Effects of dietary crude protein on antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep (Ovis aries), as determined by transcriptomic analysis

preprint OA: closed
Full text JSON View at publisher
Full text 108,370 characters · extracted from preprint-html · click to expand
Effects of dietary crude protein on antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep (Ovis aries), as determined by transcriptomic analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of dietary crude protein on antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep (Ovis aries), as determined by transcriptomic analysis Zhenling Wu, Fengshuo Zhang, Quyangangmao Su, Qiurong Ji, Kaina Zhu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3966713/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: The rumen is a balanced ecosystem harboring a variety of microorganisms and plays an important role in the digestion and absorption of nutrients for ruminant. However, there are few studies on the effects of dietary crude protein on development and function in rumen of Tibetan sheep. The objective of this study was to evaluate the effects of dietary crude protein (CP) on the antioxidant activity, immunocompetence and the structural properties in the rumen of Tibetan sheep. Sixty two-month-old rams with an average weight of 15.40±0.81 Kg were randomly assigned to low-protein diet (10.20% of dry matter, L group) and high-protein diet (11.58% of dry matter, H group). The experiment was conducted over 97 d, including 7 d of adaption to the diets. Results: Hematoxylin & eosin (H&E) results showed that high-protein diet increased papilla length, papilla width and muscular layer in rumen ( P < 0.05). Compared with L group, supplementation with 11.58% crude protein increased the activities of T-AOC and SOD significantly ( P < 0.05). A total of 612 significant differentially expressed genes (158 up-regulated and 456 down-regulated) were found in response to high-protein diet. Pathways and genes related to fatty acid biosynthesis, nutrition metabolism and muscle development were verified by real-time quantitative polymerase chain reaction. Conclusions: In conclusion, 11.58% crude protein diet had superior papillary development and antioxidant activity of Tibetan sheep, likely through modulating the expression of functional genes. Dietary crude protein Tibetan sheep Rumen Histomorphological Antioxidant capacity immune levels RNA-seq Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background The Tibetan sheep ( Ovis aries ) is predominantly distributed in the Qinghai-Tibet Plateau with an altitude of over 3000 m, which provision various aspects such as the meat, hides and milk [1]. Additionally, the Tibetan sheep plays a crucial role in maintaining the balance of the natural ecosystems in the Qinghai-Tibetan plateau [2]. In recent years, with the orderly advancement of grassland eco-pastoralism, the feeding mode of Tibetan sheep has gradually changed from traditional natural grazing to drylot feeding [3]. Because of influence of low temperature and hypoxia, the energy requirement of Tibetan sheep is more important than that of protein in normal metabolism. Therefore, the current research mainly focuses on the effect of dietary energy level on Tibetan sheep, and there are few studies on the effect of dietary protein level on Tibetan sheep. The rumen is a balanced ecosystem harboring a variety of microorganisms (i.e., bacteria, fungi, and protozoa), bacteria being the most abundant [4]. Due to the microbial interactions, the crude fibers were converted into volatile fatty acids by fermentation process and then met 70% of the energy needs of the host [5]. Notably, both rumen microbe and rumen phenotype were directly affected by the dietary nutrient level [6]. Therefore, understanding the nutritional requirement, especially dietary protein levels forms a basis for improving productivity in Tibetan sheep. It is hypothesized that diets with different protein levels could change functional gene expression, thereafter affecting the response of immunity and development of epithelial papillae in rumen. Therefore, this study aimed to explore the impact of dietary protein levels on the antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep. In addition, the impact of different protein level diets on the mRNA expression of rumen was evaluated. Results Histological analysis of the rumen Results of H.E. staining of rumen tissue sections were presented in Figure 1A . The papillae length in the L group was significantly shorter than that in the H group ( P < 0.05). Both papillae width and muscular layer of H group was significantly wider than in the L group ( P 0.05). Antioxidant and immune response index assays As shown in Figure 2A , the activities of T-AOC and SOD in rumen of H group were significantly higher than those of L group ( P 0.05). Although the difference was not significant, there was an increased tendency of IgA, IgM, IgG, IL-6, and IL-1β in the H group than the L group ( Figure 2B , P > 0.05). RNA-Seq and Mapping Table 1 showed the basic statistics for RNA-seq reads generated from the rumen of Tibetan sheep. A total of 390.63 million raw reads were obtained through sequencing in ten samples. After quality control, an average of 65.01 million clean reads was generated (64.04 million for H group and 65.97 million for L group). For all samples, the percent of clean reads was 99.85%. The Q30 values were between 94.01% and 96.75%. Average of 96.71% of the clean reads was mapped to the Ovis aries reference genome (H group with 97.52%, L group with 95.91%). Analysis of Gene Expression Venn diagram showed that there were 1706 and 893 differentially expressed genes (DEGs) belonging to this item in treatment and control DEG datasets, respectively, and they shared 14,458 DEGs as the intersection ( Figure 3A ). According to the gene expression values (FPKM), the principal component analysis (PCA) exhibited that H group and L group was separated into two different groups ( Figure 3B ). Hierarchical clustering analysis of the DEGs showed that the same group of DEGs was clustered together, indicating the accuracy and reliability of samples ( Figure 3C ). A total of 612 significant DEGs (based on |(fold change)| > 1.2, P -value < 0.05, and false discovery rate (FDR) < 0.05) were found in response to dietary CP level. Of these genes, 20 were up-regulated and 426 were down-regulated in the H group ( Figure 3D ). Enrichment Analysis of DEGs Gene ontology (GO) enrichment analyses were carried out using the database for annotation, visualization and integrated discovery software (https://david.ncifcrf.gov) ( Figure 4A ). A total of 573 significantly enriched GO terms were annotated within three major function groups: biological process (BP, 354), cellular component (CC, 95), and molecular function (MF, 124). For the down-regulated terms, the most significant GO categories observed were perikaryon, long-chain fatty-acyl-CoA catabolic process, and endoplasmic reticulum polarization. For the up-regulated terms, the most significant GO categories observed were potassium ion homeostasis, muscle contraction, and cell periphery. Based on Kyoto Encyciopedia of Genes and Genome (KEGG) pathway enrichment analysis, 33 KEGG pathways were significantly ( P < 0.05) enriched in the rumen tissue ( Figure 4B ). The top five pathways with the most representation of DEGs were retinol metabolism (13 DEGs), metabolic pathways (56 DEGs), ECM-receptor interaction (8 DEGs), focal adhesion (12 DEGs), and protein digestion and absorption (8 DEGs). Compared to the L group, 13 differentially nutrition metabolism-related signaling pathway (i. e., protein digestion and absorption, nicotinate and nicotinamide metabolism, glutathione metabolism, carbon metabolism, and fatty acid biosynthesis) were identified in H group. Nine significant DEGs, identified from the RNA-seq data, were randomly selected for RT-qPCR validation, including two fatty acid biosynthesis-related genes ( ACACB and ACSF3 ), seven nutrition metabolism-related genes ( ATP1B1 , IDH2 , NT5E and NNT ) and three muscle development-related genes ( MYH11 , KCNMA1 and MYL9 ). The RT-qPCR confirmed that the DEGs exhibited the same pattern of expression as observed with the RNA-seq ( Figure 5 ), indicating our transcriptomic analysis was highly credible. Correlation analysis Correlation analysis ( Figure 6 ) showed that T-AOC was positively correlated ( P < 0.01) with ACACB (0.93), ACSF3 (0.94), ATP1B1 (0.94), and MYH11 (0.92), and IgG was positively correlated ( P < 0.01) with ACSF3 (0.93). T-AOC was positively correlated ( P < 0.01) with IDH2 (0.91), NT5E (0.86), KCNMA1 (0.91), MYL9 (0.87) were positively correlated ( P < 0.05). IgG was positively correlated with ACACB (0.90), ATP1B1 (0.88), IDH2 (0.87), ATP1A2 (0.90), MYH11 (0.92), KCNMA1 (0.86) ( P < 0.01). IL-6 was positively correlated ( P < 0.05) with ACACB (0.83), ATP1B1 (0.87), IDH2 (0.84), ATP1A2 (0.83), MYH11 (0.95), KCNMA1 (0.85), MYL9 (0.84). Discussion Effects of dietary protein level on rumen tissue morphology The interior of rumen was lined with stratified epithelium consisting of papillae which provide surface area for short chain fatty acid (SCFA) absorption [7]. Both number and size of papillae were influenced by nutrition intake and the concentrations of SCFA to which they were exposed [8]. Simultaneously, the muscular layer participated in peristalsis of rumen, contributing to the nutrient utilization of ruminant [9]. Previously, Xia et al (2018) reported that with the increase of the dietary crude protein, the acetate, propionate, butyrate and total volatile fatty acid (VFA) concentrations increased in rumen of Holstein bulls [10]. Cristina et al (2022) found that sheep fed a high-protein (173g CP/kg dry matter) diet showed higher acetate, butyrate and VFA concentration compared with those fed a low-protein (134g CP/kg dry matter) diet [11]. A similar result was observed by Lv et al., who observed that the ruminal concentration of butyrate and isobutyrate increased with the high crude protein diet in weaned lambs [12]. According to previous studies, the fermentation parameters in the rumen, especially butyrate concentration promoted rumen papillae growth in ruminants [13]. In the present study, the papillae length, papillae width and muscular layer of the rumen were significantly affected by the dietary protein levels. With the increase of the dietary protein level, the development of rumen papillae increased. It speculated that the apparent digestibility of nutrient in high protein diet was higher than for low protein diet [14], and then altered rumen fermentation, which contributing to development of rumen papillae. Effects of dietary protein level on antioxidant properties of rumen tissue The equilibrium between oxidation and antioxidation is crucial for maintaining balanced redox homeostasis [15]. For ruminant, the ruminal epithelium predispose to oxidative stress due to oxidants produced endogenously by active oxidative metabolism [16]. The excess free radicals in ruminal epithelium are removed by antioxidant enzymes (e.g., GSH-Px, T-AOC, SOD, and CAT) [17]. The T-AOC reflects the compensatory ability of the antioxidant enzyme system to external stimulation and the metabolism state of free radicals [18]. In the present study, the T-AOC activity has increased significantly as the dietary crude protein level increased from 10.20% to 11.58%. Our result was consistent with Chen et al. (2023) findings, in which a higher T-AOC activity was observed when increased dietary crude protein level from 44% to 49% [19]. Via transforming the superoxide radicals into H 2 O 2 , the SOD is the first line of defense against excessive oxidative radicals [20]. Our results showed that the SOD activity was significantly increased with increase in the proportion of dietary crude protein. A similar result was observed by Liu et al., (2023) who found that diets supplemented with the 20% crude protein level increased the plasma CAT activity compared with the 12% crude protein levels [21]. It was a reasonable explanation that the inadequate protein nutrition can decrease the production of antioxidant enzymes, while lambs are sensitive to a diet with low crude protein levels. Effects of dietary protein level on immune response of rumen tissue Although no significant difference was observed in the immune response of rumen tissue, dietary crude protein increase tended to promoted the activities of IgA, IgG and IgM, while opposite trend was seen for the activity of TNF-α. In the plasma parameters of yak, the activities of IgA, IgG and IgM was lesser when fed the high-protein diet, whereas the activity of TNF-α was greater than that of the low-protein diet in yak [22]. The family of Igs including IgA, IgG, and IgM, were important non-specific immune factors, which participated in activation of the complement system and the enhancement of immunity [23]. Additionally, the TNF-α is one of the important potent inducer of pro-inflammatory cytokines that promoted cell proliferation and indirectly inhibits apoptosis through the induction of NF-кB [24]. In this study, the activity of TNF-α was reduced, and the activities of IgA, IgG and IgM were elevated, which indicated that the Tibetan sheep in the high-protein diet exhibited a stronger humoral and cellular immunity function. Effects of dietary protein level on gene expression of rumen tissue There were several metabolism-related pathways in the 33 significant KEGG pathways. Both protein digestion and absorption, and carbon metabolism pathways were essential for regulating the synthesis and transformation of protein and carbohydrate to maintain the balance of cell energy metabolism [25, 26]. The fatty acid biosynthesis metabolism pathway was the process by which the body converts acetyl-CoA and malonyl-CoA into fatty acids [27]. The nicotinate and nicotinamide were precursors of the coenzymes nicotinamide-adenine dinucleotide (NAD + ) and were involved in tricarboxylic acid cycle [28]. Furthermore, the glutathione metabolism pathway was implicated closely in regulating the synthesis of proteins and nucleic acids, as well as maintenance of tissue antioxidant defenses [29]. Our results suggested that the different pathways mainly enriched in nutrition metabolism, which explained the reason of increasing dietary crude protein level improved the growth performance and nutrient utilization in ruminant [30]. Eleven of these DEGs, including two fatty acid biosynthesis-related genes ( ACACB and ACSF3 ), seven nutrition metabolism-related genes ( ATP1B1 , SLC5A1 , IDH2 , ATP1A2 , NT5E and NNT ) and three muscle development-related genes ( MYH11 , KCNMA1 and MYL9 ). Correlation analysis revealed a positive correlation between ACACB and T-AOC, ACSF3 and T-AOC, IgG. For the fatty acid biosynthesis-related genes, the ACACB catalyzed the carboxylation of acetyl-CoA to malonyl-CoA, a major precursor of fatty acid synthesis [31]. The ACACB was involved in mitochondrial fatty acid (FA) oxidation and FA biosynthesis, which ubiquitously expressed in various developments of tissues, especially in heart, liver, and skeletal muscle [32]. ACACB -knockout mice exhibited insulin sensitivity, conferring protective effects against obesity and diabetes [33]. As an essential enzyme, the ACSF3 performed the first step of mitochondrial fatty acid synthesis II and activated fatty acids, served as the substrate for both de novo fatty acid synthesis and oxidation [34]. Deletion of SIRT3 causes altered expression of ACSF3 , leading to govern the capacity of ACSF3 to mediate fatty acid metabolism disorder [35]. The up-regulated expression of their transcripts in respond to increasing dietary protein levels may reflect the increase for fatty acids synthesis in rumen. Moreover, three genes identified as MYH11 , KCNMA1 and MYL9 were associated with muscle development. MYH11 , a member of the myosin family, encoded the smooth muscle myosin heavy chain ( SMMHC ) and modulated the maturely differentiated SMCs in visceral tissues [36]. Overexpression of Protein inhibitor of activated STAT restrained proliferation and migration in vascular smooth muscle via promoting the expression of MYH11 [37]. Down-regulation of the long noncoding RNAMBNL1-AS1 increased the expression of KCNMA1 , thereby regulating the proliferation and apoptosis in skeletal muscle cells via activation of the cGMP-PKG signaling pathway [38]. MYL9 played important roles in cytoskeletal dynamics and experimental metastasis by regulating the actomyosin contractility and stress fiber assembly [39]. Annotated DEGs in the rumen tissues of Tibetan sheep with high and low crude protein levels were compared. A number of potential functional candidate genes were screened through transcriptomic sequencing analysis. However, further research is needed to define those mechanisms and the optimal crude protein required to promote rumen papillae development. Conclusion In conclusion, the present study demonstrated that the different crude protein levels diet induced changes in the antioxidant activity, immunocompetence and the structural properties of the rumen tissue. Our findings show that diet containing 11.58% crude protein contributed to development of rumen papillae, and improved the antioxidant properties when compared to dietary 10.20% crude protein. The functional analysis of DEGs suggested that genes related to fatty acid biosynthesis, nutrition metabolism and muscle development were associated with rumen development. The identified genes and signaling pathways play an essential role in affecting the rumen tissue, and further studies should be performed to elucidate the mechanisms. Materials And Methods Experimental Design The experiment was conducted with 2-month-old weaned lamb (initial live weight of 15.40±0.81 Kg). A total of sixty lamb were divided into two treatments (n = 30). Diets were formulated to be isoenergetic and contained 2 levels of CP (10.20% and 11.58% of dry matter). The experiment adopted a single-factor randomized block design. This trail continued for 97 days, 7 of which were the adaptive period and 90 of which comprised the test feeding period. Throughout the experiment, lambs were fed a total mixed ration (TMR) of 70% concentration and 30% forage on a dry matter basis. Dietary dry matter (DM), CP, and ether extract (EE) were measured using the method described in a previous study. Acid detergent fiber (ADF) and neutral detergent fiber (NDF) were examined as described by Van Soest et al. The value of net energy (DE) was calculated. The ingredients and nutrient compositions of diets were presented in Table 2 . Diets and fresh drinking water were offered ad libitum. Table 2 Ration composition and nutrient levels (dry matter basis) % Items Group 1 Group L Group H Ingredient Oat hay 15.00 15.00 Oat silage 15.00 15.00 Corn 37.10 32.20 Wheat 7.70 7.70 Soybean meal 0.70 1.40 Rapeseed meal 7.00 11.20 Cottonseed meal 0.70 0.70 Maize germ meal 0.70 0.70 Palm meal 11.20 11.20 NaCl 0.60 0.68 Limestone 0.70 0.70 Baking soda 0.07 0.07 Premix 2 0.42 0.42 Lys 2.52 2.52 Met 0.48 0.39 Total 0.11 0.13 Nutrient levels 3 100.00 100.00 DE/(MJ·kg - 1 ) 9.66 9.56 Crude protein 10.20 11.58 Ether extract 3.40 3.36 Neutral detergent fiber 32.82 33.03 Acid detergent fiber 15.04 15.43 Ca 0.95 0.99 P 0.55 0.57 1 The protein level in the L group was 10.20%, while the protein level in the M group was 11.58%. 2 The premix provided the following per kg of diets: Cu 18 mg, Fe 66 mg, Zn 30 mg, Mn 48 mg, Se 0.36 mg, I 0.6 mg, Co 0.24 mg, VA 24 000 IU,VD 4 800 IU,VE 48 IU. 3 Digestible energy is calculated and the rest are measured. Sample Collection At the end of the experiment, five sheep from each group were selected randomly for slaughter at a commercial slaughterhouse. The rumen tissue of Tibetan sheep was collected immediately after slaughter. Approximately 1.5 cm 2 of rumen tissue were taken and placed immediately into liquid nitrogen for RNA extraction, while the remaining tissue were fixed in 4% paraformaldehyde for tissue sectioning. HE staining After fixation in 4% paraformaldehyde for 48 h, rumen tissue was dehydrated gradually by ethyl alcohol (Hailun, Changsha, China), and then successively embedded in paraffin wax (Sangon, Shanghai, China) and sliced into thick sections by the mounting onto poly-L-lysine-coated glass slides (Hailun, Changsha, China). Those slides were stained with with eosin for 3 min. The rumen papilla length, papilla width, muscular thickness, and stratum corneum thickness in images were measured using the Image-Pro Plus 5.1 software (Media Cybernetics Inc., Bethesda, MD, USA). Enzyme linked immunosorbent assay (Elisa) Both antioxidant and immunity of rumen were determined using the Elisa kit (Meibiao Biotechnology Co., Ltd, Jiangsu, China). In brief, 0.1 g of rumen tissue with 900 μL of phosphate buffered saline (Hailun, Changsha, China) were centrifuged at 3,000 × g at 4°C for 20 min. The supernatant fluid was collected and filtered through a 0.22-μm membrane. Transcriptome analysis Total RNA was extracted from rumen following the instructions of the RNA Extraction Kit (Invitrogen, Carlsbad, CA, USA). The integrity and purity of RNA were determined by Agilent Bioanalyzer 4150 (Agilent Technologies, CA, USA) and Nanodrop ND-2000 (Thermo Scientific, USA), respectively. After verifying and quantifying the cDNA, the libraries were sequenced on the Illumina HiSeq 4000 platform. The original sequencing data with low-quality reads were filtered using SOAPnuke (https://github.com/BGI-flexlab/SOAPnuke). The HISAT2 (V2.04) was applied to map the clean reads to the sheep reference genome of Ovis aries (Oar_v3.1). Differential expression analyses were carried out to identify differentially expressed gene between different samples. EdgeR was used to normalize the data and extract DEGs with FDR 1.2. The analyses of GO and KEGG were used to classify the DEGs based on the specific biological functions using DESeq2 software package [40]. Real-Time Quantitative PCR (qRT-PCR) Analysis Five genes were randomly selected for qRT-PCR to verify the accuracy of the transcriptome sequencing data. The total RNA isolated from rumen tissue was reverse transcribed into cDNA using a PrimeScript TM RT reagent kit (TaKaRa, China). The qRT-PCR was performed with the SYBR ® Premix Ex TaqTM kit (TaKaRa, China) in triplicate. The relative gene expression of the mRNAs was calculated using the 2 −ΔΔCt method. Primers sequences were designed at Online primer design (Bioengineering Co. LTD, Shanghai, China) ( Table 3 ). Table 3 Primer sequences of the differentially expressed genes (DEGs) for real-time polymerase chain reaction (PCR) analysis. Name Primer sequence (5’-3’) Tm (℃) Product length MYL9 F:TGTGATCCGCAACGCCTTCG R:TGTGATCCGCAACGCCTTCG 60.0 127bp KCNMA1 F:CAGGCGGATGGCACTCTCAAG R:CCCAGTCTTTCACGGAGGTCATC 60.0 88bp MYH11 F:AGCCAGAGACGAGAGGACCTTC R:AAGCCGTTGGAGAGGAATGTGTAG 60.0 120bp NNT F:TACGGATGCGGCAGCCAATC R:TAGGCAACCAAAGACCCACTGAAG 60.0 90bp NT5E F:CCATTCTTCTCAACAGCAGCATCC R:GAGCGGTGCCATCCAGATAGAC 60.0 132bp IDH2 F:GGAGATGGACGGCGATGAGATG R:TCATTGGTCTGGTCACGGTTCG 60.0 129bp ATP1B1 F:TACGGCTACAAAGAGGGCAAACC R:TGAACAGGCAGGACATACGGATTG 60.0 137bp ACSF3 F:ACCACACGTACAAGGACCTCTATTC R:AAGGAGACATCGTTGGAGCACAG 60.0 130bp ACACB F:GAGACAAGATCGCCTCCACCATC R:CACTCCACCGTCAGACCACTTC 60.0 85bp Ethics statement The experimental animals used in this study were Tibetan sheep of the Qinghai Plateau type in China, located at the Tibetan sheep experimental base in Haiyan County, Haibei Prefecture, Qinghai Province. Animal care and experimental protocols were approved (QUA-2020-0710) by the Institutional Animal Care and Use Committee of the Qinghai University, China. Statistical Analysis The difference of the histomorphology, Elisa data and mRNA expression between two groups was evaluated using two-tailed Student’s t -test with SPSS software (V19.0). Results are presented as the mean values ± standard error of the measurement (SEM). P value < 0.05 was considered statistically significant. Declarations Authors' contributions ZLW analyzed and explained the transcriptome data of the rumen of Tibetan sheep. ZLW and FSZ performed H.E. staining and measurement on the rumen. Perform Elisa testing on antioxidant and immune levels in rumen tissue using ZLW, FSZ, and QRJ. ZLW, QYAMS, KNZ, and YZ confirmed gene expression through RT-qPCR. ZLW, ZYW, and LSG are the main contributors to manuscript writing. LSG and SZH provided financial support for this experiment. All authors have read and agreed to the published version of the manuscript. Funding The current work was funded by Construction of Standardized Production System for Improving quality and efficiency of Tibetan sheep industry (2022-NK-169). Data availability statement Sequence data that support the findings of this study have been deposited in the European Nucleotide Archive with the primary accession code PRJNA1077743. Conflicts of interest No conflict of interest existed in the submission of this manuscript, and manuscript was approved by all authors for publication. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Zhou L, Raza SHA, Gao Z, Hou S, Alwutayd KM, Aljohani ASM, Abdulmonem WA, Alghsham RS, Aloufi BH, Wang Z et al : Fat deposition, fatty acid profiles, antioxidant capacity and differentially expressed genes in subcutaneous fat of Tibetan sheep fed wheat-based diets with and without xylanase supplementation . Journal of animal physiology and animal nutrition 2024, 108 (1):252-263. Sun Y, Angerer J, Hou FJTRJ: Effects of grazing systems on herbage mass and liveweight gain of Tibetan sheep in Eastern Qinghai-Tibetan Plateau, China . 2015, 37 (2):181-190. Cui X, Wang Z, Guo P, Li F, Chang S, Yan T, Zheng H, Hou F: Shift of Feeding Strategies from Grazing to Different Forage Feeds Reshapes the Rumen Microbiota To Improve the Ability of Tibetan Sheep (Ovis aries) To Adapt to the Cold Season . Microbiology spectrum 2023, 11 (2):e0281622. Shabat SK, Sasson G, Doron-Faigenboim A, Durman T, Yaacoby S, Berg Miller ME, White BA, Shterzer N, Mizrahi I: Specific microbiome-dependent mechanisms underlie the energy harvest efficiency of ruminants . The ISME journal 2016, 10 (12):2958-2972. Li F, Guan LL: Metatranscriptomic Profiling Reveals Linkages between the Active Rumen Microbiome and Feed Efficiency in Beef Cattle . Applied and environmental microbiology 2017, 83 (9). Wei X, Wu H, Wang Z, Zhu J, Wang W, Wang J, Wang Y, Wang C: Rumen-protected lysine supplementation improved amino acid balance, nitrogen utilization and altered hindgut microbiota of dairy cows . Animal nutrition (Zhongguo xu mu shou yi xue hui) 2023, 15 :320-331. Shahid AB, Malhi M, Soomro SA, Shah MG, Sanjrani MNJPJoZ: Influence of Dietary Selenium Yeast Supplementation on Fermentation Pattern, Papillae Morphology and Antioxidant Status in Rumen of Goat . 2020, 52 (2). Malhi M, Gui H, Yao L, Aschenbach JRR, G?Bel G, Shen ZJJoDS: Increased papillae growth and enhanced short-chain fatty acid absorption in the rumen of goats are associated with transient increases in cyclin D1 expression after ruminal butyrate infusion . 2013, 96 (12):7603-7616. Zhang N, Zhang H, Ding J, Wang L, Wei Y, Xiang Y: Effects of excessive urea on rumen morphology and microbiota in Jianzhou Da'er goat (Capra hircus) . Research in veterinary science 2022, 153 :1-7. Xia C, Aziz Ur Rahman M, Yang H, Shao T, Qiu Q, Su H, Cao B: Effect of increased dietary crude protein levels on production performance, nitrogen utilisation, blood metabolites and ruminal fermentation of Holstein bulls . Asian-Australasian journal of animal sciences 2018, 31 (10):1643-1653. Saro C, Mateo J, Caro I, Carballo DE, Fernández M, Valdés C, Bodas R, Giráldez FJ: Effect of Dietary Crude Protein on Animal Performance, Blood Biochemistry Profile, Ruminal Fermentation Parameters and Carcass and Meat Quality of Heavy Fattening Assaf Lambs . Animals : an open access journal from MDPI 2020, 10 (11). Lv X, Cui K, Qi M, Wang S, Diao Q, Zhang N: Ruminal Microbiota and Fermentation in Response to Dietary Protein and Energy Levels in Weaned Lambs . Animals : an open access journal from MDPI 2020, 10 (1). Liu L, Sun D, Mao S, Zhu W, Liu J: Infusion of sodium butyrate promotes rumen papillae growth and enhances expression of genes related to rumen epithelial VFA uptake and metabolism in neonatal twin lambs . Journal of animal science 2019, 97 (2):909-921. Piccioli-Cappelli F, Loor JJ, Seal CJ, Minuti A, Trevisi E: Effect of dietary starch level and high rumen-undegradable protein on endocrine-metabolic status, milk yield, and milk composition in dairy cows during early and late lactation . Journal of dairy science 2014, 97 (12):7788-7803. Jun, Wang, Houguo, Xu, Rantao, Zuo, Kangsen, Mai, Wei, nutrition QJTBjo: Effects of oxidised dietary fish oil and high-dose vitamin E supplementation on growth performance, feed utilisation and antioxidant defence enzyme activities of juvenile large yellow croaker (Larmichthys crocea) . 2016. Steele MA, Dionissopoulos L, AlZahal O, Doelman J, McBride BW: Rumen epithelial adaptation to ruminal acidosis in lactating cattle involves the coordinated expression of insulin-like growth factor-binding proteins and a cholesterolgenic enzyme . Journal of dairy science 2012, 95 (1):318-327. Schogor AL, Palin MF, Santos GT, Benchaar C, Lacasse P, Petit HV: Mammary gene expression and activity of antioxidant enzymes and oxidative indicators in the blood, milk, mammary tissue and ruminal fluid of dairy cows fed flax meal . The British journal of nutrition 2013, 110 (10):1743-1750. Li X, Chen S, Li JE, Wang N, Liu X, An Q, Ye XM, Zhao ZT, Zhao M, Han Y et al : Chemical Composition and Antioxidant Activities of Polysaccharides from Yingshan Cloud Mist Tea . Oxidative medicine and cellular longevity 2019, 2019 :1915967. Chen YF, Cao KL, Huang HF, Li XQ, Leng XJ: Dietary Effects of Lipid and Protein Levels on Growth, Feed Utilization, Lipid Metabolism, and Antioxidant Capacity of Triploid Rainbow Trout (Oncorhynchus mykiss) . Aquaculture nutrition 2023, 2023 :8325440. Bai K, Feng C, Jiang L, Zhang L, Zhang J, Zhang L, Wang T: Dietary effects of Bacillus subtilis fmbj on growth performance, small intestinal morphology, and its antioxidant capacity of broilers . Poultry science 2018, 97 (7):2312-2321. Liu Y, Azad MAK, Zhao X, Zhu Q, Kong X: Dietary Protein Levels Modulate the Antioxidant Capacity during Different Growth Stages in Huanjiang Mini-Pigs . Antioxidants (Basel, Switzerland) 2023, 12 (1). Zhu Y, Sun G, Dunzhu L, Li X, Zhaxi L, Zhaxi S, Suolang, Ciyang, Yangji C, Wangdui B et al : Effects of Different Dietary Protein Level on Growth Performance, Rumen Fermentation Characteristics and Plasma Metabolomics Profile of Growing Yak in the Cold Season . Animals : an open access journal from MDPI 2023, 13 (3). Kumar N, Garg AK, Mudgal V, Dass RS, Chaturvedi VK, Varshney VP: Effect of different levels of selenium supplementation on growth rate, nutrient utilization, blood metabolic profile, and immune response in lambs . Biological trace element research 2008, 126 Suppl 1 :S44-56. Martins GR, Gelaleti GB, Moschetta MG, Maschio-Signorini LB, Zuccari DA: Proinflammatory and Anti-Inflammatory Cytokines Mediated by NF-κB Factor as Prognostic Markers in Mammary Tumors . Mediators of inflammation 2016, 2016 :9512743. Coleman DN, Alharthi AS, Liang Y, Lopes MG, Lopreiato V, Vailati-Riboni M, Loor JJ: Multifaceted role of one-carbon metabolism on immunometabolic control and growth during pregnancy, lactation and the neonatal period in dairy cattle . Journal of animal science and biotechnology 2021, 12 (1):27. Santana Luz AB, de Araújo Costa RO, de Medeiros G, Piuvezam G, Passos TS, de Araújo Morais AH: What are the digestion and absorption models used to reproduce gastrointestinal protein processes?: A protocol for systematic review . Medicine 2021, 100 (30):e26697. Morrish F, Noonan J, Perez-Olsen C, Gafken PR, Fitzgibbon M, Kelleher J, VanGilst M, Hockenbery D: Myc-dependent mitochondrial generation of acetyl-CoA contributes to fatty acid biosynthesis and histone acetylation during cell cycle entry . The Journal of biological chemistry 2010, 285 (47):36267-36274. Du F, Zou Y, Hu Q, Jing Y, Yang X: Metabolic Profiling of Pleurotus tuoliensis During Mycelium Physiological Maturation and Exploration on a Potential Indicator of Mycelial Maturation . Frontiers in microbiology 2018, 9 :3274. Dong XQ, Chu LK, Cao X, Xiong QW, Mao YM, Chen CH, Bi YL, Liu J, Yan XM: Glutathione metabolism rewiring protects renal tubule cells against cisplatin-induced apoptosis and ferroptosis . Redox report : communications in free radical research 2023, 28 (1):2152607. Liu QW, C.Li, H. Q.Guo, G.Huo, W. J.Zhang, S. L.Zhang, Y. L.Pei, C. A.Wang, H. %J Journal of Animal, Sciences F: Effects of dietary protein level and rumen-protected pantothenate on nutrient digestibility, nitrogen balance, blood metabolites and growth performance in beef calves . 2018, 27 (3). Zhu C, Qi Y, Wang X, Mi B, Cui C, Chen S, Zhao Z, Zhao F, Liu X, Wang J et al : Variation in Acetyl-CoA Carboxylase Beta Gene and Its Effect on Carcass and Meat Traits in Gannan Yaks . International journal of molecular sciences 2023, 24 (20). Zain M, Awan FR, Najam SS, Islam M, Khan AR, Bilal A, Bellili N, Marre M, Roussel R, Fumeron FJMG: Association of ACACB gene polymorphism (rs2268388, G>A) with type 2 diabetes and end stage renal disease in Pakistani Punjabi population . 2017, 12 :109-112. Abu-Elheiga, Lutfi, Oh W, Kordari, Parichher, Wakil, Salih JJPotNAoSotUSoA: Acetyl-CoA carboxylase 2 mutant mice are protected against obesity and diabetes induced by high-fat/high-carbohydrate diets . 2003. He W, Fang X, Lu X, Liu Y, Li G, Zhao Z, Li J, Yang R: Function Identification of Bovine ACSF3 Gene and Its Association With Lipid Metabolism Traits in Beef Cattle . Frontiers in veterinary science 2021, 8 :766765. Sun R, Kang X, Zhao Y, Wang Z, Wang R, Fu R, Li Y, Hu Y, Wang Z, Shan W et al : Sirtuin 3-mediated deacetylation of acyl-CoA synthetase family member 3 by protocatechuic acid attenuates non-alcoholic fatty liver disease . British journal of pharmacology 2020, 177 (18):4166-4180. Miano JM, Cserjesi P, Ligon KL, Periasamy M, Olson EN: Smooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis . Circulation research 1994, 75 (5):803-812. Liu H, Zhang J, Xue Z, Chang M, Feng X, Cai Y, Bai L, Wang W, Liu E, Zhao S et al : Deficiency of protein inhibitor of activated STAT3 exacerbates atherosclerosis by modulating VSMC phenotypic switching . Atherosclerosis 2023, 380 :117195. Xue-Feng L, Zong-Qiang W, Long-Yun L, Guo-Qing Z, Shao-Nan YJE, Medicine M: Downregulation of the long noncoding RNA MBNL1-AS1 protects sevoflurane-pretreated mice against ischemia-reperfusion injury by targeting KCNMA1 . 2018, 50 (9):115-. Licht AH, Nübel T, Feldner A, Jurisch-Yaksi N, Schorpp-Kistner MJJoCI: Junb regulates arterial contraction capacity, cellular contractility, and motility via its target Myl9 in mice . 2010, 120 (7):2307. Young MD, Wakefield MJ, Smyth GK, Oshlack A: Gene ontology analysis for RNA-seq: accounting for selection bias . Genome biology 2010, 11 (2):R14. Additional Declarations Competing interest reported. No conflict of interest existed in the submission of this manuscript, and manuscript was approved by all authors for publication. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3966713","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":280323647,"identity":"087b884b-4365-438e-b345-59564f4c1ded","order_by":0,"name":"Zhenling Wu","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Zhenling","middleName":"","lastName":"Wu","suffix":""},{"id":280323648,"identity":"65131580-e930-4aa6-9d7c-af620828e2d7","order_by":1,"name":"Fengshuo Zhang","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Fengshuo","middleName":"","lastName":"Zhang","suffix":""},{"id":280323649,"identity":"f2e28aef-4a1e-4a04-a3a7-66445032a53b","order_by":2,"name":"Quyangangmao Su","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Quyangangmao","middleName":"","lastName":"Su","suffix":""},{"id":280323650,"identity":"33ba96c8-9397-4686-adfb-abaf8931f9c5","order_by":3,"name":"Qiurong Ji","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Qiurong","middleName":"","lastName":"Ji","suffix":""},{"id":280323652,"identity":"5608f02d-7f4b-4b45-a2a6-257ddc5573fc","order_by":4,"name":"Kaina Zhu","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Kaina","middleName":"","lastName":"Zhu","suffix":""},{"id":280323653,"identity":"c373c2c8-84e1-4919-88f9-1a839e0a99ba","order_by":5,"name":"Yu Zhang","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Zhang","suffix":""},{"id":280323656,"identity":"585a5401-9b6a-4818-ba2b-1d3707a6776c","order_by":6,"name":"Zhiyou Wang","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Zhiyou","middleName":"","lastName":"Wang","suffix":""},{"id":280323657,"identity":"4be53e71-e218-4c3c-8326-cb8638ce6e7a","order_by":7,"name":"Shengzhen Hou","email":"","orcid":"","institution":"Qinghai University","correspondingAuthor":false,"prefix":"","firstName":"Shengzhen","middleName":"","lastName":"Hou","suffix":""},{"id":280323658,"identity":"04713820-eec6-49e1-baf1-b4661f13047d","order_by":8,"name":"Linsheng Gui","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIiWNgGAWjYFACxsYDCQwMCSDmgQ8/2OTY2NsPENLSANPCeHBmD58xH8+ZBIL2gAwFqWI+zMMmlzhPwsEAr3L5iOSGAw931OXxS7dfOMDDY5beJgHU/6NiG04thjcSGw4knjlcLDnnTMEBCYu03DbpxgOMPWdu49YyA6Sl7UDihhs5CQcMeI7ltskcSGBmbCOopS5xP0hLAtv/dDaJBAO8WuQlwFqYEzdIpB84cICNLYGgFgOehyAthxNn3MhhONjYw2bYBgzkg/j8It+e/vDhT6DD+mekP/785webvHx7+8EHPyrw2HIAzuRBRMcBTIVItjTAmewP8CkcBaNgFIyCEQwAUsBnbo4Yt+kAAAAASUVORK5CYII=","orcid":"","institution":"Qinghai University","correspondingAuthor":true,"prefix":"","firstName":"Linsheng","middleName":"","lastName":"Gui","suffix":""}],"badges":[],"createdAt":"2024-02-18 10:49:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3966713/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3966713/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53003039,"identity":"c74a4bf6-417d-46c7-89bb-8dd5c2136de4","added_by":"auto","created_at":"2024-03-19 14:43:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1331957,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/2df705b780204d0b282a8329.png"},{"id":53003052,"identity":"add033ce-b607-43b0-bd70-12b7981a4ba3","added_by":"auto","created_at":"2024-03-19 14:43:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":224231,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/b64b1e3cdbeb82a9ddf90115.png"},{"id":53003049,"identity":"bcaa15eb-c470-4772-a8c3-316f3d507612","added_by":"auto","created_at":"2024-03-19 14:43:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":318285,"visible":true,"origin":"","legend":"\u003cp\u003eA: Principal component analysis between samples. B: Venn diagram of genes expressed in the rumen of Low and high protein groups. C: DEGs cluster analysis. D: Volcano map of DEGs.Up, up-regulated DEGs; Down, down-regulated DEGs.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/f5d2fb79204fd60b53443a1f.png"},{"id":53003051,"identity":"55d86935-c6a7-4947-a84c-433608a93a72","added_by":"auto","created_at":"2024-03-19 14:43:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":190338,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/bcfe067722a763871b8b2a44.png"},{"id":53003046,"identity":"bc32d4a2-1d48-4975-a2bc-d88e1152dcd5","added_by":"auto","created_at":"2024-03-19 14:43:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":396304,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/6b1f75543153b6eeeaed3b4f.png"},{"id":53003050,"identity":"bd0c6203-5f59-408f-9fb3-ba7fa63ee355","added_by":"auto","created_at":"2024-03-19 14:43:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1232881,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/4e57252e11718b63e472ca43.png"},{"id":53779278,"identity":"79c98f02-9055-41b5-8f1b-5f9b18140a66","added_by":"auto","created_at":"2024-03-30 10:24:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4116579,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3966713/v1/8ac7721f-38de-49fe-9edd-bf194b1dc2b7.pdf"}],"financialInterests":"Competing interest reported. No conflict of interest existed in the submission of this manuscript, and manuscript was approved by all authors for publication.","formattedTitle":"Effects of dietary crude protein on antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep (Ovis aries), as determined by transcriptomic analysis","fulltext":[{"header":"Background","content":"\u003cp\u003eThe Tibetan sheep (\u003cem\u003eOvis aries\u003c/em\u003e) is predominantly distributed in the Qinghai-Tibet Plateau with an altitude of over 3000 m, which provision various aspects such as the meat, hides and milk\u0026nbsp;[1]. Additionally, the Tibetan sheep plays a crucial role in maintaining the balance of the natural ecosystems in the Qinghai-Tibetan plateau\u0026nbsp;[2]. In recent years, with the orderly advancement of grassland eco-pastoralism, the feeding mode of Tibetan sheep has gradually changed from traditional natural grazing to drylot\u0026nbsp;feeding\u0026nbsp;[3].\u0026nbsp;Because of influence of low temperature and hypoxia, the energy requirement of Tibetan sheep is more important than that of protein in normal metabolism. Therefore, the current research mainly focuses on the effect of dietary energy level on Tibetan sheep, and there are few studies on the effect of dietary protein level on Tibetan sheep.\u003c/p\u003e\n\u003cp\u003eThe rumen is a balanced ecosystem harboring a variety of microorganisms (i.e., bacteria, fungi, and protozoa), bacteria being the most abundant\u0026nbsp;[4]. Due to the microbial interactions, the crude fibers were converted into volatile fatty acids by fermentation process and then met 70% of the energy needs of the host\u0026nbsp;[5]. Notably, both rumen microbe and rumen phenotype were directly affected by the dietary nutrient level\u0026nbsp;[6]. Therefore, understanding the nutritional requirement, especially dietary protein levels forms a basis for improving productivity in Tibetan sheep.\u003c/p\u003e\n\u003cp\u003eIt is hypothesized that diets with different protein levels could change functional gene expression, thereafter affecting the response of immunity and development of epithelial papillae in rumen. Therefore, this study aimed to explore the impact of dietary protein levels on the antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep. In addition, the impact of different protein level diets on the mRNA expression of rumen was evaluated.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eHistological analysis of the rumen\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResults of H.E. staining of rumen tissue sections were presented in \u003cstrong\u003eFigure 1A\u003c/strong\u003e. The papillae length in the L group was significantly shorter than that in the H group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). Both papillae width and muscular layer of H group was significantly wider than in the L group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). No obvious difference was observed in the stratum corneum between the groups (\u003cstrong\u003eFigure 1B\u003c/strong\u003e, \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntioxidant and immune response index assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in \u003cstrong\u003eFigure 2A\u003c/strong\u003e, the activities of T-AOC and SOD in rumen of H group were significantly higher than those of L group\u0026nbsp;(\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). There was no significant difference in CAT, GSH-Px activity and MDA content in rumen fluid between the two groups (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05). Although the difference was not significant, there was an increased tendency of IgA, IgM, IgG, IL-6, and IL-1\u0026beta; in the H group than the L group (\u003cstrong\u003eFigure 2B\u003c/strong\u003e, \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA-Seq and Mapping\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e showed the basic statistics for RNA-seq reads generated from the rumen of Tibetan sheep. A total of 390.63 million raw reads were obtained through sequencing in ten samples. After quality control, an average of 65.01 million clean reads was generated (64.04 million for H group and 65.97 million for L group). For all samples, the percent of clean reads was 99.85%. The Q30 values were between 94.01% and 96.75%. Average of 96.71% of the clean reads was mapped to the \u003cem\u003eOvis aries\u003c/em\u003e reference genome (H group with 97.52%, L group with 95.91%).\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"https://myfiles.space/user_files/122228_c8a1650c59388082/122228_custom_files/img1710852429.png\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalysis of Gene Expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVenn diagram showed that there were 1706 and 893 differentially expressed genes (DEGs) belonging to this item in treatment and control DEG datasets, respectively, and they shared 14,458 DEGs as the intersection (\u003cstrong\u003eFigure 3A\u003c/strong\u003e). According to the gene expression values (FPKM), the principal component analysis (PCA) exhibited that H group and L group was separated into two different groups (\u003cstrong\u003eFigure 3B\u003c/strong\u003e). Hierarchical clustering analysis of the DEGs showed that the same group of DEGs was clustered together, indicating the accuracy and reliability of samples (\u003cstrong\u003eFigure 3C\u003c/strong\u003e). A total of 612 significant DEGs (based on |(fold change)| \u0026gt; 1.2, \u003cem\u003eP\u003c/em\u003e-value \u0026lt; 0.05, and false discovery rate (FDR) \u0026lt; 0.05) were found in response to dietary CP level. Of these genes, 20 were up-regulated and 426 were down-regulated in the H group (\u003cstrong\u003eFigure 3D\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnrichment Analysis of DEGs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene ontology (GO) enrichment analyses were carried out using the database for annotation, visualization and integrated discovery software (https://david.ncifcrf.gov) (\u003cstrong\u003eFigure 4A\u003c/strong\u003e). A total of 573 significantly enriched GO terms were annotated within three major function groups: biological process (BP, 354), cellular component (CC, 95), and molecular function (MF, 124). For the down-regulated terms, the most significant GO categories observed were perikaryon, long-chain fatty-acyl-CoA catabolic process, and endoplasmic reticulum polarization. For the up-regulated terms, the most significant GO categories observed were potassium ion homeostasis, muscle contraction, and cell periphery.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBased on Kyoto Encyciopedia of Genes and Genome (KEGG) pathway enrichment analysis, 33 KEGG pathways were significantly (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) enriched in the rumen tissue (\u003cstrong\u003eFigure 4B\u003c/strong\u003e). The top five pathways with the most representation of DEGs were retinol metabolism (13 DEGs), metabolic pathways (56 DEGs), ECM-receptor interaction (8 DEGs), focal adhesion (12 DEGs), and protein digestion and absorption (8 DEGs). Compared to the L group, 13 differentially nutrition metabolism-related signaling pathway (i. e., protein digestion and absorption, nicotinate and nicotinamide metabolism, glutathione metabolism, carbon metabolism, and fatty acid biosynthesis) were identified in H group.\u003c/p\u003e\n\u003cp\u003eNine significant DEGs, identified from the RNA-seq data, were randomly selected for RT-qPCR validation, including two fatty acid biosynthesis-related genes (\u003cem\u003eACACB\u003c/em\u003e and \u003cem\u003eACSF3\u003c/em\u003e), seven nutrition metabolism-related genes (\u003cem\u003eATP1B1\u003c/em\u003e, \u003cem\u003eIDH2\u003c/em\u003e, \u003cem\u003eNT5E\u003c/em\u003e and \u003cem\u003eNNT\u003c/em\u003e) and three muscle development-related genes (\u003cem\u003eMYH11\u003c/em\u003e, \u003cem\u003eKCNMA1\u003c/em\u003e and \u003cem\u003eMYL9\u003c/em\u003e). The RT-qPCR confirmed that the DEGs exhibited the same pattern of expression as observed with the RNA-seq (\u003cstrong\u003eFigure 5\u003c/strong\u003e), indicating our transcriptomic analysis was highly credible.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrelation analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrelation analysis (\u003cstrong\u003eFigure 6\u003c/strong\u003e) showed that T-AOC was positively correlated (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) with \u003cem\u003eACACB\u003c/em\u003e (0.93), \u003cem\u003eACSF3\u003c/em\u003e (0.94), \u003cem\u003eATP1B1\u003c/em\u003e (0.94), and \u003cem\u003eMYH11\u003c/em\u003e (0.92), and IgG was positively correlated (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) with \u003cem\u003eACSF3\u003c/em\u003e (0.93). T-AOC was positively correlated (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) with \u003cem\u003eIDH2\u003c/em\u003e (0.91), \u003cem\u003eNT5E\u003c/em\u003e (0.86), \u003cem\u003eKCNMA1\u003c/em\u003e (0.91), \u003cem\u003eMYL9\u003c/em\u003e (0.87) were positively correlated (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). IgG was positively correlated with \u003cem\u003eACACB\u003c/em\u003e (0.90), \u003cem\u003eATP1B1\u003c/em\u003e (0.88), \u003cem\u003eIDH2\u003c/em\u003e (0.87), \u003cem\u003eATP1A2\u003c/em\u003e (0.90), \u003cem\u003eMYH11\u003c/em\u003e (0.92), \u003cem\u003eKCNMA1\u003c/em\u003e (0.86) (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). IL-6 was positively correlated (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) with ACACB (0.83), \u003cem\u003eATP1B1\u003c/em\u003e (0.87), \u003cem\u003eIDH2\u003c/em\u003e (0.84), \u003cem\u003eATP1A2\u003c/em\u003e (0.83), \u003cem\u003eMYH11\u003c/em\u003e (0.95), \u003cem\u003eKCNMA1\u003c/em\u003e (0.85), \u003cem\u003eMYL9\u0026nbsp;\u003c/em\u003e(0.84).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003eEffects of dietary protein level on rumen tissue morphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe interior of rumen was lined with stratified epithelium consisting of papillae which provide surface area for short chain fatty acid (SCFA) absorption\u0026nbsp;[7]. Both number and size of papillae were influenced by nutrition intake and the concentrations of SCFA to which they were exposed\u0026nbsp;[8]. Simultaneously, the muscular layer participated in peristalsis of rumen, contributing to the nutrient utilization of ruminant\u0026nbsp;[9]. Previously, Xia et al (2018) reported that with the increase of the dietary crude protein, the acetate, propionate, butyrate and total volatile fatty acid (VFA) concentrations increased in rumen of Holstein bulls\u0026nbsp;[10]. Cristina et al (2022) found that sheep fed a high-protein (173g CP/kg dry matter) diet showed higher acetate, butyrate and VFA concentration compared with those fed a low-protein (134g CP/kg dry matter) diet\u0026nbsp;[11]. A similar result was observed by Lv et al., who observed that the ruminal concentration of butyrate and isobutyrate increased with the high crude protein diet in weaned lambs\u0026nbsp;[12]. According to previous studies, the fermentation parameters in the rumen, especially butyrate concentration promoted rumen papillae growth in ruminants\u0026nbsp;[13]. In the present study, the papillae length, papillae width and muscular layer of the rumen were significantly affected by the dietary protein levels. With the increase of the dietary protein level, the development of rumen papillae increased. It speculated that the apparent digestibility of nutrient in high protein diet was higher than for low protein diet\u0026nbsp;[14], and then altered rumen fermentation, which contributing to development of rumen papillae.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of dietary protein level on antioxidant properties of rumen tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe equilibrium between oxidation and antioxidation is crucial for maintaining balanced redox homeostasis\u0026nbsp;[15]. For ruminant, the ruminal epithelium predispose to oxidative stress due to oxidants produced endogenously by active oxidative metabolism\u0026nbsp;[16]. The excess free radicals in ruminal epithelium are removed by antioxidant enzymes (e.g., GSH-Px,\u0026nbsp;T-AOC, SOD, and CAT)\u0026nbsp;[17]. The T-AOC reflects the compensatory ability of the antioxidant enzyme system to external stimulation and the metabolism state of free radicals\u0026nbsp;[18]. In the present study, the\u0026nbsp;T-AOC\u0026nbsp;activity\u0026nbsp;has increased significantly as the dietary crude protein level increased from 10.20% to 11.58%. Our result was consistent with Chen et al. (2023) findings, in which a higher\u0026nbsp;T-AOC\u0026nbsp;activity was observed when increased dietary crude protein level from 44% to 49%\u0026nbsp;[19]. Via transforming the superoxide radicals into H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, the SOD is the first line of defense against excessive oxidative radicals\u0026nbsp;[20]. Our results showed that the\u0026nbsp;SOD\u0026nbsp;activity was significantly increased with increase in the proportion of dietary crude protein. A similar result was observed by Liu et al., (2023) who found that diets supplemented with the 20% crude protein level increased the plasma CAT activity compared with the 12% crude protein levels\u0026nbsp;[21]. It was a reasonable explanation that the inadequate protein nutrition can decrease the production of antioxidant enzymes, while lambs are sensitive to a diet with low crude protein levels.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of dietary protein level on immune response of rumen tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAlthough no significant difference was observed in the immune response of rumen tissue, dietary crude protein increase tended to promoted the activities of IgA, IgG and IgM, while opposite trend was seen for the activity of TNF-\u0026alpha;. In the plasma parameters of yak, the activities of IgA, IgG and IgM was lesser when fed the high-protein diet, whereas the activity of TNF-\u0026alpha; was greater than that of the low-protein diet in yak\u0026nbsp;[22]. The family of Igs including IgA, IgG, and IgM, were important non-specific immune factors, which participated in activation of the complement system and the enhancement of immunity\u0026nbsp;[23]. Additionally, the TNF-\u0026alpha; is one of the important potent inducer of pro-inflammatory cytokines that promoted cell proliferation and indirectly inhibits apoptosis through the induction of NF-кB\u0026nbsp;[24]. In this study, the activity of TNF-\u0026alpha; was reduced, and the activities of IgA, IgG and IgM were elevated, which indicated that the Tibetan sheep in the high-protein diet exhibited a stronger humoral and cellular immunity function.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of dietary protein level on gene expression of rumen tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere were several metabolism-related pathways in the 33 significant KEGG pathways. Both protein digestion and absorption, and carbon metabolism pathways were essential for regulating the synthesis and transformation of protein and carbohydrate to maintain the balance of cell energy metabolism\u0026nbsp;[25, 26]. The fatty acid biosynthesis metabolism\u0026nbsp;pathway was the process by which the body converts acetyl-CoA and malonyl-CoA into fatty acids\u0026nbsp;[27]. The nicotinate and nicotinamide were precursors of the coenzymes nicotinamide-adenine dinucleotide (NAD\u003csup\u003e+\u003c/sup\u003e) and were involved in tricarboxylic acid cycle\u0026nbsp;[28]. Furthermore, the glutathione metabolism pathway was implicated closely in regulating the synthesis of proteins and nucleic acids, as well as maintenance of tissue antioxidant defenses\u0026nbsp;[29]. Our results suggested that the different pathways mainly enriched in nutrition metabolism, which explained the reason of increasing dietary crude protein level improved the growth performance and nutrient utilization in ruminant\u0026nbsp;[30].\u003c/p\u003e\n\u003cp\u003eEleven of these DEGs, including two fatty acid biosynthesis-related genes (\u003cem\u003eACACB\u003c/em\u003e and \u003cem\u003eACSF3\u003c/em\u003e), seven nutrition metabolism-related genes (\u003cem\u003eATP1B1\u003c/em\u003e, \u003cem\u003eSLC5A1\u003c/em\u003e, \u003cem\u003eIDH2\u003c/em\u003e, \u003cem\u003eATP1A2\u003c/em\u003e, \u003cem\u003eNT5E\u003c/em\u003e and \u003cem\u003eNNT\u003c/em\u003e) and three muscle development-related genes (\u003cem\u003eMYH11\u003c/em\u003e, \u003cem\u003eKCNMA1\u003c/em\u003e and \u003cem\u003eMYL9\u003c/em\u003e). Correlation analysis revealed a positive correlation between \u003cem\u003eACACB\u003c/em\u003e and T-AOC, \u003cem\u003eACSF3\u003c/em\u003e and T-AOC, IgG. For the fatty acid biosynthesis-related genes, the \u003cem\u003eACACB\u003c/em\u003e catalyzed the carboxylation of acetyl-CoA to malonyl-CoA, a major precursor of fatty acid synthesis\u0026nbsp;[31]. The \u003cem\u003eACACB\u003c/em\u003e was involved in mitochondrial fatty acid (FA) oxidation and FA biosynthesis, which ubiquitously expressed in various developments of tissues, especially in heart, liver, and skeletal muscle\u0026nbsp;[32]. \u003cem\u003eACACB\u003c/em\u003e-knockout mice exhibited insulin sensitivity, conferring protective effects against obesity and diabetes\u0026nbsp;[33]. As an essential enzyme, the \u003cem\u003eACSF3\u003c/em\u003e performed the first step of mitochondrial fatty acid synthesis II and activated fatty acids, served as the substrate for both de novo fatty acid synthesis and oxidation\u0026nbsp;[34]. Deletion of \u003cem\u003eSIRT3\u003c/em\u003e causes altered expression of \u003cem\u003eACSF3\u003c/em\u003e, leading to govern the capacity of \u003cem\u003eACSF3\u003c/em\u003e to mediate fatty acid metabolism disorder\u0026nbsp;[35]. The up-regulated expression of their transcripts in respond to increasing dietary protein levels may reflect the increase for fatty acids synthesis in rumen.\u003c/p\u003e\n\u003cp\u003eMoreover, three genes identified as \u003cem\u003eMYH11\u003c/em\u003e, \u003cem\u003eKCNMA1\u003c/em\u003e and \u003cem\u003eMYL9\u003c/em\u003e were associated with muscle development. \u003cem\u003eMYH11\u003c/em\u003e, a member of the myosin family, encoded the smooth muscle myosin heavy chain (\u003cem\u003eSMMHC\u003c/em\u003e) and modulated the maturely differentiated SMCs in visceral tissues\u0026nbsp;[36]. Overexpression of Protein inhibitor of activated \u003cem\u003eSTAT\u003c/em\u003e restrained proliferation and migration in vascular smooth muscle via promoting the expression of \u003cem\u003eMYH11\u0026nbsp;\u003c/em\u003e[37].\u0026nbsp;Down-regulation of the long noncoding RNAMBNL1-AS1 increased the expression of \u003cem\u003eKCNMA1\u003c/em\u003e, thereby regulating the proliferation and apoptosis in skeletal muscle cells via activation of the cGMP-PKG signaling pathway\u0026nbsp;[38]. \u003cem\u003eMYL9\u003c/em\u003e played important roles in cytoskeletal dynamics and experimental metastasis by regulating the actomyosin contractility and stress fiber assembly\u0026nbsp;[39].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnnotated DEGs in the rumen tissues of Tibetan sheep with high and low crude protein levels were compared. A number of potential functional candidate genes were screened through transcriptomic sequencing analysis. However, further research is needed to define those mechanisms and the optimal crude protein required to promote rumen papillae development.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the present study demonstrated that the different crude protein levels diet induced changes in the antioxidant activity, immunocompetence and the structural properties of the rumen tissue. Our findings show that diet containing 11.58% crude protein contributed to development of rumen papillae, and improved the antioxidant properties when compared to dietary 10.20% crude protein. The functional analysis of DEGs suggested that genes related to fatty acid biosynthesis, nutrition metabolism and muscle development were associated with rumen development. The identified genes and signaling pathways play an essential role in affecting the rumen tissue, and further studies should be performed to elucidate the mechanisms.\u003c/p\u003e\n"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eExperimental Design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiment was conducted with 2-month-old weaned lamb (initial live weight of 15.40\u0026plusmn;0.81 Kg). A total of sixty lamb were divided into two treatments (n = 30). Diets were formulated to be isoenergetic and contained 2 levels of CP (10.20% and 11.58% of dry matter). The experiment adopted a single-factor randomized block design. This trail continued for 97 days, 7 of which were the adaptive period and 90 of which comprised the test feeding period. Throughout the experiment, lambs were fed a total mixed ration (TMR) of 70% concentration and 30% forage on a dry matter basis. Dietary dry matter (DM), CP, and ether extract (EE) were measured using the method described in a previous study. Acid detergent fiber (ADF) and neutral detergent fiber (NDF) were examined as described by Van Soest et al. The value of net energy (DE) was calculated. The ingredients and nutrient compositions of diets were presented in \u003cstrong\u003eTable 2\u003c/strong\u003e. Diets and fresh drinking water were offered \u003cem\u003ead\u003c/em\u003e libitum.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003eRation composition and nutrient levels (dry matter basis) %\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.39393939393939%\" rowspan=\"2\"\u003e\n \u003cp\u003eItems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.60606060606061%\" colspan=\"2\"\u003e\n \u003cp\u003eGroup\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50.847457627118644%\"\u003e\n \u003cp\u003eGroup L\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"49.152542372881356%\"\u003e\n \u003cp\u003eGroup H\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eIngredient\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eOat hay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eOat silage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eCorn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e37.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e32.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eWheat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e7.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e7.70\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eSoybean meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e1.40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eRapeseed meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e7.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e11.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eCottonseed meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eMaize germ meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003ePalm meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e11.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e11.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eNaCl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eLimestone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eBaking soda\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003ePremix\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eLys\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e2.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e2.52\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eMet\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.39\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eNutrient levels\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e100.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eDE/(MJ\u0026middot;kg\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e9.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e9.56\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eCrude protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e10.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e11.58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eEther extract\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e3.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e3.36\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eNeutral detergent fiber\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e32.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e33.03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eAcid detergent fiber\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e15.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e15.43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eCa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.99\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.612244897959183%\"\u003e\n \u003cp\u003e0.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.591836734693878%\"\u003e\n \u003cp\u003e0.57\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eThe protein level in the L group was 10.20%, while the protein level in the M group was 11.58%.\u003csup\u003e2\u003c/sup\u003eThe premix provided the following per kg of diets: Cu 18 mg, Fe 66 mg, Zn 30 mg, Mn 48 mg, Se 0.36 mg, I 0.6 mg, Co 0.24 mg, VA 24 000 IU,VD 4 800 IU,VE 48 IU.\u003csup\u003e3\u003c/sup\u003eDigestible energy is calculated and the rest are measured.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample Collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt the end of the experiment, five sheep from each group were selected randomly for slaughter at a commercial slaughterhouse. The rumen tissue of Tibetan sheep was collected immediately after slaughter. Approximately 1.5 cm\u003csup\u003e2\u003c/sup\u003e of rumen tissue were taken and placed immediately into liquid nitrogen for RNA extraction, while the remaining tissue were fixed in 4% paraformaldehyde for tissue sectioning.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHE staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter fixation in 4% paraformaldehyde for 48 h, rumen tissue was dehydrated gradually by ethyl alcohol (Hailun, Changsha, China), and then successively embedded in paraffin wax (Sangon, Shanghai, China) and sliced into thick sections by the mounting onto poly-L-lysine-coated glass slides (Hailun, Changsha, China). Those slides were stained with with eosin for 3 min. The rumen papilla length, papilla width, muscular thickness, and stratum corneum thickness in images were measured using the Image-Pro Plus 5.1 software (Media Cybernetics Inc., Bethesda, MD, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme linked immunosorbent assay (Elisa)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBoth antioxidant and immunity of rumen were determined using the Elisa kit (Meibiao Biotechnology Co., Ltd, Jiangsu, China). In brief, 0.1 g of rumen tissue with 900 \u0026mu;L of phosphate buffered saline (Hailun, Changsha, China) were centrifuged at 3,000 \u0026times; g at 4\u0026deg;C for 20 min. The supernatant fluid was collected and filtered through a 0.22-\u0026mu;m membrane.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptome analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from rumen following the instructions of the RNA Extraction Kit (Invitrogen, Carlsbad, CA, USA). The integrity and purity of RNA were determined by Agilent Bioanalyzer 4150 (Agilent Technologies, CA, USA) and Nanodrop ND-2000 (Thermo Scientific, USA), respectively. After verifying and quantifying the cDNA, the libraries were sequenced on the Illumina HiSeq 4000 platform. The original sequencing data with low-quality reads were filtered using SOAPnuke (https://github.com/BGI-flexlab/SOAPnuke). The HISAT2 (V2.04) was applied to map the clean reads to the sheep reference genome of \u003cem\u003eOvis aries\u003c/em\u003e (Oar_v3.1).\u003c/p\u003e\n\u003cp\u003eDifferential expression analyses were carried out to identify differentially expressed gene between different samples. EdgeR was used to normalize the data and extract DEGs with \u0026nbsp;FDR \u0026lt; 0.05 and fold change \u0026gt;1.2. The analyses of GO and KEGG were used to classify the DEGs based on the specific biological functions using DESeq2 software package\u0026nbsp;[40].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-Time Quantitative PCR (qRT-PCR) Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFive genes were randomly selected for qRT-PCR to verify the accuracy of the transcriptome sequencing data. The total RNA isolated from rumen tissue was reverse transcribed into cDNA using a PrimeScript\u003csup\u003eTM\u003c/sup\u003e RT reagent kit (TaKaRa, China). The qRT-PCR was performed with the SYBR\u003csup\u003e\u0026reg;\u003c/sup\u003e Premix Ex TaqTM kit (TaKaRa, China) in triplicate. The relative gene expression of the mRNAs was calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method. Primers sequences were designed at Online primer design (Bioengineering Co. LTD, Shanghai, China) (\u003cstrong\u003eTable 3\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e Primer sequences of the differentially expressed genes (DEGs) for real-time polymerase chain reaction (PCR) analysis.\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003eTm\u0026nbsp;(℃)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003eProduct length\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eMYL9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:TGTGATCCGCAACGCCTTCG\u003c/p\u003e\n \u003cp\u003eR:TGTGATCCGCAACGCCTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e127bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eKCNMA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:CAGGCGGATGGCACTCTCAAG\u003c/p\u003e\n \u003cp\u003eR:CCCAGTCTTTCACGGAGGTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e88bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eMYH11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:AGCCAGAGACGAGAGGACCTTC\u003c/p\u003e\n \u003cp\u003eR:AAGCCGTTGGAGAGGAATGTGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e120bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eNNT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:TACGGATGCGGCAGCCAATC\u003c/p\u003e\n \u003cp\u003eR:TAGGCAACCAAAGACCCACTGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e90bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eNT5E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:CCATTCTTCTCAACAGCAGCATCC\u003c/p\u003e\n \u003cp\u003eR:GAGCGGTGCCATCCAGATAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e132bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eIDH2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:GGAGATGGACGGCGATGAGATG\u003c/p\u003e\n \u003cp\u003eR:TCATTGGTCTGGTCACGGTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e129bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eATP1B1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:TACGGCTACAAAGAGGGCAAACC\u003c/p\u003e\n \u003cp\u003eR:TGAACAGGCAGGACATACGGATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e137bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eACSF3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:ACCACACGTACAAGGACCTCTATTC\u003c/p\u003e\n \u003cp\u003eR:AAGGAGACATCGTTGGAGCACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e130bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.346938775510203%\"\u003e\n \u003cp\u003eACACB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\"\u003e\n \u003cp\u003eF:GAGACAAGATCGCCTCCACCATC\u003c/p\u003e\n \u003cp\u003eR:CACTCCACCGTCAGACCACTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\"\u003e\n \u003cp\u003e60.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.367346938775512%\"\u003e\n \u003cp\u003e85bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental animals used in this study were Tibetan sheep of the Qinghai Plateau type in China, located at the Tibetan sheep experimental base in Haiyan County, Haibei Prefecture, Qinghai Province. Animal care and experimental protocols were approved (QUA-2020-0710) by the Institutional Animal Care and Use Committee of the Qinghai University, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe difference of the histomorphology, Elisa data and mRNA expression between two groups was evaluated using two-tailed Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test with SPSS software (V19.0). Results are presented as the mean values \u0026plusmn; standard error of the measurement (SEM). \u003cem\u003eP\u003c/em\u003e value \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZLW analyzed and explained the transcriptome data of the rumen of Tibetan sheep. ZLW and FSZ performed H.E. staining and measurement on the rumen. Perform Elisa testing on antioxidant and immune levels in rumen tissue using ZLW, FSZ, and QRJ. ZLW, QYAMS, KNZ, and YZ confirmed gene expression through RT-qPCR. ZLW, ZYW, and LSG are the main contributors to manuscript writing. LSG and SZH provided financial support for this experiment. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe current work was funded by Construction of Standardized Production System for Improving quality and efficiency of Tibetan sheep industry (2022-NK-169).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSequence data that support the findings of this study have been deposited in the European Nucleotide Archive with the primary accession code PRJNA1077743.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo conflict of interest existed in the submission of this manuscript, and manuscript was approved by all authors for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhou L, Raza SHA, Gao Z, Hou S, Alwutayd KM, Aljohani ASM, Abdulmonem WA, Alghsham RS, Aloufi BH, Wang Z\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFat deposition, fatty acid profiles, antioxidant capacity and differentially expressed genes in subcutaneous fat of Tibetan sheep fed wheat-based diets with and without xylanase supplementation\u003c/strong\u003e. \u003cem\u003eJournal of animal physiology and animal nutrition \u003c/em\u003e2024, \u003cstrong\u003e108\u003c/strong\u003e(1):252-263.\u003c/li\u003e\n\u003cli\u003eSun Y, Angerer J, Hou FJTRJ: \u003cstrong\u003eEffects of grazing systems on herbage mass and liveweight gain of Tibetan sheep in Eastern Qinghai-Tibetan Plateau, China\u003c/strong\u003e. 2015, \u003cstrong\u003e37\u003c/strong\u003e(2):181-190.\u003c/li\u003e\n\u003cli\u003eCui X, Wang Z, Guo P, Li F, Chang S, Yan T, Zheng H, Hou F: \u003cstrong\u003eShift of Feeding Strategies from Grazing to Different Forage Feeds Reshapes the Rumen Microbiota To Improve the Ability of Tibetan Sheep (Ovis aries) To Adapt to the Cold Season\u003c/strong\u003e. \u003cem\u003eMicrobiology spectrum \u003c/em\u003e2023, \u003cstrong\u003e11\u003c/strong\u003e(2):e0281622.\u003c/li\u003e\n\u003cli\u003eShabat SK, Sasson G, Doron-Faigenboim A, Durman T, Yaacoby S, Berg Miller ME, White BA, Shterzer N, Mizrahi I: \u003cstrong\u003eSpecific microbiome-dependent mechanisms underlie the energy harvest efficiency of ruminants\u003c/strong\u003e. \u003cem\u003eThe ISME journal \u003c/em\u003e2016, \u003cstrong\u003e10\u003c/strong\u003e(12):2958-2972.\u003c/li\u003e\n\u003cli\u003eLi F, Guan LL: \u003cstrong\u003eMetatranscriptomic Profiling Reveals Linkages between the Active Rumen Microbiome and Feed Efficiency in Beef Cattle\u003c/strong\u003e. \u003cem\u003eApplied and environmental microbiology \u003c/em\u003e2017, \u003cstrong\u003e83\u003c/strong\u003e(9).\u003c/li\u003e\n\u003cli\u003eWei X, Wu H, Wang Z, Zhu J, Wang W, Wang J, Wang Y, Wang C: \u003cstrong\u003eRumen-protected lysine supplementation improved amino acid balance, nitrogen utilization and altered hindgut microbiota of dairy cows\u003c/strong\u003e. \u003cem\u003eAnimal nutrition (Zhongguo xu mu shou yi xue hui) \u003c/em\u003e2023, \u003cstrong\u003e15\u003c/strong\u003e:320-331.\u003c/li\u003e\n\u003cli\u003eShahid AB, Malhi M, Soomro SA, Shah MG, Sanjrani MNJPJoZ: \u003cstrong\u003eInfluence of Dietary Selenium Yeast Supplementation on Fermentation Pattern, Papillae Morphology and Antioxidant Status in Rumen of Goat\u003c/strong\u003e. 2020, \u003cstrong\u003e52\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eMalhi M, Gui H, Yao L, Aschenbach JRR, G?Bel G, Shen ZJJoDS: \u003cstrong\u003eIncreased papillae growth and enhanced short-chain fatty acid absorption in the rumen of goats are associated with transient increases in cyclin D1 expression after ruminal butyrate infusion\u003c/strong\u003e. 2013, \u003cstrong\u003e96\u003c/strong\u003e(12):7603-7616.\u003c/li\u003e\n\u003cli\u003eZhang N, Zhang H, Ding J, Wang L, Wei Y, Xiang Y: \u003cstrong\u003eEffects of excessive urea on rumen morphology and microbiota in Jianzhou Da\u0026apos;er goat (Capra hircus)\u003c/strong\u003e. \u003cem\u003eResearch in veterinary science \u003c/em\u003e2022, \u003cstrong\u003e153\u003c/strong\u003e:1-7.\u003c/li\u003e\n\u003cli\u003eXia C, Aziz Ur Rahman M, Yang H, Shao T, Qiu Q, Su H, Cao B: \u003cstrong\u003eEffect of increased dietary crude protein levels on production performance, nitrogen utilisation, blood metabolites and ruminal fermentation of Holstein bulls\u003c/strong\u003e. \u003cem\u003eAsian-Australasian journal of animal sciences \u003c/em\u003e2018, \u003cstrong\u003e31\u003c/strong\u003e(10):1643-1653.\u003c/li\u003e\n\u003cli\u003eSaro C, Mateo J, Caro I, Carballo DE, Fern\u0026aacute;ndez M, Vald\u0026eacute;s C, Bodas R, Gir\u0026aacute;ldez FJ: \u003cstrong\u003eEffect of Dietary Crude Protein on Animal Performance, Blood Biochemistry Profile, Ruminal Fermentation Parameters and Carcass and Meat Quality of Heavy Fattening Assaf Lambs\u003c/strong\u003e. \u003cem\u003eAnimals : an open access journal from MDPI \u003c/em\u003e2020, \u003cstrong\u003e10\u003c/strong\u003e(11).\u003c/li\u003e\n\u003cli\u003eLv X, Cui K, Qi M, Wang S, Diao Q, Zhang N: \u003cstrong\u003eRuminal Microbiota and Fermentation in Response to Dietary Protein and Energy Levels in Weaned Lambs\u003c/strong\u003e. \u003cem\u003eAnimals : an open access journal from MDPI \u003c/em\u003e2020, \u003cstrong\u003e10\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eLiu L, Sun D, Mao S, Zhu W, Liu J: \u003cstrong\u003eInfusion of sodium butyrate promotes rumen papillae growth and enhances expression of genes related to rumen epithelial VFA uptake and metabolism in neonatal twin lambs\u003c/strong\u003e. \u003cem\u003eJournal of animal science \u003c/em\u003e2019, \u003cstrong\u003e97\u003c/strong\u003e(2):909-921.\u003c/li\u003e\n\u003cli\u003ePiccioli-Cappelli F, Loor JJ, Seal CJ, Minuti A, Trevisi E: \u003cstrong\u003eEffect of dietary starch level and high rumen-undegradable protein on endocrine-metabolic status, milk yield, and milk composition in dairy cows during early and late lactation\u003c/strong\u003e. \u003cem\u003eJournal of dairy science \u003c/em\u003e2014, \u003cstrong\u003e97\u003c/strong\u003e(12):7788-7803.\u003c/li\u003e\n\u003cli\u003eJun, Wang, Houguo, Xu, Rantao, Zuo, Kangsen, Mai, Wei, nutrition QJTBjo: \u003cstrong\u003eEffects of oxidised dietary fish oil and high-dose vitamin E supplementation on growth performance, feed utilisation and antioxidant defence enzyme activities of juvenile large yellow croaker (Larmichthys crocea)\u003c/strong\u003e. 2016.\u003c/li\u003e\n\u003cli\u003eSteele MA, Dionissopoulos L, AlZahal O, Doelman J, McBride BW: \u003cstrong\u003eRumen epithelial adaptation to ruminal acidosis in lactating cattle involves the coordinated expression of insulin-like growth factor-binding proteins and a cholesterolgenic enzyme\u003c/strong\u003e. \u003cem\u003eJournal of dairy science \u003c/em\u003e2012, \u003cstrong\u003e95\u003c/strong\u003e(1):318-327.\u003c/li\u003e\n\u003cli\u003eSchogor AL, Palin MF, Santos GT, Benchaar C, Lacasse P, Petit HV: \u003cstrong\u003eMammary gene expression and activity of antioxidant enzymes and oxidative indicators in the blood, milk, mammary tissue and ruminal fluid of dairy cows fed flax meal\u003c/strong\u003e. \u003cem\u003eThe British journal of nutrition \u003c/em\u003e2013, \u003cstrong\u003e110\u003c/strong\u003e(10):1743-1750.\u003c/li\u003e\n\u003cli\u003eLi X, Chen S, Li JE, Wang N, Liu X, An Q, Ye XM, Zhao ZT, Zhao M, Han Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eChemical Composition and Antioxidant Activities of Polysaccharides from Yingshan Cloud Mist Tea\u003c/strong\u003e. \u003cem\u003eOxidative medicine and cellular longevity \u003c/em\u003e2019, \u003cstrong\u003e2019\u003c/strong\u003e:1915967.\u003c/li\u003e\n\u003cli\u003eChen YF, Cao KL, Huang HF, Li XQ, Leng XJ: \u003cstrong\u003eDietary Effects of Lipid and Protein Levels on Growth, Feed Utilization, Lipid Metabolism, and Antioxidant Capacity of Triploid Rainbow Trout (Oncorhynchus mykiss)\u003c/strong\u003e. \u003cem\u003eAquaculture nutrition \u003c/em\u003e2023, \u003cstrong\u003e2023\u003c/strong\u003e:8325440.\u003c/li\u003e\n\u003cli\u003eBai K, Feng C, Jiang L, Zhang L, Zhang J, Zhang L, Wang T: \u003cstrong\u003eDietary effects of Bacillus subtilis fmbj on growth performance, small intestinal morphology, and its antioxidant capacity of broilers\u003c/strong\u003e. \u003cem\u003ePoultry science \u003c/em\u003e2018, \u003cstrong\u003e97\u003c/strong\u003e(7):2312-2321.\u003c/li\u003e\n\u003cli\u003eLiu Y, Azad MAK, Zhao X, Zhu Q, Kong X: \u003cstrong\u003eDietary Protein Levels Modulate the Antioxidant Capacity during Different Growth Stages in Huanjiang Mini-Pigs\u003c/strong\u003e. \u003cem\u003eAntioxidants (Basel, Switzerland) \u003c/em\u003e2023, \u003cstrong\u003e12\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eZhu Y, Sun G, Dunzhu L, Li X, Zhaxi L, Zhaxi S, Suolang, Ciyang, Yangji C, Wangdui B\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEffects of Different Dietary Protein Level on Growth Performance, Rumen Fermentation Characteristics and Plasma Metabolomics Profile of Growing Yak in the Cold Season\u003c/strong\u003e. \u003cem\u003eAnimals : an open access journal from MDPI \u003c/em\u003e2023, \u003cstrong\u003e13\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eKumar N, Garg AK, Mudgal V, Dass RS, Chaturvedi VK, Varshney VP: \u003cstrong\u003eEffect of different levels of selenium supplementation on growth rate, nutrient utilization, blood metabolic profile, and immune response in lambs\u003c/strong\u003e. \u003cem\u003eBiological trace element research \u003c/em\u003e2008, \u003cstrong\u003e126 Suppl 1\u003c/strong\u003e:S44-56.\u003c/li\u003e\n\u003cli\u003eMartins GR, Gelaleti GB, Moschetta MG, Maschio-Signorini LB, Zuccari DA: \u003cstrong\u003eProinflammatory and Anti-Inflammatory Cytokines Mediated by NF-\u0026kappa;B Factor as Prognostic Markers in Mammary Tumors\u003c/strong\u003e. \u003cem\u003eMediators of inflammation \u003c/em\u003e2016, \u003cstrong\u003e2016\u003c/strong\u003e:9512743.\u003c/li\u003e\n\u003cli\u003eColeman DN, Alharthi AS, Liang Y, Lopes MG, Lopreiato V, Vailati-Riboni M, Loor JJ: \u003cstrong\u003eMultifaceted role of one-carbon metabolism on immunometabolic control and growth during pregnancy, lactation and the neonatal period in dairy cattle\u003c/strong\u003e. \u003cem\u003eJournal of animal science and biotechnology \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e(1):27.\u003c/li\u003e\n\u003cli\u003eSantana Luz AB, de Ara\u0026uacute;jo Costa RO, de Medeiros G, Piuvezam G, Passos TS, de Ara\u0026uacute;jo Morais AH: \u003cstrong\u003eWhat are the digestion and absorption models used to reproduce gastrointestinal protein processes?: A protocol for systematic review\u003c/strong\u003e. \u003cem\u003eMedicine \u003c/em\u003e2021, \u003cstrong\u003e100\u003c/strong\u003e(30):e26697.\u003c/li\u003e\n\u003cli\u003eMorrish F, Noonan J, Perez-Olsen C, Gafken PR, Fitzgibbon M, Kelleher J, VanGilst M, Hockenbery D: \u003cstrong\u003eMyc-dependent mitochondrial generation of acetyl-CoA contributes to fatty acid biosynthesis and histone acetylation during cell cycle entry\u003c/strong\u003e. \u003cem\u003eThe Journal of biological chemistry \u003c/em\u003e2010, \u003cstrong\u003e285\u003c/strong\u003e(47):36267-36274.\u003c/li\u003e\n\u003cli\u003eDu F, Zou Y, Hu Q, Jing Y, Yang X: \u003cstrong\u003eMetabolic Profiling of Pleurotus tuoliensis During Mycelium Physiological Maturation and Exploration on a Potential Indicator of Mycelial Maturation\u003c/strong\u003e. \u003cem\u003eFrontiers in microbiology \u003c/em\u003e2018, \u003cstrong\u003e9\u003c/strong\u003e:3274.\u003c/li\u003e\n\u003cli\u003eDong XQ, Chu LK, Cao X, Xiong QW, Mao YM, Chen CH, Bi YL, Liu J, Yan XM: \u003cstrong\u003eGlutathione metabolism rewiring protects renal tubule cells against cisplatin-induced apoptosis and ferroptosis\u003c/strong\u003e. \u003cem\u003eRedox report : communications in free radical research \u003c/em\u003e2023, \u003cstrong\u003e28\u003c/strong\u003e(1):2152607.\u003c/li\u003e\n\u003cli\u003eLiu QW, C.Li, H. Q.Guo, G.Huo, W. J.Zhang, S. L.Zhang, Y. L.Pei, C. A.Wang, H. %J Journal of Animal, Sciences F: \u003cstrong\u003eEffects of dietary protein level and rumen-protected pantothenate on nutrient digestibility, nitrogen balance, blood metabolites and growth performance in beef calves\u003c/strong\u003e. 2018, \u003cstrong\u003e27\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eZhu C, Qi Y, Wang X, Mi B, Cui C, Chen S, Zhao Z, Zhao F, Liu X, Wang J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eVariation in Acetyl-CoA Carboxylase Beta Gene and Its Effect on Carcass and Meat Traits in Gannan Yaks\u003c/strong\u003e. \u003cem\u003eInternational journal of molecular sciences \u003c/em\u003e2023, \u003cstrong\u003e24\u003c/strong\u003e(20).\u003c/li\u003e\n\u003cli\u003eZain M, Awan FR, Najam SS, Islam M, Khan AR, Bilal A, Bellili N, Marre M, Roussel R, Fumeron FJMG: \u003cstrong\u003eAssociation of ACACB gene polymorphism (rs2268388, G\u0026gt;A) with type 2 diabetes and end stage renal disease in Pakistani Punjabi population\u003c/strong\u003e. 2017, \u003cstrong\u003e12\u003c/strong\u003e:109-112.\u003c/li\u003e\n\u003cli\u003eAbu-Elheiga, Lutfi, Oh W, Kordari, Parichher, Wakil, Salih JJPotNAoSotUSoA: \u003cstrong\u003eAcetyl-CoA carboxylase 2 mutant mice are protected against obesity and diabetes induced by high-fat/high-carbohydrate diets\u003c/strong\u003e. 2003.\u003c/li\u003e\n\u003cli\u003eHe W, Fang X, Lu X, Liu Y, Li G, Zhao Z, Li J, Yang R: \u003cstrong\u003eFunction Identification of Bovine ACSF3 Gene and Its Association With Lipid Metabolism Traits in Beef Cattle\u003c/strong\u003e. \u003cem\u003eFrontiers in veterinary science \u003c/em\u003e2021, \u003cstrong\u003e8\u003c/strong\u003e:766765.\u003c/li\u003e\n\u003cli\u003eSun R, Kang X, Zhao Y, Wang Z, Wang R, Fu R, Li Y, Hu Y, Wang Z, Shan W\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSirtuin 3-mediated deacetylation of acyl-CoA synthetase family member 3 by protocatechuic acid attenuates non-alcoholic fatty liver disease\u003c/strong\u003e. \u003cem\u003eBritish journal of pharmacology \u003c/em\u003e2020, \u003cstrong\u003e177\u003c/strong\u003e(18):4166-4180.\u003c/li\u003e\n\u003cli\u003eMiano JM, Cserjesi P, Ligon KL, Periasamy M, Olson EN: \u003cstrong\u003eSmooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis\u003c/strong\u003e. \u003cem\u003eCirculation research \u003c/em\u003e1994, \u003cstrong\u003e75\u003c/strong\u003e(5):803-812.\u003c/li\u003e\n\u003cli\u003eLiu H, Zhang J, Xue Z, Chang M, Feng X, Cai Y, Bai L, Wang W, Liu E, Zhao S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDeficiency of protein inhibitor of activated STAT3 exacerbates atherosclerosis by modulating VSMC phenotypic switching\u003c/strong\u003e. \u003cem\u003eAtherosclerosis \u003c/em\u003e2023, \u003cstrong\u003e380\u003c/strong\u003e:117195.\u003c/li\u003e\n\u003cli\u003eXue-Feng L, Zong-Qiang W, Long-Yun L, Guo-Qing Z, Shao-Nan YJE, Medicine M: \u003cstrong\u003eDownregulation of the long noncoding RNA MBNL1-AS1 protects sevoflurane-pretreated mice against ischemia-reperfusion injury by targeting KCNMA1\u003c/strong\u003e. 2018, \u003cstrong\u003e50\u003c/strong\u003e(9):115-.\u003c/li\u003e\n\u003cli\u003eLicht AH, N\u0026uuml;bel T, Feldner A, Jurisch-Yaksi N, Schorpp-Kistner MJJoCI: \u003cstrong\u003eJunb regulates arterial contraction capacity, cellular contractility, and motility via its target Myl9 in mice\u003c/strong\u003e. 2010, \u003cstrong\u003e120\u003c/strong\u003e(7):2307.\u003c/li\u003e\n\u003cli\u003eYoung MD, Wakefield MJ, Smyth GK, Oshlack A: \u003cstrong\u003eGene ontology analysis for RNA-seq: accounting for selection bias\u003c/strong\u003e. \u003cem\u003eGenome biology \u003c/em\u003e2010, \u003cstrong\u003e11\u003c/strong\u003e(2):R14.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dietary crude protein, Tibetan sheep, Rumen, Histomorphological, Antioxidant capacity, immune levels, RNA-seq","lastPublishedDoi":"10.21203/rs.3.rs-3966713/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3966713/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eThe rumen is a balanced ecosystem harboring a variety of microorganisms and plays an important role in the digestion and absorption of nutrients for ruminant. However, there are few studies on the effects of dietary crude protein on development and function in rumen of Tibetan sheep. The objective of this study was to evaluate the effects of dietary crude protein (CP) on the antioxidant activity, immunocompetence and the structural properties in the rumen of Tibetan sheep. Sixty two-month-old rams with an average weight of 15.40±0.81 Kg were randomly assigned to low-protein diet (10.20% of dry matter, L group) and high-protein diet (11.58% of dry matter, H group). The experiment was conducted over 97 d, including 7 d of adaption to the diets.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eHematoxylin \u0026amp; eosin (H\u0026amp;E) results showed that high-protein diet increased papilla length, papilla width and muscular layer in rumen (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). Compared with L group, supplementation with 11.58% crude protein increased the activities of T-AOC and SOD significantly (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). A total of 612 significant differentially expressed genes (158 up-regulated and 456 down-regulated) were found in response to high-protein diet. Pathways and genes related to fatty acid biosynthesis, nutrition metabolism and muscle development were verified by real-time quantitative polymerase chain reaction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eIn conclusion, 11.58% crude protein diet had superior papillary development and antioxidant activity of Tibetan sheep, likely through modulating the expression of functional genes.\u003c/p\u003e","manuscriptTitle":"Effects of dietary crude protein on antioxidant activity, immunocompetence and the structural properties of the rumen in Tibetan sheep (Ovis aries), as determined by transcriptomic analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-19 14:42:51","doi":"10.21203/rs.3.rs-3966713/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1cc5dc99-917c-41fd-b2be-b9ab506fc745","owner":[],"postedDate":"March 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-30T10:16:23+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-19 14:42:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3966713","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3966713","identity":"rs-3966713","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00