, detoxification process and genes involving in the activation of SAR and ISR pathway justified to draw conclusion that the actinobacterial inoculation changes the mode of plant defense from SAR to ISR at molecular level compared to its actual defense mechanism. The decrease in lesion length correlated with the activation of ISR mechanism in rice plants inoculated with DBT64 in presence of R. solani infection which maintained the disease score less than 10 per cent compared to pathogen control which has reached nearly 30 per cent. The study can be taken forward for transcriptome analysis to identify the major genes expressed differentially during the tripartite interaction. Abbreviations SA-Salicylic acid, ET-Ethylene, JA-Jasmonic acid, ISR- Induced systemic resistance, SAR-Systemic acquired resistance, BCA-Biocontrol agents, SES-Standard evaluation system, qRT-PCR - quantitatice real time polymerase chain reaction, GOI-Gene of Interest, GST- Probable glutathione S-transferase, ICS-iso-chorismate synthase, PAL-Phenyl ammonia lyase, ASMT- Acetylserotonin-O-methyltransferase, CAT-catalases, PER-Peroxidases, PHE-Phenols, PPO-polyphenol oxidases Declarations Author contributions AYP carried out the present work and drafted the manuscript; KPU conceptualized and supervised the experiments and critically reviewed the manuscript: gave inputs at times during the experimentation and PSK, DNK and BB critically reviewed the manuscript. All the authors read and approved the manuscript Funding This work was supported by Department of Biotechnology (DBT’s Sanction Order No. BT/PR25029/NER/95/967/2017 dated 30th, September, 2019) Availability of Data and Materials All datasets are available from the corresponding author on reasonable request Ethics Approval and Consent to Participate Not applicable Consent for Publication Not applicable Competing interests The authors declare that they have no competing interests References Abbas A, Fu Y, Qu Z, Zhao H, Sun Y, Lin Y, Xie J, Cheng J Jiang D (2021) Isolation and evaluation of the biocontrol potential of Talaromyces spp. against rice sheath blight guided by soil microbiome. Environ Microbiol 23(10):5946-5961. https://doi.org/10.1111/j.1467-7652.2007.00243.x AbdElgawad H, Saleh AM, Al Jaouni S, Selim S, Hassan MO, Wadaan MA, Shuikan AM, Mohamed H S and Hozzein W N (2019) Utilization of actinobacteria to enhance the production and quality of date palm ( Phoenix dactylifera L.) fruits in a semi-arid environment. Sci Tot Environ 666:690-697. https://doi.org/10.1016/j.scitotenv.2019.02.140 Anon (2020) Anaconda Software Distribution, Anaconda Inc. Available at: https://docs.anaconda.com/. Ansari W A, Krishna R, Zeyad MT, Singh S Yadav A (2020) Endophytic actinomycetes-mediated modulation of defense and systemic resistance confers host plant fitness under biotic stress conditions. In Microbial Versatility in Varied Environments 167-180). Springer, Singapore. https://doi.org/10.1007/978-981-15-3028-9_13. Awan Z A, Shoaib A (2019) Combating early blight infection by employing Bacillus subtilis in combination with plant fertilizers. Current Plant Biol, 20:100125. https://doi.org/10.1016/j.cpb.2019.100125 Barka E A, Vatsa P, Sanchez L, Gaveau-Vaillant N, Jacquard C, Klenk H P Clément C Ouhdouch Y, van Wezel G P 2016 Taxonomy, physiology and natural products of Actinobacteria. Microbiol Mol Biol Rev 80(1):1-43.DOI: https://doi.org/10.1128/MMBR.00019-15 Bashyal B M, Pandey S, Singh A R, Singh D, Kamil D, Aggarwal R (2022) Utilization of fungal biocontrol agents against rice sheath blight disease provides insight into their role in plant defense responses. https://doi.org/10.56042/ijbb.v59i11.66903 Bhaktavatsalam G, Satyanarayana K, Reddy APK, John VT (1978) Evaluation for sheath blight resistance in rice. Int Rice Res Newslett 3:9-10 Cao W, Zhang H, Zhou Y, Zhao J, Lu S, Wang X, Chen X, Yuan L, Guan H, Wang G Shen W (2022) Suppressing chlorophyll degradation by silencing OsNYC3 improves rice resistance to Rhizoctonia solani , the causal agent of sheath blight. Plant Biotechnol J 20(2):335. doi: 10.1111/pbi.13715 Chen T, Lv Y, Zhao T, Li N, Yang Y, Yu W, He X, Liu T, Zhang, B (2013) Comparative transcriptome profiling of a resistant vs. susceptible tomato ( Solanum lycopersicum ) cultivar in response to infection by tomato yellow leaf curl virus. PloS one 8(11): 80816. https://doi.org/10.1371/journal.pone.0080816 Cohen SP and Leach JE 2019 Abiotic and biotic stresses induce a core transcriptome response in rice. Scientific reports, 9(1): 1-11. https://doi.org/10.1038/s41598-019-42731-8 Durgadevi D, Harish S, Manikandan R, Prabhukarthikeyan S R, Alice D and Raguchander T (2021) Proteomic profiling of defense/resistant genes induced during the tripartite interaction of Oryza sativa , Rhizoctonia solani AG1-1A, and Bacillus subtilis against rice sheath blight. Physiol Mol Plant Pathol 115:p.101669. https://doi.org/10.1016/j.pmpp.2021.101669 Ebrahimi-Zarandi M, Saberi Riseh R, Tarkka MT (2022) Actinobacteria as effective biocontrol agents against plant pathogens, an overview on their role in eliciting plant defense. Microorganisms 10(9):1739. https://doi.org/10.3390/microorganisms10091739 Elsharkawy MM, Sakran RM, Ahmad AA, Behiry SL, Abdelkhalek A, Hassan MM Khedr, AA (2022) Induction of Systemic Resistance against Sheath Blight in Rice by Different Pseudomonas Isolates. Life, 12(3):349. https://doi.org/10.3390/life12030349 Feng Z M, Peng GAO, Zhao JH, Wang GD, Zhang HM, Cao WL, Xiang, XUE, Zhang YF, Rong HUA Chen ZX, Chen XJ (2022) iTRAQ-based quantitative proteomics analysis of defense responses triggered by the pathogen Rhizoctonia solani infection in rice. J. Int. Agricul, 21(11):139-152. https://doi.org/10.1016/S2095-3119(20)63499-2 Firdaus RBR, Leong Tan M, Rahmat SR, Senevi Gunaratne M (2020) Paddy, rice and food security in Malaysia: A review of climate change impacts. Cogent Soc Sci 6: 1818373. https://doi.org/10.1080/23311886.2020.1818373 Hartee E F (1955) Haematin compounds. In: Modern methods of Plant Analysis, (Peach, K. and Tracy, M. eds.), Springer-Verlag, New York, 4: 197-245. Hata EM, Yusof MT, Zulperi D (2021) Induction of systemic resistance against bacterial leaf streak disease and growth promotion in rice plant by Streptomyces shenzhenesis TKSC3 and Streptomyces sp. SS8. The plant Pathol J 37(2): 173. doi: 10.5423/PPJ.OA.05.2020.0083 He D C, He M H, Amalin D M, Liu W, Alvindia D G and Zhan J (2021) Biological control of plant diseases: An evolutionary and eco-economic consideration. Pathogens 10(10) 1311. https://doi.org/10.3390/pathogens10101311 Hyun MW, Yun YH, Kim JY, Kim SH (2011) Fungal and plant phenylalanine ammonia-lyase. Mycobiology 39(4): 257-265 DOI: 10.5941/MYCO.2011.39.4.257 International Rice Genome Sequencing Project (2002). Standard Evaluation System for Rice (SES). Manila, Philippines, Int.Rice. Research Institute. Jia Y, Liu G, Park D S, Yang Y (2013) Inoculation and scoring methods for rice sheath blight disease. Methods Mol Biol 956: 257-268. DOI: 10.1007/978-1-62703-194-3_19 Jiang J, Ma S, Ye N, Jiang M, Cao J, Zhang J (2017) WRKY transcription factors in plant responses to stresses. J Int Plant Biol 59(2): 86-101. DOI: 10.1111/jipb.12513 Kaale SE, Mahadhy A, Damas M, Mgina CA, Lyimo TJ (2022) Phylogenetic diversity of Actinobacteria from Momela soda lakes, Arusha National Park, Tanzania. African J Aquatic Sci :1-14. https://doi.org/10.2989/16085914.2021.2005527 Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M and Hirakawa M (2006) From genomics to chemical genomics: new developments in KEGG. Nucleic acids Res 34:354-D357. DOI: 10.1093/nar/gkj102 Klessig DF Choi HW and Dempsey DMA (2018) Systemic acquired resistance and salicylic acid: past, present, and future. Mol. Plant-microbe Int. 31(9):871-888. DOI: 10.1094/MPMI-03-18-0067-CR Kumar M, Brar A, Yadav M, Chawade A, Vivekanand V, Pareek N (2018) Chitinases—potential candidates for enhanced plant resistance towards fungal pathogens. Agriculture, 8(7):88https://doi.org/10.3390/agriculture8070088 Kumar R, Barua P, Chakraborty N, Nandi AK (2020) Systemic acquired resistance specific proteome of Arabidopsis thaliana . Plant Cell Reports, 39(11):1549-1563. DOI: 10.1007/s00299-020-02583-3 Law J W F, Ser H L, Ab Mutalib N S, Saokaew S, Duangjai A, Khan T M, Chan K G, Goh B H and Lee L H (2019) Streptomyces monashensis sp. nov., a novel mangrove soil actinobacterium from East Malaysia with antioxidative potential. Scientific reports, 9(1), pp.1-18. DOI: 10.1038/s41598-019-39592-6 Lee DY, Jeon J, Kim KT, Cheong K, Song H, Choi G, Ko J, Opiyo SO, Correll JC, Zuo S Madhav S (2021) Comparative genome analyses of four rice-infecting Rhizoctonia solani isolates reveal extensive enrichment of homogalacturonan modification genes. BMCgenomics 22(1):1-15. https://doi.org/10.1186/s12864-021-07549-7 Lee K, Choi GH, Back K (2017) Cadmium‐induced melatonin synthesis in rice requires light, hydrogen peroxide, and nitric oxide: key regulatory roles for tryptophan decarboxylase and caffeic acid O‐methyltransferase. J Pineal Res 63(4), p.e12441. DOI: 10.1111/jpi.12441 Lefevere H, Bauters L, Gheysen G (2020) Salicylic acid biosynthesis in plants. Front Plant Sci 11: 338. https://doi.org/10.3389/fpls.2020.00338 Li Y, Guo Q, Li Y, Sun Y, Xue Q, Lai H (2019) Streptomyces pactum Act12 controls tomato yellow leaf curl virus disease and alters rhizosphere microbial communities. Biol Fert soils 55(2): 149-169. http://doi.org/10.1007/s00374-019-01339-w Lozano-Durán R, Robatzek S, 2015, 14-3-3 proteins in plant-pathogen interactions. Mol. Plant Microbe Int. 28(5):511-518. https://doi.org/10.1094/MPMI-10-14-0322-CR Mawang CI, Azman AS, Fuad ASM, Ahamad M (2021) Actinobacteria: An eco-friendly and promising technology for the bioaugmentation of contaminants. Biotechnol Rep p.e00679. DOI: 10.1016/j.btre.2021.e00679 Mayer AM Harel E Shaul R B (1965) Assay of catechol oxidase, a critical comparison of methods. Phytochem 5 : 783-789. https://doi.org/10.1016/S0031-9422(00)83660-2 Metsalu T, Vilo, J (2015) ClustVis: a web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nucleic acids Res, 43(W1): W566-W570. DOI: 10.1093/nar/gkv468 Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem 31(3):426-428. https://doi.org/10.1021/ac60147a030 Molla KA, Karmakar S, Molla J, Bajaj P, Varshney RK, Datta SK, Datta K (2020) Understanding sheath blight resistance in rice: the road behind and the road ahead. Plant Biotechnol J 18:895–915 https://doi.org/10.1111/pbi.13312 Mur LA, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol: 140(1): 249-262. https://doi.org/10.1104/pp.105.072348 Naeimi S, Khosravi V, Varga A, Vágvölgyi C, Kredics L, 2020, Screening of organic substrates for solid-state fermentation, viability and bioefficacy of Trichoderma harzianum AS12-2, a biocontrol strain against rice sheath blight disease. Agronomy, 10(9):1258. https://doi.org/10.3390/agronomy10091258 Nawaz ME, Malik K, Hassan MN (2022) Rice-associated antagonistic bacteria suppress the Fusarium fujikoroi causing rice bakanae disease. BioControl, 67(1):101-109. https://doi.org/10.1007/s10526-021-10122-6 Ngalimat MS, Mohd Hata E, Zulperi D, Ismail SI, Ismail MR, Mohd Zainudin NAI, Saidi NB Yusof MT (2021) Plant growth-promoting bacteria as an emerging tool to manage bacterial rice pathogens. Microorganisms 9(4):682. DOI: 10.3390/microorganisms9040682 Panpatte DG, Jhala YK Vyas RV (2020) Signaling pathway of induced systemic resistance. In Molecular Aspects of Plant Beneficial Microbes in Agriculture, 133-141 Academic Press. https://doi.org/10.1016/B978-0-12-818469-1.00011-0 Patil HJ, Srivastava AK, Singh DP, Chaudhari BL Arora DK (2011) Actinomycetes mediated biochemical responses in tomato ( Solanum lycopersicum ) enhances bioprotection against Rhizoctonia solani . Crop protection 30(10):1269-1273. https://doi.org/10.1016/j.cropro.2011.04.008 Pombo MA, Ramos RN, Zheng Y, Fei Z, Martin G B Rosli H. G (2019) Transcriptome-based identification and validation of reference genes for plant-bacteria interaction studies using Nicotiana benthamiana . Scientific reports, 9(1):1-10. https://doi.org/10.1038/s41598-018-38247-2 Pralhad S P, Krishnaraj P U and Pralhad M P (2020) Evaluation of actinobacteria for biocontrol of sheath blight in rice. J. Pharmacog. Phytochem istry 9(3): 371-376. http://www.phytojournal.com/ Prasad M, Srinivasan R, Chaudhary M, Choudhary M, Jat LK (2019) Plant growth promoting rhizobacteria (PGPR) for sustainable agriculture: perspectives and challenges. PGPR amelioration in sustainable agriculture, 9:129-157. https://doi.org/10.1016/B978-0-12-815879-1.00007-0 Prashantha ST, Bashyal BM, Krishnan SG, Dubey H, Solanke AU, Prakash G, Aggarwal R (2021) Identification and expression analysis of pathogenicity-related genes of Rhizoctonia solani anastomosis groups infecting rice. Biotechnology, 11(8):1-12. https://doi.org/10.1007/s13205-021-02934-1 Rashid MM, Bhuiyan MR, Dilzahan HA, Hamid MA, Hasan N, Khan MAI, Latif MA (2020) Biological control of rice sheath blight disease (Rhizoctonia solani) using bio-pesticides and bio-control agents. Bangladesh Rice Journal, 24(1):47-58. https://doi.org/10.3329/brj.v24i1.53239 Rehman HM, Nawaz MA, Shah ZH, Ludwig-Müller J, Chung G, Ahmad MQ, Yang SH, Lee SI (2018) Comparative genomic and transcriptomic analyses of Family-1 UDP glycosyltransferase in three Brassica sp. and Arabidopsis indicates stress-responsive regulation. Scientific Reports 8(1): 1875 https://doi.org/10.3390/genes13091640 Ross WW, Senderoff R R (1992) Phenylanine ammonia lyase from loblolly pine; purification of the enzyme and isolation of complementary DNA clones. Plant physiology, 98:380-386 Sadasivam S, Manickam A (1996) Phenols. New Age International, 256. Safari Motlagh MR, Jahangiri B, Kulus D, Tymoszuk A, Kaviani B (2022) Endophytic fungi as potential biocontrol agents against Rhizoctonia solani JG Kühn, the causal agent of rice sheath blight disease. Biology, 11(9): 1282. https://doi.org/10.3390/biology11091282 Samal P, Molla KA, Bal A, Ray S, Swain H, Khandual A, Sahoo P, Behera M, Jaiswal S, Iquebal A, Chakraborti M (2022) Comparative transcriptome profiling reveals the basis of differential sheath blight disease response in tolerant and susceptible rice genotypes. Protoplasma, 259(1):61-73. https://doi.org/10.1007/s00709-021-01637-x Shamim M, Sharma D, Bisht D, Maurya R, Kaashyap M, Srivastava D, Mishra A, Kumar D, Kumar M, Juturu VN Khan NA (2022) Proteo-molecular investigation of cultivated rice, wild rice, and barley provides clues of defense responses against Rhizoctonia solani infection. Bioengineering, 9(10), p.589. https://doi.org/10.3390/bioengineering9100589 Sharma NR, Teng PS, Olivares PM (1990) Comparison of assessment methods for rice sheath blight disease. Philippines Phytopathology 26:20-24. Singh P, Mazumdar P, Harikrishna, J A and Babu S (2019) Sheath blight of rice: a review and identification of priorities for future research. Planta, 250(5): 1387-1407. https://doi.org/10.1007/s00425-019-03246-8 Sinha S, Kumar A, Kumar M, Singh SP, Singh PK (2018) Screening of rice genotypes for abiotic and biotic stresses using molecular markers. Journal of Pharmacognosy and Phytochemistry, 7(2):2111-2115. Smith A, Lovelace AH, Kvitko BH (2018) Validation of RT-qPCR approaches to monitor Pseudomonas syringae gene expression during infection and exposure to pattern-triggered immunity. Molecular Plant-Microbe Interactions, 31(4):410-419. https://doi.org/10.1094/MPMI-11-17-0270-TA Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ, Buchala AJ, Métraux JP, Brown R, Kazan K, Van Loon LC (2003) NPR1 modulates cross-talk between salicylate-and jasmonate-dependent defense pathways through a novel function in the cytosol. The Plant Cell, 15(3):760-770. https://doi.org/10.1105/tpc.009159 Suryawanshi PP, Krishnaraj PU, Suryawanshi MP (2020) Evaluation of actinobacteria for biocontrol of sheath blight in rice. Journal of Pharmacognosy and Phytochemistry, 9:371-376. Taha M, Ghaly M, Atwa H, Askoura M (2021) Evaluation of the effectiveness of soil Streptomyces isolates for induction of plant resistance against Tomato mosaic virus (ToMV). Current Microbiology, 78(8):3032-3043. https://doi.org/10.1007/s00284-021-02567-w Tamreihao K, Ningthoujam DS, Nimaichand S, Singh ES, Reena P, Singh SH, Nongthomba U (2016) Biocontrol and plant growth promoting activities of a Streptomyces corchorusii strain UCR3-16 and preparation of powder formulation for application as biofertilizer agents for rice plant. Microbiological research, 192:260-270. https://doi.org/10.1016/j.micres.2016.08.005 Wei Y, Liu G, Chang Y, Lin D, Reiter RJ, He C, Shi H (2018) Melatonin biosynthesis enzymes recruit WRKY transcription factors to regulate melatonin accumulation and transcriptional activity on W‐box in cassava. Journal of pineal research, 65(1):p.e12487. https://doi.org/10.1111/jpi.12487 Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature, 414(6863):562-565. https://doi.org/10.1038/35107108 Xu T, Cao L, Zeng J, Franco CM, Yang Y, Hu X, Liu Y, Wang X, Gao Y, Bu Z, Shi L (2019) The antifungal action mode of the rice endophyte Streptomyces hygroscopicus OsiSh-2 as a potential biocontrol agent against the rice blast pathogen. Pesticide biochemistry and physiology, 160:58-69. https://doi.org/10.1016/j.pestbp.2019.06.015 Yang X, Gu X, Ding J, Yao L, Gao X, Zhang M, Meng Q, Wei S, Fu J (2022) Gene expression analysis of resistant and susceptible rice cultivars to sheath blight after inoculation with Rhizoctonia solani . BMC genomics, 23(1):1-16. https://doi.org/10.1186/s12864-022-08524-6 Zhang G, Cui Y, Ding X and Dai Q (2013) Stimulation of phenolic metabolism by silicon contributes to rice resistance to sheath blight. Journal of Plant Nutrition and Soil Science, 176(1): 118-124. https://doi.org/10.1002/jpln.201200008 Zhang J, Chen L, Fu C, Wang L, Liu H, Cheng Y, Li S, Deng Q, Wang S, Zhu J and Liang Y (2017) Comparative transcriptome analyses of gene expression changes triggered by Rhizoctonia solani AG1 IA infection in resistant and susceptible rice varieties. Frontiers in Plant Science, 8: 1422. https://doi.org/10.3389/fpls.2017.01422 Zhang H, Li R, Liu, W (2011) Effects of chitin and its derivative chitosan on postharvest decay of fruits: A review. International Journal of Molecular Sciences, 12(2):917-934. https://doi.org/10.3390/ijms12020917 Zhou W, Wang Y, Li B, Petijová L, Hu S, Zhang Q, Niu J, Wang D, Wang S, Dong Y, Čellárová (2021) Whole‐genome sequence data of Hypericum perforatum and functional characterization of melatonin biosynthesis by N‐acetylserotonin O‐methyltransferase. Journal of Pineal Research, 70(2): p.e12709. https://doi.org/10.1111/jpi.12709 Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2421512","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":164538340,"identity":"6a4ebef8-8a0b-44fe-9a62-0eba04205bd6","order_by":0,"name":"Arun Y P","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDElEQVRIiWNgGAWjYJACxgYGhgQgzf7jQ4UNiN94gFgtDJIzzqSB+cRrkeZtOwwWwauFf/YZs4czauryDI6fPWA4s+283dr2w0BbamyicWmROJdjbrjh2OFigzN5CQkfzt1O3nYmEajlWFpuAy49Z3jMJB+wHUjccCDH4OCMstvJZgeAWhgbDuPUIg/W8q8uccP5N4bNPGznks3OP8SvxQCkZWMbc+KGGznGzDxtB+zMbhCwxfAMW5nkzL7DiTNvvEtjnHEmOcHsBtCWBDx+kTvDvE2y51tdYt/53GMMHyrs7M3Opz988KHGBrf3YUDhAA+YTgSrTCCkHATkGyBa7IlRPApGwSgYBSMLAACvCW6SOnbNogAAAABJRU5ErkJggg==","orcid":"","institution":"University of Agricultural Sciences, Dharwad","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Arun","middleName":"Y","lastName":"P","suffix":""},{"id":164538346,"identity":"7bd71673-9fb7-4b4f-9d6d-ac70a5528096","order_by":1,"name":"Krishnaraj P U","email":"","orcid":"","institution":"University of Agricultural Sciences, Dharwad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Krishnaraj","middleName":"P","lastName":"U","suffix":""},{"id":164538351,"identity":"c3995e5c-a7a8-49c5-8a7c-6162fe3b2a63","order_by":2,"name":"Prashanthi S K","email":"","orcid":"","institution":"University of Agricultural Sciences, Dharwad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Prashanthi","middleName":"S","lastName":"K","suffix":""},{"id":164538352,"identity":"a94b081a-9b7b-4762-87cb-e19d6bd23e84","order_by":3,"name":"D N Kambrekar","email":"","orcid":"","institution":"University of Agricultural Sciences, Dharwad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"D","middleName":"N","lastName":"Kambrekar","suffix":""},{"id":164538360,"identity":"9e4c8712-4739-4c61-8936-aa84fa8e4553","order_by":4,"name":"Basavaraj Bagewadi","email":"","orcid":"","institution":"University of Agricultural Sciences, Dharwad","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Basavaraj","middleName":"","lastName":"Bagewadi","suffix":""}],"badges":[],"createdAt":"2022-12-28 09:29:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2421512/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2421512/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":31225078,"identity":"6e4bd46a-09cf-4052-8dd8-f125eb67e8d4","added_by":"auto","created_at":"2023-01-06 15:17:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":445269,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eActinobacterial isolates inhibiting the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e (RS4) by affecting the mycelial growth and sclerotia formation A. Pathogen control (RS4) B. OR02 C. DBT64 C. AUDT502. The inhibitory action of DBT 64 isolate on RS4 (P- Pathogen control (RS4), Q-DBT64).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/6c7b73a68c00e48870795fbe.png"},{"id":31223834,"identity":"4aa6b795-fa8c-44a2-940a-4ffa22b283f0","added_by":"auto","created_at":"2023-01-06 15:09:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":345359,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSteps in inoculation of sheath \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand confirmation of sheath blight disease A. \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e growth on potato dextrose agar media B. Preparation of pathogen inoculum on typha grass bits C. \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e inoculation to rice through typha bit inoculation method. D. Sheath blight symptoms after 17 days on pathogen inoculation on rice sheath in BPT5204.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/be615d27a427e276c0dc5ba8.png"},{"id":31225079,"identity":"a99cd046-ba87-4049-850c-cce01a7ac350","added_by":"auto","created_at":"2023-01-06 15:17:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":642533,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRice plants growth and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003einfection symptoms in rice at different intervals between pathogen control (P) and actinobacteria-pathogen (AP) treatments. (C-Healthy control, A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/a10e5442df8b5d8df452ab89.png"},{"id":31223836,"identity":"31ec147e-1948-4daf-9294-13b6d1272b44","added_by":"auto","created_at":"2023-01-06 15:09:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":181001,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of actinobacteria on growth parameters and disease incidence of rice under \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e infection. A. Shoot length B. Number of tillers C. Lesion length D. Table representing the disease score between two treatments actinobacteria+pathogen (AP) inoculation and pathogen inoculation (P). (C-Healthy control, A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/d55272918276f36ec3afddf1.png"},{"id":31226096,"identity":"432ec40d-9447-4677-9523-67623444d546","added_by":"auto","created_at":"2023-01-06 15:25:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":56155,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePrincipal component analysis (PCA) plots showing significant differences among and between the treatments and sampling intervals during biochemical analysis (A) and qRT PCR analysis (B) (PAL-Phenyl ammonia lyase, PER-peroxidases, PHE-phenols, CAT-catalases, PPO-polyphenol oxidases) (C-Healthy control, A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) (level of significance - p \u0026lt; 0.01)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/0d36c03c7a0c5b73fd43aef6.png"},{"id":31223843,"identity":"184a5b1b-01bd-4fc8-b627-2a1eb191e8d9","added_by":"auto","created_at":"2023-01-06 15:09:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1078659,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBar plots representing the biochemical analysis to study the effect of stress enzymes/compounds produced in presence and absence of sheath blight infection and actinobacterial inoculation (PAL-Phenyl ammonia lyase, PER-peroxidases, PHE-phenols, CAT-catalases, PPO-polyphenol oxidases). (C-Healthy control, A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) (level of significance - p \u0026lt; 0.01)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/a837624fbdfa4b6b6ead21fc.png"},{"id":31223842,"identity":"4700b106-c831-409f-8034-0b8654674884","added_by":"auto","created_at":"2023-01-06 15:09:07","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":155052,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBar plots representing the gene expression analysis of actinobacteria inoculated rice under \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003einfection (CBP- chlorophyll a-b binding protein-2, ASMT- Acetylserotonin-O-methyltransferase , 14-3-3 - 14-3-3 like protein GF14-E, Chitinase - Chitinase 8, NPR- Ankyrin repeat containing protein NPR1), (GST- Probable glutathione S-transferase, ICS-iso-chorismate synthase and PAL-Phenyl ammonia lyase) ( A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) (level of significance - p \u0026lt; 0.01)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/f5354f25ff8438a1ce531349.png"},{"id":31225077,"identity":"c1dfec89-45df-4972-80a5-7bae2e999479","added_by":"auto","created_at":"2023-01-06 15:17:15","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":62367,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation heatmaps showing differential biochemical activity of stress enzymes and differential expression of genes between the treatments and sampling intervals during biochemical analysis (A) and qRT-PCR analysis (B) (PAL-Phenyl ammonia lyase, PER-peroxidases, PHE-phenols, CAT-catalases, PPO-polyphenol oxidases) (C-Healthy control, A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) infection (CBP- chlorophyll a-b binding protein-2, ASMT- Acetylserotonin-O-methyltransferase , 14-3-3 - 14-3-3 like protein GF14-E, Chitinase - Chitinase 8, NPR- Ankyrin repeat containing protein NPR1), (GST- Probable glutathione S-transferase, ICS-iso-chorismate synthase and PAL-Phenyl ammonia lyase) ( A- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, P- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and AP - \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e) (level of significance - p \u0026lt; 0.01)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/2ec086c68cc633751ce482e7.png"},{"id":31223838,"identity":"b2478850-72e0-44d2-b4c3-5664f63cebfa","added_by":"auto","created_at":"2023-01-06 15:09:07","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":175983,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe overview of sheath blight resistance mechanisms observed during the tripartite interaction (Rice- \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eRhizoctonia solani \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eStreptomyces hyderabadensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e). The expression of genes represented in green (CBP- chlorophyll a-b binding protein-2, ASMT- Acetylserotonin-O-methyltransferase , 14-3-3 - 14-3-3 like protein GF14-E, Chitinase - Chitinase 8, NPR- Ankyrin repeat containing protein NPR1) were found to be enhanced in the presence of supportive/biochemical agents represented in orange (CAT-catalases, PER-Peroxidases, PHE-Phenols and PPO-polyphenol oxidases). The NPR (Ankyrin repeat containing protein NPR1) corresponding to induced systemic resistance (ISR) pathway were found to be enhanced and the genes corresponding to systemic acquired resistance (SAR) (GST- Probable glutathione S-transferase, ICS-iso-chorismate synthase and PAL-Phenyl ammonia lyase) were found to be suppressed during the actinobacterial inoculation under \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eR. solani \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein rice. The figure depicts the shift from SAR to ISR under the influence of genes corresponding to plant growth \u0026amp; development, signaling and plant pathogen interaction.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/0daad7d5665680630ce4c3db.png"},{"id":32520416,"identity":"d26dba9d-4db2-4fcf-8f64-fd2c1dddc62b","added_by":"auto","created_at":"2023-02-06 11:29:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4596845,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/42725430-f833-4519-8812-33c81932b563.pdf"},{"id":31225073,"identity":"068555b3-3084-4464-a935-35194bec2ced","added_by":"auto","created_at":"2023-01-06 15:17:15","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22613,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-2421512/v1/8c023ab7a146930e0b641552.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Shift in SAR to ISR during the Rice- R. Solani interaction mediated by Streptomyces hyderabadensis confers sheath blight resistance in susceptible genotype","fulltext":[{"header":"Background","content":"\u003cp\u003eRice (\u003cem\u003eOryza sativa\u003c/em\u003e L.), an important cereal crop and provides stable food supply for the majority of world population (Zhang et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Samal et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The biotic and abiotic stresses in rice are the major constraints for yield reduction in rice (Sinha et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The productivity of rice is affected by several plant pathogens among which, sheath blight pathogen \u003cem\u003eRhizoctonia solani\u003c/em\u003e causes yield loss up to 50 per cent (Molla et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Sheath blight of rice is the soil-borne disease caused by necrotrophic fungi \u003cem\u003eRhizoctonia solani\u003c/em\u003e K\u0026uuml;hn which belongs to the division Basidiomycota (Lee et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The flexible adaptation of pathogen, lack of resistant varieties due to failure in identifying the single resistance genes corresponds to successive pathogen attack and susceptibility of rice to sheath blight disease (Singh et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Understanding the ability of plants to develop acquired immunity after pathogen infection and the knowledge about plant immune signaling at molecular level are the challenging tasks during plant pathogen interaction (Klessig et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In contrast to innate immunity, the concept of induced defense adopted by plants acts as a protective barrier during major stress situations (biotic /abiotic) (Jiang et al. 2016). The systemic acquired resistance (SAR) and induced systemic resistance (ISR) are the major induced defense mechanisms adopted by plants. SAR pathway activates prior to pathogen infection and ISR pathway activates during plant interaction with non-pathogenic rhizobacteria (Panpatte et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The SAR mechanism is regulated by salicylic acid (SA) pathway and activated during the attack of biotrophic pathogen and the ISR mechanism is regulated by ethylene and jasmonic acid (ET/JA) production pathway and activated during the attack of necrotrophic pathogens in plants. The induced production of salicylic acid and jasmonic acid at relative concentrations can be adapted to reversible shift from SAR to ISR to tailor plant resistance during biotic stresses (Mur et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The SA and JA mediated defense responses are mutually antagonistic mechanisms and the relative shift from SAR to ISR in plants during the infection of necrotrophic pathogens confers resistance in plants orchestrated by major plant hormones such as abscisic acid, gibberellic acid and brassinosteroids (Li et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe introduction of biological control agents (BCAs) alters the interaction among plants, pathogens and environments, leading to biological and physical cascades that influence pathogen fitness, plant health and ecological function (He et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The potential effects of microbes towards enhancing yield level and antagonism towards pests and disease causing microorganisms are being adopted in the new trend of research (Rehman et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Bio-control agents are the main tool in the present scenario to combat the biotic stress in rice caused by phytopathogens (Firdaus et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). A plethora of bio-control agents such as \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eStreptomyces\u003c/em\u003e have been potentially characterized based on \u003cem\u003ein vitro\u003c/em\u003e experiments and field trials (Prasad et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Actinobacteria are Gram-positive, morphologically and physiologically very diverse bacteria with a high GC content in their DNA (Undabarrena et al. 2016). Actinobacteria affects plant growth directly through antagonism towards soil-plant pathogens by competitive colonization or biosynthesis of antibiotics and indirectly by nitrogen fixation, siderophore synthesis, phytohormone synthesis and solubilization of minerals to make them available for plant uptake and use (Barka et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The genus \u003cem\u003eStreptomyces\u003c/em\u003e is largest among actinobacteria, predominantly found in soil and various habitats such as marine/mangrove environments and plants (Law et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Various studies reported the inhibition of sheath blight pathogen \u003cem\u003eRhizoctonia solani\u003c/em\u003e by bio-control agents belonging to \u003cem\u003eStreptomyces\u003c/em\u003e spp, \u003cem\u003eTalaromyces\u003c/em\u003e spp, \u003cem\u003eTrichoderma harzianum\u003c/em\u003e and \u003cem\u003eBacillus subtilis\u003c/em\u003e highlighting the potential nature of secondary metabolite production during pathogen inhibition under \u003cem\u003ein vitro\u003c/em\u003e and greenhouse conditions (Suryawanshi et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Abbas et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Rashid et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The actinobacterial inoculation induces systemic resistance in plants under pathogen stress and facilitates the activation of various stress hormones and detoxification enzymes to maintain the cell redox potential and stabilizes the plant metabolism under biotic stresses (Hata et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Taha et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The qRT-PCR analysis is a widely used technique for the analysis of gene expression. Accurate estimation of transcript abundance relies strongly on a normalization that requires the use of reference genes that are stably expressed in the conditions analyzed (Pombo et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). As a complement to RNA-seq, qRT-PCR allows researchers to investigate transcriptional changes between experimental conditions in a more focused manner. It is used routinely to monitor gene expressions \u003cem\u003ein-vitro\u003c/em\u003e (Smith et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe current study hence was focused to understand molecular and biochemical basis of efficient actinobacteria mediated rice defense mechanisms against \u003cem\u003eRhizoctonia solani\u003c/em\u003e infection based on qRT-PCR analysis.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn vitro\u003c/span\u003e \u003cstrong\u003escreening of actinomycetes for antagonistic activity against selected plant pathogens\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe isolated actinobacterial isolates maintained at Microbial Genetics Lab, Department of Agricultural Microbiology, University of Agricultural Sciences, Dharwad, were screened against \u003cem\u003eRhizoctonia solani\u003c/em\u003e RS4 strain collected from Department of Plant Pathology, UAS Dharwad and confirmed by molecular characterization (MK213724). The antagonistic activity was detected by dual culture test as described by Suryawanshi et al. (\u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e). The actinobacterial isolates were streaked in the middle of a plate containing L-Arginine medium. After 4 days of incubation the agar plugs of pathogen grown on PDA plate were placed at the corners of the petriplate and the observation for antagonistic activity were taken after 5 days after incubation at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eMolecular Identification Of Potent Actinobacteria\u003c/h3\u003e\n\u003cp\u003eThe efficient isolate selected based on the dual culture technique was subjected to molecular identification through amplicon sequencing after amplification of 16S rRNA gene using universal primers (27F and 1492R) (Pralhad et al. \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e). The amplified PCR products were sent for amplicon sequencing at Eurofins scientific India Pvt. limited. The obtained nucleotide sequences (forward and reverse) were subjected to contig generation using Bioedit software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioedit.software.informer.com/7.2/\u003c/span\u003e\u003c/span\u003e). The generated contig sequences were subjected to BLAST analysis using NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blast.ncbi.nlm.nih.gov/Blast\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eGreenhouse Experiments\u003c/h3\u003e\n\u003cp\u003eThe potent actinobacterial isolate selected based on dual culture technique was screened for control of \u003cem\u003eR. solani\u003c/em\u003e in infected plants of susceptible rice variety BPT5204 as per the protocol followed by Suryawanshi et al. (\u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e), with four treatments (C-Healthy control, A- \u003cem\u003eStreptomyces hyderabadensis\u003c/em\u003e, P-\u003cem\u003eRhizoctonia solani\u003c/em\u003e and AP-\u003cem\u003eRhizoctonia solani\u003c/em\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eStreptomyces hyderabadensis\u003c/em\u003e) and 10 replications. The selected efficient actinobacterial isolate was applied as seed treatment to paddy seeds. Twenty five grams of seeds were soaked in the suspension culture of actinobacteria grown in Starch Casein Broth (SCB) with concentration of 10\u003csup\u003e8\u003c/sup\u003e CFU/ml and subjected to shaking in a magnetic stirrer for half an hour and dried in a laminar air flow for overnight. The dry seeds were taken forward for sowing. Ten days before sowing, 5ml of 10\u003csup\u003e8\u003c/sup\u003e CFU/ml per 5kg of soil were added to the treatments (A and AP) (Mawang et al. 2020). The paddy seeds were sown in a pot randomly for the seeds to germinate in a wet soil. Then 15 days old seedlings were transplanted to plastic pots of 6 x 6 inch filled with autoclaved and wet soil and compost mixture in 2:1 and used for further experimentation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInoculation of\u003c/strong\u003e \u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eRhizoctonia solani\u003c/span\u003e \u003cstrong\u003e(Colonized typha bit inoculation method)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe typha (\u003cem\u003eTypha angustata\u003c/em\u003e L.) bit method of inoculation was performed according to Bhaktavatsalam et al. (\u003cspan class=\"CitationRef\"\u003e1978\u003c/span\u003e) with slight modifications. For this, typha shoots were collected and cut into 4.0\u0026ndash;5.0 cm bits with the help of sterilized knife. The bits were washed, soaked in distilled water for two hours and dried using tissue paper. The dried typha bits were transferred to a new conical flask and autoclaved twice for two consecutive days. Later, the typha bits were inoculated with three days old actively growing culture of RS4 using cork borer and inoculation loop in sterile condition. The inoculated typha bits were incubated at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C for 12\u0026ndash;15 days or till the time the typha bits were completely covered with fungal mat and sclerotia was formed over it. The fifteen days old typha bits with mycelium and sclerotia were placed between the tillers in both the treatments (P) pathogen inoculated and (AP) pathogen and actinobacterial inoculation for sheath blight disease inoculation.\u003c/p\u003e\n\u003cp\u003eAfter 30 days of transplantation, the treatments (P and AP) were infected with \u003cem\u003eR. solani\u003c/em\u003e by typha bit inoculation method and the sheath samples from all the four treatments were collected for biochemical and qRT-PCR analysis at the interval of 15, 20 and 25 days after pathogen inoculation. The disease reaction was expressed as Relative Lesion height (RLH)\u0026thinsp;=\u0026thinsp;Lesion length (cm)/Plant height (cm) (Sharma et al., \u003cspan class=\"CitationRef\"\u003e1990\u003c/span\u003e). The percentage was then used with the scoring table (Supplementary table 1) to determine \u003cem\u003eR. solani\u003c/em\u003e effect on rice (Jia et al., \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eThe disease reaction of BPT-5204 against \u003cem\u003eRhizoctonia solani\u003c/em\u003e infection was measured in terms of relative lesion height percentage (RLH %) at 15, 20 and 25 days post inoculation (dpi). RLH % was calculated using the following formula according to 0\u0026ndash;9 grade scale of Standard Evaluation System (SES) (IRRI, 2002).\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAccAAAByCAYAAAAmjBrAAAASP0lEQVR4nO3dv6vb1vvA8cdfvnsLHQohhGL5b8hQ7DtkiO5cMtidMhVk6BbsJUOHLjZdulxDoZAp9pA/4DqFDJHokL/hSoSQZm62QAv6DOmje/RYP3394yb3/QKTxLZ0jo6O9EjP0XE6aZqmAgAAMv937AoAAHDdEBwBADAIjgAAGARHAAAMgiMAAAbBEQAAg+AIAIBBcAQAwCA4AgBgEBwBADAIjgAAGARHAAAMgiMAAAbBEQAAg+AIAIBBcAQAwCA4AgBgEBwBADAIjgAAGI2CY5Ik0ul0al/j8Ti33Gq1Kv1uFEWFZc3n89Jlquphyy4TRZF0Op3ce71er7Ze+r3VarXx/mq1ktPT00blX1Vdm7rb4r7a1G88Hrdexl1OX00kSSLz+bxVOXVOT09z9Shbv+1PvV5PRD62sfYD295l/UP7Vd2rblvteor627a0b+y6vT8l25wzrsLtS7swn88Pcq7Rc8mhaf8vazN7PCZJUvg99xywdXulLSyXy1REUhFJgyDI3p/NZtn7nudtLBcEQfb5bDZrVJbv+9kyy+Uy91kYhpXlldF6xHG8UU4cx7m/Fy1r61G37n2qatM4jrPPWu7iNE0v28T3/a2XbVqu53mN+0TT9Wn/1P5atB3ah9x+7LZbGIbZ+27/dt8v4n7X3S63Xera1T3OqvpcW22Pwc+Ru4/dfb/Psur6TFOe57U6312V9uVd1b9JWVXHmX5Hjwk9B9rv6jlAtY0Taidp1clkIr7vi4hIHMc7vdrdlfl8LovFQsIwlG63KyIfr1LW67V4nifdblfu3bsnIiK//PJLblndnuFwWLr+s7Mz8X1fPM8rvZr5VJyfn0uapnJ+fr7Xcnq9nsRxvLP1JUmSW99wOCzdjp9//llERB49epS91+125eOxtHtuHdbr9VH6SJqmkqapTCaTg5d90yRJIp7n7Wx9p6enEsexXFxc7GyddSaTiQRBIIPBYKd3v9Z8PpfpdFr5nSRJsu/oefjk5ERELo9lXVccxxIEQfae7/tbxaWdjTlqwLmOoiiS6XQqvu9Lv9/P3n/79m3h990TV5IkMhqN5OzsrLacx48fi4gcJF1zVWWpPjcdYdMqNl1Zl250U4RuakPTmRrIptNpoxSiTRm7+ymKotzJaLFYVKZ29STz6tWrjc9ms1llPdqmjnepKl3kDklEUZT7vCqdaIcybNrVLuvWoekJZ59l2D7rpvfbHIs2ZWeXdfvf6elprhx3e1arVa4vDgaDXH911xFFUW2aez6fy3q9LuyXdmjA3ee2Xez2iWym8S29eHz48GFlHYuGudz2qtrGyWQiaZpWHndFx+nt27dFJH+x+eLFi43vaWx68uRJ5TZsaHObWZZWTdN82simFo+dVtV12fXo9ug69LbdTXv5vp/dtuvtetG6lH6nLBVhU55VryrbplX1M91mbQN3HboNbtu66Uq3fNv+Nn3o1kXbLAzD3D5s0ids3ypr57L+WdV+VfsrTTdTPkXtUfTdsrRqXaq0LK2qZcZxnLWr9lX9t5ap5amydKK2gy6n9S9LN2tbudtZN5RwiDKKjs2ifVTXDvY7tm+6dVwul7l9pX3I1t3tW245egzU9f+yNtDl9RjUfe5ul9su+r67Ddp/qo6bsvOn5Zal29xmaKZq+MI9Xu32u3Wr2rctw91u0qp6ZSMiubTlroxGo9xVyWAwaLW81k2vNJT9t9L6z+dzuXfvnvT7/Sytobfso9Go8G5J77aePn1auu70v/RW3aspvfPSV1U6R6+Gf/jhh1wb/Pbbb6XLRFGU3eVpKkP/jOO4NOVi05kvX74UEcndvTehV52a/hYRuX//vojUX9GWOTs7K7y6rxu8D8Mw9+/nz5+XftfdL+v1WnzflzRNK9PzZTRd5Pu+dLvdrB30qlmvrHU/np+fZ0MdZZIkkcViISIi3377be7PxWJRuF+DINjYf+/evTtqGS7P87L21T6u5VfR78zn89z56/Xr14Xf931/Yz9qJqqqf2t/Wa1W0u/3N/qT5baPPa9q39ftrDoWPM/Lsl/a7z3Py45Rfa8o3d/0zstN+T58+FDG43GjjFsTTYYhdj1UsXVw1LRVp9OR6XQqQRBImqatT3xNLJfLXNCo61Aut3PdunUr91m/3xfP8ySOY0mSJLslf/TokURRJC9evJDJZCJJkmQBttvtyjfffCMi+Vy30o5UddLctdlslmufqnE83Q49ceuFhrbBdaQnfDfNq/vgKvW+uLiQ5XKZe2+9Xlc+BdeGu1+Wy2W27m2eAtS+qetwU2CvXr2Su3fvisjH9tBUZN2Y8bNnz7K/67HhHiN//vln63oeo4wyd+7cyf5eN2amFxLuMvugF3Wj0Uh6vZ70+/3KMWBtH3vBa8fXRS7H2K8SkIrGNPVY03NHFU2NxnEsJycn13q4rc7WwTEIglyQWiwW1/JBnLJxRaWdwfM8Wa/X2Z3vYDDITi5F+W532TaaTovZx3iWe8LXixn3VdaR9SJC5PLuT//0PG8vF0RtNL2rcOkdtJ5Q7Ilm1+PGw+Ew99Ba2+kUbj+1+204HEq3280dj6PR6MqP/JfdNe3SIcpoQh9Ce/PmTe7Y2/UFoz64J3J5IVMVuMvaZ5s+fwhuoNdnMHahSZDddSC+Ulq13+/nrrzLUo1N7Ho+UBvuiUZTqG3uTtvYR1p1G20P+ouLCwmCIMsYLBYLCYLgoE/PlbEZgSZsqk33i175NrlKbqtJuq5OVVag3+9LmqbZyXe9Xl/pglXvGPbpEGU0oRet0+l078fe+fl57vyyzdCA2+evywWG0idFdzlzoa6faOakakipbpjBuvKY43A4zD0223Y8UD1+/Hirk1ydsnHFMu44o9KGtzRF8qnodrtZ52k7nSCKIkmSJBe8dzWeUEfb2Q3EekJwxyHbKro71PGwtgdSE257tw0Kbl8rOuFEUZS9f35+nl20vnnzpnSduq0il3ci7h2J+/m2DlFGGXfb67IbelzUPal8Vdrn9EJGh3XKlPUT91huMqZ6KKvVSk5OTrK67eru8cGDB6Wf6Ti8yOX4a5G2FyE7eSDHTRWISOsxFZ3vto/8tHtQ1KUi3HFGV7fbzbbPHZv8/vvvN9ahJ8DrGjjdcVI3ONTts8FgkBvvavIrFVXshdB8Pi9djwZhd3xRx3TLHhJoUqfFYrGx3do+u0wJiXxsa70b9Tyv9VxDdz7maDTKrVczLqPRKAuQelFYFXz6/X52YatjW/pn0UMx2zhEGS73bkXHqt2L9yI2Y7WLDJYdu9RjLUmSXJ/r9XqVF2K6/4oCaNGxbNe/C3ohWnfBuFqt5OXLlzIcDrO6xXHcOL3vTsOww2Hdbje7cNH9qw89usfqZDIRz/NyFwyLxSL3oFZjTR5prZp+4D7eaz/78ccfG09bsNMpil5V9ah6dN8+Sl5EHwuuUvSoctl39vWrEu6j4/YVhmGuju7LfaS6aB36mLg75cBdrm7/penm9Iiiurj7oGzaQxm7PvfRdvexbluvIrpddjk7NaWorWw9dLpPk35e9zh80Xq0LxX1f3d6zHK5zO2DqmOzbD8U7Yu67bf7osi+y3CnH7ltYM8LZe3gluf7fu440HXYOhXV0T3u3XXo+0EQ5PZjk6loVecU2z/d9RUdy0V9t+g9V5OpHLZNbbtUTemw542qfW7XXdYn7P7cRvvfFvsE2Tlhn3o5x1A3P/NQP5sHFCmam/u5KJqLfEifa7vWuRH/K4fekq/X670+9KM/O3eosbhD0Z/CslNq0v+mKADYH33Sue4n1vZBn6pu/esyn4EbERxF8r8TuI/5fOPxWBaLxd7GTo9Jx2p1+obryZMnEgTBZ7fNwHVyfn4unucd9H/K0N88DcPw6NO1jqGTpnt+bvmaiaJIBoPBTh/XXq1W8uTJk73/UPcxabtZv//+u3z33Xet1vX3339fqS5XXf461eNzWcf79++PVoc//vhD/vrrr9x7g8FAvvrqq4PV4VDreP/+vXz48EG+/vrrvdbj33//lX/++Uc+fPiw9To+dTcuOH5ufvrpJ/n1118bffeqB+2XX355peV3tZ7PqR7XZR1ffPHF0etwHdZxHerwua3jU0Vw/Aw0DXo3uaMDQBsERwAAjBvzQA4AAE0RHAEAMAiOAAAYBEcAAAyCIwAABsERAACD4AgAgEFwBADAIDgCAGAQHAEAMAiOAAAYBEcAAAyCIwAABsERAACD4AgAgEFwBADAIDgCAGAQHAEAMAiOAAAYBEcAAAyCIwAABsERAACD4AgAgEFwBADAIDgCAGAQHAEAMAiOAAAYBEcAAAyCIwAABsERAACD4AgAgEFwBADAIDgCAGAQHAEAMAiON0ySJNLpdApf8/lcxuNx6edNrVar1svY5TqdjkRR1Gi58Xjcqpw68/k8V4/T09Pc51EUlbZRUd3t91er1U7rW6Rtm2gdD6HT6UiSJAcpC9haihtpuVymIpKKSOr7/sbnnudln4dh2Grds9ksW7Ytd9km5QZBUFj/bQVBkIpI6nleGsdx5XYU1VWXF5E0CILsu257L5fLndW3iJbVlNY5juM91upSGIapiKSz2ewg5QHb4M4ROzeZTCRNU0nTdK/ljMdjWSwWO13n8+fPs793u93W23F2diae54mIyGKxOPgd0mq1ktFo1Pj78/lcFouFhGEo3W53jzW71O/3ZblcynQ6lfl8fpAygbYIjtjK6elpYdrRpiTd4GA/syndImVp3V6vlwXG9XotnU6nNpVoU8Y2vdnpdCSOYxERieO4VWq3zLt372q/U1WvopRsWfuOx+NcYOx0OtLr9UrLjaJIptOp+L4v/X5/4/Ner1fY/nY/2jpqm1WlyIfDoXieJ9PplBQrrqfj3rjiWK6SVtXP4jjOUo/uOtzUoqbq3HSlLd9N57mpSu2eWp6mKd1yy+pv+b6fS2lqfWxqT7+n9axSlgJ266/bVpZW9Twvq7/7HXd97vvaJkX1DMMwe7/JoW3bxOXWX7fTLcvdx/q+W3ZVPW37ueln4LrgzhHZnZf70jsoaz6fSxzH4vu+dLvdLBW3Xq8r7wD0Lu/+/fsiInL37t3ss2fPnhUuE4Zh7t+a8nTLbSKKIlmv17lyT05ORER2fufi3r3OZrPKekZRJHEcy3q9liiK5Pbt29lnb9++LVxmuVzm/u3up6K7vyraJm65IpfboPv4wYMHletx94utl75X1J/u3LkjIrLz1DiwCwRHiO/72diavnTczHrx4oWI5AOqevXq1UHq29bTp0+zv+vJ2g0Iu6j3YDCQTqeTnejjOJbJZFK5jBvMbt26deU6tOGmOW3Z7riryOXY68XFxZXKtBch7j64avoa2DWCI1rRE6TneRsBdTgcli4XBIGIXJ543YBUd2eyb2/evLnyOsIwzLVF0ztb/f54PJbBYLDTOlUpuzMVKb7LA24agiO20vYEenZ2JsvlMnvQZTQaZQH2UE9JltH03jHoAzYim2nkY9GswVXvFIFPGcERreiYoYi0nsw+Go1yd1eHOvnq+KLIZWrPvXNyxz8PKYqi7OnSx48fH7RsO87o0n0cxzHpTtxYBEe08ujRo+zv7rSB8XhceSLV6R5F0zi2/cUYd1w0iqLS9QyHQ/F9X0Qu07kvX74UkfKHZg6RWvzzzz8r/70Nuy1l01vc8U473cTdxw8fPsz+3uv1dvrwknuB0vZhImDvDv14LI7LnQJhX7PZLPeIvn1VrUOnA9ipGGIe6S97hWG4MWVB/psC4P7bnbahv7Ri3y9jt81OYSirl+WWW9ZGdd8Pw3CjHW3bLZfLwmVtm9hpEnX1se1R9Es1RftYp6UU7eOiflP0noupHLjOOmm6558xAf7T6/VK78iWy2XlAz3YvSRJxPM88X1fzs/PD17+6emprNdrieP46OPOgEVaFQfR6/Xk/v37G0+48mTk8XS7XZnNZtk8y0PSuad1c0GBY/n/Y1cAN0Mcxxvz50Q+/gCA53ncNR7JZDKR169fy2AwONgdXBRFMhgMZDab1c4FBY6FtCoOpui/RAqCQM7Ozo5QG7g0YB3idKC/wMQdI64zgiMAAAZjjgAAGARHAAAMgiMAAAbBEQAAg+AIAIBBcAQAwCA4AgBgEBwBADAIjgAAGARHAAAMgiMAAAbBEQAAg+AIAIBBcAQAwCA4AgBgEBwBADAIjgAAGARHAAAMgiMAAAbBEQAAg+AIAIBBcAQAwCA4AgBgEBwBADD+B5LCWrxQYCgrAAAAAElFTkSuQmCC\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003ch2\u003eBiochemical analysis\u003c/h2\u003e\n\u003cp\u003eSheath samples of four treatments were collected from rice plants at different sampling intervals (15, 20 and 25 days) the collected samples were subjected to biochemical analysis based on standard protocols mentioned: peroxidase (Hartee \u003cspan class=\"CitationRef\"\u003e1955\u003c/span\u003e), polyphenol oxidase (Mayer et al. \u003cspan class=\"CitationRef\"\u003e1965\u003c/span\u003e), phenylalanine ammonia lyase (Ross and Sederoff 1992), catalase activity (Miller, \u003cspan class=\"CitationRef\"\u003e1959\u003c/span\u003e) and phenol content (Sadasivan and Manikam 1996).\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eReal Time‑pcr Assays\u003c/h3\u003e\n\u003cp\u003eThe harvested sheath samples of rice were taken forward for qRT-PCR analysis. Genes involved in plant-pathogen interaction, signal transduction, salicylic acid and jasmonic acid pathways were selected (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u0026nbsp;\u003c/p\u003e\u0026nbsp;\u003ctable border=\"1\" id=\"Tab1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimers for qRT-PCR analysis to study the genes expressed during the rice- \u003cem\u003eR. solani\u003c/em\u003e interaction in presence and absence of actinobacteria. F- Forward primer, R-Reverse primer\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGenes\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDescription\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer Sequences\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eHouse keeping\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOsEF-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOryza sativa\u003c/em\u003e elongation factor-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-AGTCACATGCTGCCTAAGGTT\u003c/p\u003e\n \u003cp\u003eR-TCACTGCCAGCTTACGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBlanvillain Baufume et al. 2017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eDetoxification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGST2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProbable glutathione S-transferase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-GGCGACCTCAAGGAGTCAGCA\u003c/p\u003e\n \u003cp\u003eR-CATCATCGGACGGATTAGGCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eZhang et al. 2015\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhotosynthesis related protein\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCBP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChlorophyll a-b binding protein 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-CGTCTCTGCAGGAGAGTGTG\u003c/p\u003e\n \u003cp\u003eR-ACTCGTACATCCATCCACGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSekhar et al. 2019\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePlant growth and development\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eASMT2-RT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAcetylserotonin-O-methyltransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-ACTGTGCTGGATCTGCCTCAT\u003c/p\u003e\n \u003cp\u003eR-ACAACATCGGCTGCTGGAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHong et al. 2018\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eSystemic acquired resistance (SAR)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14-3-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14-3-3 like protein GF14-E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-GCCGCAGCCACTGAGAAAAAC\u003c/p\u003e\n \u003cp\u003eR-TCATACCTCTCGGCCTGCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMirzaei et al. 2012\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCHI8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChitinase 8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-GTGGAACGAGGGGTAGTTCTG\u003c/p\u003e\n \u003cp\u003eR-TGGTAGTTCGATTGCCCTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRicha et al. 2017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eICS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIso-chorismate synthase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-TGTCCCCACAAAGGCATCCTGG\u003c/p\u003e\n \u003cp\u003eR- GGCCCTCAACCTTTAAACATGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKyndt et al. 2012\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePAL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePhenyl ammonia lyase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-CCCTGCCAATCTGCTGAACTA\u003c/p\u003e\n \u003cp\u003eR-GCCGCTATGCAACGAAGAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChandler et al. 2015\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eInduced systemic resistance (ISR)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOsNPR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnkyrin repeat containing protein NPR1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-CACGCCTAAGCCTCGGATTA\u003c/p\u003e\n \u003cp\u003eR-TCAGTGAGCAGCATCCTGACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eYuan et al. 2007\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eThe rice sheath samples up to the maximum lesion height were collected on 15, 20 and 25 days after pathogen inoculation and subjected to RNA isolation. RNA isolation was performed using TRIzol reagent (Invitrogen, USA) by following the protocol given by the manufacturer. The genomic DNA contamination was removed Invitrogen TURBO DNA-free Kit was used to remove genomic DNA from the isolated RNA as per the manufacturer\u0026rsquo;s protocol. Applied Biosystem\u0026rsquo;s High-Capacity cDNA Reverse Transcription Kit was used for single-stranded cDNA synthesis as per the manufacturer\u0026rsquo;s protocol. TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus) was used to perform the quantitative real-time PCR (Quant Studio 5, applied biosystems, USA) to analyze the gene expressions of target genes across the treatment samples. A 10 \u0026micro;L reaction mixture consisting of 5 \u0026micro;L TB Green Premix Ex Taq (Tli RNaseH Plus) (2X), 0.2 \u0026micro;L ROX Reference Dye (50X), 3 \u0026micro;L nuclease-free water, 0.5 \u0026micro;L each forward and reverse primers, and 1 \u0026micro;L cDNA (30ng concentration, previously determined through standard PCR), was prepared and loaded into the wells of an optical plate. The thermal cycling conditions used according to the instrument cycling parameters followed by Prashantha et al. (\u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Annealing temperatures of the specific primers were standardized by gradient PCR (Nexus gradient mastercycler, Eppendorf, Germany). The qRT-PCR was performed in triplicates on the real time-PCR instrument. The differential expression of the replicated count data obtained for the healthy control was further used for clustering the replicated count data and relative fold change expression values. The analysis of CT values obtained from the qRT-PCR were normalized and analyzed with minor modifications as per Zhang et al. \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e. The difference between the threshold cycle (Ct) values of the gene of interest (GOI) and the housekeeping gene (that acts as the internal reference or normalizing gene) (norm) was calculated (\u0026Delta;Ct value) for the respective templates to normalize the expression values of a targeted gene under study. The \u0026Delta;\u0026Delta;Ct values for target transcripts of treatment samples was calculated for finding their relative expression levels compared to the control Finally, the fold change expression data were obtained using the formula 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e. The error bars indicates the standard deviation calculated from three technical replicates on each of two independent biological replications among four treatments (Prashantha et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eThe bar graphs were constructed using Anaconda Package 3 Python 3.9.12. (Anon \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e). The principal component plots and correlation heatmaps were constructed using Clustvis software version 2.0 (Metsalu et al. 2015) with default parameters.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eIn vitro\u003c/span\u003e \u003cb\u003escreening and identification of efficient actinobacterial isolate and confirmation of pathogen virulence\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe present investigation was conducted to identify the efficient actinobacterial isolate against \u003cem\u003eR. solani\u003c/em\u003e under \u003cem\u003ein vitro\u003c/em\u003e and greenhouse conditions based on biochemical and gene expression analysis. Based on dual culture technique, three isolates showed unique character in inhibition of pathogen (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (ABCD)). Based on the repeated experiments and phenotypic observations the isolate DBT 64 found successful in imposing stress on pathogen growth and affecting sclerotia formation in plate (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (P and Q)).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe isolate DBT 64 was subjected to 16S rRNA sequencing after amplification using universal primers. The obtained contigs of respective isolates were taken forward for BLAST analysis with blastn algorithm in NCBI database and submitted to NCBI database. The results found that the isolate DBT64 was found to be 99% similar to \u003cem\u003eStreptomyces hyderabadensis\u003c/em\u003e (ON573299). The initial confirmation of pathogen and its virulent nature (Koch\u0026rsquo;s postulates) to affect the rice plants to provide exact symptoms was studied prior to greenhouse experiments. The steps in pathogen infection and disease development were shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The sheath blight symptoms were observed after 16\u0026ndash;21 days post inoculation of pathogen through typha bit inoculation method.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eEffect Of Actinobacterial Inoculation On Rice Growth And Disease Resistance\u003c/h3\u003e\n\u003cp\u003eThe observations with respect to growth parameters and disease incidence among all the four treatments were recorded at 15, 20 and 25 days after pathogen inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe growth parameters such as shoot length and number of tillers between three intervals were recorded (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The shoot length showed significant difference between four treatments. The comparison between P and AP treatments showed that shoot length is compromised significantly in pathogen inoculated rice plants (P) and the growth promotion in actinobacteria and pathogen inoculated (AP) were in accordance to the growth of healthy control rice plants (C) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The number of tillers produced was constant between the day\u0026rsquo;s intervals (15, 20 and 25) but differed between the treatments. The average tillers produced in healthy control (C) at three intervals (4\u0026ndash;5), actinobacteria inoculated (A) (5\u0026ndash;6), pathogen control (P) (2\u0026ndash;3) and actinobacteria-pathogen inoculated (AP) (4\u0026ndash;5) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The contribution of actinobacterial inoculation towards disease incidence was assessed through lesion length formed in two treatments (P and AP). The disease scale was assessed based on lesion length in percentage. The percentage disease incidence at 15, 20 and 25 days in case of pathogen (P) infected rice plants were more than 10% and less than 30%, the disease score was 3 at all the intervals. The percentage disease incidence in case of actinobacteria-pathogen inoculated rice plants were less than 10% hence, disease score was found to be 1 in case of all the intervals of sampling (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eBiochemical Analysis\u003c/h3\u003e\n\u003cp\u003eTo study the effect of stress molecules in plants that participate and tend to show differential expression during plant stress to maintain cellular homeostasis, the biochemical analysis of five major stress enzymes/compounds such as phenol content, peroxidases, polyphenol oxidases, phenyl ammonia lyases and catalases were studied in different treatments (C, A, P and AP) and at different intervals (15, 20 and 25 dpi). Sheath samples were used to estimate the level of these enzymes produced at different intervals. The principal component analysis of activity of biochemical enzymes at different intervals between the treatments in actinobacteria\u0026thinsp;+\u0026thinsp;pathogen treated samples (AP) compared to pathogen control (P) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe phenyl ammonia lyase activity, peroxidase, phenol content, polyphenol oxidases and catalases activity was significantly increased in case of actinobacteria\u0026thinsp;+\u0026thinsp;pathogen inoculated samples. The activity of PPO was enhanced in healthy control samples, the actinobacteria treatment (A) enhanced the levels of all the biochemical enzymes and phenol contents compared to healthy control (C). The bar graphs representing the levels of biochemical activity between the treatments at different sampling intervals were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. The correlation analysis of biochemical enzymes based on the level of production of biochemical compounds at different intervals and between the treatments showed that the actinobacterial inoculation may facilitate the rice plants to increase its biochemical activity during the pathogen attack that probably contributed to the disease resistance (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eQrt-pcr Analysis\u003c/h3\u003e\n\u003cp\u003eBased on growth parameters and biochemical analysis, genes related to photosynthesis, detoxification/response to stress, SAR and ISR were selected in rice based on previous studies. The expression fold of genes was calculated against the healthy control (C) after normalizing the CT values with housekeeping gene. The principal component analysis of differential gene expression based on fold change showed significant differences between the treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). The results of qRT-PCR were shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe expression of chlorophyll a-b binding protein gene was increased at 15 and 25 days post inoculation due to actinobacterial inoculation. The comparison between pathogen (P) and actinobacteria and pathogen inoculated (AP) the expression was on par at 15 and 20 days but at the later stages the expression increased in actinobacteria-pathogen infected samples compared to pathogen control (3.2 and 3.5 fold) in P and AP treatments respectively. The expression of glutathione-s-transferase gene was found to be 5.8 fold in case of actinobacteria treatment (A) at 15th day sampling but expression was decreased among all the treatments at later stages of observation at different intervals among all the treatments. The expression pattern of iso-chorismate synthase gene was similar to GST gene which was observed only at initial stages up to 2.34 fold at 15 days in case of actinobacteria inoculated sample (A). The expression fold in the treatments P and AP was found to be less than 1 fold at all the intervals of sampling. The ASMT gene was highly expressed (288 fold) in pathogen treated samples at 20 days after pathogen inoculation, showing the imbalance in the cell redox homeostasis in rice due to pathogen attack. The expression of gene corresponding to 14-3-3 like protein which is known to be involved in cellular signaling process under stress in plants was increased at the rate of 3 fold at 15 and 25 days due to actinobacterial inoculation (A). The higher expression levels in between P and AP was found in AP treatment at 25th day sampling. The signaling process was enhanced due to actinobacterial inoculation under pathogen infection. The chitinase gene expression was found to be enhanced by actinobacterial inoculation in presence and absence of pathogen at 15 and 25 days that insist the initial activation of chitinase gene due to the actinobacterial infection. The pathogen treated samples showed chitinase gene expression at 20 and 25 days (1.5 and 1.1) fold respectively. The resistance may be due to the initial activation of chitinase gene due to actinobacterial inoculation prior to pathogen infection. The expression of PAL gene was found 32 fold in case of actinobacteria treated sample, 14 fold in pathogen control (P) and 1.78 fold in case of actinobacteria treated sample at 15 dpi of pathogen. The results correlated with biochemical assay results where effect of PAL during actinobacterial inoculation increased at initial stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). At 15 days interval the expression of NPR gene in case of actinobacteria and pathogen treated (AP) samples was found 3.64 fold, but in case of Pathogen control (P) and actinobacteria treated samples 1.84 and 1.54 fold respectively. The initial activation of NPR gene enhanced the initial defense in rice to combat sheath blight pathogen attack at later stages of growth. The correlation analysis of genes expressed based on the fold change at different intervals and between the treatments showed the differential expression pattern of SAR, ISR and genes involved in plant growth promotion and plant defense against invading plant pathogens which clearly indicates the effect of actinobacterial inoculation prior to disease development in rice (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe molecular and biochemical basis of selection of efficient actinobacterial isolate contributing to plant defense against plant pathogens forms the basis of this study. The overall results from \u003cem\u003ein vitro\u003c/em\u003e screening, greenhouse experiments, biochemical analysis and qRT-PCR analysis highlighted the significant effects of actinobacterial presence in the rhizosphere in modulating resistance mechanisms in rice at various stages. The collection of samples and gene expression analysis were done at different intervals to study the effect of sheath blight pathogen attack and understand the differential gene regulation during the compatible interaction. The gene expression studies in rice during the \u003cem\u003eR. solani\u003c/em\u003e infection were done at 24, 48 and 72 hours after inoculation and genes corresponding to pathogenesis related, heat shock proteins, signaling mechanisms and others were reported to be differentially expressed in resistant varieties in comparison with susceptible varieties (Zhang et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), (Suryawanshi et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), (Cao et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The sheath samples were collected at 3 and 5 days post inoculation and the disease symptoms visualized after 15\u0026ndash;18 days of pathogen inoculation by typha bit inoculation method (Prashantha et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Samal et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). To understand the rice plant behavior before infection, during the infection and after the infection, the sampling was done at 15, 20 and 25 days after the pathogen inoculation and to study the effect of the efficient isolate \u003cem\u003eStreptomyces hyderabadensis\u003c/em\u003e at the initial and later stages of infection. Hence, the study provides expression based results of major plant genes that involved in plant resistance at later of rice plants which is important to know the fate of rice plants and the extent of actinobacterial contribution in rice plants. The increase in shoot length in actinobacteria treated sample (A) and the samples with sheath blight pathogen pressure and actinobacterial inoculation (AP) provided interesting results with respect to the inoculation of \u003cem\u003eS. hyderabandensis\u003c/em\u003e both as seed treatment and soil application. The maximum length of shoot was found upto 80cm and maximum tillers reached upto 5 tillers in actinobacterial treatment. The bio-control agents able to confer dual benefits as both growth promoting in plants and antagonistic against infected plant pathogens (Abbas et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Rashid et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Naeimi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The inoculation of bio-control agents increased the plant height, shoot length and significant increases in plant growth was observed when compared to healthy control and pathogen control (P). The pathogen infected samples produced on an average of 3 tillers per plant and the plant height was found to be 60cm at 25 days, which is significantly less than health control, pathogen control and actinobacteria\u0026thinsp;+\u0026thinsp;pathogen inoculated samples. The effect of pathogen infection will decrease the plant height and number of tillers (Safari motlagh et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) but actinobacterial inoculation in presence of disease increased at tillers (4 tillers) and in par with healthy control and the plant height upto 70 cm which is more than healthy control and significantly higher than pathogen control. Hence, actinobacterial inoculation benefitted maintaining the normal growth and development of rice plants under pathogen infection. The presence/absence and the extent of control of sheath blight symptom or lesion length are the main parameters to evaluate the effect of biological control in rice plants under \u003cem\u003eR. solani\u003c/em\u003e infection (Zhang et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The lesion length in pathogen treated increased upto 15cm and the disease scale was found to be 3 but in case of actinobacterial treatment under pathogen pressure the maximum lesion height was found to be 8cm at 25 days after inoculation with the disease score of 1. Similar results were reported by (Abbas et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Rashid et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2020\u003c/span\u003e and Naeimi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) in that the lesion length was decreased due to the inoculation of bio-control agents and can cause significant difference in plant morphological growth and strength of sheath in a way that plant can be cautious about the necrotrophic infection (Naeimi et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Plants produce phenyl ammonia lyase (PAL) which is derived product of shikimic acid pathway which in turn gets activated through phenyl propanoid pathway and helps plants to produce various secondary metabolites under stress (Hyun et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The resistant varieties of rice plants were subjected to PAL analysis and it was concluded that PAL activity increase in plants under stress will be a part of major resistance mechanisms in plants (Zhang et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Molla et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The studies regarding microbial inoculation for sheath blight resistance in rice increased the levels of PAL activity and provided significant decrease in disease incidence (Elsharkawy et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Bashyal et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our results depicted that in case of actinobacteria\u0026thinsp;+\u0026thinsp;pathogen inoculated treatment PAL has been enhanced which has been correlated with the previous studies that PAL, content increase contributed to disease resistance in rice. The increase in polyphenol oxidases protects rice plants from oxidative stress and combating reactive oxygen species (ROS) against fungal pathogens (Zhang et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Our results showed that, the healthy plants possess enough level of PPO expression and under normal conditions, which was enhanced by actinobacterial inoculation but significant decrease in PPO levels under pathogen attack in pathogen inoculated plants. But the level of PPO was found to be increase and intermediate between actinobacteria treated samples and pathogen inoculated samples (P). Hence, the actinobacterial inoculation increased the expression levels of PPO under pathogen attack which correlated with the observation that PPO increased in early blight of tomato when \u003cem\u003eBacillus subtilis\u003c/em\u003e was applied as biocontrol agent in combination with plant fertilizers (Awan and Shoaib, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The phenol content in case of actinobacterial inoculation and sheath blight infection was found to be higher compared to other three treatments. The pathogen treatment showed slight higher expression than control and actinobacteria treated samples. Similar results have been reported in case of actinobacteria treatment (AbdElgawad et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) in date palm the application it has increased the phenol content and increased the growth promotion of date palm. Increase in PAL content and phenol content will increase the disease controlling ability in rice under sheath blight attack (Patil et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The catalase activity was found to be lower in case of healthy control and actinobacteria treated samples. But the activity was increased in pathogen inoculated samples (P and AP). The actinobacterial inoculation doesn\u0026rsquo;t change expression of catalase when inoculated alone. The pathogen pressure on plant increased the catalytic activity of plant, since the external signaling from actinobacteria inoculation and pathogen mediated signaling resulted in higher rate of catalase activity in rice plants (AP). Similar overview has been provided in studies when bio-control agent was used in plants to confer disease resistance in plants (Xu et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The study involved use of \u003cem\u003eStreptomyces hygroscopicus\u003c/em\u003e increased the catalytic activity of rice interaction with \u003cem\u003eMagnaporthe oryzae\u003c/em\u003e. The peroxidase activity was found to be in increasing order of treatments (C\u0026thinsp;\u0026lt;\u0026thinsp;A\u0026thinsp;\u0026lt;\u0026thinsp;P\u0026thinsp;\u0026lt;\u0026thinsp;AP). The maximum activity was found in AP treatment. The pathogen pressure increased the peroxidase activity of plants as defense mechanism but the greater levels of peroxidase activity observed through actinobacterial inoculation. Similar results have been noticed in case of actinobacterial treatment in rice affected with \u003cem\u003eFusarium fujikoroi\u003c/em\u003e (Bakanae disease of rice) that the level of peroxidase activity was increased due to the addition of actinobacteria during pathogen infection (Nawaz et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe differential levels of stress modulating agents/biochemical enzymes contributed to sheath blight resistance in rice under actinobacterial inoculation. The further focus was to study the gene expression analysis to understand the basis of actinobacterial contribution at molecular level which provided an overview of plant defense involving major mechanisms such as systemic acquired resistance (SAR) and induced systemic resistance (ISR). The expression of chlorophyll a-b binding protein 2 was found to be higher in case of actinobacteria\u0026thinsp;+\u0026thinsp;pathogen (3.8 fold) inoculated sample, followed by pathogen inoculated sample at 25 days after pathogen inoculated sample. More than 1 fold of expression was found in actinobacteria treated sample, similar results was found when actinobacteria (\u003cem\u003eStreptomyces\u003c/em\u003e Spp.) was inoculated against sheath blight disease that increase in the chlorophyll content of leaves was observed (Tamreihao et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The studies in sheath blight disease based on iTRAQ based proteomics to identify the major mechanisms of resistant varieties against sheath blight showed that increased expression of chlorophyl a-b binding protein 2 during the \u003cem\u003eR. solani\u003c/em\u003e infection in resistant varieties (Feng et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Shamim et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The resistant varieties thus tends to increase chlorophyll content under sheath blight pathogen infection, which correlated well with our results that \u003cem\u003eS. hyderabadensis\u003c/em\u003e inoculation increased the expression of chlorophyll a-b binding protein 2. The major groups of Glutathione S-transferase (GST) genes were involved in systemic acquired resistance (SAR) in plants and involved in detoxification process (Kumar et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The initial inoculation of actinobacteria (A) increased the level of SAR (15 dpi) and then drastically decreased in the later intervals (20 and 25 dpi). This depicts that in rice plants the SAR pathway may be downregulated in presence of pathogen due to actinobacterial inoculation. The actinobacterial inoculation activates the ISR pathway (Ansari et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Ebrahimi-Zarandi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The other treatments P and AP have very low expression levels of GST gene. The hypothesis here is, in pathogen control the susceptible variety couldn\u0026rsquo;t activate the SAR pathway that stimulate the GST expression and perform its role in detoxification process against ROS generated by pathogen infection. Since AP treatment has actinobacterial treatment, the shift in SAR to ISR may happen before 15 days of pathogen inoculation/before noticing the visual pathogen symptoms. The 14-3-3 like protein GF14-E is a eukaryotic specific protein and involves in signal transduction, considered as phospho-sensors which bind to phosphorylated client proteins and alter their functions, it has various roles such as signaling in cell division, response to biotic and abiotic stimuli (Lozano-Dur\u0026aacute;n et al. 2015). The expression level of 14-3-3 like protein GF14 was increased up to 3 fold by actinobacterial treatment (A). The susceptible variety also maintained its efficiency to express the gene in all the intervals but the actinobacterial treatment was found to be effective increasing the expression more than pathogen control (P) in actinobacterial treatment in presence of pathogen (AP). The signaling cascade during the rice-pathogen interaction in presence of actinobacteria was found to be enhanced. The ASMT gene helps to secrete melatonin in plants that maintain the circadian rhythm of plant such that its actual metabolism is balanced at every stage (vegetative and reproductive), in response to spacial and temporal changes in the environment around the plants (Zhou et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The ASMT enzyme catalyzes the final reaction of melatonin biosynthesis in plants (Kanehisa et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Recent studies reported that melatonin expression will be higher in case of extreme plant stress (biotic and abiotic stress) that changes the redox potential of cell (Lee et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). It also helps to be a deciding factor during the plant defense and is considered as biological marker to identify the deviation from normal behavior of plants under pathogen infection therefore is known as biological rhythm regulator (Wei et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Our results found that the pathogen infected sheath, when screened for ASMT expression level had 288.9 fold increase in the expression at 25 days after pathogen inoculation, which depicts the extent of pathogen pressure faced by the rice plants. The actinobacterial treatment under normal conditions (A) showed less than 10 (8.9) fold increase which also indicates the actinobacterial treatment will not induce stress on plants and in both actinobacteria and pathogen inoculation, the fold changes was found to be 21.9 fold which is interesting as there is decrease in 13.7 fold from pathogen (P) treatment and pathogen\u0026thinsp;+\u0026thinsp;actinobacterial treatment. The actinobacteria inoculation prophylactically may help in signaling the rice plants by inducing the systemic resistance against various biotic and abiotic stresses. The chitinases belongs to glycosyl hydrolase family that hydrolyses the glycosidic bonds in chitin, in plants it possess anti-fungal activity (Kumar et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Chitinases are also considered as PR proteins that degrades chitin during plant fungal interactions (Yang et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The sheath blight and rice interaction under the influence of \u003cem\u003eBacillus subtilis\u003c/em\u003e as biocontrol increased the expression level of chitinase enzyme and provided resistance to sheath blight disease (Durgadevi et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Our results showed that in actinobacterial inoculation (A) increased the expression of chitinase gene\u0026thinsp;\u0026gt;\u0026thinsp;1.5 fold. The expression of chitinase gene were found at 25 days after inoculation in pathogen treated plants but almost zero expression at 15 days, where as in actinobacteria and pathogen treated samples the expression level of 1.3 fold in presence of pathogen (AP) which indicates the actinobacterial initial role in activation of plant chitinase genes. Actinobacteria is considered as intermediate organism which shares the phylogenetic identity between fungi and bacteria (Kaale et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The actinobacterial inoculation signals the plants as fungi attack to express chitinase activity, but its effect on plants will be beneficial. PAL is the key enzyme in the phenol synthesis pathway, phenol accumulation under biotic and abiotic stress in plants acts as phytoalexins and provides primary inducible defense response against external disturbance to the internal homeostasis of plants (Zhang et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The fungal biocontrol agents when inoculated to study the resistance of plants against sheath blight disease in rice, the qRT-PCR analysis showed the increased expression of PAL gene and chitinase genes in plants (Bashyal et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our results showed that the expression of PAL gene under stress of pathogen (P) was found to be 14 fold. The initial defense level of susceptible variety was found to be significant but in case of actinobacterial treatment under disease attack the expression fold was found to be 32 fold at 15 days post inoculation. The PAL activity is enhanced to provide resistance against sheath blight pathogen. The SAR pathway in P treatment failed which has been enhanced by the activation of ISR pathway by the addition of actinobacteria. The salicylic acid pathway is the derivative of two pathways Iso-chorismate synthase pathway and PAL pathway (Lefevere et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Iso-chorismate synthase is required for salicylic acid synthesis in plants (Wildermuth et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Our studies showed the initial activation of ICS gene at 15 days in actinobacteria treated sample at 2.3 fold. But the expression level of ICS gene was not found at later intervals and also the other two treatments (P and AP) in neither of the intervals of sampling. Here, the activation of salicylic acid pathway was found due to actinobacterial treatment (A) as a plant innate response but later converted to ISR. In pathogen treatment (P), the susceptible variety lacks its potential to express SAR genes during infection. In actinobacteria\u0026thinsp;+\u0026thinsp;pathogen treatment (AP), the shift in SAR to ISR pathway before 15 days/ in the initial stages of actinobacterial inoculation may be the reason for the lower expression of ICS genes since it has significance salicylic acid pathway (SAR). The NPR1 gene modulates the cross-talk between salicylate (SAR) and jasmonate (ISR)-dependent defense pathways activation through a precise function in the plant cell cytosol (Spoel et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). The initial signaling pathway of ISR pathway is NPR1 (Panpatte et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Our results showed the expression of NPR1 gene in all the intervals in actinobacteria treated samples (A). The pathogen treated samples (P) interestingly showed the expression higher than actinobacterial samples (A), the susceptible variety due to the pathogen pressure shifted its defence pathway from SAR to ISR and higher expression of NPR gene upto 2 fold. The previous SAR responsive genes and its lower expression levels (GST, ICS, PAL) showed the failure of SAR pathway and the activation of NPR gene in rice plants at all the intervals and shift in SAR to ISR pathway. The actinobacteria\u0026thinsp;+\u0026thinsp;pathogen treatment (AP) showed the higher expression among all the treatments (3.8 fold). Hence, actinobacterial inoculation was found successful in activating the ISR pathway to help rice plants to defend against the attack of necrotophic pathogen \u003cem\u003eR. solani\u003c/em\u003e. The shift in SAR to ISR during the actinobacterial inoculation in rice has been found by the lower expression levels of SAR genes, increased expression of ISR gene (NPR) and other genes contributing to plant growth and development, response to stress, signaling \u003cem\u003eetc.\u003c/em\u003e, with the help of biochemical enzymes that maintain the cell homeostasis during the plant stress condition. The major observations and overview of defense mechanisms are summarized and depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present investigation was undertaken to identify the molecular and biochemical basis of actinobacterial interaction in presence and absence of sheath blight disease in rice. The parallel understanding of tripartite interaction between a plant and bio-control agent in presence of disease is important and provided interesting results in our study. Various conclusions can be drawn such as the green house experiments in rice interaction with actinobacteria in presence of sheath blight pathogen \u003cem\u003eRhizoctonia solani\u003c/em\u003e provided results on growth promotion, maintenance of cellular homeostasis through activation of various detoxification enzymes (peroxidases, catalases, polyphenol oxidases), differential increase in phenol and phenyl ammonia lyase content under stress conditions based on biochemical analysis. The qRT-PCR analysis of genes involved in the maintenance of plant circadian rhythm during normal and stress conditions, plant chlorophyll content, detoxification process and genes involving in the activation of SAR and ISR pathway justified to draw conclusion that the actinobacterial inoculation changes the mode of plant defense from SAR to ISR at molecular level compared to its actual defense mechanism. The decrease in lesion length correlated with the activation of ISR mechanism in rice plants inoculated with DBT64 in presence of \u003cem\u003eR. solani\u003c/em\u003e infection which maintained the disease score less than 10 per cent compared to pathogen control which has reached nearly 30 per cent. The study can be taken forward for transcriptome analysis to identify the major genes expressed differentially during the tripartite interaction.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eSA-Salicylic acid, ET-Ethylene, JA-Jasmonic acid, ISR- Induced systemic resistance, SAR-Systemic acquired resistance, BCA-Biocontrol agents, SES-Standard evaluation system, qRT-PCR - quantitatice real time polymerase chain reaction, GOI-Gene of Interest, GST- Probable glutathione S-transferase, ICS-iso-chorismate synthase, PAL-Phenyl ammonia lyase, ASMT- Acetylserotonin-O-methyltransferase, CAT-catalases, PER-Peroxidases, PHE-Phenols, PPO-polyphenol oxidases\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAYP carried out the present work and drafted the manuscript; KPU conceptualized and supervised the experiments and critically reviewed the manuscript: gave inputs at times during the experimentation and PSK, DNK and BB critically reviewed the manuscript. All the authors read and approved the manuscript\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Department of Biotechnology (DBT\u0026rsquo;s Sanction Order No. BT/PR25029/NER/95/967/2017 dated 30th, September, 2019)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll datasets are available from the corresponding author on reasonable request\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eEthics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbbas A, Fu Y, Qu Z, Zhao H, Sun Y, Lin Y, Xie J, Cheng J Jiang D (2021) Isolation and evaluation of the biocontrol potential of \u003cem\u003eTalaromyces\u003c/em\u003e spp. against rice sheath blight guided by soil microbiome. Environ Microbiol 23(10):5946-5961. https://doi.org/10.1111/j.1467-7652.2007.00243.x\u003c/li\u003e\n\u003cli\u003eAbdElgawad H, Saleh AM, Al Jaouni S, Selim S, Hassan MO, Wadaan MA, Shuikan AM, Mohamed H S and Hozzein W N (2019) Utilization of actinobacteria to enhance the production and quality of date palm (\u003cem\u003ePhoenix dactylifera\u003c/em\u003e L.) fruits in a semi-arid environment. Sci Tot Environ 666:690-697. https://doi.org/10.1016/j.scitotenv.2019.02.140\u003c/li\u003e\n\u003cli\u003eAnon (2020) Anaconda Software Distribution, Anaconda Inc. Available at: https://docs.anaconda.com/.\u003c/li\u003e\n\u003cli\u003eAnsari W A, Krishna R, Zeyad MT, Singh S Yadav A (2020) Endophytic actinomycetes-mediated modulation of defense and systemic resistance confers host plant fitness under biotic stress conditions. In Microbial Versatility in Varied Environments 167-180). Springer, Singapore. https://doi.org/10.1007/978-981-15-3028-9_13.\u003c/li\u003e\n\u003cli\u003eAwan Z A, Shoaib A (2019) Combating early blight infection by employing Bacillus subtilis in combination with plant fertilizers. Current Plant Biol, 20:100125. https://doi.org/10.1016/j.cpb.2019.100125\u003c/li\u003e\n\u003cli\u003eBarka E A, Vatsa P, Sanchez L, Gaveau-Vaillant N, Jacquard C, Klenk H P Cl\u0026eacute;ment C Ouhdouch Y, van Wezel G P 2016 Taxonomy, physiology and natural products of Actinobacteria. Microbiol Mol Biol Rev 80(1):1-43.DOI: https://doi.org/10.1128/MMBR.00019-15\u003c/li\u003e\n\u003cli\u003eBashyal B M, Pandey S, Singh A R, Singh D, Kamil D, Aggarwal R (2022) Utilization of fungal biocontrol agents against rice sheath blight disease provides insight into their role in plant defense responses. https://doi.org/10.56042/ijbb.v59i11.66903\u003c/li\u003e\n\u003cli\u003eBhaktavatsalam G, Satyanarayana K, Reddy APK, John VT (1978) Evaluation for sheath blight resistance in rice. Int Rice Res Newslett 3:9-10 \u003c/li\u003e\n\u003cli\u003eCao W, Zhang H, Zhou Y, Zhao J, Lu S, Wang X, Chen X, Yuan L, Guan H, Wang G Shen W (2022) Suppressing chlorophyll degradation by silencing OsNYC3 improves rice resistance to \u003cem\u003eRhizoctonia solani\u003c/em\u003e, the causal agent of sheath blight. Plant Biotechnol J 20(2):335. doi: 10.1111/pbi.13715\u003c/li\u003e\n\u003cli\u003eChen T, Lv Y, Zhao T, Li N, Yang Y, Yu W, He X, Liu T, Zhang, B (2013) Comparative transcriptome profiling of a resistant vs. susceptible tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) cultivar in response to infection by tomato yellow leaf curl virus. PloS one 8(11): 80816. https://doi.org/10.1371/journal.pone.0080816\u003c/li\u003e\n\u003cli\u003eCohen SP and Leach JE 2019 Abiotic and biotic stresses induce a core transcriptome response in rice. Scientific reports, 9(1): 1-11. https://doi.org/10.1038/s41598-019-42731-8\u003c/li\u003e\n\u003cli\u003eDurgadevi D, Harish S, Manikandan R, Prabhukarthikeyan S R, Alice D and Raguchander T (2021) Proteomic profiling of defense/resistant genes induced during the tripartite interaction of \u003cem\u003eOryza sativa\u003c/em\u003e, \u003cem\u003eRhizoctonia solani\u003c/em\u003e AG1-1A, and Bacillus subtilis against rice sheath blight. Physiol Mol Plant Pathol 115:p.101669. https://doi.org/10.1016/j.pmpp.2021.101669 \u003c/li\u003e\n\u003cli\u003eEbrahimi-Zarandi M, Saberi Riseh R, Tarkka MT (2022) Actinobacteria as effective biocontrol agents against plant pathogens, an overview on their role in eliciting plant defense. Microorganisms 10(9):1739. https://doi.org/10.3390/microorganisms10091739 \u003c/li\u003e\n\u003cli\u003eElsharkawy MM, Sakran RM, Ahmad AA, Behiry SL, Abdelkhalek A, Hassan MM Khedr, AA (2022) Induction of Systemic Resistance against Sheath Blight in Rice by Different Pseudomonas Isolates. Life, 12(3):349. https://doi.org/10.3390/life12030349\u003c/li\u003e\n\u003cli\u003eFeng Z M, Peng GAO, Zhao JH, Wang GD, Zhang HM, Cao WL, Xiang, XUE, Zhang YF, Rong HUA Chen ZX, Chen XJ (2022) iTRAQ-based quantitative proteomics analysis of defense responses triggered by the pathogen \u003cem\u003eRhizoctonia solani\u003c/em\u003e infection in rice. J. Int. Agricul, 21(11):139-152. https://doi.org/10.1016/S2095-3119(20)63499-2\u003c/li\u003e\n\u003cli\u003eFirdaus RBR, Leong Tan M, Rahmat SR, Senevi Gunaratne M (2020) Paddy, rice and food security in Malaysia: A review of climate change impacts. Cogent Soc Sci 6: 1818373. https://doi.org/10.1080/23311886.2020.1818373\u003c/li\u003e\n\u003cli\u003eHartee E F (1955) Haematin compounds. In: Modern methods of Plant Analysis, (Peach, K. and Tracy, M. eds.), Springer-Verlag, New York, 4: 197-245. \u003c/li\u003e\n\u003cli\u003eHata EM, Yusof MT, Zulperi D (2021) Induction of systemic resistance against bacterial leaf streak disease and growth promotion in rice plant by Streptomyces shenzhenesis TKSC3 and Streptomyces sp. SS8. The plant Pathol J 37(2): 173. doi: 10.5423/PPJ.OA.05.2020.0083\u003c/li\u003e\n\u003cli\u003eHe D C, He M H, Amalin D M, Liu W, Alvindia D G and Zhan J (2021) Biological control of plant diseases: An evolutionary and eco-economic consideration. Pathogens 10(10) 1311. https://doi.org/10.3390/pathogens10101311\u003c/li\u003e\n\u003cli\u003eHyun MW, Yun YH, Kim JY, Kim SH (2011) Fungal and plant phenylalanine ammonia-lyase. Mycobiology 39(4): 257-265 DOI: 10.5941/MYCO.2011.39.4.257\u003c/li\u003e\n\u003cli\u003eInternational Rice Genome Sequencing Project (2002). Standard Evaluation System for Rice (SES). Manila, Philippines, Int.Rice. Research Institute.\u003c/li\u003e\n\u003cli\u003eJia Y, Liu G, Park D S, Yang Y (2013) Inoculation and scoring methods for rice sheath blight disease. Methods Mol Biol 956: 257-268. DOI: 10.1007/978-1-62703-194-3_19\u003c/li\u003e\n\u003cli\u003eJiang J, Ma S, Ye N, Jiang M, Cao J, Zhang J (2017) WRKY transcription factors in plant responses to stresses. J Int Plant Biol 59(2): 86-101. DOI: 10.1111/jipb.12513\u003c/li\u003e\n\u003cli\u003eKaale SE, Mahadhy A, Damas M, Mgina CA, Lyimo TJ (2022) Phylogenetic diversity of Actinobacteria from Momela soda lakes, Arusha National Park, Tanzania. African J Aquatic Sci :1-14. https://doi.org/10.2989/16085914.2021.2005527\u003c/li\u003e\n\u003cli\u003eKanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M and Hirakawa M (2006) From genomics to chemical genomics: new developments in KEGG. Nucleic acids Res 34:354-D357. DOI: 10.1093/nar/gkj102\u003c/li\u003e\n\u003cli\u003eKlessig DF Choi HW and Dempsey DMA (2018) Systemic acquired resistance and salicylic acid: past, present, and future. Mol. Plant-microbe Int. 31(9):871-888. DOI: 10.1094/MPMI-03-18-0067-CR\u003c/li\u003e\n\u003cli\u003eKumar M, Brar A, Yadav M, Chawade A, Vivekanand V, Pareek N (2018) Chitinases\u0026mdash;potential candidates for enhanced plant resistance towards fungal pathogens. Agriculture, 8(7):88https://doi.org/10.3390/agriculture8070088\u003c/li\u003e\n\u003cli\u003eKumar R, Barua P, Chakraborty N, Nandi AK (2020) Systemic acquired resistance specific proteome of \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Plant Cell Reports, 39(11):1549-1563. DOI: 10.1007/s00299-020-02583-3 \u003c/li\u003e\n\u003cli\u003eLaw J W F, Ser H L, Ab Mutalib N S, Saokaew S, Duangjai A, Khan T M, Chan K G, Goh B H and Lee L H (2019) \u003cem\u003eStreptomyces monashensis\u003c/em\u003e sp. nov., a novel mangrove soil actinobacterium from East Malaysia with antioxidative potential. Scientific reports, 9(1), pp.1-18. DOI: 10.1038/s41598-019-39592-6\u003c/li\u003e\n\u003cli\u003eLee DY, Jeon J, Kim KT, Cheong K, Song H, Choi G, Ko J, Opiyo SO, Correll JC, Zuo S Madhav S (2021) Comparative genome analyses of four rice-infecting Rhizoctonia solani isolates reveal extensive enrichment of homogalacturonan modification genes. BMCgenomics 22(1):1-15. https://doi.org/10.1186/s12864-021-07549-7\u003c/li\u003e\n\u003cli\u003eLee K, Choi GH, Back K (2017) Cadmium‐induced melatonin synthesis in rice requires light, hydrogen peroxide, and nitric oxide: key regulatory roles for tryptophan decarboxylase and caffeic acid O‐methyltransferase. J Pineal Res 63(4), p.e12441. DOI: 10.1111/jpi.12441\u003c/li\u003e\n\u003cli\u003eLefevere H, Bauters L, Gheysen G (2020) Salicylic acid biosynthesis in plants. Front Plant Sci 11: 338. https://doi.org/10.3389/fpls.2020.00338 \u003c/li\u003e\n\u003cli\u003eLi Y, Guo Q, Li Y, Sun Y, Xue Q, Lai H (2019) \u003cem\u003eStreptomyces pactum\u003c/em\u003e Act12 controls tomato yellow leaf curl virus disease and alters rhizosphere microbial communities. Biol Fert soils 55(2): 149-169. http://doi.org/10.1007/s00374-019-01339-w\u003c/li\u003e\n\u003cli\u003eLozano-Dur\u0026aacute;n R, Robatzek S, 2015, 14-3-3 proteins in plant-pathogen interactions. Mol. Plant Microbe Int. 28(5):511-518. https://doi.org/10.1094/MPMI-10-14-0322-CR \u003c/li\u003e\n\u003cli\u003eMawang CI, Azman AS, Fuad ASM, Ahamad M (2021) Actinobacteria: An eco-friendly and promising technology for the bioaugmentation of contaminants. Biotechnol\u003cem\u003e \u003c/em\u003eRep p.e00679. DOI: 10.1016/j.btre.2021.e00679\u003c/li\u003e\n\u003cli\u003eMayer AM Harel E Shaul R B (1965) Assay of catechol oxidase, a critical comparison of methods. Phytochem \u003cstrong\u003e5\u003c/strong\u003e: 783-789. https://doi.org/10.1016/S0031-9422(00)83660-2\u003c/li\u003e\n\u003cli\u003eMetsalu T, Vilo, J (2015) ClustVis: a web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nucleic acids Res, 43(W1): W566-W570. DOI: 10.1093/nar/gkv468\u003c/li\u003e\n\u003cli\u003eMiller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem 31(3):426-428. https://doi.org/10.1021/ac60147a030\u003c/li\u003e\n\u003cli\u003eMolla KA, Karmakar S, Molla J, Bajaj P, Varshney RK, Datta SK, Datta K (2020) Understanding sheath blight resistance in rice: the road behind and the road ahead. Plant Biotechnol J 18:895\u0026ndash;915 https://doi.org/10.1111/pbi.13312\u003c/li\u003e\n\u003cli\u003eMur LA, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol: 140(1): 249-262. https://doi.org/10.1104/pp.105.072348\u003c/li\u003e\n\u003cli\u003eNaeimi S, Khosravi V, Varga A, V\u0026aacute;gv\u0026ouml;lgyi C, Kredics L, 2020, Screening of organic substrates for solid-state fermentation, viability and bioefficacy of \u003cem\u003eTrichoderma harzianum\u003c/em\u003e AS12-2, a biocontrol strain against rice sheath blight disease. Agronomy, 10(9):1258. https://doi.org/10.3390/agronomy10091258\u003c/li\u003e\n\u003cli\u003eNawaz ME, Malik K, Hassan MN (2022) Rice-associated antagonistic bacteria suppress the Fusarium fujikoroi causing rice bakanae disease. BioControl, 67(1):101-109. https://doi.org/10.1007/s10526-021-10122-6\u003c/li\u003e\n\u003cli\u003eNgalimat MS, Mohd Hata E, Zulperi D, Ismail SI, Ismail MR, Mohd Zainudin NAI, Saidi NB Yusof MT (2021) Plant growth-promoting bacteria as an emerging tool to manage bacterial rice pathogens. Microorganisms\u003cem\u003e \u003c/em\u003e9(4):682. DOI: 10.3390/microorganisms9040682\u003c/li\u003e\n\u003cli\u003ePanpatte DG, Jhala YK Vyas RV (2020) Signaling pathway of induced systemic resistance. In Molecular Aspects of Plant Beneficial Microbes in Agriculture, 133-141 Academic Press. https://doi.org/10.1016/B978-0-12-818469-1.00011-0\u003c/li\u003e\n\u003cli\u003ePatil HJ, Srivastava AK, Singh DP, Chaudhari BL Arora DK (2011) Actinomycetes mediated biochemical responses in tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) enhances bioprotection against \u003cem\u003eRhizoctonia solani\u003c/em\u003e. Crop protection 30(10):1269-1273. https://doi.org/10.1016/j.cropro.2011.04.008\u003c/li\u003e\n\u003cli\u003ePombo MA, Ramos RN, Zheng Y, Fei Z, Martin G B Rosli H. G (2019) Transcriptome-based identification and validation of reference genes for plant-bacteria interaction studies using \u003cem\u003eNicotiana benthamiana\u003c/em\u003e. Scientific reports, 9(1):1-10. https://doi.org/10.1038/s41598-018-38247-2 \u003c/li\u003e\n\u003cli\u003ePralhad S P, Krishnaraj P U and Pralhad M P (2020) Evaluation of actinobacteria for biocontrol of sheath blight in rice. \u003cem\u003eJ. Pharmacog. Phytochem\u003c/em\u003eistry 9(3): 371-376. http://www.phytojournal.com/\u003c/li\u003e\n\u003cli\u003ePrasad M, Srinivasan R, Chaudhary M, Choudhary M, Jat LK (2019) Plant growth promoting rhizobacteria (PGPR) for sustainable agriculture: perspectives and challenges. PGPR amelioration in sustainable agriculture, 9:129-157. https://doi.org/10.1016/B978-0-12-815879-1.00007-0\u003c/li\u003e\n\u003cli\u003ePrashantha ST, Bashyal BM, Krishnan SG, Dubey H, Solanke AU, Prakash G, Aggarwal R (2021) Identification and expression analysis of pathogenicity-related genes of \u003cem\u003eRhizoctonia solani\u003c/em\u003e anastomosis groups infecting rice. Biotechnology, 11(8):1-12. https://doi.org/10.1007/s13205-021-02934-1\u003c/li\u003e\n\u003cli\u003eRashid MM, Bhuiyan MR, Dilzahan HA, Hamid MA, Hasan N, Khan MAI, Latif MA (2020) Biological control of rice sheath blight disease (Rhizoctonia solani) using bio-pesticides and bio-control agents. Bangladesh Rice Journal, 24(1):47-58. https://doi.org/10.3329/brj.v24i1.53239\u003c/li\u003e\n\u003cli\u003eRehman HM, Nawaz MA, Shah ZH, Ludwig-M\u0026uuml;ller J, Chung G, Ahmad MQ, Yang SH, Lee SI (2018) Comparative genomic and transcriptomic analyses of Family-1 UDP glycosyltransferase in three \u003cem\u003eBrassica\u003c/em\u003e sp. and \u003cem\u003eArabidopsis\u003c/em\u003e indicates stress-responsive regulation. Scientific Reports 8(1): 1875 https://doi.org/10.3390/genes13091640\u003c/li\u003e\n\u003cli\u003eRoss WW, Senderoff R R (1992) Phenylanine ammonia lyase from loblolly pine; purification of the enzyme and isolation of complementary DNA clones. Plant physiology, 98:380-386\u003c/li\u003e\n\u003cli\u003eSadasivam S, Manickam A (1996) Phenols. New Age International, 256.\u003c/li\u003e\n\u003cli\u003eSafari Motlagh MR, Jahangiri B, Kulus D, Tymoszuk A, Kaviani B (2022) Endophytic fungi as potential biocontrol agents against \u003cem\u003eRhizoctonia solani\u003c/em\u003e JG K\u0026uuml;hn, the causal agent of rice sheath blight disease. Biology, 11(9): 1282. https://doi.org/10.3390/biology11091282 \u003c/li\u003e\n\u003cli\u003eSamal P, Molla KA, Bal A, Ray S, Swain H, Khandual A, Sahoo P, Behera M, Jaiswal S, Iquebal A, Chakraborti M (2022) Comparative transcriptome profiling reveals the basis of differential sheath blight disease response in tolerant and susceptible rice genotypes. Protoplasma, 259(1):61-73. https://doi.org/10.1007/s00709-021-01637-x\u003c/li\u003e\n\u003cli\u003eShamim M, Sharma D, Bisht D, Maurya R, Kaashyap M, Srivastava D, Mishra A, Kumar D, Kumar M, Juturu VN Khan NA (2022) Proteo-molecular investigation of cultivated rice, wild rice, and barley provides clues of defense responses against \u003cem\u003eRhizoctonia solani\u003c/em\u003e infection. Bioengineering, 9(10), p.589. https://doi.org/10.3390/bioengineering9100589 \u003c/li\u003e\n\u003cli\u003eSharma NR, Teng PS, Olivares PM (1990) Comparison of assessment methods for rice sheath blight disease. Philippines Phytopathology 26:20-24.\u003c/li\u003e\n\u003cli\u003eSingh P, Mazumdar P, Harikrishna, J A and Babu S (2019) Sheath blight of rice: a review and identification of priorities for future research. Planta, 250(5): 1387-1407. https://doi.org/10.1007/s00425-019-03246-8\u003c/li\u003e\n\u003cli\u003eSinha S, Kumar A, Kumar M, Singh SP, Singh PK (2018) Screening of rice genotypes for abiotic and biotic stresses using molecular markers. Journal of Pharmacognosy and Phytochemistry, 7(2):2111-2115.\u003c/li\u003e\n\u003cli\u003eSmith A, Lovelace AH, Kvitko BH (2018) Validation of RT-qPCR approaches to monitor \u003cem\u003ePseudomonas syringae\u003c/em\u003e gene expression during infection and exposure to pattern-triggered immunity. Molecular Plant-Microbe Interactions, 31(4):410-419. https://doi.org/10.1094/MPMI-11-17-0270-TA \u003c/li\u003e\n\u003cli\u003eSpoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ, Buchala AJ, M\u0026eacute;traux JP, Brown R, Kazan K, Van Loon LC (2003) NPR1 modulates cross-talk between salicylate-and jasmonate-dependent defense pathways through a novel function in the cytosol. The Plant Cell, 15(3):760-770. https://doi.org/10.1105/tpc.009159\u003c/li\u003e\n\u003cli\u003eSuryawanshi PP, Krishnaraj PU, Suryawanshi MP (2020) Evaluation of actinobacteria for biocontrol of sheath blight in rice. Journal of Pharmacognosy and Phytochemistry, 9:371-376.\u003c/li\u003e\n\u003cli\u003eTaha M, Ghaly M, Atwa H, Askoura M (2021) Evaluation of the effectiveness of soil Streptomyces isolates for induction of plant resistance against Tomato mosaic virus (ToMV). Current Microbiology, 78(8):3032-3043. https://doi.org/10.1007/s00284-021-02567-w\u003c/li\u003e\n\u003cli\u003eTamreihao K, Ningthoujam DS, Nimaichand S, Singh ES, Reena P, Singh SH, Nongthomba U (2016) Biocontrol and plant growth promoting activities of a \u003cem\u003eStreptomyces corchorusii\u003c/em\u003e strain UCR3-16 and preparation of powder formulation for application as biofertilizer agents for rice plant. Microbiological research, 192:260-270. https://doi.org/10.1016/j.micres.2016.08.005 \u003c/li\u003e\n\u003cli\u003eWei Y, Liu G, Chang Y, Lin D, Reiter RJ, He C, Shi H (2018) Melatonin biosynthesis enzymes recruit WRKY transcription factors to regulate melatonin accumulation and transcriptional activity on W‐box in cassava. Journal of pineal research, 65(1):p.e12487. https://doi.org/10.1111/jpi.12487 \u003c/li\u003e\n\u003cli\u003eWildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature, 414(6863):562-565. https://doi.org/10.1038/35107108\u003c/li\u003e\n\u003cli\u003eXu T, Cao L, Zeng J, Franco CM, Yang Y, Hu X, Liu Y, Wang X, Gao Y, Bu Z, Shi L (2019) The antifungal action mode of the rice endophyte \u003cem\u003eStreptomyces hygroscopicus\u003c/em\u003e OsiSh-2 as a potential biocontrol agent against the rice blast pathogen. Pesticide biochemistry and physiology, 160:58-69. https://doi.org/10.1016/j.pestbp.2019.06.015\u003c/li\u003e\n\u003cli\u003eYang X, Gu X, Ding J, Yao L, Gao X, Zhang M, Meng Q, Wei S, Fu J (2022) Gene expression analysis of resistant and susceptible rice cultivars to sheath blight after inoculation with \u003cem\u003eRhizoctonia solani\u003c/em\u003e. BMC genomics, 23(1):1-16. https://doi.org/10.1186/s12864-022-08524-6\u003c/li\u003e\n\u003cli\u003eZhang G, Cui Y, Ding X and Dai Q (2013) Stimulation of phenolic metabolism by silicon contributes to rice resistance to sheath blight. Journal of Plant Nutrition and Soil Science, 176(1): 118-124. https://doi.org/10.1002/jpln.201200008\u003c/li\u003e\n\u003cli\u003eZhang J, Chen L, Fu C, Wang L, Liu H, Cheng Y, Li S, Deng Q, Wang S, Zhu J and Liang Y (2017) Comparative transcriptome analyses of gene expression changes triggered by \u003cem\u003eRhizoctonia solani\u003c/em\u003e AG1 IA infection in resistant and susceptible rice varieties. Frontiers in Plant Science, 8: 1422. https://doi.org/10.3389/fpls.2017.01422\u003c/li\u003e\n\u003cli\u003eZhang H, Li R, Liu, W (2011) Effects of chitin and its derivative chitosan on postharvest decay of fruits: A review. International Journal of Molecular Sciences, 12(2):917-934. https://doi.org/10.3390/ijms12020917\u003c/li\u003e\n\u003cli\u003eZhou W, Wang Y, Li B, Petijov\u0026aacute; L, Hu S, Zhang Q, Niu J, Wang D, Wang S, Dong Y, Čell\u0026aacute;rov\u0026aacute; (2021) Whole‐genome sequence data of \u003cem\u003eHypericum perforatum\u003c/em\u003e and functional characterization of melatonin biosynthesis by N‐acetylserotonin O‐methyltransferase. Journal of Pineal Research, 70(2): p.e12709. https://doi.org/10.1111/jpi.12709\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Induced systemic resistance (ISR), Systemic acquired resistance (SAR), Signaling mechanisms, Plant-Pathogen interaction, Actinobacteria","lastPublishedDoi":"10.21203/rs.3.rs-2421512/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2421512/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRice sheath blight disease is caused by the necrotrophic pathogen \u003cem\u003eRhizoctonia solani\u003c/em\u003e Kuhn (teleomorph; \u003cem\u003eThanatephorus cucumeris\u003c/em\u003e). Several studies have reported the disease suppression mechanisms in resistant varieties based on innate and systemic acquired resistance (SAR) mechanisms. The resistant varieties turn susceptible due to the intelligence of pathogen strains to mimic plant defense signaling mechanisms. An alternative and ecofriendly approach to tackle the negative effects of plant-pathogen interaction is the application of bio-control agents. Actinobacteria is known for production of secondary metabolites under stress that initiates pre-signaling to enable induced immunity at early plant stages to tackle the pathogen attack during the later stages of plant development. The current study is focused on understanding of mechanisms that provide resistance to rice plants against \u003cem\u003eR. solani\u003c/em\u003e in presence of actinobacteria, \u003cem\u003eStreptomyces hyderabadensis\u003c/em\u003e, based on biochemical and mRNA/transcript level analysis. The sheath blight incidence was significantly reduced and the disease score was maintained at 1 (lesion height less than 10%) compared to pathogen control. Biochemical analysis revealed that the actinobacterial inoculation enhanced the levels of phenyl ammonia lyase, phenol, polyphenol oxidases, catalases and peroxidases during the tripartite interaction that provided initial resistance and protection from ROS generated during pathogen infection through detoxification process. During the interaction, higher expression of chitinase gene, improvement in chlorophyll content by the expression of chlorophyll a-b binding protein, maintenance of plant overall development by maintaining the balance of melatonin production, lower expression of SAR supportive genes (PAL, ICS, GST) at the later intervals, expression of signaling proteins (14-3-3 like protein GF14-E) to activate the defense related proteins and the proteins that supports the SAR to ISR shift (NPR1) in presence of \u003cem\u003eS. hyderabadensis\u003c/em\u003e under pathogen pressure of \u003cem\u003eR. solani\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Shift in SAR to ISR during the Rice- R. Solani interaction mediated by Streptomyces hyderabadensis confers sheath blight resistance in susceptible genotype","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-01-06 15:09:02","doi":"10.21203/rs.3.rs-2421512/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8f39848e-2ed4-4198-8db6-a993c1f3b561","owner":[],"postedDate":"January 6th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-02-06T11:29:27+00:00","versionOfRecord":[],"versionCreatedAt":"2023-01-06 15:09:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2421512","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2421512","identity":"rs-2421512","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.