Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway

Renoprotective Effects of Montelukast in... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/14-660" }, "headline": "Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway", "datePublished": "2025-07-07T14:16:03", "dateModified": "2026-04-17T08:34:55", "author": [ { "@type": "Person", "name": "Abeer J. Abdulredha" }, { "@type": "Person", "name": "Murooj L. Majeed" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Sepsis-associated acute kidney injury is ubiquitous among patients with critical conditions and contributes to high mortality rates. SA-AKI was experimentally elicited in murine models via cecal ligation and puncture. Aims This study aimed to determine the possible protective effects of montelukast on sepsis-induced acute kidney injury in a mouse sepsis model. Methods Albino male Swiss mice (n = 40) were allocated into four distinct groups: (i) normal group, (ii) CLP group, (iii) vehicle group, and (iv) Cecal Ligation and Puncture + Montelukast group (20 mg/kg one hour before Cecal Ligation and Puncture). Blood and tissue biochemical/routine indicators, renal function, Sepsis-associated acute kidney injury -related pathophysiological processes, and nuclear factor kappa B (NF-κB) p65 gene expression in septic mice were assessed by histological hematoxylin and eosin (H&E) staining, immunohistochemical (IHC) staining, quantitative reverse transcription polymerase chain reaction, and Enzyme-Linked Immunosorbent Assay. Results The findings highlight that Montelukast reversed CLP-induced increases in serum blood urea nitrogen, creatinine (Cr), and kidney injury molecule levels. It also significantly inhibited elevated concentrations of interleukin (IL)-1β, tumor necrosis factor alpha (TNF-α), F2-isoprostane, and caspase-3 in renal tissues. Additionally, NF-κB protein levels were notably lower in the CLP+ montelukast group than in Cecal Ligation and Puncture group P<0.001. In addition, montelukast significantly mitigated extensive tubular damage in the murine sepsis group p<0.001. Conclusion These findings indicate that montelukast may serve as a promising therapeutic agent for sepsis-induced AKI. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/14-660/v1", "name": "Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting..." } } ] } Home Browse Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Abdulredha AJ and Majeed ML. Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.12688/f1000research.163164.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] Abeer J. Abdulredha https://orcid.org/0009-0007-8640-432X 1 , Murooj L. Majeed 2 Abeer J. Abdulredha https://orcid.org/0009-0007-8640-432X 1 , Murooj L. Majeed 2 PUBLISHED 07 Jul 2025 Author details Author details 1 Department of Pharmacology, University of Kufa, Kufa, Najaf Governorate, Iraq 2 Department of Pharmacology and Therapeutics, University of Kufa, Kufa, Najaf Governorate, Iraq Abeer J. Abdulredha Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation Murooj L. Majeed Roles: Visualization, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Advances in Fibroblast Research collection. Abstract Background Sepsis-associated acute kidney injury is ubiquitous among patients with critical conditions and contributes to high mortality rates. SA-AKI was experimentally elicited in murine models via cecal ligation and puncture. Aims This study aimed to determine the possible protective effects of montelukast on sepsis-induced acute kidney injury in a mouse sepsis model. Methods Albino male Swiss mice (n = 40) were allocated into four distinct groups: (i) normal group, (ii) CLP group, (iii) vehicle group, and (iv) Cecal Ligation and Puncture + Montelukast group (20 mg/kg one hour before Cecal Ligation and Puncture). Blood and tissue biochemical/routine indicators, renal function, Sepsis-associated acute kidney injury -related pathophysiological processes, and nuclear factor kappa B (NF-κB) p65 gene expression in septic mice were assessed by histological hematoxylin and eosin (H&E) staining, immunohistochemical (IHC) staining, quantitative reverse transcription polymerase chain reaction, and Enzyme-Linked Immunosorbent Assay. Results The findings highlight that Montelukast reversed CLP-induced increases in serum blood urea nitrogen, creatinine (Cr), and kidney injury molecule levels. It also significantly inhibited elevated concentrations of interleukin (IL)-1β, tumor necrosis factor alpha (TNF-α), F2-isoprostane, and caspase-3 in renal tissues. Additionally, NF-κB protein levels were notably lower in the CLP+ montelukast group than in Cecal Ligation and Puncture group P<0.001. In addition, montelukast significantly mitigated extensive tubular damage in the murine sepsis group p<0.001. Conclusion These findings indicate that montelukast may serve as a promising therapeutic agent for sepsis-induced AKI. READ ALL READ LESS Keywords Cecal ligation & puncture, inflammatory mediators, Montelukast, NF-κB signaling cascade, Sepsis associated acute kidney injury Corresponding Author(s) Abeer J. Abdulredha ( [email protected] ) Close Corresponding author: Abeer J. Abdulredha Competing interests: No competing interests were disclosed. Grant information: The author(s) declared that no grants were involved in supporting this work. Copyright: © 2025 Abdulredha AJ and Majeed ML. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Abdulredha AJ and Majeed ML. Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.12688/f1000research.163164.1 ) First published: 07 Jul 2025, 14 :660 ( https://doi.org/10.12688/f1000research.163164.1 ) Latest published: 17 Apr 2026, 14 :660 ( https://doi.org/10.12688/f1000research.163164.2 )  There is a newer version of this article available. Suppress this message for one day. Introduction Sepsis is a life-threatening condition caused by infection-induced organ dysfunction syndrome. 1 Sepsis is a life-threatening medical condition that occurs when an infection leads to systemic impaired function of the tissues and organs in response to this infection, leading to immunosuppression. 2 This is often due to an uncontrolled immune response, cytokine storm, and oxidative stress that cause multiple organ failure, eventually leading to death. 3 They frequently result from microorganisms, such as bacteria, viruses, and fungi, which can lead to organ dysfunction in most cases. 4 Sepsis is related to several morbidities in the heart, kidney, liver, and central nervous system. 5 Acute Kidney Injury is a common outcome associated with the clinical scenario of sepsis is Acute Kidney Injury. 6 The pathogenesis of acute kidney injury in sepsis is multifaceted. Among these contributing factors, oxidative stress and inflammation are pivotal etiological agents of septic Acute Kidney Injury. 7 Sepsis-associated acute kidney injury originates from intricate, heterogeneous mechanisms that culminate in renal injury. These mechanisms may arise directly from the infectious agent and the corresponding host immune response or may represent indirect ramifications of sepsis or its therapeutic intervention. Various pathophysiological mechanisms may interact and participate in Acute Kidney Injury in patients with sepsis, including systemic and renal inflammation, microcirculatory anomalies, microcirculatory dysfunction, metabolic reprogramming, mitochondrial impairment, and dysregulation of the renin-angiotensin-aldosterone system (RAAS). 8 Inflammation, recognized as a critical element in sepsis, appears to significantly influence the pathogenesis of Sepsis-associated acute kidney injury. Pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) can stimulate toll-like receptors (TLRs). TLR-2 and TLR-4 are expressed on the surface of tubular epithelial cells within the renal system. 9 The engagement of TLR-2 and TLR-4 initiates a cascade of inflammatory responses, which is marked by the secretion of pro-inflammatory cytokines including IL-1α, IL-6, IL-8, and TNF-α. 10 Methods Animals The current investigation was conducted using a cohort of 40 albino Swiss mice, with a weight spectrum of 25–30 g and an age range of 8–12 weeks. All euthanizing procedures were conducted under a combination of ketamine- and xylazine-based anesthesia, with diligent efforts made to mitigate individual distress. The experimental methodologies and protocols employed in this study were approved on August 29, 2024, under reference number (20553) from the ethics committee for the care and utilization of laboratory animals. Animal Welfare and Ethical Statement The current study was done with a total of 40 albino Swiss mice, aged 8-12 weeks and weighing 25-30 g, obtained from the College of Science, University of Kufa. These animals were housed in the animal house within their cages under 12:12 light: dark cycles with 25°C room temperature, 60-65% humidity, and free access to water and libitum. All animal procedures were conducted based on the guidelines of the Kufa University and were approved by the Institutional Animal Care and Use Committee (IACUC). The experimental protocol was reviewed and approved by the Research Ethics Committee, Faculty of Pharmacy, Kufa University under approval number (2055 on August 29, 2024). All efforts were made to minimize animal suffering, encompassing the use of appropriate anesthesia (xylazine of (20mg/ml) and ketamine of 100mg/ml), and animals were monitored closely throughout the study. Humane endpoint and euthanasia protocols were strictly followed through cardiac puncture following intraperitoneal injection of thiopental sodium (50 mg/kg) to induce deep anesthesia to ensure a painless and ethical procedure. Cecal ligation and puncture In the current study, Cecal Ligation and Puncture used in earlier studies, including those performed by Refs. 11 , 12 , was employed to induce sepsis in animals. It is introduced by making a midline incision measuring 1.5 cm while the subject is under general anesthesia, wherein xylazine of (20 mg/ml) and ketamine of 100 mg/ml are mixed (2:1) and administered. 13 The cecum was ligated, situated below the ileocecal junction, and punctured twice with a cutting cannula to inflict kidney organ damage during the first 24 h of acute sepsis. Subsequently, the puncture hole was used to squeeze a tiny amount of fecal material from behind the perforation site. Thereafter, the anterior abdomen was sutured to prevent leakage. Sham mice were subjected to the same procedures, except that Cecal Ligation and Puncture was not performed. Experimental groups Mice were classified into the subsequent four distinct groups (n=10): Sham group: Evidently, mice exhibited no apparent signs of disease. CLP cohort: Mice belonging to this cohort experienced a Cecal Ligation and Puncture surgical procedure. Vehicle group: Murine classified within this category was administered an equivalent volumetric measurement of the solvent dimethyl sulfoxide (DMSO) intraperitoneally; Cecal Ligation and Puncture was performed after 1 h, and then the animals were euthanized after 24 h. Montelukast group: Mice affiliated with this group received montelukast 20 mg/kg intraperitoneally 14 ; Cecal Ligation and Puncture was performed after 1 h, and then the animals were euthanized after 24 h. Sample preparation and tissue isolation After 24 h, the mice were euthanized under anesthesia and blood was collected using the direct heart puncture method. Blood was left in a gel tube rack for approximately 20 min to allow for clot formation, after which it was centrifuged at 10,000 rpm for approximately 10 min. Then, the supernatant was retained at -20 °C for sequences of biochemical assessment. 15 The right kidney tissues were fixed in 10% formaldehyde for histological investigation (H&E) and IHC analysis, 16 whereas the left kidneys of different groups were collected and divided into two sections. The first section was homogenized in cold phosphate-buffered saline (PBS) (pH 7.4), and the supernatants were used for Enzyme-Linked Immunosorbent Assay (ELISA). The remainder of the tissue (1/3) was immersed in the TRIzol reagent for gene expression measurement. For analysis, the tissue homogenate was stored at -80°C. 17 Evaluation of renal histology After fixation with 4% paraformaldehyde for 24 h, the right kidney was embedded in paraffin. H&E and periodic acid-Schiff (PAS) reagents were used to stain 4 μm thick sections cut from the renal tissue wax blocks. Tissue damage was scored as follows: 0, no harm; 1, 0–25; 2, 25–50; 3, 50–75; 4, >75%. 18 Evaluation of renal function BUN and Cr concentrations were measured using a Biolis colorimetric assay kit (Biolis, Tokyo, Japan). Assay of Enzyme-Linked Immunosorbent (ELISA) ELISA kit instructions (Sunlong, China) were followed while processing tissue samples kept in a refrigerator at -80°C for evaluation of TNF-α, IL-1β, F2-isoprostane, and caspase-3, in addition to measurement of serum KIM-1 levels. Absorbance was measured at 450 nm using a microplate reader to create a standard curve and determine the concentration. Immunohistochemistry (IHC) assay Paraffin-embedded blocks of the renal sections were studied after xylene deparaffinization; the rehydration step of these sections was performed by decreasing the alcohol concentration. Then, blockade of Peroxidase activity was blocked with H2O2, while protein blockers were used for non-specific binding sites, primary antibodies against NF-κB (rabbit NF-κB antibody, 1:200) were incubated at 4°C overnight, followed by the addition of a secondary antibody (biotinylated antibody) done at 37°C for 30 min. HRP was added at the same time. Finally, each slide was treated with the chromogen (100μl/slide) for 15 min. All sections were counterstained with hematoxylin. Positive immunostaining was visualized as brown granules contained in the cytoplasm. 19 Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) assay Total RNA was extracted using TRIzol reagent, according to the manufacturer’s instructions. We used an ABI 7500 real-time PCR machine and the Power SYBR Green PCR master mix to run real-time PCR in triplicate on cDNA produced by a reverse transcription reaction. Table 1 displays the primer sequences used, with GAPDH as the internal control. The 2^-∆∆Ct technique was used to determine the relative expression levels of target genes. Table 1. Sequences of primers and housekeeping gene. GENE F (forward primer) R (reverse primer) NF-κB/P65 GGCCTCATCCACATGAACTT CACTGTCACCTGGAAGCAGA HKG TCTTGGGCTACACTGAGGAC TGTTGCTGTAGCCGTATTCA Statistical analysis This study utilized version 9.3.1 of GraphPad Prism for statistical analysis https://www.graphpad.com/demos/ . One-way analysis of variance (ANOVA) was used to examine differences across groups. Subsequently, the Bonferroni method for multiple comparisons was used to conduct post-hoc tests. All tests were deemed statistically significant when P was less than 0.05. All data are presented as the mean ± SEM. Results Renal function The results indicated that the CLP cohort had remarkably elevated serum BUN ( Figure 1A ) and Cr ( Figure 1B ) levels, in contrast to the sham cohort. Additionally, the BUN and Cr levels in the montelukast group were significantly lower than those in the Cecal Ligation and Puncture (CLP) cohort. Figure 1. A: Mean (±SEM) concentrations of the urea in the different experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture. B: Mean (±SEM) concentrations of serum creatinine in the different experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture. Inflammatory cytokines According to these findings, the Cecal Ligation and Puncture cohort exhibited a notably heightened level of TNF-α ( Figure 2A ) and IL-1β ( Figure 2B ), which was in stark contrast to the sham cohort. Furthermore, TNF-α plus IL-1β concentrations in the montelukast cohort were significantly lower than those in the CLP cohort. Figure 2. A: Mean concentrations (±SEM) of renal tissue TNF-α (ng/L) among the various experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; TNF-α: tumor necrosis factor alpha. B: Mean concentrations (±SEM) of renal tissue IL-1β (ng/L) among the various experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; IL: interleukin. Apoptotic factor (caspase-3) The results indicated that caspase-3 tissue levels in the Cecal Ligation and Puncture cohort were remarkably higher than those in the sham cohort. Additionally, the montelukast group had significantly lower levels of caspase-3 than the Cecal Ligation and Puncture group Figure 3 . Figure 3. Mean (± SEM) caspase-3 (ng/ml) levels of the experimental groups; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture. Oxidative stress (F2-isoprostane) The results indicated that Cecal Ligation and Puncture cohort had a significantly higher concentration of F2-isoprostanes than the sham cohort. Additionally, the cohort administered montelukast exhibited significantly reduced concentrations compared to the CLP cohort Figure 4 . Figure 4. Mean (±SEM) concentrations of F2-isoprostane (ng/L) in the various experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture. Serum KIM-1 The results indicated that the CLP cohort had remarkably higher serum KIM-1 levels than the sham cohort. Additionally, the KIM-1 levels in the montelukast group were significantly lower than those in the Cecal Ligation and Puncture group Figure 5 . Figure 5. Mean (±SEM) concentrations of serum KIM-1 in the different experimental cohorts; *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture. Renal histopathological damage As illustrated in Figure 6 , significant pathological alterations were observed in both Cecal Ligation and Puncture and vehicle cohorts. Nevertheless, the nephroprotective effects induced by Cecal Ligation and Puncture were markedly ameliorated by pretreatment with montelukast. Figure 6. A: Montelukast mitigates the pathological impairment of renal tissues in septic rodent models. H&E staining (400 x). Sham group, mice kidney with normal renal tubules. B: Montelukast mitigates the pathological impairment of renal tissues in septic rodent models. H&E staining (400 x). CLP group, mice kidneys with 95% renal tubule damage. Cytoplasmic vacuoles (yellow arrows), eosinophilic casts (blue arrows), and severe inflammation (green arrows). C: Montelukast mitigates the pathological impairment of renal tissues in septic rodent models. H&E staining (400 x), vehicle groups, mice kidney with 90% renal tubule damage. Cytoplasmic swelling and increased cytoplasmic eosinophilia (black arrows), cytoplasmic vacuoles (yellow arrows), and normal glomerulus (orange arrows). D: Montelukast mitigates the pathological impairment of renal tissues in septic rodent models. H&E staining (400 x). Montelukast group, mice kidney with 25% renal tubule damage. Normal tubules (orange arrows). E: Montelukast mitigates the pathological impairment of renal tissues in septic rodent models. H&E staining (400 x). Quantification of renal tissue damage scores of mice across all groups, *p<0.001, compared to sham group; #p<0.001, compared to CLP or vehicle group, CLP: Cecal ligation & puncture. mRNA expression of NF-κB p 65 gene As shown in Figure 7 , the CLP group had a lower DCT than the sham group, indicating a significant increase in the NF-κB p 65 gene mRNA expression. Additionally, there was a substantial DCT surge in the montelukast group compared to the CLP group, representing a decrease in NF-κB p 65 gene mRNA expression. Figure 7. Mean (±SEM) levels of NF-κB p65 mRNA expression in the experimental groups. *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; NF-κB: nuclear factor kappa B. Expression of NF-κB p 65 via IHC Figure 8 illustrates the intensity of positive NF-κB p 65 staining in renal tissue, in addition to negative staining, as follows: Figure 8. A: Immunohistochemical expression of NF-κB in mice kidney. Sham group lacked NF-κB labeling intensity (blue color). B: Immunohistochemical expression of NF-κB in mice kidney. CLP group displayed strong positive NF-κB labeling intensity (brown color). C: Immunohistochemical expression of NF-κB in mice kidney, vehicle group displayed strong positive NF-κB labeling intensity (brown color). D: Immunohistochemical expression of NF-κB in mice kidney, CLP + Montelukast group exhibited minimal NF-κB labeling intensity (blue color), the microscopic assessment was quantified using integral optical density at 400x magnification. E: Immunohistochemical expression of NF-κB in mice kidney, Mean (±SEM) H. Score of NF-κB p 65 mRNA expression in the experimental groups. *p<0.001, vs. Sham group; #p<0.001, vs. CLP or vehicle group, CLP: Cecal ligation & puncture; NF-κB: nuclear factor kappa B. Discussions Polymicrobial sepsis is a life-threatening condition characterized by dysfunction of multiple organs resulting from an aberrant response of the body to microbial invasion. 20 Several experimental and clinical investigations have shown that the immunosuppressive state induced by sepsis is typified by decreased antimicrobial effector functionalities, thereby increasing vulnerability to infections. 21 Immunosuppression associated with sepsis is multifaceted and is believed to arise from compromised cytokine production and reduction in the phagocytic capabilities of myeloid cells. The present investigation revealed that the tissue concentration of the pro-inflammatory cytokine TNF-α was markedly elevated in the Cecal Ligation and Puncture cohort compared to that in the ostensibly healthy cohort. This investigation corroborates previous findings, 22 which demonstrated that in sepsis models, the concentrations of proinflammatory cytokines, particularly TNF-α, were elevated in CLP mice and that increased concentrations of TNF-α correlated with mortality outcomes. In addition, this result was consistent with a previous study 23 showing that renal ischemia-reperfusion injury (RIRI) is a major cause of AKI, characterized by significant inflammation that exacerbates tissue damage. Additionally, the level of tissue TNF-α was significantly lower in the montelukast group than that in the Cecal Ligation and Puncture group. Our results were confirmed by an investigation conducted by Khodir et al., which provided evidence suggesting that montelukast may confer a protective effect on the heart in the context of LPS-induced cardiac injury in rat models. 24 These findings imply that the anti-inflammatory effects of montelukast may be ascribed to the attenuation of pro-inflammatory mediators. 25 Furthermore, our study revealed a notable increase in the tissue levels of IL-1β in the CLP cohort compared to the sham group. This work concurs with a prior study conducted by Ibadi et al. in exploring the lung damage induced by CLP, and found that the Cecal Ligation and Puncture procedure caused a significant surge in pro-inflammatory cytokine levels, IL-1β. 26 Another study investigated the effects of resveratrol on IRI in rats. They found that the level of IL-1β became altered (increased significantly) in ischemic rats. 27 On the other hand, the present study, regarding the influence of montelukast on the concentration of IL-1β, demonstrates that the levels of tissue IL-1β were considerably diminished in the montelukast cohort, in contrast to CLP. Our study is in agreement with those visualized by Ref. 25 and found that compared to the LPS cohort, management with montelukast lessened the surge in serum IL-1β concentration. In addition, the current study found that the CLP and vehicle groups had significantly higher tissue levels of caspase-3 than the sham group. Similar results showed that the sepsis group had higher caspase-3 levels than the normal physiological state. 28 Moreover, this work concurs with a prior study that examined renal damage induced by RIRI. They found that RIRI caused a significant surge in the kidney marker of apoptosis, caspase-3, compared to the sham group. 29 , 30 Additionally, in the present study, concerning the effect of montelukast on the level of caspase-3, the concentration of renal caspase-3 was remarkably lowered within the montelukast cohort, contrary to the CLP group. To the best of our knowledge, no prior study has investigated the pharmacological effects of montelukast on caspase-3 during sepsis. This finding could be ascribed to the ability of montelukast to reduce the levels of NO and renal HO-1. Montelukast effectively mitigated elevated concentrations of ET-1, MCP-1, and TNF-α. These effects were associated with a reduction in caspase-3 expression in the kidneys, confirming its anti-apoptotic activity. 31 Moreover, the current investigation found that the CLP and vehicle cohorts had considerably higher kidney tissue concentrations of F2-isoprostane than the sham cohort. This study supports another study that established a notably higher concentration of the oxidative stress marker (F2-Isoprostane) within the sepsis cohort than in the sham cohort. 32 In the present study, regarding the impact of montelukast on the expression of F2-isoprostane, it was observed that montelukast markedly reduced the concentration of F2-isoprostane within kidney tissue compared to the Cecal Ligation and Puncture group. Additionally, our work is compatible with, 33 which examined whether montelukast possesses the potential to conserve lung function during instances of polymicrobial sepsis. The results of this study showed that mice subjected to sepsis exhibited a notable increase in the level of F2-isoprostane within lung tissues, in stark contrast to the sham cohort. Compared to the sepsis cohort, the administration of montelukast resulted in a significant reduction in F2-isoprostane levels in the lung tissue. This finding can be attributed to the montelukast inhibitory effect of the NF-κB/NLRP3 pathway in which NLRP3 can induce reactive oxygen species production. 34 Furthermore, the current study showed that the mRNA expression of KIM-1 was remarkably higher in the Cecal Ligation and Puncture cohort than in the sham cohort. This work agrees with a previous study that confirmed that the mRNA levels of KIM-1 in Lyn mice that underwent sepsis were remarkably higher than those in sham mice. 35 In addition, the current study aligns with another research effort that established the upregulation of inflammatory marker KIM-1 in both the RIRI and vehicle groups when compared to the sham group. 29 – 30 In the present investigation, concerning the impact of montelukast on the expression of KIM-1, it was observed that montelukast markedly reduced the concentration of KIM-1 in kidney tissue compared to the CLP group. To the best of our knowledge, this investigation represents an inaugural work that elucidates the influence of this pharmacological agent on renal KIM-1 expression within the context of the CLP model of sepsis in mice. This observation may be attributed to the ability of montelukast to inhibit the ERK signaling pathway. 36 Collier and Schnellmann posited that the proposed mechanism underlying acute renal injury is initiated by the phosphorylation of STAT3 and signal transducer and activator of transcription (ERK1/2). 37 In addition, the present investigation revealed that the mRNA expression levels of NF-κB p65 were notably elevated in the Cecal Ligation and Puncture CLP cohort compared to the sham cohort. This work corroborates findings from a previous study, which indicated that the phosphorylation level of p65 within the renal tissue of the Cecal Ligation and Puncture cohort was significantly increased when juxtaposed with the sham cohort. 38 In the present study, concerning the impact of montelukast on the expression levels of NF-κB p 65, there was a notable reduction in NF-κB p65 expression within the renal tissue relative to the CLP cohort. This study is the first to clarify the effect of this pharmacological agent on kidney NF-κB p65 expression in a murine model of Cecal Ligation and Puncture -induced sepsis. This result may be attributed to the ability of montelukast to mitigate IL-1β-induced NF-κBp65 phosphorylation, thereby inhibiting nuclear translocation and subsequent NF-κB activity related to gene expression. 39 Moreover, the Cecal Ligation and Puncture and vehicle groups showed remarkable histopathological changes compared to the sham group. The renal tissue of the sham group mice had normal architecture, whereas the kidneys obtained from the mice in the Cecal Ligation and Puncture cohort exhibited signs of hemorrhage, severe inflammation, increased cytoplasmic eosinophilia, eosinophilic casts, and cytoplasmic vacuoles, as well as loss of brush border. These observations are consistent with those obtained by 19 in their study on groups of Cecal Ligation and Puncture mice. They reported that Cecal Ligation and Puncture causes inflammation, necrosis, hemorrhage, and degeneration of kidney tissue. Additionally, the Montelukast group showed a significantly lower level of renal tissue injury than did the sepsis group. Our results agree with Khodir and colleagues’ study on rats to examine the renoprotective effects of Montelukast after Cecal Ligation and Puncture. 40 This finding can be attributed to their antioxidant and anti-inflammatory properties. Conclusions Montelukast safeguarded renal function in septic mice exhibiting AKI by attenuating the release of inflammatory mediators by inhibiting NF-κB-P65 expression. Additionally, it reduces the extent of oxidative stress, thereby improving kidney outcomes. Furthermore, it can inhibit the adverse consequences associated with apoptotic progression following renal injury by modulating the concentrations of apoptotic factors. Ethical approval The experimental methodologies and protocols employed in this study were approved on August 29, 2024, under reference number (20553) from the ethics committee for the care and utilization of laboratory animals. Data availability Excel data Montelukast. https://doi.org/10.6084/m9.figshare.28599605.v2 41 Reporting guidelines: arrive checklist. https://doi.org/10.6084/m9.figshare.29150939 42 Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication). References 1. Zhang X, Su C, Zhao S, et al. : Combination therapy of Ulinastatin with Thrombomodulin alleviates endotoxin (LPS)-induced liver and kidney injury via inhibiting apoptosis, oxidative stress and HMGB1/TLR4/NF-κB pathway. Bioengineered. 2022; 13 : 2951–2970. PubMed Abstract | Publisher Full Text | Free Full Text 2. Cao C, Yu M, Chai Y: Pathological alteration and therapeutic implications of sepsis-induced immune cell apoptosis. Cell Death Dis. 2019; 10 : 782. PubMed Abstract | Publisher Full Text | Free Full Text 3. Zhang H, Feng YW, Yao YM: Potential therapy strategy: targeting mitochondrial dysfunction in sepsis. Mil. Med. Res. 2018; 5 : 41. PubMed Abstract | Publisher Full Text | Free Full Text 4. Dai W, Zheng P, Luo D, et al. : LPIN1 is a regulatory factor associated with immune response and inflammation in sepsis. Front. Immunol. 2022; 13 : 820164. PubMed Abstract | Publisher Full Text | Free Full Text 5. Algahtani MM, Alshehri S, Alqarni SS, et al. : Inhibition of ITK signaling causes amelioration in sepsis-associated neuroinflammation and depression-like state in mice. Int. J. Mol. Sci. 2023; 24 : 8101. PubMed Abstract | Publisher Full Text | Free Full Text 6. Heinzl MW, Resl M, Klammer C, et al. : Subclinical kidney injury is caused by a moderate single inflammatory event. Shock. 2022; 58 : 14–19. PubMed Abstract | Publisher Full Text | Free Full Text 7. Wang B, Xu J, Fu P, et al. : MicroRNAs in septic acute kidney injury. Burns Trauma. 2023; 11 : tkad008. PubMed Abstract | Publisher Full Text | Free Full Text 8. Zarbock A, Nadim MK, Pickkers P, et al. : Sepsis-associated acute kidney injury: consensus report of the 28th Acute Disease Quality Initiative workgroup. Nat. Rev. Nephrol. 2023; 19 : 401–417. PubMed Abstract | Publisher Full Text 9. Chang YM, Chou YT, Kan WC, et al. : Sepsis and acute kidne injury: a review focusing on the bidirectional interplay. Int. J. Mol. Sci. 2022; 23 : 9159. PubMed Abstract | Publisher Full Text | Free Full Text 10. Kumar V: Toll-like receptors in sepsis-associated cytokine storm and their endogenous negative regulators as future immunomodulatory targets. Int. Immunopharmacol. 2020; 89 : 107087. PubMed Abstract | Publisher Full Text | Free Full Text 11. Drechsler S, Osuchowski M: Cecal ligation and puncture. Sepsis: Methods and Protocols. New York, NY: Springer US; 2021; pp. 1–8. Publisher Full Text 12. Zigam QA, Al-Zubaidy AA, Abbas WJ, et al. : Cardioprotective Effects of Octreotide against Sepsis-Induced Cardiotoxicity in Mice. Arch. Razi Inst. 2023; 78 : 53–61. PubMed Abstract | Publisher Full Text | Free Full Text 13. Navarro KL, Huss M, Smith JC, et al. : Mouse anesthesia: the art and science. ILAR J. 2021; 62 : 238–273. PubMed Abstract | Publisher Full Text | Free Full Text 14. Şener G, Şehirli Ö, Çetinel Ş, et al. : Amelioration of sepsis-induced hepatic and ileal injury in rats by the leukotriene receptor blocker Montelukast. Prostaglandins Leukot. Essent. Fat. Acids. 2005; 73 : 453–462. PubMed Abstract | Publisher Full Text 15. Parasuraman S, Raveendran R, Kesavan R: Blood sample collection in small laboratory animals. J. Pharmacol. Pharmacother. 2010; 8 : 153. PubMed Abstract | Publisher Full Text | Free Full Text 16. Chen D, Ma S, Ye W, et al. : Kaempferol Reverses Acute Kidney Injury in Septic Model by Inhibiting NF-κB/AKT Signaling Pathway. J. Food Biochem. 2023; 2023 : 1–11. Publisher Full Text 17. Taha IA, Al-Drobie BF, Alghanim KM: The Role Of Fixation On Antibodies Expression In Immunohistochemical Staining. Maaen J. Med. Sci. 2024; 3 : 1. Publisher Full Text 18. Shi L, Zha H, Pan Z, et al. : DUSP1 protects against ischemic acute kidney injury through stabilizing mtDNA via interaction with JNK. Cell Death Dis. 2023; 14 : 724. PubMed Abstract | Publisher Full Text | Free Full Text 19. Arifin A, Purwanto B, Indarto D, et al. : Improvement of renal functions in mice with septic acute kidney injury using secretome of mesenchymal stem cells. Saudi J. Biol. Sci. 2024; 31 : 103931. PubMed Abstract | Publisher Full Text | Free Full Text 20. Hollenberg SM, Singer M: Pathophysiology of sepsis-induced cardiomyopathy. Nat. Rev. Cardiol. 2021; 18 : 424–434. Publisher Full Text 21. Nascimento DC, Viacava PR, Ferreira RG, et al. : Sepsis expands a CD39+ plasmablast population that promotes immunosuppression via adenosine-mediated inhibition of macrophage antimicrobial activity. Immunity. 2021; 54 : 2024–2041.e8. PubMed Abstract | Publisher Full Text 22. Newham P, Ross D, Ceuppens P, et al. : Determination of the safety and efficacy of therapeutic neutralization of tumor necrosis factor-α (TNF-α) using AZD9773, an anti-TNF-α immune Fab, in murine CLP sepsis. Inflamm. Res. 2014; 63 : 149–160. PubMed Abstract | Publisher Full Text 23. Alkhafaji GA, Janabi AM: GIP/GLP-1 dual agonist tirzepatide ameliorates renal ischemia/reperfusion damage in rats. Int. J. Appl. Pharm. 2025; 165–173. Publisher Full Text 24. Khodir AE, Ghoneim HA, Rahim MA, et al. : Montelukast attenuates lipopolysaccharide-induced cardiac injury in rats. Hum. Exp. Toxicol. 2016; 35 : 388–397. PubMed Abstract | Publisher Full Text 25. Hagar HH, Alhazmi SM, Arafah M, et al. : Inhibition of sepsis-induced pancreatic injury by leukotriene receptor antagonism via modulation of oxidative injury, and downregulation of inflammatory markers in experimental rats. Naunyn Schmiedeberg’s Arch. Pharmacol. 2024; 397 : 3425–3435. PubMed Abstract | Publisher Full Text 26. Ibadi MH, Majeed S, Ghafil FA, et al. : Effects of CDDO-EA in sepsis-induced acute lung injury: mouse model of endotoxemia. Wiad Lek. 2024; 77 : 497–505. PubMed Abstract | Publisher Full Text 27. Alaasam ER, Janabi AM, Al-Buthabhak KM, et al. : Nephroprotective role of resveratrol in renal ischemia-reperfusion injury: a preclinical study in Sprague-Dawley rats. BMC Pharmacol. Toxicol. 2024; 25 : 82. PubMed Abstract | Publisher Full Text | Free Full Text 28. Miliaraki M, Briassoulis P, Ilia S, et al. : Survivin and caspases serum protein levels and survivin variants mRNA expression in sepsis. Sci. Rep. 2021; 11 : 1049. PubMed Abstract | Publisher Full Text | Free Full Text 29. Jallawee HQ, Janabi AM: Potential nephroprotective effect of dapagliflozin against renal ischemia reperfusion injury in rats via activation of autophagy pathway and inhibition of inflammation, oxidative stress and apoptosis. SEEJPH. 2024; 488–500. Publisher Full Text 30. Jallawee HQ, Janabi AM: Trandolapril improves renal ischemia-reperfusion injury in adult male rats via activation of the autophagy pathway and inhibition of inflammation, oxidative stress, and apoptosis. J. Biosci. Appl. Res. 2024; 10 : 114–127. Publisher Full Text 31. Awad AM, Elshaer SL, Gangaraju R, et al. : Ameliorative effect of montelukast against STZ-induced diabetic nephropathy: targeting HMGB1, TLR4, NF-κB, NLRP3 inflammasome, and autophagy pathways. Inflammopharmacology. 2023; 32 : 495–508. PubMed Abstract | Publisher Full Text | Free Full Text 32. Ghafil FA, Hassan ES, Aziz ND, et al. : Cardioprotective Potential of Celastrol in Sepsis-Induced Cardiotoxicity; Mouse Model of Endotoxemia. Iran. J. War Public Health. 2023; 15 : 361–367. 33. Alnfakh ZA, Al-Mudhafar DH, Al-Nafakh RT, et al. : The anti-inflammatory and antioxidant effects of Montelukast on lung sepsis in adult mice. J. Med. Life. 2022; 15 : 819–827. PubMed Abstract | Publisher Full Text | Free Full Text 34. Gad AM, Abd El-Raouf OM, El-Sayeh BM, et al. : Renoprotective effects of montelukast in an experimental model of cisplatin nephrotoxicity in rats. J. Biochem. Mol. Toxicol. 2017; 31 : e21979. PubMed Abstract | Publisher Full Text 35. Li N, Lin G, Zhang H, et al. : Lyn attenuates sepsis-associated acute kidney injury by inhibition of phospho-STAT3 and apoptosis. Biochem. Pharmacol. 2023; 211 : 115523. PubMed Abstract | Publisher Full Text 36. Kang JH, Lim H, Lee DS, et al. : Montelukast inhibits RANKL-induced osteoclast formation and bone loss via CysLTR1 and P2Y12. Mol. Med. Rep. 2018; 18 : 2387–2398. PubMed Abstract | Publisher Full Text 37. Collier JB, Schnellmann RG: Extracellular signal–regulated kinase 1/2 regulates mouse kidney injury molecule-1 expression physiologically and following ischemic and septic renal injury. J. Pharmacol. Exp. Ther. 2017; 363 : 419–427. PubMed Abstract | Publisher Full Text | Free Full Text 38. Sun S, Wang J, Wang J, et al. : Maresin 1 Mitigates Sepsis-Associated Acute Kidney Injury in Mice via Inhibition of the NF-κB/STAT3/MAPK Pathways. Front. Pharmacol. 2019; 10 : 1323. PubMed Abstract | Publisher Full Text | Free Full Text 39. Dong H, Liu F, Ma F, et al. : Montelukast inhibits inflammatory response in rheumatoid arthritis fibroblast-like synoviocytes. Int. Immunopharmacol. 2018; 61 : 215–221. PubMed Abstract | Publisher Full Text 40. Khodir AE, Ghoneim HA, Rahim MA, et al. : Montelukast reduces sepsis-induced lung and renal injury in rats. Can. J. Physiol. Pharmacol. 2014; 92 : 839–847. PubMed Abstract | Publisher Full Text 41. Abdulredha AJ: Excel data Montelukast.2025. Publisher Full Text Reference Source 42. Abdulredha AJ: montelukast arrive checklist.docx. figshare. 2025. Reference Source Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 07 Jul 2025 ADD YOUR COMMENT Comment Author details Author details 1 Department of Pharmacology, University of Kufa, Kufa, Najaf Governorate, Iraq 2 Department of Pharmacology and Therapeutics, University of Kufa, Kufa, Najaf Governorate, Iraq Abeer J. Abdulredha Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Validation, Writing – Original Draft Preparation Murooj L. Majeed Roles: Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information The author(s) declared that no grants were involved in supporting this work. Article Versions (2) version 2 Revised Published: 17 Apr 2026, 14:660 https://doi.org/10.12688/f1000research.163164.2 version 1 Published: 07 Jul 2025, 14:660 https://doi.org/10.12688/f1000research.163164.1 Copyright © 2025 Abdulredha AJ and Majeed ML. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Abdulredha AJ and Majeed ML. Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.12688/f1000research.163164.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 07 Jul 2025 Views 0 Cite How to cite this report: Fayez Kadhim S. Reviewer Report For: Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.5256/f1000research.179468.r450096 ) The direct URL for this report is: https://f1000research.com/articles/14-660/v1#referee-response-450096 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 30 Jan 2026 Salim Fayez Kadhim , College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.179468.r450096 Reviewer Report This manuscript investigates the renoprotective effects of montelukast in a murine model of sepsis-associated acute kidney injury (SA-AKI), with a particular focus on modulation of the NF-κB signaling pathway. The topic is clinically relevant, as SA-AKI remains ... Continue reading READ ALL Reviewer Report This manuscript investigates the renoprotective effects of montelukast in a murine model of sepsis-associated acute kidney injury (SA-AKI), with a particular focus on modulation of the NF-κB signaling pathway. The topic is clinically relevant, as SA-AKI remains a major contributor to morbidity and mortality in septic patients, and effective pharmacological interventions are still limited. The study is generally well organized, methodologically sound, and supported by multiple complementary experimental approaches Strengths Clear scientific rationale as the manuscript clearly justifies the investigation of montelukast based on its known anti-inflammatory and antioxidant properties and links these mechanisms logically to SA-AKI pathophysiology. Appropriate experimental model where the use of the cecal ligation and puncture (CLP) model is appropriate and well-recognized as a clinically relevant model of polymicrobial sepsis. Comprehensive outcome assessment in which renal injury was evaluated using functional markers (BUN, creatinine, KIM-1), inflammatory mediators (TNF-α, IL-1β), oxidative stress (F2-isoprostane), apoptosis (caspase-3), and histopathological analysis, strengthening the reliability of the conclusions. Mechanistic insight which included the assessment of NF-κB p65 expression at both mRNA and protein levels (qRT-PCR and IHC) adds mechanistic depth and supports the proposed mode of action of montelukast. Ethical compliance and transparency represented by the ethical approval, animal welfare considerations, and data availability are clearly stated and adhere to accepted standards. Major Concerns and Suggestions Limited translational relevance While the findings are promising, the study relies on a single dose and pretreatment protocol. Since clinical sepsis treatment is typically initiated after disease onset, post-treatment studies would strengthen translational relevance. If data unavailable, I would recommend adding this to the recommendations and future studies. Vehicle control clarification: The vehicle (DMSO) group shows effects similar to the CLP group. A brief discussion on the potential influence of DMSO would be helpful. Minor Comments Please expand the introduction (quite short). Some sections of the Introduction and Discussion contain repetitive statements regarding sepsis-induced inflammation and cytokine release; minor editing could improve conciseness. Figures are generally clear; however, higher-resolution histological images and inclusion of scale bars would enhance interpretability. Also some annotations seem to be hand-made, please replace with arrows. Conclusion Overall, this manuscript presents novel and well-supported evidence that montelukast exerts protective effects against sepsis-induced AKI via suppression of inflammatory, oxidative, and apoptotic pathways, particularly through NF-κB inhibition. Despite some limitations related to translational scope, the study adds valuable preclinical data and merits publication after minor to moderate revisions addressing the points raised above. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Pharmacology, clinical pharmacy, neuroscience I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Fayez Kadhim S. Reviewer Report For: Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.5256/f1000research.179468.r450096 ) The direct URL for this report is: https://f1000research.com/articles/14-660/v1#referee-response-450096 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 07 Jul 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 2 (revision) 17 Apr 26 read read Version 1 07 Jul 25 read Salim Fayez Kadhim , University of AlKafeel, Kufa, Iraq Tony Whitehouse , Queen Elizabeth Hospital Birmingham, University Hospitals Birmingham NHS Foundation Trust, Birmingham, UK Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Whitehouse T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 13 May 2026 | for Version 2 Tony Whitehouse , Queen Elizabeth Hospital Birmingham, University Hospitals Birmingham NHS Foundation Trust, Birmingham, UK 0 Views copyright © 2026 Whitehouse T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Thank you for asking me to review this revised manuscript which has benefitted from an update. I do feel however that there is more to do. ​​​​​​ The abstract needs expanding. SA-AKI is not ubiquitous but is very common and is ASSOCIATED with increased mortality and not yet conclusively shown to contribute. It is unclear in the abstract, how the montelukast was adminsitered. The introduction needs shortening and becoming more directed. The point of this paper is about the use of a leukotriene1 receptor anatgonist and the NFkappaB pathway. Such a broad introduction, which touches on Toll-like receptors, necroptosis and autophagy-related genesis, is a little too much. It is unclear to me why monteleukast was chosen as the intervention and what its place might be in the treatment or avoidance of AKI. There is no need to replicate the phrase "40 albino Swiss mice...etc". Similarly the anaesthetic technique only needs to appear once. Although SEMs look better, SDs make statistical analysis easier to visualise for the reader. usually, the distribution of cytokines is skewed and not normally distributed and log transformation is often needed. There should be some reporting of nmbers in the results section rather than only graphs especially as the graphs all look very similar. Understanding the degree of difference numberically is important. Like the Intro, the discussion should be shortened and directed to the mechanisms elucidated and how they compare with the existing literature. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? No Are the conclusions drawn adequately supported by the results? No Competing Interests No competing interests were disclosed. Reviewer Expertise Sepsis I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Whitehouse T. Peer Review Report For: Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.5256/f1000research.198469.r477189) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-660/v2#referee-response-477189 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Fayez Kadhim S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 05 May 2026 | for Version 2 Salim Fayez Kadhim , College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq 0 Views copyright © 2026 Fayez Kadhim S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Thank you for the opportunity to review the revised article and the authors' responses. I have carefully considered the changes made and the clarifications provided. I am satisfied that the authors have adequately addressed all previous concerns and suggestions. I have no further comments to add at this stage. Salim Kadhim Competing Interests No competing interests were disclosed. Reviewer Expertise Pharmacology, clinical pharmacy, neuroscience I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Fayez Kadhim S. Peer Review Report For: Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.5256/f1000research.198469.r475959) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-660/v2#referee-response-475959 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Fayez Kadhim S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 30 Jan 2026 | for Version 1 Salim Fayez Kadhim , College of Pharmacy, University of AlKafeel, Kufa, Najaf Governorate, Iraq 0 Views copyright © 2026 Fayez Kadhim S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Report This manuscript investigates the renoprotective effects of montelukast in a murine model of sepsis-associated acute kidney injury (SA-AKI), with a particular focus on modulation of the NF-κB signaling pathway. The topic is clinically relevant, as SA-AKI remains a major contributor to morbidity and mortality in septic patients, and effective pharmacological interventions are still limited. The study is generally well organized, methodologically sound, and supported by multiple complementary experimental approaches Strengths Clear scientific rationale as the manuscript clearly justifies the investigation of montelukast based on its known anti-inflammatory and antioxidant properties and links these mechanisms logically to SA-AKI pathophysiology. Appropriate experimental model where the use of the cecal ligation and puncture (CLP) model is appropriate and well-recognized as a clinically relevant model of polymicrobial sepsis. Comprehensive outcome assessment in which renal injury was evaluated using functional markers (BUN, creatinine, KIM-1), inflammatory mediators (TNF-α, IL-1β), oxidative stress (F2-isoprostane), apoptosis (caspase-3), and histopathological analysis, strengthening the reliability of the conclusions. Mechanistic insight which included the assessment of NF-κB p65 expression at both mRNA and protein levels (qRT-PCR and IHC) adds mechanistic depth and supports the proposed mode of action of montelukast. Ethical compliance and transparency represented by the ethical approval, animal welfare considerations, and data availability are clearly stated and adhere to accepted standards. Major Concerns and Suggestions Limited translational relevance While the findings are promising, the study relies on a single dose and pretreatment protocol. Since clinical sepsis treatment is typically initiated after disease onset, post-treatment studies would strengthen translational relevance. If data unavailable, I would recommend adding this to the recommendations and future studies. Vehicle control clarification: The vehicle (DMSO) group shows effects similar to the CLP group. A brief discussion on the potential influence of DMSO would be helpful. Minor Comments Please expand the introduction (quite short). Some sections of the Introduction and Discussion contain repetitive statements regarding sepsis-induced inflammation and cytokine release; minor editing could improve conciseness. Figures are generally clear; however, higher-resolution histological images and inclusion of scale bars would enhance interpretability. Also some annotations seem to be hand-made, please replace with arrows. Conclusion Overall, this manuscript presents novel and well-supported evidence that montelukast exerts protective effects against sepsis-induced AKI via suppression of inflammatory, oxidative, and apoptotic pathways, particularly through NF-κB inhibition. Despite some limitations related to translational scope, the study adds valuable preclinical data and merits publication after minor to moderate revisions addressing the points raised above. Is the work clearly and accurately presented and does it cite the current literature? Partly Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Pharmacology, clinical pharmacy, neuroscience I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Fayez Kadhim S. Peer Review Report For: Renoprotective Effects of Montelukast in Sepsis-Induced AKI: Targeting the NF-κB Pathway [version 1; peer review: 1 approved with reservations] . F1000Research 2025, 14 :660 ( https://doi.org/10.5256/f1000research.179468.r450096) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-660/v1#referee-response-450096 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Renoprotective Effects of Montelukast in...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-660/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/14-660/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/14-660/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Abdulredha AJ and Majeed ML'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-660/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/14-660", templates : { twitter : "Renoprotective Effects of Montelukast in Sepsis-Induced AKI:.... Abdulredha AJ and Majeed ML, published by " + "@F1000Research" + ", https://f1000research.com/articles/14-660/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/163164/179468") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "179468"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "477191": 0, "417926": 0, "477190": 0, "417927": 0, "477189": 7, "417924": 0, "477188": 0, "417925": 0, "477187": 0, "417922": 0, "477186": 0, "417923": 0, "477185": 0, "417920": 0, "477184": 0, "417921": 0, "407566": 0, "407567": 0, "407564": 0, "407565": 0, "407562": 0, "407563": 0, "477193": 0, "417928": 0, "407560": 0, "477192": 0, "407561": 0, "407568": 0, "407569": 0, "402206": 0, "402207": 0, "402204": 0, "402205": 0, "402212": 0, "402213": 0, "402210": 0, "402211": 0, "402208": 0, "402209": 0, "450095": 0, "475959": 3, "404790": 0, "404791": 0, "404788": 0, "404789": 0, "450096": 24, "404796": 0, "404797": 0, "404794": 0, "404795": 0, "404792": 0, "404793": 0, "480967": 0, "480966": 0, "480965": 0, "480964": 0, "480963": 0, "480962": 0, "480961": 0, "480960": 0, "480969": 0, "480968": 0, "398438": 0, "398439": 0, "398436": 0, "398437": 0, "398446": 0, "398447": 0, "398445": 0, "398442": 0, "398440": 0, "398441": 0, "410614": 0, "410615": 0, "410622": 0, "417919": 0, "410623": 0, "410620": 0, "410621": 0, "410618": 0, "410619": 0, "410616": 0, "410617": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "6ada0394-d9c6-4ca0-9322-d79eecf5ed34"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });