Non-nodulating Rhizobium-like ACO-34A fixes nitrogen in pure cultures and has a nif plasmid

preprint OA: closed
Full text JSON View at publisher
Full text 168,684 characters · extracted from preprint-html · click to expand
Non-nodulating Rhizobium-like ACO-34A fixes nitrogen in pure cultures and has a nif plasmid | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Non-nodulating Rhizobium-like ACO-34A fixes nitrogen in pure cultures and has a nif plasmid Luis Galdino García Pérez, Julio Cesar Martínez Romero, Marco A. Rogel, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8833836/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Rhizobia fix nitrogen in plant nodules. Notably, Rhizobium sp. ACO-34A (which could be reclassified as Paenirhizobium ), recovered from the rhizosphere of Agave americana , is capable of fixing nitrogen in a defined medium in microaerobic conditions and carries nifHDKENBV genes in a 213 kb plasmid. ACO-34A failed to induce nodules in several leguminous hosts and does not have nod genes. ACO-34A NifH mutant did not fix nitrogen in pure cultures and did not promote stem growth in Lotus japonicum plants as the wild strain did. The plasmid harboring the nif genes contains repABC replication genes, genes for homocitrate synthesis, for toxin-antitoxin production and for plant colonization. Comparative phylogenomic analyses revealed that strain ACO-34A is close to Ciceribacter sichuanensis S101, which was isolated from soybean nodules and should be reclassified. According to ANI, AAI and dDDH parameters, ACO-34A may represent a novel species within the Rhizobiacea family. Rhizobium Agave biofertilizers nif genes nitrogen fixation rhizobial plasmids Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Nitrogen fixation is an ancient and fundamental biochemical process (Pi et al., 2024 ). This process not only supports primary productivity in natural ecosystems but also underpins biogeochemical nitrogen cycling, particularly in nitrogen-limited soils (Mus et al., 2019 ; Pi et al., 2024 ). It may have evolved first in archaea and later transferred to bacteria (the archaea-first hypothesis) (Raymond et al., 2004 ; Mus et al., 2019 ; Koirala and Brözel 2021 ). Nitrogen gas (N 2 ) is chemically inert, as the nitrogen are triply bonded to each other (Gastearena et al., 2025 ). Only the Haber Bosh industrial process and a few bacteria and archaea are capable of breaking the triple bond. However, biological nitrogen fixation is energetically costly in terms of ATPs and the nitrogenase enzyme converts the abundant and inert nitrogen from the atmosphere into ammonia. Nitrogen-fixing bacteria have been well studied because they are used to produce biofertilizers that may substitute for chemical fertilizers, contributing to sustainability in agriculture. Nitrogen-fixing bacteria together with other species could be used to constitute bacterial consortia for the production not only of biofertilizers but also of biopesticides and bio stimulants (Solomon et al., 2023 ). This could be the basis for an innovative, integral management strategy for plant inoculation. The identification of diazotrophs has increased markedly, largely driven by the detection of nif genes in bacterial genomes, which has enabled the recognition of previously undescribed organisms with the capacity for nitrogen fixation. Comparative genomics approaches have been particularly useful for identifying conserved core nif operons and, simultaneously, for revealing lineage specific adaptive signatures within the broader nitrogen fixation gene repertoire, including regulatory and accessory components that modulate nif expression and activity beyond the essential structural genes (Tao et al., 2021 ; Zhang et al., 2024 ). Likewise, the integration of multiomics frameworks spanning genomics, proteomics, transcriptomics and metabolomics has improved mechanistic resolution of the complex processes that sustain nitrogen fixation and has clarified key layers of its regulation (Shantharam & Mattoo, 1997 ). The core set of six nif genes ( nifHDKENB ) is used to identify nitrogen-fixing species (Dos Santos et al., 2012 ). However, some species with a five-gene set nifHDKEB or even a four-gene set nifHDKB have been found to be capable of fixing nitrogen (Chen et al., 2021 ; Ivanovsky et al., 2021 ). The mere presence of nif genes does not guarantee active nitrogen fixation, thus the acetylene reduction assays are needed to confirm nitrogen fixation in bacteria. However, few studies include this analysis. Besides the structural nitrogenase proteins, others are required for an efficient process. These include transporters for sugars or metals, gene regulators, hydrogen uptake dehydrogenases, and homocitrate synthase. For instance, metals that constitute the structural nitrogenase molecule need to be transported inside cells. In rhizobia the transport of sugars from root exudates is induced during colonization within the nodule, and dicarboxylate acid transporters are essential for supplying the energy required for nitrogen fixation in nodules (Yurgel and Kahn, 2004 ; Lindström & Mousavi, 2019 ). Similarly, homocitrate, an essential component of the iron-molybdenum cofactor of nitrogenase, is provided by the plant host in symbiotic relationships (Bellés-Sancho et al 2021 ). In contrast, free-living diazotrophs must synthesize their own homocitrate. Finally, uptake hydrogenases enhance efficiency by recycling the H 2 produced as a byproduct during the catalytic activity of the nitrogenase. For example, Bradyrhizobium strains containing uptake hydrogenases are more efficient symbiotic partners (Baginsky et al., 2002 ) and these enzymes are also found in free-living diazotrophs such as Azospirillum and Azoarcus olearius (Solaiyappan & Reinhold-Hurek, 2021). Beijerinck was the first to isolate Rhizobium from nodules in 1888 (Fred et al., 1932 ). Afterwards, the commercialization of biofertilizers began in 1895 with the introduction of 'Nitragin' by Nobbe and Hiltner (Singh et al., 2019 ). Among nitrogen-fixing bacteria, rhizobia are preferred inoculants, as they are considered safe and have been in use for more than a hundred years (Sessitsch et al., 2002 ; Bhattacharjee et al., 2012 ; Glick, 2012 ). The main characteristic of Rhizobium is that the nodulation ( nod ) and nitrogen fixation ( nif ) genes are contained on plasmids that are part of the mobilome and considered accessory genes, as they can be lost without affecting bacterial growth (Wardell et al., 2021 ). These nod genes induce the formation of nodules that contain millions of nitrogen-fixing bacteria. Typically, Rhizobium strains do not fix nitrogen in a free-living state. Instead, this process occurs within nodules, where rhizobia undergo a differentiation process to become bacteroids. Bacteroids are typically larger than their free-living counterparts and are pleomorphic in some cases (Solaiyappan & Reinhold-Hurek, 2021). These differentiated cells have distinct gene expression profiles and upregulate genes for microaerobic life (Uchiumi et al., 2004 ; Solaiyappan & Reinhold-Hurek, 2021). Exceptionally, Azorhizobium caulinodans (Iki et al., 2007 ) and a few Bradyrhizobium strains can fix nitrogen in culture medium (Wongdee et al., 2018 ). In A. caulinodans two copies of nifH genes were found that differed in their promoter regions (Iki et al., 2007 ). Abundant population of non-nodulating bradyrhizobia exist in soil (VanInsberghe et al., 2015 ), and some contain nif genes that may be functional in free-living bacteria (Wongdee et al., 2018 ). When in plant nodules, rhizobia fix nitrogen and provide it to the plant as ammonium (Valentine et al., 2017 ) or alanine in some cases (Schulte et al., 2021 ). In contrast, free-living nitrogen-fixing bacteria retain the fixed nitrogen, using it for their own bacterial growth and seemingly do not excrete it to the external media. Nevertheless, mutants and modified bacteria that excrete ammonium have been obtained for different bacterial species such as Azospirillum, Kosakonia and other plant-associated bacteria, and because they excrete ammonium, they are better stimulators of plant growth (Jiang et al., 2022 ). Previously we reported Rhizobium sp. ACO-34A from the rhizosphere of Agave americana plants in Chiapas in Mexico and obtained its genome using the Pacific Biosciences (PacBio RSII) single-molecule real-time (SMRT) platform (Ruíz-Valdiviezo et al., 2017 ). ACO-34A does not produce nodules in several legumes tested such as Phaseolus vulgaris , Leucaena spp., and no nod genes were found. ACO-34A was found to be related to Rhizobium daejeonense L61 T (De La Torre-Ruiz et al., 2016 ). However, rhizobial taxonomy is being continuously modified (He et al., 2024 ) and some bacteria that were originally classified as Rhizobium were assigned to newly created genera, e,g., Rhizobium daejeonense recovered from a cyanide treatment bioreactor in Korea, was recently reclassified as Ciceribacte r (Rahi et al., 2021 ). Recent studies using phylogenomics, genome-to-genome distance, and digital DNA-DNA hybridization have proven effective in delineating novel genera within Rhizobiaceae (Ma et al., 2023 ; He et al., 2024 ). Considering novel parameters to define genera in rhizobia, R. daejeonense does not group within Ciceribacter and stands as an independent clade that could correspond to a new genus (Kuzmanović et al., 2022 ). Thus, ACO-34A taxonomic status should be further analyzed. ACO-34A was recovered from Agave roots, similarly Rhizobium strains are successful root colonizers (Gutierrez-Zamora & Martínez-Romero, 2001). ACO-34A has a high capability to promote plant growth (De La Torre-Ruiz et al., 2016 ; García-Pérez et al., 2024 ) and is being used as a plant inoculant in agricultural fields. In this context, the aim of this work was to evaluate the ability of strain ACO-34A to fix nitrogen in microaerobic cultures, obtain a NifH mutant, establish the bacterium taxonomic position, describe characteristics of the nif plasmid and present an updated genome sequence of ACO-34A obtained with the Illumina and Nanopore platforms. Materials and methods Bacterial cultures and Acetylene Reduction Assay. Bacteria were grown in PY medium (Toledo et al., 2003 ) and isolated pure colonies were obtained on plates in the same medium. For acetylene reduction assay (ARA), cultures were grown for 24 h in nitrogen-free, semisolid MM medium (Fåhraeus, 1957 ). Acetylene was injected into vials containing the ACO-34A cultures, followed by incubation for 24–48 h at 30 ºC. The conversion of acetylene to ethylene was quantified by gas chromatography following standard procedures. Ethylene and acetylene were measured using a Varian gas chromatograph as described by Martínez et al., ( 1985 ). Genome assembly and ANI, AAI and dDDH Analyses ACO-34A genome was re-sequenced using short reads (Illumina novas 6000 system) and long reads (Oxford Nanopore Technologies MinION system). Low-quality short-reads (Q < 30) were removed during trim quality validation using trim-galore v0.6.10 and fastqc v0.12.1 (Krueger, 2015 ). Hybrid genome assembly was then performed using Unicycler v0.5.1 (Wick et al., 2017 ), and genome coverage was determined using Bowtie2 v2.5.4 (Langmead & Salzberg). CheckM v1.2.2 was used to verify the quality of the genome assembly (Parks et al., 2015 ). A circular map of the nif plasmid was visualized using the Proksee web server ( https://proksee.ca/ ), and the annotation was performed using prokka v1.14.6 (Seemann, 2014 ), with default parameters, to identify coding sequences (CDS), tRNA and rRNA genes. Additional CDS prediction and functional annotation were performed with the RAST-tk server (Rapid Annotation Using Subsystem Technology) (Brettin et al., 2015 ) to ensure comprehensive identification of genetic elements. Circular plasmid map editing was performed with Inkscape software v1.4. The newly recovered sequence of a 213 kb plasmid from Rhizobium sp. ACO-34A was compared to the one in Genbank from the national center for biotechnology information (NCBI) database (accession number: CP021375.1). Phylogenomic and phylogenetic analysis of ACO-34A Phylogenomic comparisons were performed with genomes deposited in the NCBI-RefSeq database for the genera Ciceribacter and Paenirhizobium , deposited before December 2025. GET_HOMOLOGUES v14112024 was used to calculate the core genome and obtain shared single-copy genes (Contreras-Moreira & Vinuesa, 2013 ). Subsequently, GET_PHYLOMARKERS was run with the core-genome matrix to identify high-quality marker genes. The species tree was obtained using ASTRAL-IV, which accounts for genetic tree discordance and estimates branch lengths in substitutions per site, using the IQ-TREE implementation (Vinuesa et al., 2018 ). The phylogenies were visualized using FigTree v1.4.4. Average Nucleotide Identity (ANI) was calculated based on MUMmer alignments (ANIm) using pyani module v0.2.12 (Pritchard et al., 2016 ) and Average Amino Acid Identity (AAI) was computed with the CompareM toolkit v0.1.2, which integrates Prodigal v2.6.2 and DIAMOND v0.9.0 ( https://github.com/dparks1134/CompareM/ ). On the other hand, in silico DNA–DNA hybridization (dDDH) analyses were performed with the closest strains using the TYGS online server ( https://tygs.dsmz.de/ ). For the phylogenetic analysis, homologous sequences were retrieved from the NCBI database for each gene family (e.g., nitrogen fixation, replication, transport, secretion systems, and stress response) and multiple sequence alignments were performed with MUSCLE v3.8.31 (Edgar, 2004 ) with default parameters. Poorly aligned regions were removed manually. Maximum Likelihood phylogenetic trees were constructed with IQ-TREE v2.1.2 using modelfinder for optimal model selection, with 1000 bootstrap replicates. Construction of NifH mutants The ACO-34A NifH single recombinant mutants were obtained through single-crossover homologous recombination via vector insertion mutagenesis (VIM) methodology. To achieve this, a ~ 390-bp intragenic region of the nifH gene was amplified by PCR using primers Up-nifHSR (5’ TGTGAATTCGGCTGTGCCGGTCGC 3’) and Lw-nifHSR (5’ TTGAATTCGTCGCGCGGCACGAAG 3’). This PCR product was cloned into the pJET1.2/blunt vector (Thermo Scientific ™ ) and subsequently sequenced. To construct a suicide plasmid for VIM, the nifH intragenic region was purified using the EcoRI sites in the primers and ligated to the EcoRI-restricted pK18mob plasmid (Schäfer et al., 1994 ). E. coli DH5α/pK18mob-nifHSR transformants were verified and used as donors in three independent triparental matings with the Rhizobium sp . ACO-34A strain, employing the DH5α/ pRK2013 plasmid as a helper. Transconjugants were selected on PY medium containing kanamycin and fosfomycin. To confirm that the expected single-crossover had occurred, PCR amplification of selected Km R -Fm R transconjugants was performed using a combination of primers corresponding to the insert and the universal primers M13 forward and reverse. An additional PCR was conducted using the primers nifHAcoFw (5’ TTTGAATTCCTCGAACTCGAGGATGTCCTG 3’) and nifHAcoRev (5’ AGAGAATTC TCCAGCTCTTCCATGGTGAT 3’), whose specific sequence is outside the region utilized in the construction of pKmob-nifHSR; thus, the PCR product is only obtained in the wild-type strain. Lotus japonicum inoculation assays Lotus japonicum Gifu seeds were scarified with sandpaper, disinfected in 6% chlorine for 10 minutes, and rinsed thoroughly 3–5 times with distilled water. Seeds were then incubated at 21°C in a growth chamber under a photoperiod of 16:8 for germination (Montiel et al. 2024; García-Soto et al., 2024 ). Seven-day-old seedlings were transferred to square Petri dishes containing Noble Agar supplemented with 1/4 B&D medium (Broughton and Dilworth 1971 ) devoid of nitrogen. Seven-day-old seedlings were inoculated with Rhizobium sp. ACO34-A or its NifH mutant. For this, each Petri dish was supplemented with 1 mL of an aqueous solution containing the corresponding bacterium strain at OD 0.05, or with 1 mL of distilled water for control plants. Results Nitrogen fixation of Paenirhizobium sp. ACO-34A Nitrogen fixation assays using multiple colonies in nitrogen-free medium consistently indicated acetylene reduction, providing solid evidence of nitrogenase activity in the clonal strains derived from ACO-34A. The strains recovered from the pellicles formed beneath the surface of the nitrogen-free medium exhibited a phenotypic profile identical to the original clone. These strains were subcultured in PY medium again and re-cultured in nitrogen-free medium to confirm the positive ARA assay. Additionally, the genotypic and antibiotic resistance profiles were evaluated, showing consistency with the original strain. This indicates that the ACO-34A strain has the capacity to carry out biological nitrogen fixation in vitro. To substantiate a determinant relationship between nif gene function and acetylene reduction, independent NifH mutants were generated and functionally characterized. All NifH mutants did not produce ethylene in the acetylene reduction assay under the experimental conditions evaluated, whereas the wild-type strain did. Genetic and molecular fingerprinting controls, including ERIC-PCR profiles, corroborated that the mutants were derived from ACO-34A (Supplementary Fig. 2). Lotus japonicus is a model plant to study microbial symbiosis with the advantage of being small and fast-growing. In Lotus , ACO34-A promoted stem growth. Significant differences in stem height were observed in plants inoculated with the NifH mutant (Fig. 1 ). Plants inoculated with the NifH mutant allowed to determine the promoting effects due to nitrogen fixation and plants with the NifH mutants had slighty longer stems than control non-inoculated plants. This suggests that nitrogen fixation explains in part the growth promotion of ACO34-A. Genome of Paenirhizobium sp. ACO-34A ACO34-A deposited genome (GCF_002600635.1) was recently removed from the NCBI RefSeq database because it was argued that there was a potential contamination with Ciceribacter sequences. To address this issue about contamination, we re-sequenced its genome from a pure culture derived from an isolated colony after five subcultures, using the Illumina and Nanopore sequencing platforms. The comparison of the newly obtained genome assembly to the previously reported genome showed that they were identical in sequence and almost identical in replicon size (Table 1 ). The data obtained for the reported replicons assembled with PacBio (Ruíz-Valdiviezo et al., 2017 ) were compared with the hybrid genome assembly using Illumina-Nanopore reads. As shown in Table 1 , genomic analyses showed agreement between the two sequencing results. The lengths of the chromosomes (4.75 Mb) and plasmid replicons (pRACO-34Aa-d) showed insignificant differences (variation < 100 bp). From the genome analysis we found that Rhizobium ACO-34A has two plasmids and two chromids (one containing a copy of ribosomal genes). This was corroborated using the Eckhardt technique (Supplementary Fig. 1). The nif genes were found on the 213 kb plasmid that we define here as the nif plasmid. Like other rhizobia, ACO-34A possesses the genes that encode the dicarboxylate transporters. Notably, these are located in the ACO-34A chromosome. These observations confirm the structural integrity of the Paenirhizobium sp. ACO-34A genome. In addition, a completeness of 99.01% was estimated and it could be observed a contamination of 1.18%. These results, complemented by high sequencing depth (> 332X), support the quality of the assembly for further phylogenomic and taxonomic analyses. Table 1 Comparative genome assembly metrics of strain ACO-34A derived from PacBio, and Illumina-Nanopore sequencing platforms. PacBio (Ruíz-Valdiviezo et al., 2017 ) Illumina–Nanopore Chromosome 4,754,916 4,754,988 pRACO34a 213,273 213,280 pRACO34b 305,590 305,619 pRACO34c 494,144 494,163 pRACO34d 516,813 516,834 Coverage 347 X 332 X Phylogenomic and genomic relatedness indices ACO-34A may be assigned to Paenirhizobium (that means almost Rhizobium , Ma et al., 2023 ) not yet officially accepted. Rhizobium daejeonense (Ma et al., 2023 ) is closely related to ACO-34A (Fig. 2 ). R. daejeonense was previously reclassified as Ciceribacter (Rahi et al., 2021 ) and now it is recognized as a distinct genus, Paenirhizobium . Ciceribacter sichuanensis , isolated from soybean nodules in China (Zhang et al., 2024 ), which was found to be close to ACO-34A likely also belongs to Paenirhizobium . We did not find nod genes in Ciceribacter sichuanensis , which is also the case for Ciceribacter daejeonense . All of these related strains with ACO-34A would appear to belong to a non-nodulating rhizobial genus. The ANI, AAI, and dDDH values calculated from ACO34-A genome in comparison with the closest reference genomes were consistently below the accepted species-level thresholds. In Fig. 2 A, ACO-34A forms a well-supported lineage, clearly separated from the representative strains of Ciceribacter sichuanensis S101. On the other hand, the topology of the species tree with respect to Paenirhizobium shows that the representative strain Paenirhizobium daejeonense KACC 13094 is the closest clade (Fig. 2 B). According to this topology, ACO-34A occupies a single branch within this genus. The representative strain closest to ACO-34A based on ANI was Ciceribacter sichuanensis S101 (92.17%), whereas Paenirhizobium daejeonense KACC_13094 showed an ANI of 92.06%. Similarly, the average AAI between ACO-34A and C. sichuanensis was 94.92%, and 94.58% with P. daejeonense KACC 13094. In addition to ANI analyses, we performed cAAI, which is now considered to be useful for delineating genera in rhizobia (Li et al., 2024 ; Fig. 2 C). dDDH values against these strains were in both cases < 46%. Key functional traits encoded in the nif plasmid The complete set of nitrogen fixation genes in ACO-34A is located on a 213 kb plasmid (Fig. 3 ) in the newly sequenced genomes that we report here and in the previously reported genome (Ruíz-Valdiviezo et al., 2017 ). As evidenced by genome assembly analyses, this feature is consistently detected in both the newly generated hybrid assembly and the previously reported PacBio-based genome (Fig. 3 ). In ACO-34A the nif plasmid contains all genes necessary for nitrogen fixation, namely nifHDKENB and in addition, it also has nifA , nifB and a nifV gene encoding homocitrate synthase that produces homocitrate (Fig. 3 ). This nif cluster is located in a plasmid region with high homology to the nif cluster annotated in the C. sichuanensis S101 T genome and is flanked by several transposase genes. This plasmid harbors the structural and accessory nif genes required for nitrogenase activity, including nifHDKENB , and additionally contains key regulatory regions such as nifA and nifB . Phylogenetic estimation of the nifH gene, together with additional genes encoded on the nif plasmid, revealed that the nifH sequence of strain ACO-34A clusters closely with that of Ciceribacter sichuanensis (Fig. 4 ). Likewise, it is positioned within a broader phylogeny-based taxonomic assemblage dominated by free-living, non-nodulating nitrogen fixers, including Rhizobium cremeum (Yang et al., 2022 ) as well as species of the genus Martelella (Li et al., 2021 ) and Hartmannibacter diazotrophicus (Suarez et al., 2015 ). The strong nodal support suggests that the phylogenetic affinity of ACO-34A nifH is robust to resampling and reflects a stable signal in the alignment. Notably, nodulation genes were not detected in the closest relatives examined; supporting the inference that ACO-34A belongs to a non-nodulating rhizobial lineage. The nif cluster is embedded within a broader mobile genomic context (Fig. 5 ). In close proximity to the nif genes, the hesB gene was identified in the immediate vicinity of the nitrogen fixation locus (Fig. 3 ). This gene has been linked in multiple systems to nitrogen-related physiology (Böhme 1998 ) and is annotated as an iron-binding protein, which is biologically plausible given the high metalloprotein requirements during nitrogenase maturation. The plasmid also encodes a repABC replication and maintenance system typical of large rhizobial replicons. (Cevallos et al., 2008 ; Wetzel et al., 2025). Phylogenetic patterns of repABC suggest affinity with Agrobacterium and Ensifer lineages, consistent with a rhizobial origin. In addition, conjugal transfer modules, including tra and trb genes and a type IV secretion related apparatus, indicate transfer competence and provide a mechanistic basis for dispersal among rhizosphere bacteria. Most plasmids in Rhizobium have the repABC operon for replication (Mazur et al., 2011 ). A plasmid replication/maintenance system (the repABC operon) was identified and the analysis of the ACO-34A repABC gene sequences from the 213 kb plasmid showed that they resemble those from Agrobacterium and Ensifer (not shown) indicating a rhizobial origin of the replicon. Multiple transport systems were also encoded in the plasmid, including glutathione transporters (Wang et al., 2024 ), bicarbonate and riboflavin transport systems. The dipeptide permease DppA , and the membrane trafficking protein EntH were encoded in the plasmid sequence. Dicarboxylate transporters, which are essential for nitrogen fixation in nodules, and sugar transporters involved in the utilization of root exudates were also found. Genes conferring stress tolerance were also identified including those that encode for osmoregulatory proteins (OmpR, Rodriguez et al., 2020) and glycogen metabolism genes ( glgA and glgB ). Multiple proteins involved in the conjugal transfer (TraA, TraB and TraC) were also identified, Furthermore, these genes show high similarity to those identified in the plasmid pAt1D132b of Agrobacterium fabrum 1D132 (Fig. 5 ). The nif plasmid contains many transposases, hypothetical genes as well as a secretion system corresponding to the Type I (Fig. 6 A-b) transporters and Type IV system with genes similar to virB that does not match with the corresponding genes from rhizobia (Fig. 7 ). On the one hand, the annotation of multiple transposases (IS3, IS6 and IS481 families of transposases) that delimit regions with genes showing high percentages of similarity with different strains of the Rhizobiaceae family (depending on the region to be considered (Fig. 5 ) indicates a chimeric origin of the plasmid. On the nif plasmid there were genes that resemble emrA and emrB which encode efflux pumps that confer resistance to antibiotics (Dalbanjan et al., 2024 ; Zack et al., 2024 ). The emrA and emrB genes found in ACO-34A genome were not found in the related C. sichuanensis or in Rhizobium cremeum genomes. A gene encoding BvgA , which in rhizobia is part of a toxin-antitoxin system that could prevent plasmid loss, was found on the nif plasmid. In five serial subcultures of ACO-34A, the kanamycin resistance (located in the nifH gene on the nif plasmid) was conserved in bacteria (not shown) suggesting that curing the nif plasmid would be difficult with a toxin-antitoxin system present on the plasmid. The ompR gene from ACO-34A nif plasmid is phylogenetically related to Agrobacterium ompR gene (Fig. 8 ). A hypothetical gene from the ACO-34A nif plasmid resembles a gene encoding a protein with an Ig domain (Chaterjee ) from Paraburkhoderia fungorum . For biofilm formation, glgA and glgB gene products were identified. Notably, the nif plasmid contains several genes of unknown function or encoding hypothetical proteins. It is worth mentioning that no uptake-hydrogenase (hup ) genes (Sotelo et al., 2021 ) were detected in the ACO34-A genome. Discussion In Rhizobium nitrogen fixation normally occurs in nodules, so ACO34-A is outstanding for being capable of fixing nitrogen in free living conditions and this characteristic is certainly encoded in nif genes as NifH mutants were uncapable of fixing nitrogen. Notably the NifH mutant did not promote stem growth in Lotus japonicum plants as the wild type did. Rhizobium sp. ACO-34A isolated from the roots of Agave americana plants in Chiapas, Mexico showed plant growth promotion capabilities (De La Torre-Ruiz et al., 2016 ). Agave plants may select and promote growth of free-living diazotrophs due to its high photosynthetic capacity, which provides an abundant carbon supply to sustain bacterial populations, together with reduced nitrogen availability, thereby avoiding the inhibition of nitrogen fixation (Beltran-García et al., 2014). Similar processes may occur in other cacti or in C4 plants such as maize (Roesch et al., 2008 ; Montanez et al., 2009; Van Deynze et al., 2018 ). Consequently, agaves may represent a potential niche for the isolation of nitrogen fixing bacteria, such as ACO-34A, which is currently being used successfully in agricultural fields (Manzano-Gómez et al., 2025 ). Furthermore, ACO-34A may be applied in mixed inoculants with the aim of establishing an integrated management strategy for plant biofertilizers. ACO-34A consistently clustered with strains within the not officially recognized genus Paenirhizobium , including the lineage represented by Paenirhizobium daejeonense. Closely related genomes historically placed in Ciceribacter have been reclassified as new taxa, consistent with ongoing taxonomic revisions in this clade. Taken together our results support that ACO-34A represents a previously undescribed species within Paenirhizobium . All genomic relatedness indices were significantly below the accepted species boundaries (95–96% for ANI-AAI and 70% for dDDH). In regard to the genome, clearly there was no contaminating DNA it the deposited genome of ACO34-A and the resemblance to Ciceribacter reflects the genetic similarity of Ciceribacter and Paenirhizobium and is therefore not actual evidence for contamination. Nitrogen fixation in ACO-34A and perhaps in C. sichuanensis could be due to the origin of their nif genes, apparently from free-living nitrogen-fixing bacteria. The putatively transferred nif genes could have also carried as well the regulatory regions and mechanisms to be expressed under free-living conditions and not confined to nodules. Recent comparative analyses have shown that nifH phylogenies often reflect ecological rather than strictly taxonomic relationships, particularly in free-living diazotrophs inhabiting root-associated environments (Tao et al., 2021 ). In bradyrhizobia, few nif genes were found alone in small genomic islands in the chromosome, and they were not phylogenetically related to the nif genes linked to the nod genes from plant nodulating symbionts. Thus, they likely have an evolutionary origin different from the nif genes linked to nod genes (Tao et al., 2021 ). This is similar to what we discovered for the independent Paenirhizobium nif genes in absence of nod genes. It has been reported that the modular architecture of nif -containing islands is often associated with the presence of transferable integrative elements and transcriptional promoters (Tao et al., 2021 ; Ma et al., 2023 ). Homocitrate is a component of the nitrogenase FeMo-cofactor and is considered to be required for free-living nitrogen fixation (Nouwen et al., 2017 ; Bellés-Sancho et al., 2021 ; Warmack et al., 2023 ). Plants provide homocitrate but free-living bacteria must synthesize it to fix nitrogen. nifV is absent from a wide range of rhizobial genomes that fix nitrogen exclusively within nodules (Hakoyama et al., 2009 ). The presence of nifV gene in ACO34-A is congruent with its capacity to fix nitrogen under free-living conditions. Conclusion Overall, our results support the conclusion that ACO-34A is a free-living diazotroph.Nevertheless, additional experimental assays are required to determine whether, during nitrogen fixation, strain ACO-34A excretes ammonium to the plant. This work confirms the ACO34-A genome sequence using Illumina and Nanopore sequencing. The hybrid assembly, generated from a meticulously purified lineage was identical to the previously obtained PacBio genome (Ruíz-Valdiviezo et al., 2017 ). We surmise that ACO-34A represents a novel species within Paenirhizobium . In general terms, strain ACO-34A can be placed within a cluster dominated by non-nodulating diazotrophs. From an evolutionary perspective, strain ACO-34A shows a very close relationship with C. sichuanensis which should be reclassified as Paenirhizobium sichuanensis . Both taxa share the presence of nif genes which may be ancestral in this genus besides the supposition of their original acquisition by lateral transfer. Notably, C. sichuanensis was recovered from soybean yet lacks nod genes. In the case of ACO-34A, diazotrophic activity was confirmed using the acetylene reduction assay (ARA). In contrast, for C. sichuanensis , data on acetylene reduction have not yet been reported, nor has the replicon-level location of the nif gene cluster. Agave plants may select for associated nitrogen-fixing bacteria because they have a large photosynthetic capability with abundant carbon supplies to feed bacteria, and limited nitrogen so as not to inhibit nitrogen fixation (Beltran-García et al., 2014). This may also occur in other cacti or in C4 plants as maize (Roesch et al., 2008 ; Montanez et al., 2009; Van Deynze et al., 2018 ). Seemingly, agaves may be an excellent niche from which to isolate nitrogen-fixing bacteria to be used as biofertilizers, such as ACO-34A, that is being successfully used as an inoculant in agricultural fields (Manzano-Gómez et al., 2025 ). ACO-34A may be used in mixed inoculants with the idea of integrated management of plant inoculants. Declarations Ethical Approval not applicable Funding This study was funded by PAPIIT-UNAM IN206124. Author Contribution E.M-R wrote the main manuscript text, managed resources and directed the experimental work.L.G.G.P., M.A.R., and M.R-P performed the experiments and implemented the methodologyJ.M.R. and G.C.-F. performed all phylogenetic analyses.L.G. designed primers and designed mutantJ.M.G. and R.P. performed experimentsM.G.G.R. performed genomic analyses.C.I.R.M. and R.R.R. proposed research activities.All authors reviewed the manuscript. Data Availability Genome will be available upon request, since NCBI is no longer accepting genome deposits. References Baginsky C, Brito B, Imperial J, Palacios JM, Ruiz-Argüeso T (2002) Diversity and evolution of hydrogenase systems in rhizobia. Appl Environ Microbiol 68(10):4915–4924. https://doi.org/10.1128/AEM.68.10.4915-4924.2002 Barahona E, Collantes-García JA, Rosa-Núñez E, Xiong J, Jiang X, Jiménez-Vicente E, Echávarri-Erasun C, Guo Y, Rubio LM, González-Guerrero M (2024) Azotobacter vinelandii scaffold protein NifU transfers iron to NifQ as part of the iron–molybdenum cofactor biosynthesis pathway for nitrogenase. J Biol Chem. Advance online publication https://doi.org/10.1016/j.jbc.2024.107900 Bellés-Sancho P, Lardi M, Liu Y, Hug S, Pinto-Carbó MA, Zamboni N, Pessi G (2021) Paraburkholderia phymatum homocitrate synthase NifV plays a key role for nitrogenase activity during symbiosis with papilionoids and in free-living growth conditions. Cells 10(4):952. https://doi.org/10.3390/cells10040952 Beltran-Garcia MJ, White JF Jr., Prado FM, Prieto KR, Yamaguchi LF, Torres MS, Kato MJ, Medeiros MHG, Di Mascio P (2014) Nitrogen acquisition in Agave tequilana from degradation of endophytic bacteria. Sci Rep 4:6938. https://doi.org/10.1038/srep06938 Bhattacharjee RB, Jourand P, Chaintreuil C, Dreyfus B, Singh A, Mukhopadhyay SN (2012) Indole acetic acid and ACC deaminase-producing Rhizobium leguminosarum bv. trifolii SN10 promote rice growth, and in the process undergo colonization and chemotaxis. Biol Fertil Soils 48:173–182. https://doi.org/10.1007/s00374-011-0614-9 Böhme H (1998) Regulation of nitrogen fixation in heterocyst-forming cyanobacteria. Trends Plant Sci 3(9):346–351. https://doi.org/10.1016/S1360-1385(98)01290-4 Brettin T, Davis J, Disz T et al (2015) RASTtk : A modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep 5, 8365. https://doi.org/10.1038/srep08365 Broughton WJ, Dilworth MJ (1971) Control of leghaemoglobin synthesis in snake beans. Biochem J 125(4):1075–1080. https://doi.org/10.1042/bj1251075 Cevallos MA, Cervantes-Rivera R, Gutiérrez-Ríos RM (2008) The repABC plasmid family. Plasmid 60(1):19–37. https://doi.org/10.1016/j.plasmid.2008.03.001 Chatterjee S, Basak AJ, Nair AV, Duraivelan K, Samanta D (2021) Immunoglobulin-fold containing bacterial adhesins: molecular and structural perspectives in host tissue colonization and infection. FEMS Microbiol Lett 368(2):fnaa220. http://doi.org/10.1093/femsle/fnaa220 Chen Y, Nishihara A, Haruta S (2021) Nitrogen-fixing ability and nitrogen fixation-related genes of thermophilic fermentative bacteria in the genus Caldicellulosiruptor . Microbes Environ 36(2):ME21018. https://doi.org/10.1264/jsme2.ME21018 Contreras-Moreira B, Vinuesa P (2013) GET_HOMOLOGUES, a versatile software package for scalable and robust microbial pangenome analysis. Appl Environ Microbiol 79(24):7696–7701. https://doi.org/10.1128/AEM.02411-13 Dalbanjan NP, Kadapure AJ, Kumar PKS (2024) Comprehensive review on latent role of stress proteins in antibiotic resistance. Microbe 4:100151. https://doi.org/10.1016/j.microb.2024.100151 De La Torre-Ruiz N, Ruiz-Valdiviezo VM, Rincón-Molina CI, Rodríguez-Mendiola M, Arias-Castro C, Gutiérrez-Miceli FA, Rincón-Rosales R (2016) Effect of plant growth-promoting bacteria on the growth and fructan production of Agave americana L. Brazilian J Microbiol 47:587–596. https://doi.org/10.1016/j.bjm.2016.04.010 Dos Santos PC, Fang Z, Mason SW, Setubal JC, Dixon R (2012) Distribution of nitrogen fixation and nitrogenase-like sequences amongst microbial genomes. BMC Genomics 13(1):162. https://doi.org/10.1186/1471-2164-13-162 Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792–1797. https://doi.org/10.1093/nar/gkh340 Fåhraeus G (1957) The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. J Gen Microbiol 16(2):374–381. https://doi.org/10.1099/00221287-16-2-374 Fred EB, Baldwin IL, McCoy E (1932) Root nodule bacteria and leguminous plants. University of Wisconsin, Wisconsin, IA García-Pérez LG, Rincón-Molina CI, Martínez-Romero E, Rogel MA, Tapia-Torres Y, Manzano-Gómez LA, Maldonado-Gómez JC, Rincón-Molina FA, Rincón-Rosales R (2024) Genomic Insights and Plant Growth-Promoting Potential of Rhizobial Strains fromAgave americana. Horticulturae 10:1370. https://doi.org/10.3390/horticulturae10121370 García-Soto I, Andersen SU, Monroy-Morales E, Robledo-Gamboa M, Guadarrama J, Aviles-Baltazar NY, Serrano M, Stougaard J, Montiel J (2024) A collection of novel Lotus japonicus LORE1 mutants perturbed in the nodulation program induced by the Agrobacterium pusense strain IRBG74. Front Plant Sci 5:14:1326766. 10.3389/fpls.2023.1326766 PMID: 38250449; PMCID: PMC10796720 Gastearena X, Matxain JM, Ruipérez F (2025) Exploring N2 activation using novel Lewis acid/base pairs: Computational insight into frustrated Lewis pair reactivity. Dalton Trans 54:4338–4352. https://doi.org/10.1039/D4DT03425B Glick BR (2012) Plant growth-promoting bacteria: mechanism and application. Scientifica 2012, Article ID 963401. http://doi.org/10.6064/2012/963401 Gutiérrez-Zamora ML, Martínez-Romero E (2001) Natural endophytic association between Rhizobium etli and maize ( Zea mays L). J Biotechnol 91(2–3):117–126. https://doi.org/10.1016/s0168-1656(01)00332-7 Hakoyama T, Niimi K, Watanabe H, Tabata R, Matsubara J, Sato S, Nakamura Y, Tabata S, Li J, Matsumoto T, Tatsumi K, Nomura M, Tajima S, Ishizaka M, Yano K, Imaizumi-Anraku H, Kawaguchi M, Kouchi H, Suganuma N (2009) Host plant genome overcomes the lack of a bacterial gene for symbiotic nitrogen fixation. Nature 462(7272):514–517. https://doi.org/10.1038/nature08594 He M, Chen G, Li KJ, Tang XX, Liu XX, Ren CB, Zheng DQ (2024) Characterization and genomic analysis of Affinirhizobium gouqiense sp. nov. isolated from seawater of Gouqi Island located in the East China Sea and reclassification of Rhizobium lemnae to the genus Affinirhizobium as Affinirhizobium lemnae comb. nov. Curr Microbiol 81(9):283. https://doi.org/10.1007/s00284-024-03807-5 Iki T, Aono T, Oyaizu H (2007) Evidence for functional differentiation of duplicated nifH genes in Azorhizobium caulinodans . FEMS Microbiol Lett 274(2):173–179. https://doi.org/10.1111/j.1574-6968.2007.00823.x Ivanovsky R, Lebedeva N, Keppen O, Tourova T (2021) Nitrogen metabolism of an anoxygenic filamentous phototrophic bacterium Oscillochloris trichoides strain DG-6. Microbiology 90(4):428–434. https://doi.org/10.1134/S0026261721040068 Jiang S, Li J, Wang Q, Yin C, Zhan Y, Yan Y, Lin M, Ke X (2022) Maize growth promotion by inoculation with an engineered ammonium-excreting strain of nitrogen-fixing Pseudomonas stutzeri . Microorganisms 10, 1986. https://doi.org/10.3390/microorganisms10101986 Koirala A, Brözel VS (2021) Phylogeny of nitrogenase structural and assembly components reveals new insights into the origin and distribution of nitrogen fixation across bacteria and archaea. Microorganisms 9(8):1662. https://doi.org/10.3390/microorganisms9081662 Krueger F (2015) Trim Galore: A wrapper around Cutadapt and FastQC to consistently apply adapter and quality trimming to FastQ files, with extra functionality for RRBS data. Babraham Institute Kuzmanović N, Fagorzi C, Mengoni A, Lassalle F, diCenzo GC (2022) Taxonomy of Rhizobiaceae revisited: proposal of a new framework for genus delimitation. Int J Syst Evol MicroBiol 72:005243. https://doi.org/10.1099/ijsem.0.005243 Langmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9(4):357–359. https://doi.org/10.1038/nmeth.1923 Li Y, Li X, Liu H, Zhang Y, Wang E, Chen W (2024) Phylogenomic analyses and reclassification of the Mesorhizobium complex: Proposal for 9 novel genera and reclassification of 15 species. BMC Genomics 25:455. https://doi.org/10.1186/s12864-024-10333-y Li M, Gao C, Feng Y, Liu K, Cao P, Liu Y, Yi X (2021) Martelella alba sp. nov., isolated from mangrove rhizosphere soil within the Beibu Gulf. Arch Microbiol 203:1779–1786. https://doi.org/10.1007/s00203-020-02178-2 Lindström K, Mousavi SA (2019) Effectiveness of nitrogen fixation in rhizobia. Microb Biotechnol 12(6):1259–1270. https://doi.org/10.1111/1751-7915.13517 Ma T, Xue H, Piao C, Jiang N, Li Y (2023) Phylogenomic reappraisal of the family Rhizobiaceae at the genus and species levels, including the description of Ectorhizobium quercum gen. nov., sp. nov. Front Microbiol 14:1207256. https://doi.org/10.3389/fmicb.2023.1207256 Manzano-Gómez LA, Rincón-Molina CI, Martínez-Romero E, Stopol-Martínez SS, Santos-Santiago A, Villalobos-Maldonado JJ, Ruíz-Valdiviezo VM, Rincón-Rosales R (2025) Native rhizobial inoculation improves tomato yield and nutrient uptake while mitigating heavy metal accumulation in a conventional farming system. Microorganisms 13, 1904. https://doi.org/10.3390/microorganisms13081904 Martínez E, Pardo MA, Palacios R, Cevallos MA (1985) Reiteration of nitrogen fixation gene sequences and specificity of Rhizobium in nodulation and nitrogen fixation in Phaseolus vulgaris . Microbiology 131(7):1779–1786. https://doi.org/10.1099/00221287-131-7-1779 Mazur A, Majewska B, Stasiak G, Wielbo J, Skorupska A (2011) repABC-based replication systems of Rhizobium leguminosarum bv. trifolii TA1 plasmids: incompatibility and evolutionary analyses. Plasmid 66(2):53–66. https://doi.org/10.1016/j.plasmid.2011.04.002 Montañez A, Abreu C, Gill P, Hardarson G, Sicardi M (2009) Biological nitrogen fixation in maize (Zea mays L.) by N-15 isotope-dilution and identification of associated culturable diazotrophs. Biol Fertil Soils 45(3):253–263. https://doi.org/10.1007/s00374-008-0322-2 Montiel J, Reid D, Grønbæk TH, Benfeldt CM, James EK, Ott T, Ditengou FA, Nadzieja M, Kelly S, Stougaard J (2021) Distinct signaling routes mediate intercellular and intracellular rhizobial infection in Lotus japonicus. Plant Physiol 185(3):1131–1147. https://doi.org/10.1093/plphys/kiaa049 Mus F, Colman DR, Peters JW, Boyd ES (2019) Geobiological feedbacks, oxygen, and the evolution of nitrogenase. Free Radic Biol Med 140:250–259. https://doi.org/10.1016/j.freeradbiomed.2019.01.050 Nouwen N, Arrighi J-F, Cartieaux F, Chaintreuil C, Gully D, Klopp C, Giraud E (2017) The role of rhizobial (NifV) and plant (FEN1) homocitrate synthases in Aeschynomene /photosynthetic Bradyrhizobium symbiosis. Sci Rep 7:448. https://doi.org/10.1038/s41598-017-00559-0 Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW (2015) CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res 25(7):1043–1055. https://doi.org/10.1101/gr.186072.114 Pi HW, Chiang Y-R, Li W-H (2024) Mapping geological events and nitrogen fixation evolution onto the timetree of the evolution of nitrogen-fixation genes. Mol Biol Evol 41(2):msae023. https://doi.org/10.1093/molbev/msae023 Pritchard L, Glover RH, Humphris S, Elphinstone JG, Toth IK (2016) Genomics and taxonomy in diagnostics for food security: soft-rotting enterobacterial plant pathogens. Anal Methods 8(1):12–24. https://doi.org/10.1039/C5AY02550H Rahi P, Khairnar M, Hagir A, Narayan A, Jain KR, Madamwar D, Pansare A, Shouche Y (2021) Peteryoungia gen. nov. with four new species combinations and description of Peteryoungia desertarenae sp. nov., and taxonomic revision of the genus Ciceribacter based on phylogenomics of Rhizobiaceae. Arch Microbiol 203:3591–3604. https://doi.org/10.1007/s00203-021-02349-9 Raymond J, Siefert JL, Staples CR, Blankenship RE (2004) The natural history of nitrogen fixation. Mol Biol Evol 21(3):541–554. https://doi.org/10.1093/molbev/msh047 Rodríguez S, Correa-Galeote D, Sánchez-Pérez M, Ramírez M, Isidra-Arellano MC, Reyero-Saavedra MdR, Zamorano-Sánchez D, Hernández G, Valdés-López O, Girard L (2020) A novel OmpR-type response regulator controls multiple stages of the Rhizobium etli – Phaseolus vulgaris N₂-fixing symbiosis. Front Microbiol 11:615775. https://doi.org/10.3389/fmicb.2020.615775 Roesch LFW, Camargo FAO, Bento FM, Triplett EW (2008) Biodiversity of diazotrophic bacteria within the soil, root and stem of field-grown maize. Plant Soil 302(1–2):91–104. https://doi.org/10.1007/s11104-007-9458-3 Ruíz-Valdiviezo VM, Rogel-Hernandez MA, Guerrero G, Rincón-Molina CI, García-Perez LG, Gutiérrez-Miceli FA, Rincón-Rosales R (2017) Complete genome sequence of a novel nonnodulating Rhizobium species isolated from Agave americana L. rhizosphere. Genome Announc 5(46):e01280–e01217. https://doi.org/10.1128/genomea.01280-17 Sarkar D, Landa M, Bandyopadhyay A, Pakrasi HB, Zehr JP, Maranas CD (2021) Elucidation of trophic interactions in an unusual single-cell nitrogen-fixing symbiosis using metabolic modeling. PLoS Comput Biol 17(5):e1008983. https://doi.org/10.1371/journal.pcbi.1008983 Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum . Gene 145:69–73. https://doi.org/10.1016/0378-1119(94)90324-7 Schulte CCM, Borah K, Wheatley RM, Terpolilli JJ, Saalbach G, Crang N et al (2021) Metabolic control of nitrogen fixation in rhizobium-legume symbioses. Sci Adv 7:eabh2433. https://doi.org/10.1126/sciadv.abh2433 Seemann T (2014) Prokka: Rapid prokaryotic genome annotation. Bioinformatics 30(14):2068–2069. https://doi.org/10.1093/bioinformatics/btu153 Sessitsch A, Howieson JG, Perret X, Antoun H, Martínez-Romero E (2002) Advances in Rhizobium research. CRC Crit Rev Plant Sci 21(4):323–378. https://doi.org/10.1080/0735-260291044278 Shantharam S, Mattoo AK (1997) Enhancing biological nitrogen fixation: An appraisal of current and alternative technologies for N input into plants. Plant Soil 194:205–216. https://doi.org/10.1023/A:1004234315999 Singh M, Singh D, Gupta A, Pandey KD, Singh PK, Kumar A (2019) Plant growth promoting rhizobacteria. In: Singh AK, Kummar A, Singh PK (eds) PGPR Amelioration in Sustainable Agriculture. Elsevier, Cambridge, MA, pp 41–66. https://doi.org/10.1016/B978-0-12-815879-1.00003-3 Solaiyappan Mani S, Reinhold-Hurek B (2021) RNA-seq provides new insights into the gene expression changes in Azoarcus olearius BH72 under nitrogen-deficient and replete conditions beyond the nitrogen fixation process. Microorganisms 9(9):1888. https://doi.org/10.3390/microorganisms9091888 Solomon W, Mutum L, Janda T et al (2023) Potential benefit of microalgae and their interaction with bacteria to sustainable crop production. Plant Growth Regul 101:53–65. https://doi.org/10.1007/s10725-023-01019-8 Sotelo M, Ureta AC, Muñoz S, Sanjuán J, Monza J, Palacios J (2021) Introduction of H2-Uptake Hydrogenase Genes. Into Rhizobial Strains Improves Symbiotic Nitrogen Fixation in Vicia sativa and Lotus corniculatus Forage Legumes Front Agron. 3:661534. https://doi.org/10.3389/fagro.2021.661534 Suarez C, Cardinale M, Ratering S, Steffens D, Jung S, Montoya AMZ, Schnell S (2015) Plant growth-promoting effects of Hartmannibacter diazotrophicus on summer barley ( Hordeum vulgare L.) under salt stress. Appl Soil Ecol 95:23–30. https://doi.org/10.1016/j.apsoil.2015.04.017 Tao J, Wang S, Liao T, Luo H (2021) Evolutionary origin and ecological implication of a unique nif island in free-living Bradyrhizobium lineages. ISME J 15(11):3195–3206. https://doi.org/10.1038/s41396-021-01002-z Toledo I, Lloret L, Martínez-Romero E (2003) Sinorhizobium americanus sp. nov., a new Sinorhizobium species nodulating native Acacia spp. in Mexico. Syst Appl Microbiol 26:54–64. https://doi.org/10.1078/072320203322337317 Uchiumi T, Ohwada T, Itakura M, Mitsui H, Nukui N, Dawadi P, Kaneko T, Tabata S, Yokoyama T, Tejima K, Saeki K, Omori H, Hayashi M, Maekawa T, Sriprang R, Murooka Y, Tajima S, Simomura K, Nomura M, Minamisawa K (2004) Expression islands clustered on the symbiosis island of the Mesorhizobium loti genome. J Bacteriol 186(8):2439–2448. https://doi.org/10.1128/JB.186.8.2439-2448.2004 Valentine AJ, Kleinert A, Benedito VA (2017) Adaptive strategies for nitrogen metabolism in phosphate deficient legume nodules. Plant Sci 256:46–52. https://doi.org/10.1016/j.plantsci.2016.12.010 Van Deynze A, Zamora P, Delaux P-M, Heitmann C, Jayaraman D, Rajasekar S et al (2018) Nitrogen fixation in a landrace of maize is supported by a mucilage-associated diazotrophic microbiota. PLoS Biol 16(8):e2006352. https://doi.org/10.1371/journal.pbio.2006352 VanInsberghe D, Maas KR, Cardenas E, Strachan CR, Hallam SJ, Mohn WW (2015) Non-symbiotic Bradyrhizobium ecotypes dominate North American forest soils. ISME J 9(11):2435–2441. https://doi.org/10.1038/ismej.2015.54 Vinuesa P, Ochoa-Sánchez LE, Contreras-Moreira B (2018) GET_PHYLOMARKERS, a software package to select optimal orthologous clusters for phylogenomics and inferring pan-genome phylogenies, used for a critical geno-taxonomic revision of the genus Stenotrophomonas . Front Microbiol 9:771. https://doi.org/10.3389/fmicb.2018.00771 Wang XY, Li P, Du XJ, Wang S (2024) Effect of glutathione-transport-related gene gsiD on desiccation tolerance of Cronobacter sakazakii and its related regulatory mechanism. Appl Environ Microbiol 90(2):e01562–e01523. https://doi.org/10.1128/aem.01562-23 Wardell GE, Hynes MF, Young PJ, Harrison E (2021) Why are rhizobial symbiosis genes mobile? Phil Trans R Soc B 377:20200471. https://doi.org/10.1098/rstb.2020.0471 Warmack RA, Maggiolo AO, Orta A et al (2023) Structural consequences of turnover-induced homocitrate loss in nitrogenase. Nat Commun 14:1091. https://doi.org/10.1038/s41467-023-36636-4 Wetzel ME, Olsen GJ, Chakravartty V, Farrand SK (2015) The repABC plasmids with quorum-regulated transfer systems in members of the Rhizobiales divide into two structurally and separately evolving groups. Genome Biol Evol 7(12):3337–3357. https://doi.org/10.1093/gbe/evv227 Wick RR, Judd LM, Gorrie CL, Holt KE (2017) Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol 13(6):e1005595. https://doi.org/10.1371/journal.pcbi.1005595 Wongdee J, Boonkerd N, Teaumroong N, Tittabutr P, Giraud E (2018) Regulation of nitrogen fixation in Bradyrhizobium sp. strain DOA9 involves two distinct NifA regulatory proteins that are functionally redundant during symbiosis but not during free-living growth. Front Microbiol 9:1644. https://doi.org/10.3389/fmicb.2018.01644 Yang E, Liu J, Chen D, Wang S, Xu L, Ma K, Zhang X, Sun L, Wang W (2022) Rhizobium cremeum sp. nov., isolated from sewage and capable of acquisition of heavy metal and aromatic compounds resistance genes. Syst Appl Microbiol 45(3):126322. https://doi.org/10.1016/j.syapm.2022.126322 Yurgel SN, Kahn ML (2004) Dicarboxylate transport by rhizobia. FEMS Microbiol Rev 28(4):489–501. https://doi.org/10.1016/j.femsre.2004.04.002 Zack KM, Sorenson T, Joshi SG (2024) Types and mechanisms of efflux pump systems and the potential of efflux pump inhibitors in the restoration of antimicrobial susceptibility, with a special reference to Acinetobacter baumannii . Pathogens 13(3):197. https://doi.org/10.3390/pathogens13030197 Zhang Y, Chen Y, Penttinen P et al (2024) Ciceribacter sichuanensis sp. nov., a plant growth promoting rhizobacterium isolated from root nodules of soybean in Sichuan, China. Antonie Van Leeuwenhoek 117:46. https://doi.org/10.1007/s10482-024-01941-5 Additional Declarations No competing interests reported. Supplementary Files SUPPLEMENTARYFIGURES.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8833836","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":597216359,"identity":"43ca361e-d5c5-48e2-b744-46ae750e7fa8","order_by":0,"name":"Luis Galdino García Pérez","email":"","orcid":"","institution":"Instituto Tecnológico de Tuxtla Gutiérrez","correspondingAuthor":false,"prefix":"","firstName":"Luis","middleName":"Galdino García","lastName":"Pérez","suffix":""},{"id":597216361,"identity":"558f8131-6288-4e01-a165-65cb9923350c","order_by":1,"name":"Julio Cesar Martínez Romero","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"Julio","middleName":"Cesar Martínez","lastName":"Romero","suffix":""},{"id":597216365,"identity":"a7f6d6bc-9914-4f92-88c5-6ecf362fdf3f","order_by":2,"name":"Marco A. Rogel","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"A.","lastName":"Rogel","suffix":""},{"id":597216366,"identity":"e4763242-eed4-493e-98f3-543d42ad0395","order_by":3,"name":"Gustavo Cuaxinque-Flores","email":"","orcid":"","institution":"Universidad Autónoma de Guerrero","correspondingAuthor":false,"prefix":"","firstName":"Gustavo","middleName":"","lastName":"Cuaxinque-Flores","suffix":""},{"id":597216368,"identity":"1c587b24-853e-4c46-a2a3-8a130d4f2f4f","order_by":4,"name":"María Gabriela Guerrero Ruiz","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"María","middleName":"Gabriela Guerrero","lastName":"Ruiz","suffix":""},{"id":597216371,"identity":"61330cba-a823-4dc0-aeea-30ebe03ddb99","order_by":5,"name":"Marisa Rodríguez-Padilla","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"Marisa","middleName":"","lastName":"Rodríguez-Padilla","suffix":""},{"id":597216372,"identity":"dd1a3674-6f55-4c21-b80f-021a48c57258","order_by":6,"name":"Lourdes Girard","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"Lourdes","middleName":"","lastName":"Girard","suffix":""},{"id":597216373,"identity":"85d804e4-83c1-4271-994d-a987212b5f25","order_by":7,"name":"Ronal Pacheco","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"Ronal","middleName":"","lastName":"Pacheco","suffix":""},{"id":597216376,"identity":"d4fb0f58-0d0a-45e8-9726-a898b856672d","order_by":8,"name":"Jesús Montiel González","email":"","orcid":"","institution":"UNAM","correspondingAuthor":false,"prefix":"","firstName":"Jesús","middleName":"Montiel","lastName":"González","suffix":""},{"id":597216378,"identity":"d29b3427-9515-4512-b76d-7d9a24d68f50","order_by":9,"name":"Clara Ivette Rincón Molina","email":"","orcid":"","institution":"Instituto Tecnológico de Tuxtla Gutiérrez","correspondingAuthor":false,"prefix":"","firstName":"Clara","middleName":"Ivette Rincón","lastName":"Molina","suffix":""},{"id":597216379,"identity":"376a5395-2225-43aa-90a0-78b855a28448","order_by":10,"name":"José David Flores-Félix","email":"","orcid":"","institution":"Universidad de Salamanca","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"David","lastName":"Flores-Félix","suffix":""},{"id":597216380,"identity":"292b0161-8e98-421d-9b99-02d94ae08751","order_by":11,"name":"Reiner Rincón Rosales","email":"","orcid":"","institution":"Instituto Tecnológico de Tuxtla Gutiérrez","correspondingAuthor":false,"prefix":"","firstName":"Reiner","middleName":"Rincón","lastName":"Rosales","suffix":""},{"id":597216381,"identity":"da7a861d-db5c-4b6f-8c4b-e3394ee96c08","order_by":12,"name":"Esperanza Martínez-Romero","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYNACAwYGftJ0HABqkWwgTQvIogPEquYXO/zs84eCO3LGxw8/fsHYdkdet4E7TQKfFsnZacYzDhg8MzY7k2Zmwdj2zHDbAd7NBvi0GNxOMAb65XDiths8bAaMbYcZgVo2PsCnxf52+meQlvrNMyBa7IFaNuD1l4F0DtiWBAMJHuYHQC2JBG2RuJ1TzHDG4LDhDKBfGBLOHU7edpiAX/hnp29mqPhzWJ6//fDjDx/KDttuO967DW+IIQM2iQQQxUysepDaDyQoHgWjYBSMghEEAG4kTpYC1x7MAAAAAElFTkSuQmCC","orcid":"","institution":"UNAM","correspondingAuthor":true,"prefix":"","firstName":"Esperanza","middleName":"","lastName":"Martínez-Romero","suffix":""}],"badges":[],"createdAt":"2026-02-09 19:23:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8833836/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8833836/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103475962,"identity":"42b5172a-b9b5-4d4a-bcb0-edb24c559671","added_by":"auto","created_at":"2026-02-26 06:57:39","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":51284,"visible":true,"origin":"","legend":"\u003cp\u003eStem length of \u003cem\u003eL. japonicus \u003c/em\u003eplants inoculated with \u003cem\u003eRhizobium \u003c/em\u003esp. ACO34-A.\u003c/p\u003e\n\u003cp\u003eCtrl) non-inoculated plants, Wt) \u003cem\u003eRhizobium \u003c/em\u003esp. ACO34-A inoculated plants, \u003cem\u003enifh\u003c/em\u003e) \u003cem\u003enifH \u003c/em\u003emutant inoculated plants. Statistical significance was detected by a Tukey’s multiple comparison test, different letters represent significant difference. Black dots in the box plots indicate individual samples from three biological replicates.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/92e14123d9b2ccc35fafeea4.jpg"},{"id":103507643,"identity":"d14bb162-b088-4859-92e3-4d1eca41fce3","added_by":"auto","created_at":"2026-02-26 13:42:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":205367,"visible":true,"origin":"","legend":"\u003cp\u003eA. Phylogenomic tree based on 284 single-copy marker genes from 15 strains of the \u003cem\u003eCiceribacter\u003c/em\u003e genus and 4 strains of \u003cem\u003eRhizobium\u003c/em\u003e (including \u003cem\u003eR. daejeonense\u003c/em\u003e and \u003cem\u003eRhizobium\u003c/em\u003esp. ACO-34A). The tree was constructed using the GTR+F+ASC+R3 evolutionary model with 1000 bootstrap replicates to assess branch support.\u003c/p\u003e\n\u003cp\u003eB. Phylogenomic tree reconstruction bases on 1416 single copy gene markers from 8 strains of \u003cem\u003ePaeniirhizobium\u003c/em\u003egenes. The tree was inferred using the GTR+F+ASC+R4 model, with 1000 bootstrap to asses brach support.\u003c/p\u003e\n\u003cp\u003eC. Average nucleotide identity and average aminoacid identity with the closest strains of \u003cem\u003ePaenirhizobium genus\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/fc3cfe73346fd54cc2e59a8e.png"},{"id":103507619,"identity":"2e348db7-c8a8-436e-9b30-049e2f1ac109","added_by":"auto","created_at":"2026-02-26 13:42:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":756501,"visible":true,"origin":"","legend":"\u003cp\u003eCircular map of the 213 kb plasmid of \u003cem\u003eRhizobium\u003c/em\u003esp. ACO-34A. Selected genetic elements are shown on the plasmid.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/8d83953349559c845d94827c.png"},{"id":103475973,"identity":"b5fdec2a-ac3b-4788-a6ea-f9f11170a58e","added_by":"auto","created_at":"2026-02-26 06:57:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":495172,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of the NifH protein, showing the position of \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO34-A (starred) and its closest homologs with \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e S101\u003csup\u003eT\u003c/sup\u003e.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/d7612422983e5693d9b92335.png"},{"id":103475960,"identity":"279921ba-f57e-4ccf-8f84-9649fe5e3a39","added_by":"auto","created_at":"2026-02-26 06:57:39","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":77145,"visible":true,"origin":"","legend":"\u003cp\u003eLinear representation (from bottom to top) of plasmid pRACO-34A (CP021375.1) from the strain \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO-34A, compared by BLAST with the sequences of \u003cem\u003eAgrobacterium fabrum\u003c/em\u003e1D132 plasmid pAt1D132b (CP033025.1), \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e S101T (JAMXLX010000001.1), \u003cem\u003eRhizobium cremeum\u003c/em\u003e strain S302 plasmid 2(CP180219.1) and \u003cem\u003eHartmannibacter diazotrophicus\u003c/em\u003e strain E19T (LT960614.1). Genes related to horizontal gene transfer (HGT) are annotated at the top.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/efc531837253c5316f58f70b.png"},{"id":103475984,"identity":"cfed930e-0e13-4130-87f6-d41a4024e3ec","added_by":"auto","created_at":"2026-02-26 06:57:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":105954,"visible":true,"origin":"","legend":"\u003cp\u003eA. Phylogenomic tree \u003cem\u003eprsD \u003c/em\u003egene showing the placement of strain ACO-34A among reference species\u003c/p\u003e\n\u003cp\u003eB. Phylogenomic tree \u003cem\u003eprsE \u003c/em\u003e(I) gene showing the placement of strain ACO-34A among reference species\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/40099743448fee5b489e5c68.png"},{"id":103475987,"identity":"845e8fd8-f96b-4eff-953f-30b646c5dd7c","added_by":"auto","created_at":"2026-02-26 06:57:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":252784,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenomic tree \u003cem\u003evirB\u003c/em\u003e (IV) gene showing the placement of strain ACO-34A among reference species\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/a4ee7206b5a8be3e9752b45d.png"},{"id":103475986,"identity":"4cbd95a8-667b-4860-95bf-58da1f7a45d3","added_by":"auto","created_at":"2026-02-26 06:57:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":167059,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenomic tree \u003cem\u003eompR\u003c/em\u003e gene showing the placement of strain ACO-34A among reference species\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/7429710f65277f7c77ade1c5.png"},{"id":103510047,"identity":"766ee3d6-6904-4e34-b462-3f3857056561","added_by":"auto","created_at":"2026-02-26 14:03:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2575833,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/b5f3817c-0b68-49ac-9631-6a75dd51e0b9.pdf"},{"id":103475963,"identity":"54b0fff0-1672-488a-9d13-d3070b245afc","added_by":"auto","created_at":"2026-02-26 06:57:40","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":399342,"visible":true,"origin":"","legend":"","description":"","filename":"SUPPLEMENTARYFIGURES.docx","url":"https://assets-eu.researchsquare.com/files/rs-8833836/v1/ac75a81f2be231deb50ba785.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Non-nodulating Rhizobium-like ACO-34A fixes nitrogen in pure cultures and has a nif plasmid","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNitrogen fixation is an ancient and fundamental biochemical process (Pi et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This process not only supports primary productivity in natural ecosystems but also underpins biogeochemical nitrogen cycling, particularly in nitrogen-limited soils (Mus et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Pi et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). It may have evolved first in archaea and later transferred to bacteria (the archaea-first hypothesis) (Raymond et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Mus et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Koirala and Br\u0026ouml;zel \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNitrogen gas (N\u003csub\u003e2\u003c/sub\u003e) is chemically inert, as the nitrogen are triply bonded to each other (Gastearena et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Only the Haber Bosh industrial process and a few bacteria and archaea are capable of breaking the triple bond. However, biological nitrogen fixation is energetically costly in terms of ATPs and the nitrogenase enzyme converts the abundant and inert nitrogen from the atmosphere into ammonia. Nitrogen-fixing bacteria have been well studied because they are used to produce biofertilizers that may substitute for chemical fertilizers, contributing to sustainability in agriculture. Nitrogen-fixing bacteria together with other species could be used to constitute bacterial consortia for the production not only of biofertilizers but also of biopesticides and bio stimulants (Solomon et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This could be the basis for an innovative, integral management strategy for plant inoculation.\u003c/p\u003e \u003cp\u003eThe identification of diazotrophs has increased markedly, largely driven by the detection of nif genes in bacterial genomes, which has enabled the recognition of previously undescribed organisms with the capacity for nitrogen fixation. Comparative genomics approaches have been particularly useful for identifying conserved core nif operons and, simultaneously, for revealing lineage specific adaptive signatures within the broader nitrogen fixation gene repertoire, including regulatory and accessory components that modulate nif expression and activity beyond the essential structural genes (Tao et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Likewise, the integration of multiomics frameworks spanning genomics, proteomics, transcriptomics and metabolomics has improved mechanistic resolution of the complex processes that sustain nitrogen fixation and has clarified key layers of its regulation (Shantharam \u0026amp; Mattoo, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e1997\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe core set of six nif genes (\u003cem\u003enifHDKENB\u003c/em\u003e) is used to identify nitrogen-fixing species (Dos Santos et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). However, some species with a five-gene set \u003cem\u003enifHDKEB\u003c/em\u003e or even a four-gene set \u003cem\u003enifHDKB\u003c/em\u003e have been found to be capable of fixing nitrogen (Chen et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Ivanovsky et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The mere presence of \u003cem\u003enif\u003c/em\u003e genes does not guarantee active nitrogen fixation, thus the acetylene reduction assays are needed to confirm nitrogen fixation in bacteria. However, few studies include this analysis. Besides the structural nitrogenase proteins, others are required for an efficient process. These include transporters for sugars or metals, gene regulators, hydrogen uptake dehydrogenases, and homocitrate synthase. For instance, metals that constitute the structural nitrogenase molecule need to be transported inside cells. In rhizobia the transport of sugars from root exudates is induced during colonization within the nodule, and dicarboxylate acid transporters are essential for supplying the energy required for nitrogen fixation in nodules (Yurgel and Kahn, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Lindstr\u0026ouml;m \u0026amp; Mousavi, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Similarly, homocitrate, an essential component of the iron-molybdenum cofactor of nitrogenase, is provided by the plant host in symbiotic relationships (Bell\u0026eacute;s-Sancho et al \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In contrast, free-living diazotrophs must synthesize their own homocitrate. Finally, uptake hydrogenases enhance efficiency by recycling the H\u003csub\u003e2\u003c/sub\u003e produced as a byproduct during the catalytic activity of the nitrogenase. For example, \u003cem\u003eBradyrhizobium\u003c/em\u003e strains containing uptake hydrogenases are more efficient symbiotic partners (Baginsky et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2002\u003c/span\u003e) and these enzymes are also found in free-living diazotrophs such as \u003cem\u003eAzospirillum\u003c/em\u003e and \u003cem\u003eAzoarcus olearius\u003c/em\u003e (Solaiyappan \u0026amp; Reinhold-Hurek, 2021).\u003c/p\u003e \u003cp\u003eBeijerinck was the first to isolate \u003cem\u003eRhizobium\u003c/em\u003e from nodules in 1888 (Fred et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1932\u003c/span\u003e). Afterwards, the commercialization of biofertilizers began in 1895 with the introduction of 'Nitragin' by Nobbe and Hiltner (Singh et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Among nitrogen-fixing bacteria, rhizobia are preferred inoculants, as they are considered safe and have been in use for more than a hundred years (Sessitsch et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Bhattacharjee et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Glick, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The main characteristic of \u003cem\u003eRhizobium\u003c/em\u003e is that the nodulation (\u003cem\u003enod\u003c/em\u003e) and nitrogen fixation (\u003cem\u003enif\u003c/em\u003e) genes are contained on plasmids that are part of the mobilome and considered accessory genes, as they can be lost without affecting bacterial growth (Wardell et al., \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These \u003cem\u003enod\u003c/em\u003e genes induce the formation of nodules that contain millions of nitrogen-fixing bacteria.\u003c/p\u003e \u003cp\u003eTypically, \u003cem\u003eRhizobium\u003c/em\u003e strains do not fix nitrogen in a free-living state. Instead, this process occurs within nodules, where rhizobia undergo a differentiation process to become bacteroids. Bacteroids are typically larger than their free-living counterparts and are pleomorphic in some cases (Solaiyappan \u0026amp; Reinhold-Hurek, 2021). These differentiated cells have distinct gene expression profiles and upregulate genes for microaerobic life (Uchiumi et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Solaiyappan \u0026amp; Reinhold-Hurek, 2021).\u003c/p\u003e \u003cp\u003eExceptionally, \u003cem\u003eAzorhizobium caulinodans\u003c/em\u003e (Iki et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) and a few \u003cem\u003eBradyrhizobium\u003c/em\u003e strains can fix nitrogen in culture medium (Wongdee et al., \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In \u003cem\u003eA. caulinodans\u003c/em\u003e two copies of \u003cem\u003enifH\u003c/em\u003e genes were found that differed in their promoter regions (Iki et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Abundant population of non-nodulating bradyrhizobia exist in soil (VanInsberghe et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), and some contain \u003cem\u003enif\u003c/em\u003e genes that may be functional in free-living bacteria (Wongdee et al., \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). When in plant nodules, rhizobia fix nitrogen and provide it to the plant as ammonium (Valentine et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) or alanine in some cases (Schulte et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In contrast, free-living nitrogen-fixing bacteria retain the fixed nitrogen, using it for their own bacterial growth and seemingly do not excrete it to the external media. Nevertheless, mutants and modified bacteria that excrete ammonium have been obtained for different bacterial species such as \u003cem\u003eAzospirillum, Kosakonia\u003c/em\u003e and other plant-associated bacteria, and because they excrete ammonium, they are better stimulators of plant growth (Jiang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePreviously we reported \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO-34A from the rhizosphere of \u003cem\u003eAgave americana\u003c/em\u003e plants in Chiapas in Mexico and obtained its genome using the Pacific Biosciences (PacBio RSII) single-molecule real-time (SMRT) platform (Ru\u0026iacute;z-Valdiviezo et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). ACO-34A does not produce nodules in several legumes tested such as \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e, \u003cem\u003eLeucaena\u003c/em\u003e spp., and no \u003cem\u003enod\u003c/em\u003e genes were found. ACO-34A was found to be related to \u003cem\u003eRhizobium daejeonense\u003c/em\u003e L61\u003csup\u003eT\u003c/sup\u003e (De La Torre-Ruiz et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). However, rhizobial taxonomy is being continuously modified (He et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and some bacteria that were originally classified as \u003cem\u003eRhizobium\u003c/em\u003e were assigned to newly created genera, \u003cem\u003ee,g., Rhizobium daejeonense\u003c/em\u003e recovered from a cyanide treatment bioreactor in Korea, was recently reclassified as \u003cem\u003eCiceribacte\u003c/em\u003er (Rahi et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Recent studies using phylogenomics, genome-to-genome distance, and digital DNA-DNA hybridization have proven effective in delineating novel genera within \u003cem\u003eRhizobiaceae\u003c/em\u003e (Ma et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; He et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Considering novel parameters to define genera in rhizobia, \u003cem\u003eR. daejeonense\u003c/em\u003e does not group within \u003cem\u003eCiceribacter\u003c/em\u003e and stands as an independent clade that could correspond to a new genus (Kuzmanović et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Thus, ACO-34A taxonomic status should be further analyzed.\u003c/p\u003e \u003cp\u003eACO-34A was recovered from \u003cem\u003eAgave\u003c/em\u003e roots, similarly \u003cem\u003eRhizobium\u003c/em\u003e strains are successful root colonizers (Gutierrez-Zamora \u0026amp; Mart\u0026iacute;nez-Romero, 2001). ACO-34A has a high capability to promote plant growth (De La Torre-Ruiz et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Garc\u0026iacute;a-P\u0026eacute;rez et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and is being used as a plant inoculant in agricultural fields. In this context, the aim of this work was to evaluate the ability of strain ACO-34A to fix nitrogen in microaerobic cultures, obtain a NifH mutant, establish the bacterium taxonomic position, describe characteristics of the \u003cem\u003enif\u003c/em\u003e plasmid and present an updated genome sequence of ACO-34A obtained with the Illumina and Nanopore platforms.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eBacterial cultures and Acetylene Reduction Assay.\u003c/p\u003e \u003cp\u003eBacteria were grown in PY medium (Toledo et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) and isolated pure colonies were obtained on plates in the same medium. For acetylene reduction assay (ARA), cultures were grown for 24 h in nitrogen-free, semisolid MM medium (F\u0026aring;hraeus, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1957\u003c/span\u003e). Acetylene was injected into vials containing the ACO-34A cultures, followed by incubation for 24\u0026ndash;48 h at 30 \u0026ordm;C. The conversion of acetylene to ethylene was quantified by gas chromatography following standard procedures. Ethylene and acetylene were measured using a Varian gas chromatograph as described by Mart\u0026iacute;nez et al., (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1985\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenome assembly and ANI, AAI and dDDH Analyses\u003c/p\u003e \u003cp\u003eACO-34A genome was re-sequenced using short reads (Illumina novas 6000 system) and long reads (Oxford Nanopore Technologies MinION system). Low-quality short-reads (Q\u0026thinsp;\u0026lt;\u0026thinsp;30) were removed during trim quality validation using trim-galore v0.6.10 and fastqc v0.12.1 (Krueger, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Hybrid genome assembly was then performed using Unicycler v0.5.1 (Wick et al., \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and genome coverage was determined using Bowtie2 v2.5.4 (Langmead \u0026amp; Salzberg). CheckM v1.2.2 was used to verify the quality of the genome assembly (Parks et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). A circular map of the \u003cem\u003enif\u003c/em\u003e plasmid was visualized using the Proksee web server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://proksee.ca/\u003c/span\u003e\u003cspan address=\"https://proksee.ca/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the annotation was performed using prokka v1.14.6 (Seemann, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), with default parameters, to identify coding sequences (CDS), tRNA and rRNA genes. Additional CDS prediction and functional annotation were performed with the RAST-tk server (Rapid Annotation Using Subsystem Technology) (Brettin et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) to ensure comprehensive identification of genetic elements. Circular plasmid map editing was performed with Inkscape software v1.4. The newly recovered sequence of a 213 kb plasmid from \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO-34A was compared to the one in Genbank from the national center for biotechnology information (NCBI) database (accession number: CP021375.1).\u003c/p\u003e \u003cp\u003ePhylogenomic and phylogenetic analysis of ACO-34A\u003c/p\u003e \u003cp\u003ePhylogenomic comparisons were performed with genomes deposited in the NCBI-RefSeq database for the genera \u003cem\u003eCiceribacter\u003c/em\u003e and \u003cem\u003ePaenirhizobium\u003c/em\u003e, deposited before December 2025. GET_HOMOLOGUES v14112024 was used to calculate the core genome and obtain shared single-copy genes (Contreras-Moreira \u0026amp; Vinuesa, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Subsequently, GET_PHYLOMARKERS was run with the core-genome matrix to identify high-quality marker genes. The species tree was obtained using ASTRAL-IV, which accounts for genetic tree discordance and estimates branch lengths in substitutions per site, using the IQ-TREE implementation (Vinuesa et al., \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The phylogenies were visualized using FigTree v1.4.4. Average Nucleotide Identity (ANI) was calculated based on MUMmer alignments (ANIm) using pyani module v0.2.12 (Pritchard et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and Average Amino Acid Identity (AAI) was computed with the CompareM toolkit v0.1.2, which integrates Prodigal v2.6.2 and DIAMOND v0.9.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/dparks1134/CompareM/\u003c/span\u003e\u003cspan address=\"https://github.com/dparks1134/CompareM/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). On the other hand, \u003cem\u003ein silico\u003c/em\u003e DNA\u0026ndash;DNA hybridization (dDDH) analyses were performed with the closest strains using the TYGS online server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://tygs.dsmz.de/\u003c/span\u003e\u003cspan address=\"https://tygs.dsmz.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor the phylogenetic analysis, homologous sequences were retrieved from the NCBI database for each gene family (e.g., nitrogen fixation, replication, transport, secretion systems, and stress response) and multiple sequence alignments were performed with MUSCLE v3.8.31 (Edgar, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) with default parameters. Poorly aligned regions were removed manually. Maximum Likelihood phylogenetic trees were constructed with IQ-TREE v2.1.2 using modelfinder for optimal model selection, with 1000 bootstrap replicates.\u003c/p\u003e \u003cp\u003eConstruction of NifH mutants\u003c/p\u003e \u003cp\u003eThe ACO-34A NifH single recombinant mutants were obtained through single-crossover homologous recombination via vector insertion mutagenesis (VIM) methodology. To achieve this, a\u0026thinsp;~\u0026thinsp;390-bp intragenic region of the \u003cem\u003enifH\u003c/em\u003e gene was amplified by PCR using primers Up-nifHSR (5\u0026rsquo; TGTGAATTCGGCTGTGCCGGTCGC 3\u0026rsquo;) and Lw-nifHSR (5\u0026rsquo; TTGAATTCGTCGCGCGGCACGAAG 3\u0026rsquo;). This PCR product was cloned into the pJET1.2/blunt vector (Thermo Scientific\u003csup\u003e\u0026trade;\u003c/sup\u003e) and subsequently sequenced. To construct a suicide plasmid for VIM, the \u003cem\u003enifH\u003c/em\u003e intragenic region was purified using the EcoRI sites in the primers and ligated to the EcoRI-restricted pK18mob plasmid (Sch\u0026auml;fer et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). \u003cem\u003eE. coli\u003c/em\u003e DH5α/pK18mob-nifHSR transformants were verified and used as donors in three independent triparental matings with the \u003cem\u003eRhizobium sp\u003c/em\u003e. ACO-34A strain, employing the DH5α/\u003cem\u003epRK2013\u003c/em\u003e plasmid as a helper. Transconjugants were selected on PY medium containing kanamycin and fosfomycin. To confirm that the expected single-crossover had occurred, PCR amplification of selected Km\u003csup\u003eR\u003c/sup\u003e-Fm\u003csup\u003eR\u003c/sup\u003e transconjugants was performed using a combination of primers corresponding to the insert and the universal primers M13 forward and reverse. An additional PCR was conducted using the primers nifHAcoFw (5\u0026rsquo; TTTGAATTCCTCGAACTCGAGGATGTCCTG 3\u0026rsquo;) and nifHAcoRev (5\u0026rsquo; AGAGAATTC TCCAGCTCTTCCATGGTGAT 3\u0026rsquo;), whose specific sequence is outside the region utilized in the construction of pKmob-nifHSR; thus, the PCR product is only obtained in the wild-type strain.\u003c/p\u003e \u003cp\u003e \u003cem\u003eLotus japonicum\u003c/em\u003e inoculation assays\u003c/p\u003e \u003cp\u003e \u003cem\u003eLotus japonicum\u003c/em\u003e Gifu seeds were scarified with sandpaper, disinfected in 6% chlorine for 10 minutes, and rinsed thoroughly 3\u0026ndash;5 times with distilled water. Seeds were then incubated at 21\u0026deg;C in a growth chamber under a photoperiod of 16:8 for germination (Montiel et al. 2024; Garc\u0026iacute;a-Soto et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Seven-day-old seedlings were transferred to square Petri dishes containing Noble Agar supplemented with 1/4 B\u0026amp;D medium (Broughton and Dilworth \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1971\u003c/span\u003e) devoid of nitrogen. Seven-day-old seedlings were inoculated with \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO34-A or its NifH mutant. For this, each Petri dish was supplemented with 1 mL of an aqueous solution containing the corresponding bacterium strain at OD 0.05, or with 1 mL of distilled water for control plants.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eNitrogen fixation of \u003cem\u003ePaenirhizobium\u003c/em\u003e sp. ACO-34A\u003c/p\u003e \u003cp\u003eNitrogen fixation assays using multiple colonies in nitrogen-free medium consistently indicated acetylene reduction, providing solid evidence of nitrogenase activity in the clonal strains derived from ACO-34A. The strains recovered from the pellicles formed beneath the surface of the nitrogen-free medium exhibited a phenotypic profile identical to the original clone. These strains were subcultured in PY medium again and re-cultured in nitrogen-free medium to confirm the positive ARA assay. Additionally, the genotypic and antibiotic resistance profiles were evaluated, showing consistency with the original strain.\u003c/p\u003e \u003cp\u003eThis indicates that the ACO-34A strain has the capacity to carry out biological nitrogen fixation in vitro. To substantiate a determinant relationship between \u003cem\u003enif\u003c/em\u003e gene function and acetylene reduction, independent NifH mutants were generated and functionally characterized. All NifH mutants did not produce ethylene in the acetylene reduction assay under the experimental conditions evaluated, whereas the wild-type strain did. Genetic and molecular fingerprinting controls, including ERIC-PCR profiles, corroborated that the mutants were derived from ACO-34A (Supplementary Fig.\u0026nbsp;2).\u003c/p\u003e \u003cp\u003e \u003cem\u003eLotus japonicus\u003c/em\u003e is a model plant to study microbial symbiosis with the advantage of being small and fast-growing. In \u003cem\u003eLotus\u003c/em\u003e, ACO34-A promoted stem growth. Significant differences in stem height were observed in plants inoculated with the NifH mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Plants inoculated with the NifH mutant allowed to determine the promoting effects due to nitrogen fixation and plants with the NifH mutants had slighty longer stems than control non-inoculated plants. This suggests that nitrogen fixation explains in part the growth promotion of ACO34-A.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGenome of \u003cem\u003ePaenirhizobium\u003c/em\u003e sp. ACO-34A\u003c/p\u003e \u003cp\u003eACO34-A deposited genome (GCF_002600635.1) was recently removed from the NCBI RefSeq database because it was argued that there was a potential contamination with \u003cem\u003eCiceribacter\u003c/em\u003e sequences. To address this issue about contamination, we re-sequenced its genome from a pure culture derived from an isolated colony after five subcultures, using the Illumina and Nanopore sequencing platforms. The comparison of the newly obtained genome assembly to the previously reported genome showed that they were identical in sequence and almost identical in replicon size (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe data obtained for the reported replicons assembled with PacBio (Ru\u0026iacute;z-Valdiviezo et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) were compared with the hybrid genome assembly using Illumina-Nanopore reads. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, genomic analyses showed agreement between the two sequencing results. The lengths of the chromosomes (4.75 Mb) and plasmid replicons (pRACO-34Aa-d) showed insignificant differences (variation\u0026thinsp;\u0026lt;\u0026thinsp;100 bp). From the genome analysis we found that \u003cem\u003eRhizobium\u003c/em\u003e ACO-34A has two plasmids and two chromids (one containing a copy of ribosomal genes). This was corroborated using the Eckhardt technique (Supplementary Fig.\u0026nbsp;1). The \u003cem\u003enif\u003c/em\u003e genes were found on the 213 kb plasmid that we define here as the \u003cem\u003enif\u003c/em\u003e plasmid. Like other rhizobia, ACO-34A possesses the genes that encode the dicarboxylate transporters. Notably, these are located in the ACO-34A chromosome. These observations confirm the structural integrity of the \u003cem\u003ePaenirhizobium\u003c/em\u003e sp. ACO-34A genome. In addition, a completeness of 99.01% was estimated and it could be observed a contamination of 1.18%. These results, complemented by high sequencing depth (\u0026gt;\u0026thinsp;332X), support the quality of the assembly for further phylogenomic and taxonomic analyses.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparative genome assembly metrics of strain ACO-34A derived from PacBio, and Illumina-Nanopore sequencing platforms.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePacBio (Ru\u0026iacute;z-Valdiviezo et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2017\u003c/span\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIllumina\u0026ndash;Nanopore\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChromosome\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4,754,916\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4,754,988\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003epRACO34a\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e213,273\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e213,280\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003epRACO34b\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e305,590\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e305,619\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003epRACO34c\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e494,144\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e494,163\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003epRACO34d\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e516,813\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e516,834\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCoverage\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e347 X\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e332 X\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ePhylogenomic and genomic relatedness indices\u003c/p\u003e \u003cp\u003eACO-34A may be assigned to \u003cem\u003ePaenirhizobium\u003c/em\u003e (that means almost \u003cem\u003eRhizobium\u003c/em\u003e, Ma et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) not yet officially accepted. \u003cem\u003eRhizobium daejeonense\u003c/em\u003e (Ma et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) is closely related to ACO-34A (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e). \u003cem\u003eR. daejeonense\u003c/em\u003e was previously reclassified as \u003cem\u003eCiceribacter\u003c/em\u003e (Rahi et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and now it is recognized as a distinct genus, \u003cem\u003ePaenirhizobium\u003c/em\u003e. \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e, isolated from soybean nodules in China (Zhang et al., \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), which was found to be close to ACO-34A likely also belongs to \u003cem\u003ePaenirhizobium\u003c/em\u003e. We did not find \u003cem\u003enod\u003c/em\u003e genes in \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e, which is also the case for \u003cem\u003eCiceribacter daejeonense\u003c/em\u003e. All of these related strains with ACO-34A would appear to belong to a non-nodulating rhizobial genus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe ANI, AAI, and dDDH values calculated from ACO34-A genome in comparison with the closest reference genomes were consistently below the accepted species-level thresholds. In Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, ACO-34A forms a well-supported lineage, clearly separated from the representative strains of \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e S101. On the other hand, the topology of the species tree with respect to \u003cem\u003ePaenirhizobium\u003c/em\u003e shows that the representative strain \u003cem\u003ePaenirhizobium daejeonense\u003c/em\u003e KACC 13094 is the closest clade (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). According to this topology, ACO-34A occupies a single branch within this genus.\u003c/p\u003e \u003cp\u003eThe representative strain closest to ACO-34A based on ANI was \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e S101 (92.17%), whereas \u003cem\u003ePaenirhizobium daejeonense\u003c/em\u003e KACC_13094 showed an ANI of 92.06%. Similarly, the average AAI between ACO-34A and \u003cem\u003eC. sichuanensis\u003c/em\u003e was 94.92%, and 94.58% with \u003cem\u003eP. daejeonense\u003c/em\u003e KACC 13094. In addition to ANI analyses, we performed cAAI, which is now considered to be useful for delineating genera in rhizobia (Li et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). dDDH values against these strains were in both cases\u0026thinsp;\u0026lt;\u0026thinsp;46%.\u003c/p\u003e \u003cp\u003eKey functional traits encoded in the \u003cem\u003enif\u003c/em\u003e plasmid\u003c/p\u003e \u003cp\u003eThe complete set of nitrogen fixation genes in ACO-34A is located on a 213 kb plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e) in the newly sequenced genomes that we report here and in the previously reported genome (Ru\u0026iacute;z-Valdiviezo et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). As evidenced by genome assembly analyses, this feature is consistently detected in both the newly generated hybrid assembly and the previously reported PacBio-based genome (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In ACO-34A the \u003cem\u003enif\u003c/em\u003e plasmid contains all genes necessary for nitrogen fixation, namely \u003cem\u003enifHDKENB\u003c/em\u003e and in addition, it also has \u003cem\u003enifA\u003c/em\u003e, \u003cem\u003enifB\u003c/em\u003e and a \u003cem\u003enifV\u003c/em\u003e gene encoding homocitrate synthase that produces homocitrate (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This \u003cem\u003enif\u003c/em\u003e cluster is located in a plasmid region with high homology to the \u003cem\u003enif\u003c/em\u003e cluster annotated in the \u003cem\u003eC. sichuanensis\u003c/em\u003e S101\u003csup\u003eT\u003c/sup\u003e genome and is flanked by several transposase genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThis plasmid harbors the structural and accessory \u003cem\u003enif\u003c/em\u003e genes required for nitrogenase activity, including \u003cem\u003enifHDKENB\u003c/em\u003e, and additionally contains key regulatory regions such as \u003cem\u003enifA\u003c/em\u003e and \u003cem\u003enifB\u003c/em\u003e.\u003c/p\u003e \u003cp\u003ePhylogenetic estimation of the \u003cem\u003enifH\u003c/em\u003e gene, together with additional genes encoded on the \u003cem\u003enif\u003c/em\u003e plasmid, revealed that the \u003cem\u003enifH\u003c/em\u003e sequence of strain ACO-34A clusters closely with that of \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Likewise, it is positioned within a broader phylogeny-based taxonomic assemblage dominated by free-living, non-nodulating nitrogen fixers, including \u003cem\u003eRhizobium cremeum\u003c/em\u003e (Yang et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2022\u003c/span\u003e ) as well as species of the genus \u003cem\u003eMartelella\u003c/em\u003e (Li et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and \u003cem\u003eHartmannibacter diazotrophicus\u003c/em\u003e (Suarez et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The strong nodal support suggests that the phylogenetic affinity of ACO-34A \u003cem\u003enifH\u003c/em\u003e is robust to resampling and reflects a stable signal in the alignment. Notably, nodulation genes were not detected in the closest relatives examined; supporting the inference that ACO-34A belongs to a non-nodulating rhizobial lineage.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003enif\u003c/em\u003e cluster is embedded within a broader mobile genomic context (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e). In close proximity to the \u003cem\u003enif\u003c/em\u003e genes, the \u003cem\u003ehesB\u003c/em\u003e gene was identified in the immediate vicinity of the nitrogen fixation locus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This gene has been linked in multiple systems to nitrogen-related physiology (B\u0026ouml;hme \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) and is annotated as an iron-binding protein, which is biologically plausible given the high metalloprotein requirements during nitrogenase maturation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe plasmid also encodes a \u003cem\u003erepABC\u003c/em\u003e replication and maintenance system typical of large rhizobial replicons. (Cevallos et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Wetzel et al., 2025). Phylogenetic patterns of \u003cem\u003erepABC\u003c/em\u003e suggest affinity with \u003cem\u003eAgrobacterium\u003c/em\u003e and \u003cem\u003eEnsifer\u003c/em\u003e lineages, consistent with a rhizobial origin. In addition, conjugal transfer modules, including \u003cem\u003etra\u003c/em\u003e and \u003cem\u003etrb\u003c/em\u003e genes and a type IV secretion related apparatus, indicate transfer competence and provide a mechanistic basis for dispersal among rhizosphere bacteria.\u003c/p\u003e \u003cp\u003eMost plasmids in \u003cem\u003eRhizobium\u003c/em\u003e have the \u003cem\u003erepABC\u003c/em\u003e operon for replication (Mazur et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). A plasmid replication/maintenance system (the \u003cem\u003erepABC\u003c/em\u003e operon) was identified and the analysis of the ACO-34A \u003cem\u003erepABC\u003c/em\u003e gene sequences from the 213 kb plasmid showed that they resemble those from \u003cem\u003eAgrobacterium\u003c/em\u003e and \u003cem\u003eEnsifer\u003c/em\u003e (not shown) indicating a rhizobial origin of the replicon.\u003c/p\u003e \u003cp\u003eMultiple transport systems were also encoded in the plasmid, including glutathione transporters (Wang et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), bicarbonate and riboflavin transport systems. The dipeptide permease \u003cem\u003eDppA\u003c/em\u003e, and the membrane trafficking protein EntH were encoded in the plasmid sequence. Dicarboxylate transporters, which are essential for nitrogen fixation in nodules, and sugar transporters involved in the utilization of root exudates were also found.\u003c/p\u003e \u003cp\u003eGenes conferring stress tolerance were also identified including those that encode for osmoregulatory proteins (OmpR, Rodriguez et al., 2020) and glycogen metabolism genes (\u003cem\u003eglgA\u003c/em\u003e and \u003cem\u003eglgB\u003c/em\u003e). Multiple proteins involved in the conjugal transfer (TraA, TraB and TraC) were also identified, Furthermore, these genes show high similarity to those identified in the plasmid pAt1D132b of \u003cem\u003eAgrobacterium fabrum\u003c/em\u003e 1D132 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003enif\u003c/em\u003e plasmid contains many transposases, hypothetical genes as well as a secretion system corresponding to the Type I (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-b) transporters and Type IV system with genes similar to \u003cem\u003evirB\u003c/em\u003e that does not match with the corresponding genes from rhizobia (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e7\u003c/span\u003e). On the one hand, the annotation of multiple transposases (IS3, IS6 and IS481 families of transposases) that delimit regions with genes showing high percentages of similarity with different strains of the Rhizobiaceae family (depending on the region to be considered (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003e) indicates a chimeric origin of the plasmid.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOn the \u003cem\u003enif\u003c/em\u003e plasmid there were genes that resemble \u003cem\u003eemrA\u003c/em\u003e and \u003cem\u003eemrB\u003c/em\u003e which encode efflux pumps that confer resistance to antibiotics (Dalbanjan et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Zack et al., \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The \u003cem\u003eemrA\u003c/em\u003e and \u003cem\u003eemrB\u003c/em\u003e genes found in ACO-34A genome were not found in the related \u003cem\u003eC. sichuanensis\u003c/em\u003e or in \u003cem\u003eRhizobium cremeum\u003c/em\u003e genomes.\u003c/p\u003e \u003cp\u003eA gene encoding \u003cem\u003eBvgA\u003c/em\u003e, which in rhizobia is part of a toxin-antitoxin system that could prevent plasmid loss, was found on the \u003cem\u003enif\u003c/em\u003e plasmid. In five serial subcultures of ACO-34A, the kanamycin resistance (located in the \u003cem\u003enifH\u003c/em\u003e gene on the \u003cem\u003enif\u003c/em\u003e plasmid) was conserved in bacteria (not shown) suggesting that curing the \u003cem\u003enif\u003c/em\u003e plasmid would be difficult with a toxin-antitoxin system present on the plasmid.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eompR\u003c/em\u003e gene from ACO-34A \u003cem\u003enif\u003c/em\u003e plasmid is phylogenetically related to \u003cem\u003eAgrobacterium ompR\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e8\u003c/span\u003e). A hypothetical gene from the ACO-34A \u003cem\u003enif\u003c/em\u003e plasmid resembles a gene encoding a protein with an Ig domain (Chaterjee ) from \u003cem\u003eParaburkhoderia fungorum\u003c/em\u003e. For biofilm formation, \u003cem\u003eglgA\u003c/em\u003e and \u003cem\u003eglgB\u003c/em\u003e gene products were identified. Notably, the \u003cem\u003enif\u003c/em\u003e plasmid contains several genes of unknown function or encoding hypothetical proteins. It is worth mentioning that no uptake-hydrogenase \u003cem\u003e(hup\u003c/em\u003e) genes (Sotelo et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) were detected in the ACO34-A genome.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn \u003cem\u003eRhizobium\u003c/em\u003e nitrogen fixation normally occurs in nodules, so ACO34-A is outstanding for being capable of fixing nitrogen in free living conditions and this characteristic is certainly encoded in \u003cem\u003enif\u003c/em\u003e genes as NifH mutants were uncapable of fixing nitrogen. Notably the NifH mutant did not promote stem growth in \u003cem\u003eLotus japonicum\u003c/em\u003e plants as the wild type did.\u003c/p\u003e \u003cp\u003e \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO-34A isolated from the roots of \u003cem\u003eAgave americana\u003c/em\u003e plants in Chiapas, Mexico showed plant growth promotion capabilities (De La Torre-Ruiz et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Agave plants may select and promote growth of free-living diazotrophs due to its high photosynthetic capacity, which provides an abundant carbon supply to sustain bacterial populations, together with reduced nitrogen availability, thereby avoiding the inhibition of nitrogen fixation (Beltran-Garc\u0026iacute;a et al., 2014). Similar processes may occur in other cacti or in C4 plants such as maize (Roesch et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Montanez et al., 2009; Van Deynze et al., \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Consequently, agaves may represent a potential niche for the isolation of nitrogen fixing bacteria, such as ACO-34A, which is currently being used successfully in agricultural fields (Manzano-G\u0026oacute;mez et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Furthermore, ACO-34A may be applied in mixed inoculants with the aim of establishing an integrated management strategy for plant biofertilizers.\u003c/p\u003e \u003cp\u003eACO-34A consistently clustered with strains within the not officially recognized genus \u003cem\u003ePaenirhizobium\u003c/em\u003e, including the lineage represented by \u003cem\u003ePaenirhizobium daejeonense.\u003c/em\u003e Closely related genomes historically placed in \u003cem\u003eCiceribacter\u003c/em\u003e have been reclassified as new taxa, consistent with ongoing taxonomic revisions in this clade.\u003c/p\u003e \u003cp\u003eTaken together our results support that ACO-34A represents a previously undescribed species within \u003cem\u003ePaenirhizobium\u003c/em\u003e. All genomic relatedness indices were significantly below the accepted species boundaries (95\u0026ndash;96% for ANI-AAI and 70% for dDDH). In regard to the genome, clearly there was no contaminating DNA it the deposited genome of ACO34-A and the resemblance to \u003cem\u003eCiceribacter\u003c/em\u003e reflects the genetic similarity of \u003cem\u003eCiceribacter\u003c/em\u003e and \u003cem\u003ePaenirhizobium\u003c/em\u003e and is therefore not actual evidence for contamination.\u003c/p\u003e \u003cp\u003eNitrogen fixation in ACO-34A and perhaps in \u003cem\u003eC. sichuanensis\u003c/em\u003e could be due to the origin of their \u003cem\u003enif\u003c/em\u003e genes, apparently from free-living nitrogen-fixing bacteria. The putatively transferred \u003cem\u003enif\u003c/em\u003e genes could have also carried as well the regulatory regions and mechanisms to be expressed under free-living conditions and not confined to nodules. Recent comparative analyses have shown that \u003cem\u003enifH\u003c/em\u003e phylogenies often reflect ecological rather than strictly taxonomic relationships, particularly in free-living diazotrophs inhabiting root-associated environments (Tao et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In bradyrhizobia, few \u003cem\u003enif\u003c/em\u003e genes were found alone in small genomic islands in the chromosome, and they were not phylogenetically related to the \u003cem\u003enif\u003c/em\u003e genes linked to the \u003cem\u003enod\u003c/em\u003e genes from plant nodulating symbionts. Thus, they likely have an evolutionary origin different from the \u003cem\u003enif\u003c/em\u003e genes linked to \u003cem\u003enod\u003c/em\u003e genes (Tao et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This is similar to what we discovered for the independent \u003cem\u003ePaenirhizobium nif\u003c/em\u003e genes in absence of \u003cem\u003enod\u003c/em\u003e genes.\u003c/p\u003e \u003cp\u003eIt has been reported that the modular architecture of \u003cem\u003enif\u003c/em\u003e-containing islands is often associated with the presence of transferable integrative elements and transcriptional promoters (Tao et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Ma et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHomocitrate is a component of the nitrogenase FeMo-cofactor and is considered to be required for free-living nitrogen fixation (Nouwen et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Bell\u0026eacute;s-Sancho et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Warmack et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Plants provide homocitrate but free-living bacteria must synthesize it to fix nitrogen. \u003cem\u003enifV\u003c/em\u003e is absent from a wide range of rhizobial genomes that fix nitrogen exclusively within nodules (Hakoyama et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The presence of \u003cem\u003enifV\u003c/em\u003e gene in ACO34-A is congruent with its capacity to fix nitrogen under free-living conditions.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOverall, our results support the conclusion that ACO-34A is a free-living diazotroph.Nevertheless, additional experimental assays are required to determine whether, during nitrogen fixation, strain ACO-34A excretes ammonium to the plant.\u003c/p\u003e \u003cp\u003eThis work confirms the ACO34-A genome sequence using Illumina and Nanopore sequencing. The hybrid assembly, generated from a meticulously purified lineage was identical to the previously obtained PacBio genome (Ru\u0026iacute;z-Valdiviezo et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe surmise that ACO-34A represents a novel species within \u003cem\u003ePaenirhizobium\u003c/em\u003e. In general terms, strain ACO-34A can be placed within a cluster dominated by non-nodulating diazotrophs. From an evolutionary perspective, strain ACO-34A shows a very close relationship with \u003cem\u003eC. sichuanensis\u003c/em\u003e which should be reclassified as \u003cem\u003ePaenirhizobium sichuanensis\u003c/em\u003e. Both taxa share the presence of \u003cem\u003enif\u003c/em\u003e genes which may be ancestral in this genus besides the supposition of their original acquisition by lateral transfer. Notably, \u003cem\u003eC. sichuanensis\u003c/em\u003e was recovered from soybean yet lacks \u003cem\u003enod\u003c/em\u003e genes. In the case of ACO-34A, diazotrophic activity was confirmed using the acetylene reduction assay (ARA). In contrast, for \u003cem\u003eC. sichuanensis\u003c/em\u003e, data on acetylene reduction have not yet been reported, nor has the replicon-level location of the \u003cem\u003enif\u003c/em\u003e gene cluster.\u003c/p\u003e \u003cp\u003eAgave plants may select for associated nitrogen-fixing bacteria because they have a large photosynthetic capability with abundant carbon supplies to feed bacteria, and limited nitrogen so as not to inhibit nitrogen fixation (Beltran-Garc\u0026iacute;a et al., 2014). This may also occur in other cacti or in C4 plants as maize (Roesch et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Montanez et al., 2009; Van Deynze et al., \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Seemingly, agaves may be an excellent niche from which to isolate nitrogen-fixing bacteria to be used as biofertilizers, such as ACO-34A, that is being successfully used as an inoculant in agricultural fields (Manzano-G\u0026oacute;mez et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). ACO-34A may be used in mixed inoculants with the idea of integrated management of plant inoculants.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthical Approval\u003c/strong\u003e \u003cp\u003enot applicable\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis study was funded by PAPIIT-UNAM IN206124.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eE.M-R wrote the main manuscript text, managed resources and directed the experimental work.L.G.G.P., M.A.R., and M.R-P performed the experiments and implemented the methodologyJ.M.R. and G.C.-F. performed all phylogenetic analyses.L.G. designed primers and designed mutantJ.M.G. and R.P. performed experimentsM.G.G.R. performed genomic analyses.C.I.R.M. and R.R.R. proposed research activities.All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eGenome will be available upon request, since NCBI is no longer accepting genome deposits.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBaginsky C, Brito B, Imperial J, Palacios JM, Ruiz-Arg\u0026uuml;eso T (2002) Diversity and evolution of hydrogenase systems in rhizobia. Appl Environ Microbiol 68(10):4915\u0026ndash;4924. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.68.10.4915-4924.2002\u003c/span\u003e\u003cspan address=\"10.1128/AEM.68.10.4915-4924.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarahona E, Collantes-Garc\u0026iacute;a JA, Rosa-N\u0026uacute;\u0026ntilde;ez E, Xiong J, Jiang X, Jim\u0026eacute;nez-Vicente E, Ech\u0026aacute;varri-Erasun C, Guo Y, Rubio LM, Gonz\u0026aacute;lez-Guerrero M (2024) Azotobacter vinelandii scaffold protein NifU transfers iron to NifQ as part of the iron\u0026ndash;molybdenum cofactor biosynthesis pathway for nitrogenase. J Biol Chem. Advance online publication \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jbc.2024.107900\u003c/span\u003e\u003cspan address=\"10.1016/j.jbc.2024.107900\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBell\u0026eacute;s-Sancho P, Lardi M, Liu Y, Hug S, Pinto-Carb\u0026oacute; MA, Zamboni N, Pessi G (2021) \u003cem\u003eParaburkholderia phymatum\u003c/em\u003e homocitrate synthase NifV plays a key role for nitrogenase activity during symbiosis with papilionoids and in free-living growth conditions. Cells 10(4):952. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells10040952\u003c/span\u003e\u003cspan address=\"10.3390/cells10040952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeltran-Garcia MJ, White JF Jr., Prado FM, Prieto KR, Yamaguchi LF, Torres MS, Kato MJ, Medeiros MHG, Di Mascio P (2014) Nitrogen acquisition in \u003cem\u003eAgave tequilana\u003c/em\u003e from degradation of endophytic bacteria. Sci Rep 4:6938. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep06938\u003c/span\u003e\u003cspan address=\"10.1038/srep06938\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhattacharjee RB, Jourand P, Chaintreuil C, Dreyfus B, Singh A, Mukhopadhyay SN (2012) Indole acetic acid and ACC deaminase-producing Rhizobium leguminosarum bv. trifolii SN10 promote rice growth, and in the process undergo colonization and chemotaxis. Biol Fertil Soils 48:173\u0026ndash;182. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00374-011-0614-9\u003c/span\u003e\u003cspan address=\"10.1007/s00374-011-0614-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026ouml;hme H (1998) Regulation of nitrogen fixation in heterocyst-forming cyanobacteria. Trends Plant Sci 3(9):346\u0026ndash;351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1360-1385(98)01290-4\u003c/span\u003e\u003cspan address=\"10.1016/S1360-1385(98)01290-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrettin T, Davis J, Disz T et al (2015) \u003cem\u003eRASTtk\u003c/em\u003e: A modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. \u003cem\u003eSci Rep\u003c/em\u003e 5, 8365. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep08365\u003c/span\u003e\u003cspan address=\"10.1038/srep08365\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroughton WJ, Dilworth MJ (1971) Control of leghaemoglobin synthesis in snake beans. Biochem J 125(4):1075\u0026ndash;1080. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/bj1251075\u003c/span\u003e\u003cspan address=\"10.1042/bj1251075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCevallos MA, Cervantes-Rivera R, Guti\u0026eacute;rrez-R\u0026iacute;os RM (2008) The repABC plasmid family. Plasmid 60(1):19\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plasmid.2008.03.001\u003c/span\u003e\u003cspan address=\"10.1016/j.plasmid.2008.03.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChatterjee S, Basak AJ, Nair AV, Duraivelan K, Samanta D (2021) Immunoglobulin-fold containing bacterial adhesins: molecular and structural perspectives in host tissue colonization and infection. FEMS Microbiol Lett 368(2):fnaa220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.1093/femsle/fnaa220\u003c/span\u003e\u003cspan address=\"10.1093/femsle/fnaa220\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Nishihara A, Haruta S (2021) Nitrogen-fixing ability and nitrogen fixation-related genes of thermophilic fermentative bacteria in the genus \u003cem\u003eCaldicellulosiruptor\u003c/em\u003e. Microbes Environ 36(2):ME21018. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1264/jsme2.ME21018\u003c/span\u003e\u003cspan address=\"10.1264/jsme2.ME21018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eContreras-Moreira B, Vinuesa P (2013) GET_HOMOLOGUES, a versatile software package for scalable and robust microbial pangenome analysis. Appl Environ Microbiol 79(24):7696\u0026ndash;7701. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.02411-13\u003c/span\u003e\u003cspan address=\"10.1128/AEM.02411-13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDalbanjan NP, Kadapure AJ, Kumar PKS (2024) Comprehensive review on latent role of stress proteins in antibiotic resistance. Microbe 4:100151. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.microb.2024.100151\u003c/span\u003e\u003cspan address=\"10.1016/j.microb.2024.100151\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe La Torre-Ruiz N, Ruiz-Valdiviezo VM, Rinc\u0026oacute;n-Molina CI, Rodr\u0026iacute;guez-Mendiola M, Arias-Castro C, Guti\u0026eacute;rrez-Miceli FA, Rinc\u0026oacute;n-Rosales R (2016) Effect of plant growth-promoting bacteria on the growth and fructan production of \u003cem\u003eAgave americana\u003c/em\u003e L. Brazilian J Microbiol 47:587\u0026ndash;596. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bjm.2016.04.010\u003c/span\u003e\u003cspan address=\"10.1016/j.bjm.2016.04.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDos Santos PC, Fang Z, Mason SW, Setubal JC, Dixon R (2012) Distribution of nitrogen fixation and nitrogenase-like sequences amongst microbial genomes. BMC Genomics 13(1):162. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2164-13-162\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-13-162\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32(5):1792\u0026ndash;1797. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gkh340\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkh340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF\u0026aring;hraeus G (1957) The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. J Gen Microbiol 16(2):374\u0026ndash;381. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/00221287-16-2-374\u003c/span\u003e\u003cspan address=\"10.1099/00221287-16-2-374\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFred EB, Baldwin IL, McCoy E (1932) Root nodule bacteria and leguminous plants. University of Wisconsin, Wisconsin, IA\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-P\u0026eacute;rez LG, Rinc\u0026oacute;n-Molina CI, Mart\u0026iacute;nez-Romero E, Rogel MA, Tapia-Torres Y, Manzano-G\u0026oacute;mez LA, Maldonado-G\u0026oacute;mez JC, Rinc\u0026oacute;n-Molina FA, Rinc\u0026oacute;n-Rosales R (2024) Genomic Insights and Plant Growth-Promoting Potential of Rhizobial Strains fromAgave americana. Horticulturae 10:1370. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/horticulturae10121370\u003c/span\u003e\u003cspan address=\"10.3390/horticulturae10121370\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Soto I, Andersen SU, Monroy-Morales E, Robledo-Gamboa M, Guadarrama J, Aviles-Baltazar NY, Serrano M, Stougaard J, Montiel J (2024) A collection of novel \u003cem\u003eLotus japonicus\u003c/em\u003e LORE1 mutants perturbed in the nodulation program induced by the \u003cem\u003eAgrobacterium pusense\u003c/em\u003e strain IRBG74. Front Plant Sci 5:14:1326766. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2023.1326766\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2023.1326766\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ePMID: 38250449; PMCID: PMC10796720\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGastearena X, Matxain JM, Ruip\u0026eacute;rez F (2025) Exploring N2 activation using novel Lewis acid/base pairs: Computational insight into frustrated Lewis pair reactivity. Dalton Trans 54:4338\u0026ndash;4352. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/D4DT03425B\u003c/span\u003e\u003cspan address=\"10.1039/D4DT03425B\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlick BR (2012) Plant growth-promoting bacteria: mechanism and application. Scientifica 2012, Article ID 963401. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org/10.6064/2012/963401\u003c/span\u003e\u003cspan address=\"10.6064/2012/963401\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuti\u0026eacute;rrez-Zamora ML, Mart\u0026iacute;nez-Romero E (2001) Natural endophytic association between \u003cem\u003eRhizobium etli\u003c/em\u003e and maize (\u003cem\u003eZea mays\u003c/em\u003e L). J Biotechnol 91(2\u0026ndash;3):117\u0026ndash;126. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0168-1656(01)00332-7\u003c/span\u003e\u003cspan address=\"10.1016/s0168-1656(01)00332-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHakoyama T, Niimi K, Watanabe H, Tabata R, Matsubara J, Sato S, Nakamura Y, Tabata S, Li J, Matsumoto T, Tatsumi K, Nomura M, Tajima S, Ishizaka M, Yano K, Imaizumi-Anraku H, Kawaguchi M, Kouchi H, Suganuma N (2009) Host plant genome overcomes the lack of a bacterial gene for symbiotic nitrogen fixation. Nature 462(7272):514\u0026ndash;517. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature08594\u003c/span\u003e\u003cspan address=\"10.1038/nature08594\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe M, Chen G, Li KJ, Tang XX, Liu XX, Ren CB, Zheng DQ (2024) Characterization and genomic analysis of \u003cem\u003eAffinirhizobium gouqiense\u003c/em\u003e sp. nov. isolated from seawater of Gouqi Island located in the East China Sea and reclassification of \u003cem\u003eRhizobium lemnae\u003c/em\u003e to the genus \u003cem\u003eAffinirhizobium\u003c/em\u003e as \u003cem\u003eAffinirhizobium lemnae\u003c/em\u003e comb. nov. Curr Microbiol 81(9):283. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00284-024-03807-5\u003c/span\u003e\u003cspan address=\"10.1007/s00284-024-03807-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIki T, Aono T, Oyaizu H (2007) Evidence for functional differentiation of duplicated \u003cem\u003enifH\u003c/em\u003e genes in \u003cem\u003eAzorhizobium caulinodans\u003c/em\u003e. FEMS Microbiol Lett 274(2):173\u0026ndash;179. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-6968.2007.00823.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6968.2007.00823.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIvanovsky R, Lebedeva N, Keppen O, Tourova T (2021) Nitrogen metabolism of an anoxygenic filamentous phototrophic bacterium \u003cem\u003eOscillochloris trichoides\u003c/em\u003e strain DG-6. Microbiology 90(4):428\u0026ndash;434. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/S0026261721040068\u003c/span\u003e\u003cspan address=\"10.1134/S0026261721040068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang S, Li J, Wang Q, Yin C, Zhan Y, Yan Y, Lin M, Ke X (2022) Maize growth promotion by inoculation with an engineered ammonium-excreting strain of nitrogen-fixing \u003cem\u003ePseudomonas stutzeri\u003c/em\u003e. \u003cem\u003eMicroorganisms\u003c/em\u003e 10, 1986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms10101986\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10101986\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoirala A, Br\u0026ouml;zel VS (2021) Phylogeny of nitrogenase structural and assembly components reveals new insights into the origin and distribution of nitrogen fixation across bacteria and archaea. Microorganisms 9(8):1662. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms9081662\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms9081662\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrueger F (2015) Trim Galore: A wrapper around Cutadapt and FastQC to consistently apply adapter and quality trimming to FastQ files, with extra functionality for RRBS data. Babraham Institute\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuzmanović N, Fagorzi C, Mengoni A, Lassalle F, diCenzo GC (2022) Taxonomy of Rhizobiaceae revisited: proposal of a new framework for genus delimitation. Int J Syst Evol MicroBiol 72:005243. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/ijsem.0.005243\u003c/span\u003e\u003cspan address=\"10.1099/ijsem.0.005243\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9(4):357\u0026ndash;359. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.1923\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.1923\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Li X, Liu H, Zhang Y, Wang E, Chen W (2024) Phylogenomic analyses and reclassification of the Mesorhizobium complex: Proposal for 9 novel genera and reclassification of 15 species. BMC Genomics 25:455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12864-024-10333-y\u003c/span\u003e\u003cspan address=\"10.1186/s12864-024-10333-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M, Gao C, Feng Y, Liu K, Cao P, Liu Y, Yi X (2021) \u003cem\u003eMartelella alba\u003c/em\u003e sp. nov., isolated from mangrove rhizosphere soil within the Beibu Gulf. Arch Microbiol 203:1779\u0026ndash;1786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00203-020-02178-2\u003c/span\u003e\u003cspan address=\"10.1007/s00203-020-02178-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindstr\u0026ouml;m K, Mousavi SA (2019) Effectiveness of nitrogen fixation in rhizobia. Microb Biotechnol 12(6):1259\u0026ndash;1270. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1751-7915.13517\u003c/span\u003e\u003cspan address=\"10.1111/1751-7915.13517\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa T, Xue H, Piao C, Jiang N, Li Y (2023) Phylogenomic reappraisal of the family \u003cem\u003eRhizobiaceae\u003c/em\u003e at the genus and species levels, including the description of \u003cem\u003eEctorhizobium quercum\u003c/em\u003e gen. nov., sp. nov. Front Microbiol 14:1207256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2023.1207256\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2023.1207256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManzano-G\u0026oacute;mez LA, Rinc\u0026oacute;n-Molina CI, Mart\u0026iacute;nez-Romero E, Stopol-Mart\u0026iacute;nez SS, Santos-Santiago A, Villalobos-Maldonado JJ, Ru\u0026iacute;z-Valdiviezo VM, Rinc\u0026oacute;n-Rosales R (2025) Native rhizobial inoculation improves tomato yield and nutrient uptake while mitigating heavy metal accumulation in a conventional farming system. Microorganisms 13, 1904. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms13081904\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms13081904\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez E, Pardo MA, Palacios R, Cevallos MA (1985) Reiteration of nitrogen fixation gene sequences and specificity of \u003cem\u003eRhizobium\u003c/em\u003e in nodulation and nitrogen fixation in \u003cem\u003ePhaseolus vulgaris\u003c/em\u003e. Microbiology 131(7):1779\u0026ndash;1786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/00221287-131-7-1779\u003c/span\u003e\u003cspan address=\"10.1099/00221287-131-7-1779\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazur A, Majewska B, Stasiak G, Wielbo J, Skorupska A (2011) repABC-based replication systems of \u003cem\u003eRhizobium leguminosarum\u003c/em\u003e bv. \u003cem\u003etrifolii\u003c/em\u003e TA1 plasmids: incompatibility and evolutionary analyses. Plasmid 66(2):53\u0026ndash;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plasmid.2011.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.plasmid.2011.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonta\u0026ntilde;ez A, Abreu C, Gill P, Hardarson G, Sicardi M (2009) Biological nitrogen fixation in maize (Zea mays L.) by N-15 isotope-dilution and identification of associated culturable diazotrophs. Biol Fertil Soils 45(3):253\u0026ndash;263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00374-008-0322-2\u003c/span\u003e\u003cspan address=\"10.1007/s00374-008-0322-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMontiel J, Reid D, Gr\u0026oslash;nb\u0026aelig;k TH, Benfeldt CM, James EK, Ott T, Ditengou FA, Nadzieja M, Kelly S, Stougaard J (2021) Distinct signaling routes mediate intercellular and intracellular rhizobial infection in Lotus japonicus. Plant Physiol 185(3):1131\u0026ndash;1147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/plphys/kiaa049\u003c/span\u003e\u003cspan address=\"10.1093/plphys/kiaa049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMus F, Colman DR, Peters JW, Boyd ES (2019) Geobiological feedbacks, oxygen, and the evolution of nitrogenase. Free Radic Biol Med 140:250\u0026ndash;259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.freeradbiomed.2019.01.050\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2019.01.050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNouwen N, Arrighi J-F, Cartieaux F, Chaintreuil C, Gully D, Klopp C, Giraud E (2017) The role of rhizobial (NifV) and plant (FEN1) homocitrate synthases in \u003cem\u003eAeschynomene\u003c/em\u003e/photosynthetic \u003cem\u003eBradyrhizobium\u003c/em\u003e symbiosis. Sci Rep 7:448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-00559-0\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-00559-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW (2015) CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res 25(7):1043\u0026ndash;1055. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gr.186072.114\u003c/span\u003e\u003cspan address=\"10.1101/gr.186072.114\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePi HW, Chiang Y-R, Li W-H (2024) Mapping geological events and nitrogen fixation evolution onto the timetree of the evolution of nitrogen-fixation genes. Mol Biol Evol 41(2):msae023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msae023\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msae023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePritchard L, Glover RH, Humphris S, Elphinstone JG, Toth IK (2016) Genomics and taxonomy in diagnostics for food security: soft-rotting enterobacterial plant pathogens. Anal Methods 8(1):12\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/C5AY02550H\u003c/span\u003e\u003cspan address=\"10.1039/C5AY02550H\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahi P, Khairnar M, Hagir A, Narayan A, Jain KR, Madamwar D, Pansare A, Shouche Y (2021) Peteryoungia gen. nov. with four new species combinations and description of \u003cem\u003ePeteryoungia desertarenae\u003c/em\u003e sp. nov., and taxonomic revision of the genus \u003cem\u003eCiceribacter\u003c/em\u003e based on phylogenomics of Rhizobiaceae. Arch Microbiol 203:3591\u0026ndash;3604. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00203-021-02349-9\u003c/span\u003e\u003cspan address=\"10.1007/s00203-021-02349-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaymond J, Siefert JL, Staples CR, Blankenship RE (2004) The natural history of nitrogen fixation. Mol Biol Evol 21(3):541\u0026ndash;554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msh047\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msh047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez S, Correa-Galeote D, S\u0026aacute;nchez-P\u0026eacute;rez M, Ram\u0026iacute;rez M, Isidra-Arellano MC, Reyero-Saavedra MdR, Zamorano-S\u0026aacute;nchez D, Hern\u0026aacute;ndez G, Vald\u0026eacute;s-L\u0026oacute;pez O, Girard L (2020) A novel OmpR-type response regulator controls multiple stages of the \u003cem\u003eRhizobium etli\u003c/em\u003e\u0026ndash;\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e N₂-fixing symbiosis. Front Microbiol 11:615775. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2020.615775\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2020.615775\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoesch LFW, Camargo FAO, Bento FM, Triplett EW (2008) Biodiversity of diazotrophic bacteria within the soil, root and stem of field-grown maize. Plant Soil 302(1\u0026ndash;2):91\u0026ndash;104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11104-007-9458-3\u003c/span\u003e\u003cspan address=\"10.1007/s11104-007-9458-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRu\u0026iacute;z-Valdiviezo VM, Rogel-Hernandez MA, Guerrero G, Rinc\u0026oacute;n-Molina CI, Garc\u0026iacute;a-Perez LG, Guti\u0026eacute;rrez-Miceli FA, Rinc\u0026oacute;n-Rosales R (2017) Complete genome sequence of a novel nonnodulating \u003cem\u003eRhizobium\u003c/em\u003e species isolated from \u003cem\u003eAgave americana\u003c/em\u003e L. rhizosphere. Genome Announc 5(46):e01280\u0026ndash;e01217. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/genomea.01280-17\u003c/span\u003e\u003cspan address=\"10.1128/genomea.01280-17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkar D, Landa M, Bandyopadhyay A, Pakrasi HB, Zehr JP, Maranas CD (2021) Elucidation of trophic interactions in an unusual single-cell nitrogen-fixing symbiosis using metabolic modeling. PLoS Comput Biol 17(5):e1008983. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pcbi.1008983\u003c/span\u003e\u003cspan address=\"10.1371/journal.pcbi.1008983\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026auml;fer A, Tauch A, J\u0026auml;ger W, Kalinowski J, Thierbach G, P\u0026uuml;hler A (1994) Small mobilizable multi-purpose cloning vectors derived from the \u003cem\u003eEscherichia coli\u003c/em\u003e plasmids pK18 and pK19: selection of defined deletions in the chromosome of \u003cem\u003eCorynebacterium glutamicum\u003c/em\u003e. Gene 145:69\u0026ndash;73. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0378-1119(94)90324-7\u003c/span\u003e\u003cspan address=\"10.1016/0378-1119(94)90324-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchulte CCM, Borah K, Wheatley RM, Terpolilli JJ, Saalbach G, Crang N et al (2021) Metabolic control of nitrogen fixation in rhizobium-legume symbioses. Sci Adv 7:eabh2433. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciadv.abh2433\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.abh2433\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeemann T (2014) Prokka: Rapid prokaryotic genome annotation. Bioinformatics 30(14):2068\u0026ndash;2069. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btu153\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btu153\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSessitsch A, Howieson JG, Perret X, Antoun H, Mart\u0026iacute;nez-Romero E (2002) Advances in \u003cem\u003eRhizobium\u003c/em\u003e research. CRC Crit Rev Plant Sci 21(4):323\u0026ndash;378. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/0735-260291044278\u003c/span\u003e\u003cspan address=\"10.1080/0735-260291044278\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShantharam S, Mattoo AK (1997) Enhancing biological nitrogen fixation: An appraisal of current and alternative technologies for N input into plants. Plant Soil 194:205\u0026ndash;216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1004234315999\u003c/span\u003e\u003cspan address=\"10.1023/A:1004234315999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh M, Singh D, Gupta A, Pandey KD, Singh PK, Kumar A (2019) Plant growth promoting rhizobacteria. In: Singh AK, Kummar A, Singh PK (eds) PGPR Amelioration in Sustainable Agriculture. Elsevier, Cambridge, MA, pp 41\u0026ndash;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/B978-0-12-815879-1.00003-3\u003c/span\u003e\u003cspan address=\"10.1016/B978-0-12-815879-1.00003-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolaiyappan Mani S, Reinhold-Hurek B (2021) RNA-seq provides new insights into the gene expression changes in \u003cem\u003eAzoarcus olearius\u003c/em\u003e BH72 under nitrogen-deficient and replete conditions beyond the nitrogen fixation process. Microorganisms 9(9):1888. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms9091888\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms9091888\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolomon W, Mutum L, Janda T et al (2023) Potential benefit of microalgae and their interaction with bacteria to sustainable crop production. Plant Growth Regul 101:53\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10725-023-01019-8\u003c/span\u003e\u003cspan address=\"10.1007/s10725-023-01019-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSotelo M, Ureta AC, Mu\u0026ntilde;oz S, Sanju\u0026aacute;n J, Monza J, Palacios J (2021) Introduction of H2-Uptake Hydrogenase Genes. Into Rhizobial Strains Improves Symbiotic Nitrogen\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFixation in Vicia sativa and Lotus corniculatus Forage Legumes Front Agron. 3:661534. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fagro.2021.661534\u003c/span\u003e\u003cspan address=\"10.3389/fagro.2021.661534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuarez C, Cardinale M, Ratering S, Steffens D, Jung S, Montoya AMZ, Schnell S (2015) Plant growth-promoting effects of \u003cem\u003eHartmannibacter diazotrophicus\u003c/em\u003e on summer barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.) under salt stress. Appl Soil Ecol 95:23\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2015.04.017\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2015.04.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTao J, Wang S, Liao T, Luo H (2021) Evolutionary origin and ecological implication of a unique \u003cem\u003enif\u003c/em\u003e island in free-living \u003cem\u003eBradyrhizobium\u003c/em\u003e lineages. ISME J 15(11):3195\u0026ndash;3206. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41396-021-01002-z\u003c/span\u003e\u003cspan address=\"10.1038/s41396-021-01002-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToledo I, Lloret L, Mart\u0026iacute;nez-Romero E (2003) \u003cem\u003eSinorhizobium americanus\u003c/em\u003e sp. nov., a new \u003cem\u003eSinorhizobium\u003c/em\u003e species nodulating native \u003cem\u003eAcacia\u003c/em\u003e spp. in Mexico. Syst Appl Microbiol 26:54\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1078/072320203322337317\u003c/span\u003e\u003cspan address=\"10.1078/072320203322337317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUchiumi T, Ohwada T, Itakura M, Mitsui H, Nukui N, Dawadi P, Kaneko T, Tabata S, Yokoyama T, Tejima K, Saeki K, Omori H, Hayashi M, Maekawa T, Sriprang R, Murooka Y, Tajima S, Simomura K, Nomura M, Minamisawa K (2004) Expression islands clustered on the symbiosis island of the \u003cem\u003eMesorhizobium loti\u003c/em\u003e genome. J Bacteriol 186(8):2439\u0026ndash;2448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JB.186.8.2439-2448.2004\u003c/span\u003e\u003cspan address=\"10.1128/JB.186.8.2439-2448.2004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValentine AJ, Kleinert A, Benedito VA (2017) Adaptive strategies for nitrogen metabolism in phosphate deficient legume nodules. Plant Sci 256:46\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plantsci.2016.12.010\u003c/span\u003e\u003cspan address=\"10.1016/j.plantsci.2016.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Deynze A, Zamora P, Delaux P-M, Heitmann C, Jayaraman D, Rajasekar S et al (2018) Nitrogen fixation in a landrace of maize is supported by a mucilage-associated diazotrophic microbiota. PLoS Biol 16(8):e2006352. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pbio.2006352\u003c/span\u003e\u003cspan address=\"10.1371/journal.pbio.2006352\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanInsberghe D, Maas KR, Cardenas E, Strachan CR, Hallam SJ, Mohn WW (2015) Non-symbiotic \u003cem\u003eBradyrhizobium\u003c/em\u003e ecotypes dominate North American forest soils. ISME J 9(11):2435\u0026ndash;2441. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ismej.2015.54\u003c/span\u003e\u003cspan address=\"10.1038/ismej.2015.54\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVinuesa P, Ochoa-S\u0026aacute;nchez LE, Contreras-Moreira B (2018) GET_PHYLOMARKERS, a software package to select optimal orthologous clusters for phylogenomics and inferring pan-genome phylogenies, used for a critical geno-taxonomic revision of the genus \u003cem\u003eStenotrophomonas\u003c/em\u003e. Front Microbiol 9:771. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2018.00771\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2018.00771\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang XY, Li P, Du XJ, Wang S (2024) Effect of glutathione-transport-related gene \u003cem\u003egsiD\u003c/em\u003e on desiccation tolerance of \u003cem\u003eCronobacter sakazakii\u003c/em\u003e and its related regulatory mechanism. Appl Environ Microbiol 90(2):e01562\u0026ndash;e01523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/aem.01562-23\u003c/span\u003e\u003cspan address=\"10.1128/aem.01562-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWardell GE, Hynes MF, Young PJ, Harrison E (2021) Why are rhizobial symbiosis genes mobile? Phil Trans R Soc B 377:20200471. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rstb.2020.0471\u003c/span\u003e\u003cspan address=\"10.1098/rstb.2020.0471\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWarmack RA, Maggiolo AO, Orta A et al (2023) Structural consequences of turnover-induced homocitrate loss in nitrogenase. Nat Commun 14:1091. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-023-36636-4\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-36636-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWetzel ME, Olsen GJ, Chakravartty V, Farrand SK (2015) The repABC plasmids with quorum-regulated transfer systems in members of the \u003cem\u003eRhizobiales\u003c/em\u003e divide into two structurally and separately evolving groups. Genome Biol Evol 7(12):3337\u0026ndash;3357. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/gbe/evv227\u003c/span\u003e\u003cspan address=\"10.1093/gbe/evv227\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWick RR, Judd LM, Gorrie CL, Holt KE (2017) Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol 13(6):e1005595. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pcbi.1005595\u003c/span\u003e\u003cspan address=\"10.1371/journal.pcbi.1005595\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWongdee J, Boonkerd N, Teaumroong N, Tittabutr P, Giraud E (2018) Regulation of nitrogen fixation in \u003cem\u003eBradyrhizobium\u003c/em\u003e sp. strain DOA9 involves two distinct NifA regulatory proteins that are functionally redundant during symbiosis but not during free-living growth. Front Microbiol 9:1644. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2018.01644\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2018.01644\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang E, Liu J, Chen D, Wang S, Xu L, Ma K, Zhang X, Sun L, Wang W (2022) Rhizobium cremeum sp. nov., isolated from sewage and capable of acquisition of heavy metal and aromatic compounds resistance genes. Syst Appl Microbiol 45(3):126322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.syapm.2022.126322\u003c/span\u003e\u003cspan address=\"10.1016/j.syapm.2022.126322\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYurgel SN, Kahn ML (2004) Dicarboxylate transport by rhizobia. FEMS Microbiol Rev 28(4):489\u0026ndash;501. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.femsre.2004.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.femsre.2004.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZack KM, Sorenson T, Joshi SG (2024) Types and mechanisms of efflux pump systems and the potential of efflux pump inhibitors in the restoration of antimicrobial susceptibility, with a special reference to \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e. Pathogens 13(3):197. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pathogens13030197\u003c/span\u003e\u003cspan address=\"10.3390/pathogens13030197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Chen Y, Penttinen P et al (2024) \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e sp. nov., a plant growth promoting rhizobacterium isolated from root nodules of soybean in Sichuan, China. Antonie Van Leeuwenhoek 117:46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10482-024-01941-5\u003c/span\u003e\u003cspan address=\"10.1007/s10482-024-01941-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rhizobium, Agave, biofertilizers, nif genes, nitrogen fixation, rhizobial plasmids","lastPublishedDoi":"10.21203/rs.3.rs-8833836/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8833836/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRhizobia fix nitrogen in plant nodules. Notably, \u003cem\u003eRhizobium\u003c/em\u003e sp. ACO-34A (which could be reclassified as \u003cem\u003ePaenirhizobium\u003c/em\u003e), recovered from the rhizosphere of \u003cem\u003eAgave americana\u003c/em\u003e, is capable of fixing nitrogen in a defined medium in microaerobic conditions and carries \u003cem\u003enifHDKENBV\u003c/em\u003e genes in a 213 kb plasmid. ACO-34A failed to induce nodules in several leguminous hosts and does not have \u003cem\u003enod\u003c/em\u003e genes. ACO-34A NifH mutant did not fix nitrogen in pure cultures and did not promote stem growth in \u003cem\u003eLotus japonicum\u003c/em\u003e plants as the wild strain did. The plasmid harboring the \u003cem\u003enif\u003c/em\u003e genes contains \u003cem\u003erepABC\u003c/em\u003e replication genes, genes for homocitrate synthesis, for toxin-antitoxin production and for plant colonization. Comparative phylogenomic analyses revealed that strain ACO-34A is close to \u003cem\u003eCiceribacter sichuanensis\u003c/em\u003e S101, which was isolated from soybean nodules and should be reclassified. According to ANI, AAI and dDDH parameters, ACO-34A may represent a novel species within the Rhizobiacea family.\u003c/p\u003e","manuscriptTitle":"Non-nodulating Rhizobium-like ACO-34A fixes nitrogen in pure cultures and has a nif plasmid","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-26 06:57:16","doi":"10.21203/rs.3.rs-8833836/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c890161a-0c11-4b2a-ad59-37a3a1e3008f","owner":[],"postedDate":"February 26th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-26T06:57:17+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-26 06:57:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8833836","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8833836","identity":"rs-8833836","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00