Development and characterization of the microsatellite markers for the Neptune whelk, Neptunea cumingii

Development and characterization of the microsatellite markers for the Neptune whelk, Neptunea cumingii | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Development and characterization of the microsatellite markers for the Neptune whelk, Neptunea cumingii Peizhen Ma, Tao Zhang, Haizhou Li, Haiyan Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1406657/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Background The Neptune whelk, Neptunea cumingii , is an economic species endemic to the East Asia Warm Temperate Biotic Subregion. The development of microsatellite markers will be beneficial to the assessment of genetic diversity and conservation of resources on this decreasing gastropod. Methods and Results The microsatellite markers were developed and characterized through Illumina high-throughput sequencing and capillary electrophoresis techniques. 11 polymorphic microsatellite loci were screened and validated. The observed heterozygosity and expected heterozygosity of each locus ranged from 0.0600 to 0.6508 and from 0.7380 to 0.9375, respectively. The average Shannon’s information index, polymorphism information content, F-Statistics and gene flow were 2.0828, 0.8325, 0.0519 and 4.5660, respectively. The genetic diversity analysis indicated a closer genetic distance between populations of Dalian and Lvshun. Conclusions The distribution pattern of polymorphic microsatellite loci reveals that the Yellow Sea Warm Current generates the high level of genetic connectivity in N. cumingii . The markers developed in this study are expected as informative for further analysis of genetic diversity in N. cumingii . microsatellite markers Neptunea cumingii genetic diversity Illumina high-throughput sequencing Figures Figure 1 Introduction The Neptune whelk, Neptunea cumingii , is a large gastropod distributed regionally within the areas of the Yellow Sea warm current and the Tsushima warm current [1, 2, 3]. As an economically important species, the muscle of N. cumingii is rich in essential amino acids and unsaturated fatty acids and valued by consumers [4], despite food poisoning case of tetramine has been reported [2]. With adult whelk mainly in gravel and sand bottom, the bottom trawlers have been widely used to catch N. cumingii , resulting in a sharp decrease and threatened status of wild resources [3]. Consequently, to relieve stress of overfishing and protect the wild resources, research on N. cumingii has been carried out, mainly focused on the feeding habits [5], the reproductive biology [1, 6, 7] and artificial breeding [8]. Genetic diversity is the scientific basis for germplasm resource protection [9]. Sui (2008) selected simple sequence repeats from close-relative gastropods and verified them in N. cumingii [10]. Later, short gene fragments, COX I and CYTB , were used to probe into genetic diversity of six geographic groups of N. cumingii in China, with no significant differences among populations detected [11]. Besides, polymorphic microsatellite loci were isolated from a congeneric whelk, N. arthritica [12]. Here in this study, we developed and characterized the microsatellite markers for N. cumingii using high‑throughput sequencing and capillary electrophoresis techniques, aiming to assist in population genetic studies on this increasingly scarce gastropod. Materials And Methods Development of microsatellite markers To construct the genomic library, nine individuals of N. cumingii from seas of Dalian (DL), Lvshun (LS) and Weihai (WH) were selected, with three individuals from each sampling site (Fig. 1 ) [13]. Genomic DNA was extracted from the cryopreserved foot muscles using the Tiangen DNA kit (DP324, Tiangen Biotech (Beijing) Co., Ltd., Beijing) following the manufacturer’s instructions. The genomic DNA was then fragmented into ~ 400 bp to develop the genomic library. Eight probes, including p(AG) 10 , p(AC) 10 , p(AAC) 8 , p(AGG) 8 , p(ACG) 8 , p(AAG) 8 , p(ATCT) 6 , as well as p(ACAT) 6 , were adopted in capturing microsatellites from the library by the magnetic beads enriched method. The enriched genomic library was sequenced on the Illumina NovaSeq platform (Illumina, San Diego, CA, USA) at Shanghai Personalbio Biotechnology Co., Ltd using 2×150 bp paired-end sequencing mode. Raw reads were filtered by removing reads of which the length are ≤ 50 bp, or of low quality, or with 3’ adaptors using AdapterRomoval 2.1.7 [14], and combined by FLASH 1.2.11 [15]. Microsatellites were calculated by motif types. The loci were then searched from all combined sequences by an online Microsatellite identification tool at http://pgrc.ipk-gatersleben.de/misa/ . After deleting the microsatellites with flanking sequences < 20 bp, CDHIT software was used to cluster the remaining sequences. The SSR length polymorphism (SSLP) of each cluster was calculated by Perl program. Microsatellite markers for N. cumingii were developed from clusters with SSLP ≧ 2 and designed using Primer3 v2.3.6 [16]. The primer pairs were then screened by the following criterions: a) no motif types were the mononucleotide repeat motifs or compound repeat motifs, b) only one SSR in each read, c) the primer pairs should be within one cluster, d) each designed primer had to be supported by two primers in the clusters, and e) exact same primers were removed. Screening And Characterization Of Microsatellite Markers To check the amplified fragment length and specific amplification, 50 primer pairs were selected randomly. The PCR mixture contained 0.5 µL each primer, 1.0 µL template DNA, 10 µL 2 × Taq PCR MasterMix (PC1120, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), and 8 µL H 2 O in a 20µL reaction system. Fragments were amplified using the following protocol: initial denature at 95°C for 5 min, 35 cycles of 95°C for 30 sec, 50°C for 30 sec, and 72°C for 30 sec, with a final extension at 72°C for 7 min. The agarose gel electrophoresis was used here to detect the PCR products. Primer pairs with single, bright bands agreeing with expected fragment sizes were selected to be further tested. Genetic Diversity Analysis Of Microsatellite Markers 11 pairs of primers with high quality were selected (Table 1 ) and applied in three populations from Dalian (40 individuals), Lvshun (20 individuals) and Weihai (27 individuals). Genomic DNA was extracted as describe above and amplified with fluorescent labeled polymorphic microsatellite markers. The PCR mixture contained 1.0 µL each primer, 1.0 µL template DNA, 2.0 µL 10*buffer, 0.5 µL dNTP, 0.5 µL Taq DNA Polymerase and 14 µL H 2 O in a 20µL reaction system. Fragments were amplified using the protocol described above with corresponding annealing temperature. The products were purified and capillary electrophoresis [17] was conducted on ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Table 1 Characteristics of eleven microsatellite loci from N. cumingii developed in this study Locus Primer sequence (5’-3’) Repeat motif Size range (bp) Ta (°C) Fluorescence labeling NC01 F: AAAACCCTTTGATGTTTCCAG R: TGCTGTCCAGCTTGGTTATG (AAG)n 141–162 59 HEX NC02 F: CCTCGACCCAGATGCTATTG R: TTTTTCGGAAGAGTAGGCCA (TCT)n 269–299 60 FAM NC03 F: TGGAGGAACGGGTGTCTAAT R: TTTACATCCCTCACCCGCTA (TGTA)n 202–234 60 FAM NC04 F: CCCAATTTTCTTTCCCTTTCTT R: GCCTTTTTCGGAATAAACCA (AG)n 163–189 59 HEX NC05 F: TGGCAACTTGGATCAGTTCTC R: CACTTGATTGAGTCCTCGCA (AG)n 200–224 60 FAM NC06 F: TCCACTGGCCCTGTATCTCT R: CATCCATCTGTCTATCTCTCTATCCA (AGAT)n 260–300 60 HEX NC07 F: GTAGCTGTTGACCCAAACCC R: GAATGGACCAAAGCCAAAGA (AAG)n 272–302 60 TAMRA NC08 F: CCTTCTTCGTCTTGTTCTTGTTC R: TTCATTTTGTTTCGTCAACCA (TTC)n 356–385 59 FAM NC09 F: ATCCGCTCCCAAAGTTAGGT R: ACTGTTTCCCCAGCATGAGT (AAG)n 192 − 143 59 HEX NC10 F: CCCTTGTTCTTCACCAAAAATC R: TGGTGCATAATGTGCTTTCTC (AG)n 218–230 60 TAMRA NC11 F: TGAAGATATCTCCCACACTTGG R: CTTGTTCCGCTTCCACTGTT (AAG)n 246–261 60 HEX Results were analyzed by GeneMarker V2.2.0 to read the size and signal value of the fragments. The observed number of alleles ( Na ), effective number of alleles ( Ne ), observed heterozygosity ( Ho ), expected heterozygosity ( He ), Shannon’s information index ( I ) and F-Statistics ( Fst ) were evaluated by PopGene software verson 1.31, as well as Nei’s Unbiased measures of genetic identity and genetic distance among three populations [18]. The gene flow ( Nm ) was estimated following Nm = 0.25(1- Fst )/ Fst . And polymorphism information content ( PIC ) was calculated using the formula proposed by Bostein et al [19]. Results And Discussion By Illumina high-throughput sequencing of nine individuals of N. cumingii , 8,776,062 raw reads were obtained with 1,316 million bp total bases. The average GC content was 41.86%. Totally, 7,339,720 high-quality reads were obtained, accounting for 83.63% raw reads. 2,497,115 combined pairs were assembled, from which a total of 30,31,455 microsatellites were identified. 851,479 combined pairs had more than one microsatellite. Most microsatellites were mononucleotide repeat motifs, accounting for 94.55% all microsatellites. 7875 microsatellites (4.50%) were dinucleotide repeat motifs, and 1135 (0.65%) and 347 (0.20%) were trinucleotide and tetranucleotide repeat motifs, respectively. The cluster analysis revealed 242,751 clusters in total, of which 51,467 clusters (21.20%) showed length polymorphism ( ≧ 2) across 9 individuals. Thereinto, 27,626 clusters (11.38%) had two lengths. After the primer pairs were filtered, 1297 primer pairs with SSLP from 2 to 4 were obtained. A total of 11 primer pairs were validated in 87 individuals from three populations (Table 2 ). The Na and Ne ranged from 6 to 13 and from 3.7478 to 14.4273, respectively. Both Ho and He were high, with means of 0.4355 and 0.8447 for each locus, respectively. The Shannon’s information index values varied from 1.5955 to 2.4490. The PIC values of each locus varied from 0.7296 to 0.9301, with all greater than 0.5, suggesting that all the eleven microsatellite loci were highly polymorphic and valuable for genetic diversity studies [19]. The average Fst and Nm values were 0.0519 and 4.5660, indicating little genetic differentiation and abundant gene flow [20]. In addition, the maximum value (0.8332) and minimum value (0.6096) of Nei’s genetic identity occurred between populations of Lvshun and Dalian and between Lvshun and Weihai, respectively, corresponding to the minimum and maximum genetic distance values of 0.1825 and 0.4949. The distribution pattern reveals that the Yellow Sea Warm Current is the drive that leads to the high level of genetic connectivity in N. cumingii . In conclusion, the 11 microsatellite markers developed and characterized in this study provide high level of genetics, and these markers will be useful for further analysis of genetic diversity in N. cumingii . Table 2 Genetic diversity based on 11 microsatellite loci of N. cumingii Locus Sample size Na Ne Ho He I PIC Fst Nm NC01 152 8 5.4516 0.5263 0.8220 1.8977 0.8113 0.0575 4.0993 NC02 154 9 3.7478 0.4545 0.7380 1.6868 0.7311 0.0522 4.5383 NC03 148 9 3.7909 0.3378 0.7412 1.7077 0.7296 0.0648 3.6100 NC04 126 13 10.2558 0.6508 0.9097 2.4490 0.9002 0.0449 5.3179 NC05 164 12 9.8089 0.5854 0.9036 2.3744 0.8968 0.0296 8.2066 NC06 114 11 7.3757 0.5088 0.8721 2.1666 0.8602 0.0302 8.0269 NC07 136 11 8.1337 0.3971 0.8836 2.2082 0.8733 0.0337 7.1696 NC08 132 11 9.2190 0.6364 0.8983 2.3018 0.8902 0.0404 5.9400 NC09 138 17 14.4273 0.3333 0.9375 2.7434 0.9301 0.0256 9.5205 NC10 100 7 5.2083 0.3000 0.8162 1.7794 0.7945 0.0657 3.5546 NC11 100 6 4.2017 0.0600 0.7697 1.5955 0.7403 0.1445 1.4805 Mean 133 10.3636 7.4201 0.4355 0.8447 2.0828 0.8325 0.0519 4.5660 Na : observed number of alleles, Ne : effective number of alleles, Ho : observed heterozygosity, He : expected heterozygosity, I : Shannon’s information index, PIC : polymorphism information content, Fst : F-Statistics, Nm : gene flow. Declarations Acknowledgements We thank Cong Zhou, Xiaolong Wang and Zhi Hu for assistance in collecting the experimental materials. We appreciate the help in data processing from Yue Tan of the Ocean University of China. Funding This work was supported by the National Key R&D Program of China (No. 2019YFD0901303, 2019YFD0900800), the China Agriculture Research System of MOF and MARA, the Major Scientific and Technological Innovation Project of Shandong Provincial Key Research and Development Program (No. 2019JZZY020708), the Industry Leading Talents Project of Taishan Scholars (Recipient: Tao Zhang), the ‘Double Hundred’ Blue Industry Leader Team of Yantai (Recipient: Tao Zhang) and the Science and Technology Service Network Initiative, Chinese Academy of Sciences (No. KFJ-STS-QYZD-189). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author contributions HW and TZ designed the experiment. Material preparation was performed by HL. Data collection and analysis were performed and the first draft of the manuscript was written by PM. All authors commented on previous versions of the manuscript and approved the final manuscript. Ethics approval This study did not require ethics approval. Consent to participate Informed consent was obtained from all individual participants included in the study. Consent to publish The authors consent to publish all the data in this study. References 1. An JE, Choi JD, Ryu DK (2015) Age and growth of the Neptunea (Barbitonia) arthritica cumingii in the West Sea of Korea. The Korean Journal of Malacology 31: 165-170. http://dx.doi.org/10.9710/kjm.2014.30.1.25 2. Nishikawa T, Doi K, Tsujimura K, Hamano T (2009) Food poisoning case of tetramine from eating Neptunea arthritica cumingii . Annual Report of Nagasaki Prefectural Institute of Public Health and Environmental Sciences 55: 118-120. 3. Guo D, Liu X, Wang A et al (2015) Stock distribution of whelk Neptunea arthritica Crosse in Liaodong Bay. Fisheries Science 34: 718-721. http://doi.org/10.16378/j.cnki.1003-1111.2015.11.009 4. Hao Z, Wang Y, Yu Y et al (2016) Analysis and evaluation of nutritive composition in the muscle of Neptunea arthritica cumingii Crosse (Gastropoda: Buccinidae). Journal of Dalian Ocean University 37: 66-70. 5. Yang M, Feng J, Yu Z et al (2020) Comparative analysis of the feeding habits of Rapana venosa and Neptunea arthritica cumingii near Zhangzi Island, China, based on stable isotope ratios and fatty acid profiles. Aquac Res 52: 1846-1854. http://doi.org/10.1111/are.15033 6. Hao Z, Liu H, Yu Y et al (2021) Reproductive characteristics and variations in the biochemical composition of Neptunea arthritica cumingii Crosse through embryonic development. Aquac Res 52: 1-11. http://doi.org/10.1111/are.14790 7. Lombardo RC, Goshima S (2010) Female copulatory status and male male choice in Neptunea arthritica (Gastropoda: Buccinidae). J Mollus Stud 76: 317-322. http://doi.org/10.1093/mollus/eyq015 8. Yu Y, Li J, Wu W, Hao Z (2019) Research development of reproductive biology and artificial breeding technology of Neptunea cumingii . Hebei Fisheries 4: 54-56. http://doi.org/10.3969/j.issn.1004-6755.2019.04.014 9. Xia Y, Guo P, Li R et al (2014) Analysis of genetic diversity and population structure using SSR markers in tobacco. Advanced Materials Research 850-851: 1243-1246. https://doi.org/10.4028/www.scientific.net/AMR.850-851.1243 10. Sui N, Hou L, Dong C et al (2008) Optimization of fingerprint on simple sequence repeats (SSR) of conch Neptunea cumingi . Fisheries Science 27: 199-202. http://doi.org/10.16378/j.cnki.1003-1111.2008.04.006 11. Zhang D, Wang Y, Li Z et al (2021) Genetic diversity of mitochondial COX I and CYTB genes in Neptune whelk Neptunea cumingii . Journal of Dalian Ocean University 36: 612-619. http://doi.org/10.16535/j.cnki.dlhyxb.2020-285 12. Azuma N, Miranda RM, Goshima S, ABE S (2009) Polymorphic microsatelliate markers isolated from the neptune whelk Neptunea arthritica . Mol Ecol Resour 9: 120-121. http://doi.org/10.1111/j.1755-0998.2008.02179.x 13. Schlitzer R (2021) Ocean Data View http://odv.awi.de 14. Lindgreen S (2012) AdapterRemoval: easy cleaning of next-generation sequencing reads. BMC Res Notes 5: 337. http://doi.org/10.1186/1756-0500-5-337 15. Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27: 2957-2963. http://doi.org/10.1093/bioinformatics/btr507 16. Untergasser A, Cutcutache I, Koressaar T et al (2012) Primer3-new capabilities and interfaces. Nucleic Acids Res 40: e115. http://doi.org/10.1093/nar/gks596 17. Vemireddy LR, Archak S, Nagaraju J (2007) Capillary electrophoresis is essential for microsatellite marker based detection and quantification of adulteration of basmati rice ( Oryza sativa ). J Agric Food Chem 55: 8112-8117. http://doi.org/10.1021/jf0714517 18. Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89: 583-590. http://doi.org/10.1007/BF00155576 19. Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32: 314-331. 20. Reichow D, Smith MJ (2001) Microsatellites reveals high levels of gene flow among populations of the California squid Loligo opalescens . Mol Ecol 10: 1101-1109. http://doi.org/10.1046/j.1365-294x.2001.01257.x Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 22 Mar, 2022 Reviewers invited by journal 02 Mar, 2022 Editor assigned by journal 01 Mar, 2022 First submitted to journal 28 Feb, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1406657","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":87703820,"identity":"b5dcbd96-719c-46a8-ad4b-18315f8159ee","order_by":0,"name":"Peizhen Ma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYLCCBIYDDAzsDQwSCaRp4TlAihYGkBagegmi1Oq2nz344MGfO3Lmko833nhQwSDP38D87AE+LWZn8pINEnieGVvOTiu2SDjDYDjjAJu5AV4tB3LMJBIkDiduuA1kJLYxMG5g4GHD60Kz82/MfyQYHK7fcPMMWIs9YS03cswYEhIOJxjc4AFrSSRCy7tkiYQDhw03nAH7RSJ5xmE2MwIOyz348cefw/IGxw9vvPmjwsa2v735GYHQ5oGzQOEEVMyMXz2GllEwCkbBKBgFmAAA2N5LpBfNI14AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-4471-8191","institution":"Institute of Oceanology Chinese Academy of Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Peizhen","middleName":"","lastName":"Ma","suffix":""},{"id":87703821,"identity":"47b60bfd-d21c-47bb-90d4-1c77ecbff78a","order_by":1,"name":"Tao Zhang","email":"","orcid":"","institution":"Institute of Oceanology Chinese Academy of Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Zhang","suffix":""},{"id":87703822,"identity":"34407260-1208-4a0d-83c2-1274e91a161b","order_by":2,"name":"Haizhou Li","email":"","orcid":"","institution":"Shandong Fuhan Marine Technology Co., Ltd","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haizhou","middleName":"","lastName":"Li","suffix":""},{"id":87703823,"identity":"5f58beeb-3470-4659-a841-6ff7540d46b6","order_by":3,"name":"Haiyan Wang","email":"","orcid":"https://orcid.org/0000-0002-6297-3591","institution":"Institute of Oceanology Chinese Academy of Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2022-03-01 06:36:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1406657/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1406657/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":18829347,"identity":"ef269ffc-31b3-4ae9-8d5d-936238e9ae71","added_by":"auto","created_at":"2022-03-03 15:35:46","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":482217,"visible":true,"origin":"","legend":"\u003cp\u003eA map of sampling sites of the Neptune whelk, \u003cem\u003eN. cumingii\u003c/em\u003e, in this study. DL: Dalian, LS: Lvshun, WH: Weihai, YSWC: Yellow Sea Warm Current, BCC: Bohai Coastal Current, YSCC: Yellow Sea Coastal Current.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1406657/v1/d49bdf1d3c5b4a4dcd4594b1.jpeg"},{"id":18829348,"identity":"4292d5b9-0803-46fb-aeb1-61edbb490920","added_by":"auto","created_at":"2022-03-03 15:35:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":391702,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1406657/v1/fd9d2e1a-112d-4ab9-8f2b-3a3792f24043.pdf"}],"financialInterests":"","formattedTitle":"Development and characterization of the microsatellite markers for the Neptune whelk, Neptunea cumingii","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe Neptune whelk, \u003cem\u003eNeptunea cumingii\u003c/em\u003e, is a large gastropod distributed regionally within the areas of the Yellow Sea warm current and the Tsushima warm current [1, 2, 3]. As an economically important species, the muscle of \u003cem\u003eN. cumingii\u003c/em\u003e is rich in essential amino acids and unsaturated fatty acids and valued by consumers [4], despite food poisoning case of tetramine has been reported [2]. With adult whelk mainly in gravel and sand bottom, the bottom trawlers have been widely used to catch \u003cem\u003eN. cumingii\u003c/em\u003e, resulting in a sharp decrease and threatened status of wild resources [3]. Consequently, to relieve stress of overfishing and protect the wild resources, research on \u003cem\u003eN. cumingii\u003c/em\u003e has been carried out, mainly focused on the feeding habits [5], the reproductive biology [1, 6, 7] and artificial breeding [8].\u003c/p\u003e \u003cp\u003eGenetic diversity is the scientific basis for germplasm resource protection [9]. Sui (2008) selected simple sequence repeats from close-relative gastropods and verified them in \u003cem\u003eN. cumingii\u003c/em\u003e [10]. Later, short gene fragments, \u003cem\u003eCOX\u003c/em\u003e I and \u003cem\u003eCYTB\u003c/em\u003e, were used to probe into genetic diversity of six geographic groups of \u003cem\u003eN. cumingii\u003c/em\u003e in China, with no significant differences among populations detected [11]. Besides, polymorphic microsatellite loci were isolated from a congeneric whelk, \u003cem\u003eN. arthritica\u003c/em\u003e [12]. Here in this study, we developed and characterized the microsatellite markers for \u003cem\u003eN. cumingii\u003c/em\u003e using high‑throughput sequencing and capillary electrophoresis techniques, aiming to assist in population genetic studies on this increasingly scarce gastropod.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDevelopment of microsatellite markers\u003c/h2\u003e \u003cp\u003eTo construct the genomic library, nine individuals of \u003cem\u003eN. cumingii\u003c/em\u003e from seas of Dalian (DL), Lvshun (LS) and Weihai (WH) were selected, with three individuals from each sampling site (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [13]. Genomic DNA was extracted from the cryopreserved foot muscles using the Tiangen DNA kit (DP324, Tiangen Biotech (Beijing) Co., Ltd., Beijing) following the manufacturer\u0026rsquo;s instructions. The genomic DNA was then fragmented into ~\u0026thinsp;400 bp to develop the genomic library. Eight probes, including p(AG)\u003csub\u003e10\u003c/sub\u003e, p(AC)\u003csub\u003e10\u003c/sub\u003e, p(AAC)\u003csub\u003e8\u003c/sub\u003e, p(AGG)\u003csub\u003e8\u003c/sub\u003e, p(ACG)\u003csub\u003e8\u003c/sub\u003e, p(AAG)\u003csub\u003e8\u003c/sub\u003e, p(ATCT)\u003csub\u003e6\u003c/sub\u003e, as well as p(ACAT)\u003csub\u003e6\u003c/sub\u003e, were adopted in capturing microsatellites from the library by the magnetic beads enriched method. The enriched genomic library was sequenced on the Illumina NovaSeq platform (Illumina, San Diego, CA, USA) at Shanghai Personalbio Biotechnology Co., Ltd using 2\u0026times;150 bp paired-end sequencing mode. Raw reads were filtered by removing reads of which the length are \u0026le;\u0026thinsp;50 bp, or of low quality, or with 3\u0026rsquo; adaptors using AdapterRomoval 2.1.7 [14], and combined by FLASH 1.2.11 [15]. Microsatellites were calculated by motif types. The loci were then searched from all combined sequences by an online Microsatellite identification tool at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pgrc.ipk-gatersleben.de/misa/\u003c/span\u003e\u003c/span\u003e. After deleting the microsatellites with flanking sequences\u0026thinsp;\u0026lt;\u0026thinsp;20 bp, CDHIT software was used to cluster the remaining sequences. The SSR length polymorphism (SSLP) of each cluster was calculated by Perl program. Microsatellite markers for \u003cem\u003eN. cumingii\u003c/em\u003e were developed from clusters with SSLP\u0026thinsp;≧\u0026thinsp;2 and designed using Primer3 v2.3.6 [16]. The primer pairs were then screened by the following criterions: a) no motif types were the mononucleotide repeat motifs or compound repeat motifs, b) only one SSR in each read, c) the primer pairs should be within one cluster, d) each designed primer had to be supported by two primers in the clusters, and e) exact same primers were removed.\u003c/p\u003e \u003c/div\u003e\u003ch2\u003eScreening And Characterization Of Microsatellite Markers\u003c/h2\u003e\u003cp\u003eTo check the amplified fragment length and specific amplification, 50 primer pairs were selected randomly. The PCR mixture contained 0.5 \u0026micro;L each primer, 1.0 \u0026micro;L template DNA, 10 \u0026micro;L 2 \u0026times; Taq PCR MasterMix (PC1120, Beijing Solarbio Science \u0026amp; Technology Co., Ltd., Beijing, China), and 8 \u0026micro;L H\u003csub\u003e2\u003c/sub\u003eO in a 20\u0026micro;L reaction system. Fragments were amplified using the following protocol: initial denature at 95\u0026deg;C for 5 min, 35 cycles of 95\u0026deg;C for 30 sec, 50\u0026deg;C for 30 sec, and 72\u0026deg;C for 30 sec, with a final extension at 72\u0026deg;C for 7 min. The agarose gel electrophoresis was used here to detect the PCR products. Primer pairs with single, bright bands agreeing with expected fragment sizes were selected to be further tested.\u003c/p\u003e\u003ch2\u003eGenetic Diversity Analysis Of Microsatellite Markers\u003c/h2\u003e\u003cp\u003e11 pairs of primers with high quality were selected (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and applied in three populations from Dalian (40 individuals), Lvshun (20 individuals) and Weihai (27 individuals). Genomic DNA was extracted as describe above and amplified with fluorescent labeled polymorphic microsatellite markers. The PCR mixture contained 1.0 \u0026micro;L each primer, 1.0 \u0026micro;L template DNA, 2.0 \u0026micro;L 10*buffer, 0.5 \u0026micro;L dNTP, 0.5 \u0026micro;L Taq DNA Polymerase and 14 \u0026micro;L H\u003csub\u003e2\u003c/sub\u003eO in a 20\u0026micro;L reaction system. Fragments were amplified using the protocol described above with corresponding annealing temperature. The products were purified and capillary electrophoresis [17] was conducted on ABI 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of eleven microsatellite loci from \u003cem\u003eN. cumingii\u003c/em\u003e developed in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLocus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRepeat motif\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize range (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTa (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFluorescence labeling\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AAAACCCTTTGATGTTTCCAG\u003c/p\u003e \u003cp\u003eR: TGCTGTCCAGCTTGGTTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AAG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e141\u0026ndash;162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHEX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCTCGACCCAGATGCTATTG\u003c/p\u003e \u003cp\u003eR: TTTTTCGGAAGAGTAGGCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(TCT)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e269\u0026ndash;299\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFAM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGGAGGAACGGGTGTCTAAT\u003c/p\u003e \u003cp\u003eR: TTTACATCCCTCACCCGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(TGTA)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e202\u0026ndash;234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFAM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCCAATTTTCTTTCCCTTTCTT\u003c/p\u003e \u003cp\u003eR: GCCTTTTTCGGAATAAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e163\u0026ndash;189\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHEX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGGCAACTTGGATCAGTTCTC\u003c/p\u003e \u003cp\u003eR: CACTTGATTGAGTCCTCGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200\u0026ndash;224\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFAM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCCACTGGCCCTGTATCTCT\u003c/p\u003e \u003cp\u003eR: CATCCATCTGTCTATCTCTCTATCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AGAT)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e260\u0026ndash;300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHEX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTAGCTGTTGACCCAAACCC\u003c/p\u003e \u003cp\u003eR: GAATGGACCAAAGCCAAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AAG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e272\u0026ndash;302\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTAMRA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCTTCTTCGTCTTGTTCTTGTTC\u003c/p\u003e \u003cp\u003eR: TTCATTTTGTTTCGTCAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(TTC)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e356\u0026ndash;385\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFAM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATCCGCTCCCAAAGTTAGGT\u003c/p\u003e \u003cp\u003eR: ACTGTTTCCCCAGCATGAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AAG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e192\u0026thinsp;\u0026minus;\u0026thinsp;143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHEX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCCTTGTTCTTCACCAAAAATC\u003c/p\u003e \u003cp\u003eR: TGGTGCATAATGTGCTTTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e218\u0026ndash;230\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTAMRA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGAAGATATCTCCCACACTTGG\u003c/p\u003e \u003cp\u003eR: CTTGTTCCGCTTCCACTGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e(AAG)n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e246\u0026ndash;261\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHEX\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eResults were analyzed by GeneMarker V2.2.0 to read the size and signal value of the fragments. The observed number of alleles (\u003cem\u003eNa\u003c/em\u003e), effective number of alleles (\u003cem\u003eNe\u003c/em\u003e), observed heterozygosity (\u003cem\u003eHo\u003c/em\u003e), expected heterozygosity (\u003cem\u003eHe\u003c/em\u003e), Shannon\u0026rsquo;s information index (\u003cem\u003eI\u003c/em\u003e) and F-Statistics (\u003cem\u003eFst\u003c/em\u003e) were evaluated by PopGene software verson 1.31, as well as Nei\u0026rsquo;s Unbiased measures of genetic identity and genetic distance among three populations [18]. The gene flow (\u003cem\u003eNm\u003c/em\u003e) was estimated following \u003cem\u003eNm\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.25(1-\u003cem\u003eFst\u003c/em\u003e)/\u003cem\u003eFst\u003c/em\u003e. And polymorphism information content (\u003cem\u003ePIC\u003c/em\u003e) was calculated using the formula proposed by Bostein et al [19].\u003c/p\u003e"},{"header":"Results And Discussion","content":"\u003cp\u003eBy Illumina high-throughput sequencing of nine individuals of \u003cem\u003eN. cumingii\u003c/em\u003e, 8,776,062 raw reads were obtained with 1,316\u0026nbsp;million bp total bases. The average GC content was 41.86%. Totally, 7,339,720 high-quality reads were obtained, accounting for 83.63% raw reads. 2,497,115 combined pairs were assembled, from which a total of 30,31,455 microsatellites were identified. 851,479 combined pairs had more than one microsatellite. Most microsatellites were mononucleotide repeat motifs, accounting for 94.55% all microsatellites. 7875 microsatellites (4.50%) were dinucleotide repeat motifs, and 1135 (0.65%) and 347 (0.20%) were trinucleotide and tetranucleotide repeat motifs, respectively. The cluster analysis revealed 242,751 clusters in total, of which 51,467 clusters (21.20%) showed length polymorphism (\u0026thinsp;≧\u0026thinsp;2) across 9 individuals. Thereinto, 27,626 clusters (11.38%) had two lengths. After the primer pairs were filtered, 1297 primer pairs with SSLP from 2 to 4 were obtained.\u003c/p\u003e \u003cp\u003eA total of 11 primer pairs were validated in 87 individuals from three populations (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The \u003cem\u003eNa\u003c/em\u003e and \u003cem\u003eNe\u003c/em\u003e ranged from 6 to 13 and from 3.7478 to 14.4273, respectively. Both \u003cem\u003eHo\u003c/em\u003e and \u003cem\u003eHe\u003c/em\u003e were high, with means of 0.4355 and 0.8447 for each locus, respectively. The Shannon\u0026rsquo;s information index values varied from 1.5955 to 2.4490. The \u003cem\u003ePIC\u003c/em\u003e values of each locus varied from 0.7296 to 0.9301, with all greater than 0.5, suggesting that all the eleven microsatellite loci were highly polymorphic and valuable for genetic diversity studies [19]. The average \u003cem\u003eFst\u003c/em\u003e and \u003cem\u003eNm\u003c/em\u003e values were 0.0519 and 4.5660, indicating little genetic differentiation and abundant gene flow [20]. In addition, the maximum value (0.8332) and minimum value (0.6096) of Nei\u0026rsquo;s genetic identity occurred between populations of Lvshun and Dalian and between Lvshun and Weihai, respectively, corresponding to the minimum and maximum genetic distance values of 0.1825 and 0.4949. The distribution pattern reveals that the Yellow Sea Warm Current is the drive that leads to the high level of genetic connectivity in \u003cem\u003eN. cumingii\u003c/em\u003e. In conclusion, the 11 microsatellite markers developed and characterized in this study provide high level of genetics, and these markers will be useful for further analysis of genetic diversity in \u003cem\u003eN. cumingii\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenetic diversity based on 11 microsatellite loci of \u003cem\u003eN. cumingii\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLocus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSample size\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eNa\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eNe\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eHo\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eHe\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eI\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003ePIC\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eFst\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cem\u003eNm\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.4516\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.5263\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8220\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.8977\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.8113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0575\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e4.0993\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e154\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.7478\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.4545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.7380\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.6868\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.7311\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0522\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e4.5383\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e148\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.7909\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.3378\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.7412\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.7077\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.7296\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0648\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e3.6100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e126\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.2558\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.6508\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9097\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.4490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.9002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0449\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e5.3179\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e164\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9.8089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.5854\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9036\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.3744\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.8968\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0296\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e8.2066\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e114\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.3757\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.5088\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8721\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.1666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.8602\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0302\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e8.0269\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8.1337\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.3971\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8836\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.2082\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.8733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0337\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e7.1696\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9.2190\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.6364\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8983\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.3018\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.8902\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e5.9400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14.4273\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.3333\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9375\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.7434\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.9301\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e9.5205\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.2083\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.3000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.7794\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.7945\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0657\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e3.5546\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNC11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.2017\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.0600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.7697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.5955\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.7403\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.1445\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e1.4805\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMean\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e133\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.3636\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.4201\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.4355\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.0828\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.8325\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.0519\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e4.5660\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003e\u003cem\u003eNa\u003c/em\u003e: observed number of alleles, \u003cem\u003eNe\u003c/em\u003e: effective number of alleles, \u003cem\u003eHo\u003c/em\u003e: observed heterozygosity, \u003cem\u003eHe\u003c/em\u003e: expected heterozygosity, \u003cem\u003eI\u003c/em\u003e: Shannon\u0026rsquo;s information index,\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"10\"\u003e\u003cem\u003ePIC\u003c/em\u003e: polymorphism information content, \u003cem\u003eFst\u003c/em\u003e: F-Statistics, \u003cem\u003eNm\u003c/em\u003e: gene flow.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Cong Zhou, Xiaolong Wang and Zhi Hu for assistance in collecting the experimental materials. We appreciate the help in data processing from Yue Tan of the Ocean University of China.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Key R\u0026amp;D Program of China (No. 2019YFD0901303, 2019YFD0900800), the China Agriculture Research System of MOF and MARA, the Major Scientific and Technological Innovation Project of Shandong Provincial Key Research and Development Program (No. 2019JZZY020708), the Industry Leading Talents Project of Taishan Scholars (Recipient: Tao Zhang), the \u0026lsquo;Double Hundred\u0026rsquo; Blue Industry Leader Team of Yantai (Recipient: Tao Zhang) and the Science and Technology Service Network Initiative, Chinese Academy of Sciences (No. KFJ-STS-QYZD-189).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHW and TZ designed the experiment. Material preparation was performed by HL. Data collection and analysis were performed and the first draft of the manuscript was written by PM. All authors commented on previous versions of the manuscript and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study did not require ethics approval.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors consent to publish all the data in this study.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e1.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;An JE, Choi JD, Ryu DK (2015) Age and growth of the \u003cem\u003eNeptunea (Barbitonia) arthritica cumingii\u003c/em\u003e in the West Sea of Korea. The Korean Journal of Malacology 31: 165-170. http://dx.doi.org/10.9710/kjm.2014.30.1.25\u003c/p\u003e\n\u003cp\u003e2.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Nishikawa T, Doi K, Tsujimura K, Hamano T (2009) Food poisoning case of tetramine from eating \u003cem\u003eNeptunea arthritica cumingii\u003c/em\u003e. Annual Report of Nagasaki Prefectural Institute of Public Health and Environmental Sciences 55: 118-120.\u003c/p\u003e\n\u003cp\u003e3.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Guo D, Liu X, Wang A et al (2015) Stock distribution of whelk \u003cem\u003eNeptunea arthritica\u003c/em\u003e Crosse in Liaodong Bay. Fisheries Science 34: 718-721. http://doi.org/10.16378/j.cnki.1003-1111.2015.11.009\u003c/p\u003e\n\u003cp\u003e4.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Hao Z, Wang Y, Yu Y et al (2016) Analysis and evaluation of nutritive composition in the muscle of \u003cem\u003eNeptunea arthritica cumingii\u003c/em\u003e Crosse (Gastropoda: Buccinidae). Journal of Dalian Ocean University 37: 66-70.\u003c/p\u003e\n\u003cp\u003e5.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Yang M, Feng J, Yu Z et al (2020) Comparative analysis of the feeding habits of\u003cem\u003e\u0026nbsp;Rapana venosa\u003c/em\u003e and \u003cem\u003eNeptunea arthritica cumingii\u0026nbsp;\u003c/em\u003enear Zhangzi Island, China, based on stable isotope ratios and fatty acid profiles. Aquac Res 52: 1846-1854. http://doi.org/10.1111/are.15033\u003c/p\u003e\n\u003cp\u003e6.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Hao Z, Liu H, Yu Y et al (2021) Reproductive characteristics and variations in the biochemical composition of \u003cem\u003eNeptunea arthritica cumingii\u0026nbsp;\u003c/em\u003eCrosse through embryonic development. Aquac Res 52: 1-11. http://doi.org/10.1111/are.14790\u003c/p\u003e\n\u003cp\u003e7.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Lombardo RC, Goshima S (2010) Female copulatory status and male male choice in \u003cem\u003eNeptunea arthritica\u003c/em\u003e (Gastropoda: Buccinidae). J Mollus Stud 76: 317-322. http://doi.org/10.1093/mollus/eyq015\u003c/p\u003e\n\u003cp\u003e8.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Yu Y, Li J, Wu W, Hao Z (2019) Research development of reproductive biology and artificial breeding technology of \u003cem\u003eNeptunea cumingii\u003c/em\u003e. Hebei Fisheries 4: 54-56. http://doi.org/10.3969/j.issn.1004-6755.2019.04.014\u003c/p\u003e\n\u003cp\u003e9.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Xia Y, Guo P, Li R et al (2014) Analysis of genetic diversity and population structure using SSR markers in tobacco. Advanced Materials Research 850-851: 1243-1246. https://doi.org/10.4028/www.scientific.net/AMR.850-851.1243\u003c/p\u003e\n\u003cp\u003e10.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Sui N, Hou L, Dong C et al (2008) Optimization of fingerprint on simple sequence repeats (SSR) of conch \u003cem\u003eNeptunea cumingi\u003c/em\u003e. Fisheries Science 27: 199-202. http://doi.org/10.16378/j.cnki.1003-1111.2008.04.006\u003c/p\u003e\n\u003cp\u003e11.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Zhang D, Wang Y, Li Z et al (2021) Genetic diversity of mitochondial \u003cem\u003eCOX\u003c/em\u003e I and\u003cem\u003e\u0026nbsp;CYTB\u003c/em\u003e genes in Neptune whelk \u003cem\u003eNeptunea cumingii\u003c/em\u003e. Journal of Dalian Ocean University 36: 612-619. http://doi.org/10.16535/j.cnki.dlhyxb.2020-285\u003c/p\u003e\n\u003cp\u003e12.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Azuma N, Miranda RM, Goshima S, ABE S (2009) Polymorphic microsatelliate markers isolated from the neptune whelk \u003cem\u003eNeptunea arthritica\u003c/em\u003e. Mol Ecol Resour 9: 120-121. http://doi.org/10.1111/j.1755-0998.2008.02179.x\u003c/p\u003e\n\u003cp\u003e13.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Schlitzer R (2021) \u003cem\u003eOcean Data View http://odv.awi.de\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e14.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Lindgreen S (2012) AdapterRemoval: easy cleaning of next-generation sequencing reads. BMC Res Notes 5: 337. http://doi.org/10.1186/1756-0500-5-337\u003c/p\u003e\n\u003cp\u003e15.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27: 2957-2963. http://doi.org/10.1093/bioinformatics/btr507\u003c/p\u003e\n\u003cp\u003e16.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Untergasser A, Cutcutache I, Koressaar T et al (2012) Primer3-new capabilities and interfaces. Nucleic Acids Res 40: e115. http://doi.org/10.1093/nar/gks596\u003c/p\u003e\n\u003cp\u003e17.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Vemireddy LR, Archak S, Nagaraju J (2007) Capillary electrophoresis is essential for microsatellite marker based detection and quantification of adulteration of basmati rice (\u003cem\u003eOryza sativa\u003c/em\u003e). J Agric Food Chem 55: 8112-8117. http://doi.org/10.1021/jf0714517\u003c/p\u003e\n\u003cp\u003e18.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89: 583-590. http://doi.org/10.1007/BF00155576\u003c/p\u003e\n\u003cp\u003e19.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32: 314-331.\u003c/p\u003e\n\u003cp\u003e20.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Reichow D, Smith MJ (2001) Microsatellites reveals high levels of gene flow among populations of the California squid \u003cem\u003eLoligo opalescens\u003c/em\u003e. Mol Ecol 10: 1101-1109. http://doi.org/10.1046/j.1365-294x.2001.01257.x\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"microsatellite markers, Neptunea cumingii, genetic diversity, Illumina, high-throughput sequencing","lastPublishedDoi":"10.21203/rs.3.rs-1406657/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1406657/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe Neptune whelk, \u003cem\u003eNeptunea cumingii\u003c/em\u003e, is an economic species endemic to the East Asia Warm Temperate Biotic Subregion. The development of microsatellite markers will be beneficial to the assessment of genetic diversity and conservation of resources on this decreasing gastropod.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods and Results\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe microsatellite markers were developed and characterized through Illumina high-throughput sequencing and capillary electrophoresis techniques. 11 polymorphic microsatellite loci were screened and validated. The observed heterozygosity and expected heterozygosity of each locus ranged from 0.0600 to 0.6508 and from 0.7380 to 0.9375, respectively. The average Shannon’s information index, polymorphism information content, F-Statistics and gene flow were 2.0828, 0.8325, 0.0519 and 4.5660, respectively. The genetic diversity analysis indicated a closer genetic distance between populations of Dalian and Lvshun. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe distribution pattern of polymorphic microsatellite loci reveals that the Yellow Sea Warm Current generates the high level of genetic connectivity in \u003cem\u003eN. cumingii\u003c/em\u003e. The markers developed in this study are expected as informative for further analysis of genetic diversity in \u003cem\u003eN. cumingii\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Development and characterization of the microsatellite markers for the Neptune whelk, Neptunea cumingii","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-03-03 15:35:45","doi":"10.21203/rs.3.rs-1406657/v1","editorialEvents":[{"type":"communityComments","content":2},{"type":"editorInvitedReview","content":"","date":"2022-03-22T11:52:16+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-03-02T13:25:25+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-03-01T09:09:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2022-03-01T01:35:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"093c8039-9ea3-4a14-8ac4-e2fd278d53c8","owner":[],"postedDate":"March 3rd, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-05-25T14:32:34+00:00","versionOfRecord":[],"versionCreatedAt":"2022-03-03 15:35:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1406657","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1406657","identity":"rs-1406657","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}