Mechanism of miR-20b-5p targeting HIF-1α in regulating trophoblast function in recurrent spontaneous abortion.

OA: gold CC-BY-NC-ND-4.0
AI-generated summary by qwen3.7-flash, 2026-08-24

miR-20b-5p negatively regulates trophoblast function by targeting HIF-1α, contributing to trophoblast dysfunction and recurrent spontaneous abortion pathogenesis.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by qwen3.7-flash, 2026-08-24 · read from full text

This study investigated the regulatory mechanism of miR-20b-5p on trophoblast function in recurrent spontaneous abortion by targeting hypoxia-inducible factor-1α. Using placental tissue from patients with unexplained recurrent spontaneous abortion and HTR-8/SVneo cell lines, researchers demonstrated that miR-20b-5p directly binds to HIF-1α, thereby inhibiting trophoblast migration, invasion, and angiogenesis while promoting apoptosis under hypoxic conditions. The findings indicate that dysregulation of this axis contributes to impaired embryo implantation and early pregnancy loss. Relevance to endometriosis: listed among other reproductive disorders such as preeclampsia and ectopic pregnancy where miRNAs play a role, though the paper's main focus is recurrent spontaneous abortion.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

ObjectiveRecurrent spontaneous abortion (RSA) is a major pregnancy complication with unclear pathogenesis. This study aims to investigate the role of miR-20b-5p and its downstream target HIF-1α in trophoblast function and RSA pathogenesis.MethodsPlacental villous tissues from uRSA patients and healthy pregnant women were collected to assess trophoblast migration, invasion, apoptosis, and placental angiogenesis. The expression levels of miR-20b-5p and HIF-1α were analyzed using qPCR, Western blot, and immunohistochemistry. HTR-8/SVneo cells were transfected with miR-20b-5p mimics, si-miR-20b-5p, and si-HIF-1α to evaluate their effects on trophoblast function. Luciferase reporter assays were performed to confirm the regulatory relationship between miR-20b-5p and HIF-1α.ResultsTrophoblast cells isolated from uRSA patients exhibited impaired trophoblast invasion and increased trophoblast apoptosis, accompanied by increased trophoblast apoptosis. miR-20b-5p was significantly upregulated, whereas HIF-1α expression was downregulated in uRSA placental tissues. Overexpression of miR-20b-5p inhibited trophoblast migration, invasion, and endothelial-like differentiation, while its knockdown enhanced these functions. HIF-1α was identified as a direct target of miR-20b-5p, and its knockdown partially reversed the effects of miR-20b-5p inhibition.ConclusionmiR-20b-5p negatively regulates trophoblast function by targeting HIF-1α, contributing to trophoblast dysfunction and RSA pathogenesis. The miR-20b-5p/HIF-1α axis may serve as a potential therapeutic target for RSA.
Full text 34,608 characters · extracted from pmc-nxml · 4 sections · click to expand

Results

Trophoblast migration, invasion, and placental angiogenesis are crucial for successful embryo implantation and placental development. This study collected placental villous tissue samples from uRSA patients and healthy pregnant women to investigate the differences in trophoblast function between the two groups. Villous explant assays were performed to evaluate the migration and invasion capacity of trophoblast cells under in vitro culture conditions. After 48 h of culture, microscopic observations revealed that villous explants from the control group exhibited significant outward extension, with a large number of cells invading the Matrigel. In contrast, villous explants from the uRSA group displayed significantly reduced outward extension, and the number of cells invading the Matrigel was markedly decreased (Fig.  1 A-D). Fig. 1 Dysregulated trophoblast invasion, apoptosis and placental angiogenesis in uRSA patients. A Representative images of villous explant outgrowth on Matrigel-coated transwells after 48 h. B Quantification of outgrowth cells from explants (Scale bar = 100 μm, n  = 3). C – D Transwell invasion assay of isolated primary trophoblast cells demonstrated the migration cells number of the uRSA and control groups (Scale bar = 100 μm, n  = 3). E – G Flow cytometry analysis using Annexin V-FITC/PI staining revealed the proportion of early apoptotic cells (Annexin V⁺/PI⁻, panel ( F ) and late apoptotic cells (Annexin V⁺/PI⁺, panel ( G ) in the uRSA group compared to the control group ( n  = 3). H – I CD31 immunohistochemical staining was used to assess microvessel density (Scale bar = 100 μm, n  = 3). AOD: Average optical density. Data are presented as mean ± SD. ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001 Dysregulated trophoblast invasion, apoptosis and placental angiogenesis in uRSA patients. A Representative images of villous explant outgrowth on Matrigel-coated transwells after 48 h. B Quantification of outgrowth cells from explants (Scale bar = 100 μm, n  = 3). C – D Transwell invasion assay of isolated primary trophoblast cells demonstrated the migration cells number of the uRSA and control groups (Scale bar = 100 μm, n  = 3). E – G Flow cytometry analysis using Annexin V-FITC/PI staining revealed the proportion of early apoptotic cells (Annexin V⁺/PI⁻, panel ( F ) and late apoptotic cells (Annexin V⁺/PI⁺, panel ( G ) in the uRSA group compared to the control group ( n  = 3). H – I CD31 immunohistochemical staining was used to assess microvessel density (Scale bar = 100 μm, n  = 3). AOD: Average optical density. Data are presented as mean ± SD. ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001 Flow cytometry analysis of trophoblast apoptosis showed that apoptotic cell proportions were significantly higher in the uRSA group than in the control group. Notably, after 72 h of culture, apoptosis rates further increased in the uRSA group, indicating a decline in trophoblast survival capacity ( P  < 0.001, P  < 0.0001, Fig.  1 E–G). To examine the placental vascular characteristics associated with uRSA, immunohistochemical analysis of CD31 was performed to assess microvascular density (MVD). Microscopic examination showed that placental tissues in the control group exhibited clearly defined CD31-positive vascular structures with intact and dense blood vessels, whereas the uRSA group displayed significantly reduced numbers of CD31-positive blood vessels, with some vessels appearing collapsed or incomplete ( P  < 0.01, Fig.  1 H–I). These findings demonstrate that uRSA is associated with significant impairments in trophoblast function (including migration and invasion capacity) and placental vascular development, which may contribute to the pathological mechanisms underlying recurrent spontaneous abortion. To investigate the expression changes of miR-20b-5p and HIF-1α in uRSA, qPCR and Western blot analyses were performed on trophoblast cells from uRSA patients and healthy pregnant women. qPCR results showed that miR-20b-5p expression was significantly upregulated in the uRSA group compared to the control group ( P  < 0.05, Fig.  2 A), while HIF-1α mRNA expression was significantly downregulated ( P  < 0.0001, Fig.  2 A). Western blot analysis further confirmed this trend, demonstrating that HIF-1α protein levels were significantly lower in trophoblast cells from the uRSA group than in the control group ( P  < 0.0001, Fig.  2 B–C). Fig. 2 miR-20b-5p expression is up-regulated and HIF-1α expression is down-regulated in trophoblast cells of uRSA patients. A Quantitative RT-PCR analysis showed the miR-20b-5p and HIF-1A mRNA expression in trophoblast cells isolated from the uRSA group compared to the control group ( n  = 3). B – C Western blot analysis demonstrated HIF-1α protein levels in the uRSA and control group ( n  = 3). D – E Immunohistochemical staining revealed HIF-1α expression in the uRSA and control group (Scale bar = 100 μm, n  = 3). AOD: average optical density. Data are presented as mean ± SD. * p  < 0.05, **** p  < 0.0001 miR-20b-5p expression is up-regulated and HIF-1α expression is down-regulated in trophoblast cells of uRSA patients. A Quantitative RT-PCR analysis showed the miR-20b-5p and HIF-1A mRNA expression in trophoblast cells isolated from the uRSA group compared to the control group ( n  = 3). B – C Western blot analysis demonstrated HIF-1α protein levels in the uRSA and control group ( n  = 3). D – E Immunohistochemical staining revealed HIF-1α expression in the uRSA and control group (Scale bar = 100 μm, n  = 3). AOD: average optical density. Data are presented as mean ± SD. * p  < 0.05, **** p  < 0.0001 IHC analysis further verified these expression changes. Strong HIF-1α staining was observed in the trophoblasts of the control group, whereas trophoblasts in the uRSA group exhibited significantly reduced staining intensity ( P  < 0.05, Fig.  2 D–E). These results demonstrate an inverse expression pattern between miR-20b-5p and HIF-1α in uRSA trophoblasts, warranting further investigation into their potential regulatory relationship and functional significance in recurrent spontaneous abortion. To explore the functional effects of miR-20b-5p on trophoblast cells, miR-20b-5p was overexpressed in HTR-8/SVneo cells, and its effects on migration, invasion, and endothelial-like differentiation were evaluated. qPCR confirmed that transfection with miR-20b-5p mimics significantly increased miR-20b-5p levels in trophoblast cells compared to the control group ( P  < 0.01, Fig.  3 A), indicating successful transfection. Fig. 3 miR-20b-5p Overexpression Inhibits Trophoblast Migration, Invasion, and Endothelial-like differentiation. ( A ) RT-qPCR confirmed increased miR-20b-5p levels in HTR-8/SVneo cells transfected with miR-20b-5p mimics (n = 3). ( B – C ) Transwell invasion assay showed the number of cells penetrating Matrigel in the NC and OE groups (Scale bar = 100μm, n = 3). ( D – E ) Wound healing assay revealed the scratch closure area at 24 h in the NC and OE groups (Scale bar = 100μm, n = 3). ( F – H ) Tube formation assay demonstrated the vessel-like structures and branching points in the NC and OE groups (Scale bar = 100μm, n = 3). NC: negative control; OE: overexpression. Data are presented as mean ± SD. * p 0.05, ** p 0.01, *** p 0.001 miR-20b-5p Overexpression Inhibits Trophoblast Migration, Invasion, and Endothelial-like differentiation. ( A ) RT-qPCR confirmed increased miR-20b-5p levels in HTR-8/SVneo cells transfected with miR-20b-5p mimics (n = 3). ( B – C ) Transwell invasion assay showed the number of cells penetrating Matrigel in the NC and OE groups (Scale bar = 100μm, n = 3). ( D – E ) Wound healing assay revealed the scratch closure area at 24 h in the NC and OE groups (Scale bar = 100μm, n = 3). ( F – H ) Tube formation assay demonstrated the vessel-like structures and branching points in the NC and OE groups (Scale bar = 100μm, n = 3). NC: negative control; OE: overexpression. Data are presented as mean ± SD. * p 0.05, ** p 0.01, *** p 0.001 Transwell invasion assay results showed that, compared to the control group, trophoblast cells overexpressing miR-20b-5p exhibited a significant reduction in the number of cells penetrating the Matrigel membrane ( P  < 0.05, Fig.  3 B–C), suggesting that miR-20b-5p overexpression inhibits trophoblast invasion. Scratch assay results further supported this observation, showing that after 24 h of culture, the wound closure rate was significantly lower in the miR-20b-5p overexpression group than in the control group ( P  < 0.001, Fig.  3 D–E), indicating suppressed migration ability. Additionally, the Matrigel tube formation assay showed that control trophoblast cells formed well-defined capillary-like structures, whereas miR-20b-5p overexpression resulted in a significant reduction in capillary-like structures and branching points ( P  < 0.05, Fig.  3 F–H), suggesting that miR-20b-5p overexpression impairs the ability of trophoblasts to undergo endothelial-like differentiation, a critical process for proper spiral artery remodeling. To identify the target genes of miR-20b-5p, bioinformatics analysis was performed, revealing a highly conserved miR-20b-5p binding site in the 3'UTR region of HIF-1α, suggesting that HIF-1α might be a direct target of miR-20b-5p (Fig.  4 A). Fig. 4 HIF-1α is a direct target gene of miR-20b-5p. A Schematic showing predicted binding site between miR-20b-5p and the 3′ untranslated region (3′UTR) of HIF-1α. B Dual-luciferase reporter assay indicated the miR-20b-5p luciferase activity in the HIF-1α–WT and MUT constructs groups ( n  = 3). C – D Western blot analysis showed the HIF-1α protein expression in NC and OE groups ( n  = 3). NC: negative control; OE: overexpression, ns: no significance. Data are presented as mean ± SD. **** p  < 0.0001 HIF-1α is a direct target gene of miR-20b-5p. A Schematic showing predicted binding site between miR-20b-5p and the 3′ untranslated region (3′UTR) of HIF-1α. B Dual-luciferase reporter assay indicated the miR-20b-5p luciferase activity in the HIF-1α–WT and MUT constructs groups ( n  = 3). C – D Western blot analysis showed the HIF-1α protein expression in NC and OE groups ( n  = 3). NC: negative control; OE: overexpression, ns: no significance. Data are presented as mean ± SD. **** p  < 0.0001 To validate this interaction, WT and MUT HIF-1α 3'UTR dual-luciferase reporter constructs were generated and co-transfected with miR-20b-5p mimics or a negative control into HEK293T cells. Luciferase reporter assay results showed that miR-20b-5p overexpression significantly reduced luciferase activity in cells transfected with the HIF-1α-WT 3'UTR construct ( P   0.05, Fig.  4 B). Furthermore, Western blot analysis demonstrated that HIF-1α protein levels were significantly reduced following miR-20b-5p overexpression ( P  < 0.0001, Fig.  4 C–D). These results confirm that HIF-1α is a direct target of miR-20b-5p and that miR-20b-5p negatively regulates HIF-1α expression. To further investigate the interaction between miR-20b-5p and HIF-1α in trophoblast cells, miR-20b-5p and HIF-1α were knocked down, and their effects on cell migration, invasion, and endothelial-like differentiation were assessed. qPCR analysis revealed that miR-20b-5p knockdown significantly upregulated HIF-1α mRNA expression ( P   0.05, Fig.  5 A). Fig. 5 miR-20b-5p regulates trophoblast function based on HIF-1α. A RT-qPCR showed the miR-20b-5p mRNA expression levels in each group ( n  = 3). B – C Western blot analysis showed the HIF-1α protein expression in each group ( n  = 3) D – E Transwell invasion assay revealed the migration cells number in each group (Scale bar = 100 μm, n  = 3). F – G Wound healing assay showed the migration cell rate of different group at 24 h (Scale bar = 100 μm, n  = 3). H – J Tube formation demonstrated the vessel-like structures and branching points in each group (Scale bar = 100 μm, n  = 3). NC: negative control, ns: no significance. Data are presented as mean ± SD. * p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001 miR-20b-5p regulates trophoblast function based on HIF-1α. A RT-qPCR showed the miR-20b-5p mRNA expression levels in each group ( n  = 3). B – C Western blot analysis showed the HIF-1α protein expression in each group ( n  = 3) D – E Transwell invasion assay revealed the migration cells number in each group (Scale bar = 100 μm, n  = 3). F – G Wound healing assay showed the migration cell rate of different group at 24 h (Scale bar = 100 μm, n  = 3). H – J Tube formation demonstrated the vessel-like structures and branching points in each group (Scale bar = 100 μm, n  = 3). NC: negative control, ns: no significance. Data are presented as mean ± SD. * p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001 Transwell invasion assay results showed that miR-20b-5p knockdown significantly increased the number of trophoblast cells invading through the Matrigel-coated membrane ( P  < 0.0001, Fig.  5 D–E), but this effect was suppressed upon simultaneous HIF-1α knockdown ( P  < 0.001, Fig.  5 D–E). Scratch assay results exhibited a similar trend, with miR-20b-5p knockdown significantly increasing wound closure rates ( P  < 0.0001, Fig.  5 F–G), while simultaneous HIF-1α knockdown partially reversed this effect ( P  < 0.01, Fig.  5 F–G). Matrigel tube formation assay results demonstrated that miR-20b-5p knockdown promoted the formation of capillary-like structures, with an increased number of branch points and enhanced tube integrity compared to the control group ( P  < 0.0001, P  < 0.001, Fig.  5 H–J). However, simultaneous HIF-1α knockdown impaired this effect, leading to a reduction in capillary formation and incomplete branching structures ( P  < 0.001, P  < 0.05, Fig.  5 H–J). Western blot analysis further revealed that miR-20b-5p knockdown significantly upregulated HIF-1α expression ( P  < 0.0001, Fig.  5 B–C), whereas simultaneous HIF-1α knockdown suppressed this effect ( P  < 0.0001, Fig.  5 B–C). These results indicate that miR-20b-5p may regulate trophoblast function, at least in part, through HIF-1α-mediated pathways, suggesting a potential involvement in uRSA pathogenesis.

Materials

Placental villous tissue samples were collected from 5 RSA patients and 5 healthy controls. All participants provided informed consent, and the study was approved by the Ethics Committee of Dongguan Maternal and Child Health Hospital. Patients in the uRSA group met the diagnostic criteria for RSA and were screened to exclude cases caused by chromosomal abnormalities, anatomical defects, endocrine disorders, infections, immune dysfunction, or coagulation abnormalities. The control samples were obtained from women undergoing elective terminations for non-medical reasons, with no history of miscarriage or pregnancy complications. Placental villous tissue samples were obtained through surgical procedures between 6 and 10 weeks of gestation, immediately placed on ice, and subsequently used for cell culture and molecular biology experiments. Fresh placental villous tissues obtained at 6–10 weeks gestation were immediately transferred to sterile PBS containing 1% penicillin–streptomycin. After three washes with cold PBS, the tissues were minced into 1–2 mm 3 fragments and subjected to sequential enzymatic digestion. The initial digestion using 0.125% trypsin–EDTA with 0.1 mg/mL DNase I at 37 °C for 10 min was discarded to remove debris, followed by three rounds of main digestion with 0.25% trypsin–EDTA containing 0.1 mg/mL DNase I at 37 °C for 15 min each. The digestion was terminated by adding DMEM/F12 medium supplemented with 10% FBS. The resulting cell suspensions were sequentially filtered through 100-μm and 40-μm cell strainers, then purified using a discontinuous Percoll density gradient (5%−70%) centrifugation at 800 × g for 20 min. The intermediate layer containing cytotrophoblasts was collected and washed twice with complete medium. The purity of primary trophoblast cultures was assessed by immunofluorescence staining for cytokeratin 7 (CK7, Affinity, AF0195, 1:200), a specific trophoblast marker. More than 90% of cells were CK7-positive, confirming the high purity of the isolated trophoblasts. For explant invasion assays, villous fragments of approximately 1 mm 3 were carefully placed on Transwell inserts (8 μm pores, Corning) pre-coated with growth factor-reduced Matrigel at a concentration of 250 μg/mL (diluted 1:8 in serum-free DMEM/F12 medium). The explants were cultured in DMEM/F12 medium supplemented with 10% FBS, 2 mM L-glutamine, and 1% penicillin–streptomycin at 37 °C in a humidified 5% CO 2 atmosphere. The medium was changed every 48 h. After 72 h of culture, the non-invading explant tissue and any cells remaining on the upper surface of the membrane were gently removed with a cotton swab. The trophoblast cells that had invaded through the Matrigel and membrane to the lower surface were then fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and imaged under a microscope for quantification. The human trophoblast cell line HTR-8/SVneo was used for in vitro experiments and cultured in DMEM/F12 medium supplemented with 10% FBS and 1% penicillin–streptomycin at 37 °C in a 5% CO 2 incubator. Lipofectamine 3000 was used for gene transfection. miR-20b-5p overexpression (miR-20b-5p mimics), miR-20b-5p knockdown (si-miR-20b-5p), HIF-1α knockdown (si-HIF-1α), and their respective negative controls (NC-mimic or NC-siRNA) were transfected into cells. Cells were incubated for 24 h post-transfection before subsequent experiments. The experimental groups included: Control group (NC-mimic or NC-siRNA), miR-20b-5p overexpression group (miR-20b-5p mimics), miR-20b-5p knockdown group (si-miR-20b-5p), HIF-1α knockdown group (si-HIF-1α), and miR-20b-5p+HIF-1α double knockdown group (si-miR-20b-5p+si-HIF-1α). Cell migration and invasion capabilities were evaluated using scratch assays and Transwell invasion assays. For the scratch assay, cells were seeded in 6-well plates, and a scratch was created using a 200 μL pipette tip. After removal of floating cells by washing with PBS, serum-free medium was added to minimize the influence of exogenous growth factors on cell migration. Images were taken at 0 h and 24 h to assess wound closure, and the scratch area was quantified to evaluate cell migration. The Transwell invasion assay was performed using 24-well Transwell inserts with 8 μm pores pre-coated with Matrigel (Corning #356,234; Matrigel: serum-free medium 1:8). Cells were serum-starved for 24 h, then 1 × 10 5 cells were suspended in 200 μL serum-free DMEM/F12 and seeded into the upper chamber. The lower chamber was filled with 600 μL DMEM/F12 containing 10% FBS as a chemoattractant. After 24 h, non-invading cells were removed, and the inserts were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and imaged under a microscope. The number of invaded cells was counted to assess invasion ability. Apoptosis analysis was performed using flow cytometry. Cells were collected after 72 h of culture, stained with an Annexin V-FITC/PI apoptosis detection kit, and analyzed for early and late apoptosis using flow cytometry. Endothelial-like differentiation ability was assessed using Matrigel tube formation assays. Matrigel (50 μL per well) was plated in 96-well plates and allowed to solidify at 37 °C for 30 min. A total of 1 × 10 4 cells were seeded per well and incubated for 6 h. The formation of capillary-like structures was observed and photographed, and the number of branch points and total tube length were quantified using ImageJ. Total RNA was extracted using the TRIzol method, and miRNA reverse transcription kits or cDNA synthesis kits were used for reverse transcription. qPCR was performed using the SYBR Green PCR Master Mix. U6 was used as an internal control for miRNAs, and β-actin was used as an internal control for mRNAs (Table  1 ). Relative expression levels were calculated using the 2⁻ ΔΔCt method. Table 1 Primers list Gene Forward Reverse HIF-1α AGAGGTTGAGGGACGGAGAT GACGTTCAGAACTTATCCTACCAT miR-20b-5p CGCCATCAAAGTGCTCATAGTGC ATCCAGTGCAGGGTCCGAGG β-actin CACTCTTCCAGCCTTCCTTC GTACAGGTCTTTGCGGATGT Primers list Cell lysates were prepared using RIPA buffer containing protease inhibitors. Protein concentrations were measured using the BCA assay, and samples were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk for 1 h. Membranes were incubated overnight at 4 °C with primary antibodies (HIF-1α 1:1000, β-actin 1:5000, Affinity#AF1009, #AF7018), washed with TBST, and incubated with HRP-conjugated secondary antibodies (1:5000, Affinity#S0001) at room temperature for 1 h. Proteins were detected using ECL chemiluminescence, and band intensities were quantified using ImageJ. Villous tissue samples were fixed, dehydrated, paraffin-embedded, and sectioned (4 μm). After deparaffinization, rehydration, and antigen retrieval, endogenous peroxidase activity was blocked using 3% H 2 O 2 , followed by blocking with 5% BSA. Tissue sections were incubated overnight at 4 °C with primary antibodies against HIF-1α (1:200) and CD31 (1:200, Affinity #AF6191), followed by HRP-conjugated secondary antibodies (1:1000, Affinity #S0001). DAB was used for visualization, and sections were counterstained with hematoxylin. The proportion of positive cells and staining intensity were analyzed microscopically. Histochemical staining of CD31 and HIF-1A was quantified using ImageJ software. For CD31, we calculated microvessel density (MVD) by counting CD31-positive structures in five randomly selected high-power fields (400 × magnification) per section. For HIF-1A, we measured the average optical density (AOD) of positively stained areas, normalized to the total area per field, across five randomly selected regions. To verify whether miR-20b-5p directly targets HIF-1α, bioinformatics tools such as TargetScan were used to predict its binding site. Wild-type (WT) and mutated (MUT) HIF-1α 3'UTR luciferase reporter constructs were generated and validated by sequencing. HEK293T cells were seeded in 24-well plates and transfected with Lipofectamine 3000. Cells were co-transfected with pGL3-HIF-1α-WT or pGL3-HIF-1α-MUT constructs and miR-20b-5p mimics or NC-mimic, along with the Renilla luciferase plasmid pRL-TK as an internal control. After 48 h, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega), and Firefly/Renilla luminescence ratios were calculated for standardization. All experiments were performed at least in three times, and data were presented as mean ± standard deviation (mean ± SD). Statistical analyses were conducted using GraphPad Prism 9.0. Comparisons between two groups were performed using the independent t-test, while comparisons among multiple groups were conducted using one-way ANOVA, followed by Bonferroni or Tukey’s HSD post hoc tests. For non-normally distributed data, the Mann–Whitney U test was used for two-group comparisons, and the Kruskal–Wallis H test was used for multiple-group comparisons. A P-value < 0.05 was considered statistically significant.

Discussion

uRSA is a major pregnancy complication affecting women of reproductive age, with a complex etiology involving embryonic genetic factors, immune abnormalities, coagulation disorders, and endocrine dysfunction [ 17 , 18 ]. However, a significant proportion of uRSA cases lack a clear cause, highlighting the need for further investigation into its pathogenesis [ 19 , 20 ]. This study demonstrated that trophoblast migration, invasion, and endothelial-like differentiation were significantly impaired in placental tissues from uRSA patients, accompanied by upregulated miR-20b-5p expression and downregulated HIF-1α expression. Functional experiments further indicated that miR-20b-5p may negatively regulate HIF-1α, thereby affecting trophoblast biological functions and playing a critical role in the development of uRSA. During early pregnancy, trophoblasts migrate and invade the maternal decidua to establish the maternal–fetal circulatory interface, ensuring adequate oxygen and nutrient supply for fetal development [ 21 ]. Extensive research has shown that abnormal trophoblast function can result in defective placentation, thereby increasing the risk of pregnancy loss [ 22 , 23 ]. In this study, villous explant assays revealed that compared to the healthy pregnancy control group, trophoblasts from the uRSA group exhibited significantly reduced migration and invasion, with limited outward expansion of villous explants and fewer cells invading the Matrigel. Additionally, flow cytometry analysis showed that both early and late apoptosis rates were significantly higher in trophoblasts from the uRSA group, suggesting a decline in cell survival capacity. Immunohistochemical analysis further demonstrated distinct vascular abnormalities in placental tissues from the uRSA group, including reduced microvascular density and structural defects in blood vessels. These findings reveal significant impairments in trophoblast function and placental vascular development associated with uRSA cases. The observed deficiencies in trophoblast migration, invasion, and survival capacity, coupled with abnormal vascular patterns, may represent key pathological features contributing to the development of recurrent spontaneous abortion. To further explore the role of miRNAs in uRSA pathogenesis, we analyzed the expression levels of miR-20b-5p and found that it was significantly upregulated in placental villous tissues from the uRSA group, whereas HIF-1α expression was significantly downregulated. As a member of the miR-17–92 family, miR-20b-5p plays a crucial role in various physiological and pathological processes [ 24 ]. Previous studies have shown that miR-20b-5p inhibits tumor cell migration and invasion, acting as a tumor suppressor [ 8 , 11 ]. Given the similarity between trophoblasts and tumor cells in terms of biological behavior during early pregnancy, miR-20b-5p may also play a vital role in placental development. Additionally, HIF-1α is a key factor in maintaining hypoxic adaptation during placental development and plays an essential role in early embryo implantation and placental formation [ 25 ]. The dual-luciferase reporter assay in this study confirmed that miR-20b-5p directly binds to the HIF-1α 3'UTR, thereby inhibiting its translation, suggesting that miR-20b-5p may influence trophoblast function by downregulating HIF-1α. To verify the specific effects of miR-20b-5p on trophoblast biological functions, we overexpressed miR-20b-5p in HTR-8/SVneo cells and observed significant suppression of migration, invasion, and endothelial-like differentiation. Scratch assays showed reduced wound closure in miR-20b-5p-overexpressing cells, while Transwell invasion assays demonstrated decreased numbers of cells penetrating the Matrigel-coated membrane. Additionally, Matrigel tube formation assays indicated that miR-20b-5p overexpression impaired the ability of trophoblast cells to form vascular-like structures. In contrast, miR-20b-5p knockdown significantly enhanced trophoblast migration, invasion, and endothelial-like differentiation, suggesting that miR-20b-5p exerts a negative regulatory effect on trophoblast function. Furthermore, miR-20b-5p overexpression led to a significant reduction in HIF-1α protein levels, whereas miR-20b-5p knockdown upregulated HIF-1α expression, further supporting the hypothesis that miR-20b-5p affects trophoblast function through an HIF-1α-mediated mechanism. HIF-1α is a key adaptive transcription factor in response to hypoxia and plays a crucial role in placental formation [ 26 ]. HIF-1α regulates the expression of multiple downstream genes that promote placental vascularization and trophoblast invasion [ 27 , 28 ]. In this study, HIF-1α knockdown resulted in suppressed trophoblast migration, invasion, and endothelial-like differentiation. Conversely, when HIF-1α was further knocked down in miR-20b-5p-silenced cells, the promotive effects of miR-20b-5p knockdown on trophoblast function were partially reversed. These findings suggest that miR-20b-5p may influence placental development and increase uRSA risk by inhibiting HIF-1α and its downstream signaling pathways. This study demonstrates that miR-20b-5p overexpression is associated with impaired trophoblast function and reduced HIF-1α expression in uRSA. Our findings suggest that the miR-20b-5p/HIF-1α interaction may represent one of the molecular mechanisms contributing to trophoblast dysfunction in uRSA. However, certain limitations must be acknowledged. First, this study was primarily based on in vitro cell experiments. Although miR-20b-5p and HIF-1α expression changes were observed in clinical samples, further validation using animal models is needed to confirm their role in an in vivo physiological context. Second, as a key transcription factor, HIF-1α regulates multiple signaling pathways. This study focused only on its effects on trophoblast migration, invasion, and endothelial-like differentiation, and the full range of signaling pathways affected by miR-20b-5p via HIF-1α remains unclear. Future studies should integrate single-cell RNA sequencing and proteomic analysis to further investigate the role of the miR-20b-5p/HIF-1α axis in placental development and evaluate its potential as a therapeutic target for uRSA. Additionally, it is necessary to explore potential interactions between miR-20b-5p and other miRNAs or transcription factors involved in placental development to gain a more comprehensive understanding of miRNA-mediated placental regulatory networks. In conclusion, this study demonstrated that miR-20b-5p is highly expressed in placental tissues from uRSA patients and negatively regulates trophoblast migration, invasion, and endothelial-like differentiation by suppressing HIF-1α. This dysregulation may contribute to placental dysfunction and an increased risk of miscarriage. These findings provide new insights into the molecular mechanisms underlying uRSA and suggest potential therapeutic strategies targeting miR-20b-5p. Future research should further explore the specific mechanisms of the miR-20b-5p/HIF-1α axis in uRSA and evaluate its clinical potential as a biomarker or therapeutic target.

Introduction

Recurrent spontaneous abortion (RSA), defined as two or more consecutive pregnancy losses occurring before 20 weeks of gestation, is a condition that significantly impacts female fertility. It affects approximately 2–5% of women of reproductive age and has shown an increasing trend in recent years, posing a substantial challenge to global reproductive health [ 1 , 2 ]. RSA not only imposes a heavy psychological and economic burden on patients and their families but may also lead to long-term anxiety and depression in pregnant women and their partners, potentially impacting social stability [ 3 ]. Although the etiology of RSA is complex, involving chromosomal abnormalities, anatomical factors, endocrine disorders, infections, immune dysfunction, and metabolic disorders, 40–60% of cases lack a clear causative factor, classified as unexplained RSA (uRSA) [ 4 ]. Recent studies suggest that insulin resistance, abnormal thyroid autoantibodies, and embryonic genetic abnormalities may contribute to the occurrence of uRSA, but the underlying mechanisms remain unclear [ 5 ]. With evolving reproductive policies and increasing maternal age, more older women are seeking fertility assistance, accompanied by an elevated risk of pregnancy loss. Therefore, understanding the pathogenesis of RSA and identifying new diagnostic and therapeutic targets is of great significance. MicroRNAs (miRNAs) play crucial regulatory roles in various reproductive system disorders, including RSA, preeclampsia, endometriosis, and ectopic pregnancy [ 6 ]. miR-20b-5p, encoded by the MIR20B gene at Xq26.2, is one of the two mature strands of miR-20b. Previous studies have found that miR-20b-5p serves as a diagnostic biomarker for repeated implantation failure [ 7 ]. In cancer research, miR-20b-5p has been shown to inhibit tumor cell migration and invasion, functioning as a tumor suppressor [ 8 ]. Additionally, miR-20b-5p exhibits significant regulatory functions in metabolic diseases. Studies have demonstrated its upregulation in diabetic patients and its close association with various diabetic complications, affecting glucose metabolism and insulin signaling pathways [ 9 ]. Notably, uRSA has been suggested to be closely related to maternal insulin resistance, and miR-20b-5p may play a key role in this process [ 10 ]. Proper proliferation, migration, and invasion of trophoblast cells are essential for successful embryo implantation and placental development, and aberrant expression of miR-20b-5p may disrupt these biological processes, thereby increasing the risk of RSA [ 11 ]. The early placental microenvironment is characterized by low oxygen levels, requiring trophoblast cells to migrate and invade under hypoxic conditions to establish a stable maternal–fetal interface [ 12 ]. Hypoxia-inducible factor-1α (HIF-1α) is a key regulator of cellular responses to hypoxia [ 13 ]. Its activation induces a series of adaptive transcriptional responses, influencing metabolic reprogramming, angiogenesis, and cell survival [ 14 ]. Maintaining HIF-1α homeostasis in trophoblast cells is critical for successful embryo implantation and placental development [ 15 ]. Previous studies in endometrial cancer have shown that hypoxia and HIF-1α signaling can modulate miR-20b-5p expression [ 16 ]. Therefore, investigating the role of miR-20b-5p in regulating HIF-1α and its associated signaling pathways may provide new insights into the relationship between trophoblast dysfunction and RSA, shedding light on the potential mechanisms underlying uRSA. This study aims to explore the functional regulatory effects of miR-20b-5p on HIF-1α in trophoblast cells, elucidate its role in RSA, and contribute to fundamental research and clinical prevention of early pregnancy loss, with the potential to offer novel therapeutic targets for precision medicine in the future.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-09-13T09:25:22.628771+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-NC-ND-4.0