An intergenic bidirectional promoter driven novel lncRNA (LjPLR) modulates the gene expression of a late nodulin in Lotus japonicus

An intergenic bidirectional promoter driven novel lncRNA (LjPLR) modulates the gene expression of a late nodulin in Lotus japonicus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article An intergenic bidirectional promoter driven novel lncRNA (LjPLR) modulates the gene expression of a late nodulin in Lotus japonicus Aniruddho Das, Troyee Das, Zhumur Ghosh, Anirban Siddhanta This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7551253/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Root nodules are the only sites for symbiotic nitrogen fixation (SNF) in leguminous plants. The development and functioning of these nodules are governed by a cascade of gene expressions categorized as early and late nodulins. While early nodulins are rapidly induced by Nod factors and involved in infection and cortical cell division, late nodulins support mature nodule function. The regulation of these gene expressions involves several extra- and intracellular factors along withnon-coding RNAs (ncRNAs). Despite extensive studies on ncRNAsinSNF, the role of long ncRNAs (lncRNAs) in it remains largely unexplored excepting the well-characterized early nodulin lncRNA ENOD40 and its natural antisense transcript DONE40. Here, we report the identification and characterization of a novel lncRNA, L otus j aponicus P LP-IV L ong non-coding R NA ( Lj PLR), discovered through in-silico transcriptome analysis followed by in-vivo validation. Lj PLR is an antisense transcript complementary to the Lj PLP-IV gene, which encodes a phosphatidylinositol transfer protein-like protein implicated in membrane biogenesis. We have identified Lj PLP-IV as the only putative target of Lj PLR. The negatively correlated temporal gene expression patterns of Lj PLP-IV and Lj PLR during nodule biogenesis providea new insight into the regulatory landscape of SNF in Lotus japonicus . Lotus japonicus long non-coding RNA (lncRNA) SNF LjPLP-IV Bidirectional promoter Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Key message The study identifies and characterizes a novel long non-coding RNA, Lj PLR , in Lotus japonicus , which is an antisense transcript of the Lj PLP-IV gene presumably involved in membrane biogenesis. The inverse expression patterns of Lj PLP-IV and Lj PLR during nodule development offer new insights into the regulatory mechanisms governing symbiotic nitrogen fixation in Lotus japonicus . Introduction Symbiotic nitrogen fixation (SNF) involves cascade of gene expression which have been traditionally classified as early and late nodulins, reflecting the developmental time points of their expression (J. D. Murray 2011 ) . Early nodulins are triggered within a few hours of perception of Nod factors and are responsible for some important morphogenetic processes such as pre-infection, infection, and cortical cell division etc. Some comprehensive reviews have extensively discussed about the early nodulins ( Mylona et al. 1995 ; Schultze and Kondorosi 1998 ) . After the successful induction of early nodulins, another set of genes are expressed which are known as late nodulins like carbonic anhydrase, sucrose synthase and Leghemoglobin ( Stougaard 2000 ; Van De Sande and Bisseling 1997 ) . These early and late nodulin gene expressions are tightly regulated by both intra-cellular and extra-cellular factors. Recently, non-coding RNAs(ncRNA) are emerging as a potent candidate of intra-cellular regulators of gene expression in physiological processes. ncRNAs comprise of multiple subcategories in which long non-coding RNAs (lncRNA) that consist of more than 200 nucleotides (nts) in length, find a place in almost all eukaryotic life processes (St Laurent et al. 2015 ). Regulatory action of lncRNA in varied physiological processes in plants has been extensively reviewed by Chekanova J. A. (2015) , Bhatia, G et al. ( 2017 ), Wang, H. V etal. (2017) . Although the role of ncRNA in legume is extensively characterized, however the lncRNAs in SNF remains largely unexplored (Chand Jha et al, 2021 ). Notably, ENOD40, a well-studied early nodulin, was the only lncRNA reported to possess a role in the initiation of nodule biogenesis during SNF (Mylona et al. 1995 ; Charon et al. 1997 ; Charon et al. 1999 ). Recent report showed that ENOD40 is regulated by its novel natural antisense transcript DONE40 in Medicago trancatula (Ganguly, P. et al 2021 ). Intriguingly, a high level of antisense RNA transcript was discovered by Kapranov et al. 2001 in the cDNA library Lotus japonicus nodules. However, the antisense RNA transcript was not fully characterized. While screening the cDNA library, they reported a novel gene family known as Lj PLPs (isoforms I-IV) that code for L otus j aponicus P ITP like P roteins ( Lj PLP) N-terminal of which shares considerable homology with mammalian PITP ( P hosphatidyl I nositol T ransfer P rotein) and Sec14p of Saccharomyces cerevisiae proteins. Notably, the synthesis of the antisense RNA was described to be driven from an intergenic promoter in the DNA strand complimentary to that of Lj PLP-IV isoform. Plants like rice and Arabidopsis thaliana contain similar proteins supposedly involved in membrane biogenesis during organ development (Böhme et al. 2004 ). Here, using in-silico approaches, we have identified the antisense RNA transcript mentioned above as a novel lncRNA ( L otus j aponicus P LP-IV L ong non-coding R NA; Lj PLR ). We also identified its putative target gene and its temporal expression pattern during nodule biogenesis. Material and Methods Transcriptome analysis and filtering out novel antisense long non-coding RNAs Table 1: List of SRA files containing RNA transcriptome data from infected nodule samples (5 wpi) of Lotus japonicus . Samples Description GSM6675108 root nodules, MG136 Infected, rep 2 GSM6675111 root nodules, MG79 Infected, rep 2 GSM6675114 root nodules, MG136 Infected, rep 5 GSM6675119 root nodules, MG79 Infected, rep 1 GSM6675121 root nodules, MG70 Infected, rep 6 GSM6675122 root nodules, MG70 Infected, rep 2 GSM6675123 root nodules, MG79 Infected, rep 6 GSM6675125 root nodules, MG136 Infected, rep 4 GSM6675126 root nodules, MG136 Infected, rep 1 GSM6675127 root nodules, MG70 Infected, rep 1 GSM6675128 root nodules, MG136 Infected, rep 3 GSM6675129 root nodules, MG79 Infected, rep 4 GSM6675133 root nodules, MG79 Infected, rep 3 GSM6675134 root nodules, MG70 Infected, rep 5 GSM6675137 root nodules, MG79 Infected, rep 5 GSM6675138 root nodules, MG70 Infected, rep 4 GSM6675140 root nodules, MG136 Infected, rep 6 GSM6675141 root nodules, MG70 Infected, rep 3 Lotus japonicus Gifu v1.2 assemblyfasta and genome annotation files have been downloaded from Lotus Base (https://lotus.au.dk). Moreover, previously published GEO (Gene Expression Omnibus) dataset of Lotus japonicus strand specific transcriptome ( Venado, R. E. et al. 2022 ; https://doi.org/10.1073/pnas.2206291119) having accession id GSE216502 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE216502) were utilized for analysis. Among 36 datasets of GEO data, we have selected 18 samples containing RNAseq data of infected nodules of 5 wpi (weeks post infection) ( Table 1 ). Rest was not considered as those were from non-infected nodules. Qualities of the reads were checked with FastQC v0.11.7 ( Andrews, S. 2010 ), Reads were aligned to the reference genome using STAR aligner tool ( Dobin, A., et al. 2013 ). StringTie v1.3.4 ( Pertea, M., et al. 2016 ) has been used to assemble the transcripts followed by the use of custom awk scripts to detect novel antisense transcripts ( Supplementary Table S1 ). Coding Potential of lncRNA Coding potential score of the detected antisense lncRNA have been calculated using CPC v2.0 ( Kang et al., 2017 ) (http://cpc2.cbi.pku.edu.cn).The non-coding transcript coming from the opposite strand of the Lj PLP-IV gene has been finally selected for validation. This lncRNA has a length of 1330 nt having two exons and have been named as L otus j aponicus P LP-IV L ong non-coding R NA ( Lj PLR). In-silico lncRNA target prediction of Lj PLR The retrieved lncRNA sequence of Lj PLR was analysed in-silico using LncTar tool ( Li, J. et. al. 2015 ) (https://doi.org/10.1093/bib/bbu048) for its possible mRNA targets during nodulation (taking a normalized deltaG (ndG) cutoff = - 0.1). Various early and late nodulins were chosen as possible targets of Lj PLR like Lj NFR1, Lj NIN, Lj ENOD40, Lj PLP-IV, LjNOD16 and all the variants of Leghemoglobins i.e. Ljlb, Ljlb2 and Ljlb3 mRNA. NCBI GenBank Accession ID of the targeted genes were provided in the supplementary datasheet Table S1 . Sequence alignments and primer design for lncRNA validation For primer design, the nucleotide sequence of lncRNA LjPLR was subjected to sequence alignment with Lj PLPIV complete cds using NCBI blastn suite ( Camacho, C. et al. 2009 ) (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) and MultAlin ( Corpet, F. 1988 ) (http://multalin.toulouse.inra.fr/multalin/) tool. The exon 1 and exon 2 of the lncRNA Lj PLR aligns with the exonic region 5 to 6 and exonic region 8 to 10 of Lj PLP-IV cds respectively (details of the sequence alignment have been stated in results section). Thus, the exon - intron boundary of Lj PLP-IV was chosen for primer designing as the nucleotide sequence of these regions will be unique for Lj PLR antisense transcript and not for Lj PLP-IV mRNA. Therefore, three sets of primers were designed corresponding to intronic region - 5, 8 and 9 of Lj PLP-IV and accordingly named as I-5, I-8 and I-9 respectively (as illustrated in the schematic diagram Fig.1 ). Primers for PCR and Real Time-PCR I-5_RT_Forward Primer: TGACAACTACCCAGAGGTGTG I-5_RT_ Reverse Primer: GTTCAAGGTCTGCAGTGGAGC I-8_RT_Forward Primer: TACTTAGGGTGGGCCTTCCG I-8_RT_ Reverse Primer: GTGAGCACCATTCTGAACCATC I-9_RT_Forward Primer: GCTTCTGTTTGAATTTGCCTCTGC I-9_RT_ Reverse Primer: CGTCAAACTTGGAAGTCTTGTCC LjPLP-IV_RT_Forward Primer: AGGTCATGTCCGTTGAGATTG LjPLP-IV_RT_Reverse Primer: GGGAGAAGATCGTCCGAAAT LjPP2A_RT_Forward Primer: TGCTCCCTCTGGTTGTAAATG LjPP2A_RT_Reverse Primer: ACAGGGACGGATGGTATTCT Plant material and growth conditions L. japonicus (Gifu B-129) seeds have been purchased from National Bioresource Project ( Lotus japonicus , Glycine max ) University of Miyazaki, Japan. The plants were gown in a controlled environment with a 16-h-day/8-h-night cycle, a 22ºC-day/18ºC-night temperature, and a relative humidity of 70% ( Handberg and Stougaard 1992 ). Before germination, the seeds were pre-treated for 10 min in conc.H 2 SO 4 for scarification and surface sterilization in 25% commercial bleach (1% hypochlorite) and 0.1% TritonX for 10 min, followed by washing with sterile water for 6 times respectively then soaked in water and kept overnight at room temperature. The soaked submerged seeds were then transferred to 4°C for 24h. After 24h the seeds are transferred to petri dishes, containing 1% solidified 1/4 th B & D nutrient solution ( Broughton and Dilworth 1971 ). The inoculation is performed with Mesorhizobium loti (strain NZP2235), and the plants were grown in B & D nutrient solution ( Broughton and Dilworth 1971 ). For nodulation, the plants were grown in Nitrogen free nutritive media. Rhizobial strain, growth conditions and inoculation The Mesorhizobium loti wild-type strain NZP2235 ( Jarvis et al. 1982 ) was used for Lotus japonicus (Gifu B-129) nodulation. Rhizobia were grown in customized Yeast Mannitol Broth (containing Yeast Extract- 0.1g, K 2 HPO 4 - 0.05g, MgSO 4 - 0.02g, NaCl- 0.01g, Mannitol- 1g and 10% 100 mM CaCl 2 for 100 ml broth with pH- 6.8) for 2 days in the dark at 28°C. Then the plants were flood inoculated with Mesorhizobium loti suspension at OD 600 0.01-0.02. Total RNA Isolation and cDNA Preparation Total RNA was isolated from harvested root nodule of Lotus japonicus at different time points (i.e. 0, 9, 14, 21, 28 and 35 dpi) using Macherey-Nagel™NucleoSpin™ RNA Plant Kit (Cat.No. 38220090). Following total RNA isolation, cDNA was prepared from 1µg RNA for each time point using random hexamer from Invitrogen™ SuperScript™ III First-Strand Synthesis System (Cat.No.18080051). Real Time PCR Real Time-PCR analysis of the cDNAs was done using 15ng cDNA with ThermoScientific™DyNAmoColorFlash SYBR Green qPCR Kit (Cat. No. F-416L) in the presence of uniquely designed primers against specific regions for I-5, I-8, I-9 of Lj PLR and Lj PLP-IV, taking Lj PP2A as an internal control. Experimental setup and execution were conducted using an Applied Biosystems ABI 7500 Fast Real-Time PCR system. Real Time PCR program: 1 cycle at 95°C for 5 mins, 40 cycles at 95°C for 15 secs, 62°C for 30 secs and 72°C for 30 sec. Expression data were obtained from three independent biological repetitions. Relative expressions levels of the respective intronic regions of LjP LR and Lj PLP-IV were determined by computing 2 -∆∆Ct from the output of the Real Time PCR. Comparative 2 -∆∆Ct values were used to create a histogram of relative transcript level of different intronic region of Lj PLR and Lj PLP-IV in the root nodules, harvested at different time points i.e. 0, 9, 14, 18, 21, 28 and 35 dpi from Lotus japonicus was represented. Statistical analysis Arithmetic means and standard deviations (SD) for the data obtained were calculated using Microsoft Excel. Statistical significance of the fold change between an infected sample of a given dpi and uninfected sample (0 dpi) was determined using paired t-tests using GraphPad. *, ** & *** denote p-values < 0.05, < 0.01 & < 0.001 respectively. Results Lotus japonicus root nodule (5 wpi) transcriptome contains a novel lncRNA ( Lj PLR) It had been shown that high level of antisense transcripts was formed as a result of activation of a tissue-specific internal bidirectional promoter that is localized within intron 10 ( Fig.2 ) of the late nodulin gene, Lj PLP-IV ( Kapranov et al. 2001 ) in Lotus japonicus . However, the sequence and function of the antisense transcripts were not clearly elucidated. In an attempt to identify those antisense transcripts from the Lotus japonicus root nodule (5 wpi) transcriptome having strand specific paired end GEO dataset, in-silico analysis revealed more than 11,000 non-coding RNAs ( Supplementary data sheet Table S2 ). Further processing of these results found out a novel RNA transcript sequence that is expressed from the loci of Lj PLP-IV gene (Lotus Base Accession ID: LotjaGiC1v0000100.1 and NCBI GenBank Accession ID: AF367434.1) located in the chromosome number 2 (NCBI GenBank Accession ID: AP006643.1). This RNA was found to be transcribed in a direction opposite to that of Lj PLP-IV. This antisense RNA is around 1330 nt long consisting of two exons-913 nt (exon 1) and 417 nt (exon 2) ( supplementary data sheet Table S2 ). Then based on its length and coding potential it was identified as a putative lncRNA. The coding potential of this lncRNA was determined using CPC v2 ( Kang et al., 2017 ). To our satisfaction, its sequence got a Fickett score 0.32847 with a complete putative ORF 67 AA, a pI6.37542724609, which confirmed it as a non-coding sequence with coding probability 0.0390744 (Fig.3) . We have named it Lj PLR ( L otus j aponicus P LP-IV L ong non-coding R NA) and the sequence was deposited in NCBI with the GenBank Accession ID: BK068989. Sequence Alignment reveals that Lj PLR is complementary toEx5-Int5-Ex6 and Ex8-Int10 of Lj PLPIV gene Sequence alignments of Lj PLR with Lj PLP-IV gene using NCBI blastn suite ( Fig.4; A ) and MultAlin ( supplementary Fig. S1 ) tools show 100 percent sequence identity between them. However, the exon1(913 nt) of Lj PLR transcript aligns with the genic regions of Lj PLP-IV from 2879 bp to 1966 bp which corresponds to Ex8-Int8-Ex9-Int9-Ex10-Int10 (total exonic sequence coverage 91.06%) while the exon 2 (417 nt) of Lj PLR coincides from 1672 bp to 1255 bp corresponds to Ex5-Int5-Ex6 (total exonic sequence coverage 92.22%) of Lj PLP-IV gene ( Fig. 4; B ). LncTar analysis figures out that Lj PLR transcript targets only Lj PLP-IV mRNA Lj PLR being an antisense transcript of Lj PLP-IV, it is highly likely that it might down regulate the expression level of Lj PLP-IV gene. This is verified from LncTar tool analysis. While many other genes belonging to both early and late nodulins havebeen examined using this tool, but none of them were predicted to interact with Lj PLR transcript. Only the Lj PLP-IV mRNA was found out to be the possible target of Lj PLR ( Table 2 ). Moreover, none of the Table 2: In-silico prediction by LncTar tool shows the only probable target of Lj PLR transcript might be Lj PLP-IV. Query Length Query (bp) Targets Length Target (bp) dG ndG Start Position Query End Position Query Start Position Target End Position Target Lj PLR 1330 1. Lj PLPIV 4920 -931.23 -0.7158 1 1330 2042 3371 2. Lj PLP-I 1653 Target genes from No. (2)- (22) were not predicted to be interacting with lncRNA Lj PLR. 3. Lj PLP-II 1696 4. Lj PLP-III 1878 5. Nlj16 426 6. Lj lb1 441 7. Lj lb2 441 8. Lj lb3 443 9. Lj CYCLOPS 2224 10. Lotus japonicus asparagine synthetase 2183 11. Lotus japonicus POLLUX (ion channel) 3222 12. Lotus japonicus sucrose synthase 2825 13. LjNFR 1a 1866 14. LjNFR 1b 1872 15. LjNFR 5 1788 16. Lj NIN 2890 17. Lj RLK 1 1881 18. Lj RLK2 1875 19. Lj ENOD40 702 20. Lj NSP1 (nodulation signaling pathway 1) 1629 21. Lj NSP2 (nodulation signaling pathway 2) 1500 22. Lj CA1 (carbonic anhydrase) 792 other members of the Lj PLP family (i.e. Lj PLP-I, Lj PLP-II and Lj PLP-III) came out to be a target of this Lj PLR transcript. Real-Time PCR validates the expression pattern of Lj PLR transcript in Lotus japonicus root nodule Our attempt to detect the presence of Lj PLR in the cDNA of the nodule of Lotus japonicus failed since the Lj PLR transcript (1330 nt) could not be amplified. Thus, we decided to amplify exon1 and exon 2 of Lj PLR separately. Since exon 1 of Lj PLR complements with exon 8 to intron 10 of Lj PLP-IV, two sets of primers were designed corresponding to the exon-intron boundaries such as Ex8-Int8:Int8-Ex9 (I-8) and Ex9-Int9:Int9-Ex10 (I-9). For Exon 2, single set of primer was designed in the exon-intron boundary such as Ex5-Int5:Int5-Ex6 (I-5). Specific amplicons corresponding to I-5, I-8 & I-9 were obtained ( supplementary Fig. S2 ). Then, to determine the quantitative expression pattern of those different regions of Lj PLR transcript in the nodule at different dpi, we carried out Real-Time PCR from the cDNA using those primers. The results clearly indicate that all the three regions are maximally expressed at 14 th dpi which corroborates with our PCR results. Notably, the expression of the region I-8 is significantly higher compared to the other two. However, the expression of I-8 region remarkably went down after 14 th dpi and became more stable from 21 st dpi onward still 35 th dpi ( Fig.5 and S2 ). Thus, our results suggest that the 1 st exon segment of Lj PLR complementary to Ex8-Int8-Ex9 (i.e. I-8) of Lj PLP-IV has significant stability as compared to the other regions (viz. I-5 & I-9) ( Figure 5 and S2 ). Lj PLR transcript and Lj PLP-IV mRNA reciprocally expressed during nodule biogenesis Now that we know the only target of Lj PLR transcript is Lj PLP-IV ( Table 1 ), the expression of the latter was determined. The expression pattern of Lj PLP-IV ( Fig.6A ) clearly shows that it remained low during the early days of nodule development. However, its expression attained a maximum at 21 st dpi. Our results demonstrate that expression of Lj PLR reached a maximum at 14 th dpi, after which it started to decline. Thus, the reciprocal expression patterns of Lj PLP-IV and Lj PLR clearly indicates that the latter downregulates the former ( Fig. 6B ). Discussion In the past few decades, major regulatory roles of ncRNAs in gene expressions across all eukaryotes have become increasingly evident ( St Laurent et al. 2015 and Panni, S et al.2020 ). Seminal work unveiling the role of miRNA in gene-silencing in Petunia hybrida is one of the pioneers in the discovery of ncRNA ( Napoli et al. 1990; van der Krol et al. 1990 ). Since then, numerous miRNAs and siRNAs have been found to regulate diverse developmental and physiological processes in plants. Some of the well documented micro-RNAs expressed during nodulation are Mt-miR166 (HD-ZIPIII), Gma-miR171 (NSP2) and Lja-miR2111 (TML) in Medicago trancatula , Glycine max and Lotus japonicus respectively ( Hoang, N. T. et al. 2020 ). Interestingly, the diverse roles of lncRNAs have been well documented in other plants like ASCO-lncRNA (regulating in lateral root development) ( Bardou F et al. 2014 ), COOLAIR ( Swiezewski S et al. 2009 ) & COLDWRAP ( Kim D-H, Sung S 2017 ) (both controlling vernalization and autonomous pathway during flowering) in Arabidopsis thaliana while LDMAR regulating photoperiod sensitive male sterility in rice ( Ding J. et al. 2012 ). Although the regulatory functions of miRNAs during nodulation have been extensively studied, the role of lncRNAs during SNF remains very limited barring ENOD40 and DONE40 ( Chand Jha et al. 2021 ). ENOD40 is an early nodulin responsible for the initiation of cortical cell division in nodule primordial for the establishment of the symbiosomes ( Mylona et al. 1995; Charon et al. 1997; Charon et al. 1999 ). Recently another novel lncRNA called DONE40, expressed as an early nodulin which regulates ENOD40 in Medicago trancatula has been reported ( Ganguly, P. et al. 2021 ). Furthermore, in the late pathway of nodulation, there is no report of any lncRNA so far. We for the first time identified and partially characterized a novel lncRNA, expressed as a late nodulin within a determinate nodule of the robinoid legume, Lotus japonicus . Although Kapranov et al. 2001 reported the existence of a few antisense transcripts in the cDNA library of mature nodules of L. japonicus , the characterization and its biological functions remained undetermined. Consequently, our investigation of the late nodule transcriptome data conclusively identified those antisense transcripts ( Kapranov et al. 2001 ),which being longer than 200nts (length Lj PLR being 1,330 nt) in length and lacking coding potential ( Fig.2 )have been identified as a putative lncRNA in chromosome 2. Furthermore, Lj PLR was found to be transcribed in a direction opposite to that of Lj PLP-IV gene in the same loci. Intriguingly, Kapranov et al. 2001 also reported that the antisense transcripts( Lj PLR) are found to be driven by an intergenic promoter located in the Intron 10 of Lj PLP-IV gene ( Fig.2 ). Interestingly, this promoter was characterized as a bi-directional promoter that drives the expression of another late nodulin, Lj NOD16 ( Fig. 2 ), discovered by Kapranov et al. 2001 . However, neither the sub-cellular localization nor the function of Nlj16protein was known. Earlier results from our laboratory for the first time showed that Nlj16 interacts with Leghemoglobin in the root nodule of Lotus japonicus to enhance the ability to sequester oxygen ( Ghosh et al. 2019 ). This interaction leads to membrane localization of Leghemoglobin in the infected cortical cells of the nodules ( Ghosh et al. 2022 ). Our sequence alignment results ( Fig. 4 and S1 ) demonstrate that the two exons of Lj PLR showed very good complementarity with the exon-intronic region of Lj PLP-IV gene (i.e. Exon 5 to Exon 10). To our satisfaction, LncTar analysis also demonstrated that Lj PLP-IV gene is the only target of LjPLR. Lj PLP-IV ( Table 1 ), late nodulin gene codes for Lotus japonicus PITP like Protein whose N-terminal has significant homology with mammalian PITP (Phosphatidyl Inositol Transfer Protein) and yeast Sec 14p which is crucial for the transfer of membrane lipids like phosphotidylinositol (PtdIns) and phosphotidylcholine (PtdCho) ( Kapranov et al. 2001 ). It is to be noted that the region corresponding to Exon 5 to Exon 10 of Lj PLP-IV gene codes for Sec14-like domain ( Fig.2 ). Orthologs of this protein are found in many eukaryotes including AtSFH/COW1 in Arabidopsis and OsSNDP in rice. These orthologous proteins show activities in root hair tip and in pollen tube developments ( Böhme et al. 2004; Xu, W et al. 2024 ). PITP ( Cleves et al. 1991; Wirtz 1991 ) and Sec 14p ( Bankaitis et al., 1989, 1990 ) are shown to be essential for the transfer of membrane lipids like phosphotidylinositol (PtdIns) and phosphotidylcholine (PtdCho). Thus, it is highly likely that Lj PLP-IV protein is responsible for mobilization of phospholipids during nodule biogenesis. Nevertheless, the biological target of Lj PLR was predicted to be Lj PLP-IV only, none of the other isoforms of Lj PLP-IV was found to be its probable target ( Table 1 ). The primary reason for this could be the significant dissimilarities in their mRNA sequences ( Supplementary Fig. S3 ). Furthermore, and most interestingly, the expression of Lj PLR was observed to peak at 14 dpi ( Fig.5 ), whereas Lj PLP-IV reached its maximum at 21 dpi ( Fig.6A ). This strongly suggests that their expressions are negatively correlated ( Fig.6B ). Moreover, it has already been reported that Lj PLR is exclusively expressed in the nodule and not in any other parts of the plant body ( Kapranov et al. 2001 ). Taken together, Lj PLR, a unique late nodulin lncRNA, has a probable function in down-regulating Lj PLP-IV-induced phospholipid mobilization during SNF ( Fig. 8 ). Further characterization of Lj PLR will throw light into the regulatory events during late phase of nodule development. Declarations Author Contributions AD and AS conceived the working hypothesis for the study. Transcriptomic analysis to identify the lncRNA was performed by TD and ZG. AD maintained the legume plant L. japonicus and the cognate Rhizobium, M. loti. Isolation of RNA from root nodules at different dpi and preparation of corresponding cDNA were done by AD. AD performed Real time PCR, data collection and analyses. The manuscript was written by AD and AS. TD and ZG reviewed and edited the manuscript. The work was supervised by AS & ZG. The work was supported by funding from ANRF, DST, Govt. of India to AS. All authors read and approved the final manuscript. Funding This work is funded by Grants from Govt. of India DST SERB (EMR/2017/004234) and DST ANRF (CRG/2023/005319) to AS. AD and TD were supported by PhD research fellowships from the University Grants Commission and Council of Scientific and Industrial Research, India & ZG’s research support is funded by Department of Science and Technology, Govt. of India. This research is also supported by DST-FIST (Department of Biochemistry), DBT-Builder and DST-PURSE programs of University of Calcutta, India. Data Availability All the accession Ids of the genes are provided in the supplementary datasheet.The nucleotide sequence of LjPLR is deposited in NCBI with the GenBank Accession ID: BK068989. Competing interests It is declared that there is no conflict of interest. References Andrews, S ., FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. Available online at:http://www.bioinformatics.babraham.ac.uk/projects/fastqc/, 2010. Bankaitis, V.A., Aitken, J.F., Cleves, A.E., and Dowhan, W. (1990). An essential role for a phospholipid transfer protein in yeast Golgi function. Nature 347, 561–562. DOI: 10.1038/347561a0 Bankaitis, V.A., Malehorn, D.E., Emr, S.D., and Greene, R. (1989). The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for transport of secretory proteins from the yeast Golgi complex. J. Cell Biol. 108, 1271–1281. DOI: 10.1083/jcb.108.4.1271 Bardou, F., Ariel, F., Simpson, C. G., Romero-Barrios, N., Laporte, P., Balzergue, S., ... & Crespi, M. (2014). Long noncoding RNA modulates alternative splicing regulators in Arabidopsis. Developmental cell , 30 (2), 166-176. DOI: 10.1016/j.devcel.2014.06.017 Bhatia, G., Goyal, N., Sharma, S., Upadhyay, S. K., & Singh, K. (2017). Present Scenario of Long Non-Coding RNAs in Plants. Non-coding RNA , 3 (2), 16. https://doi.org/10.3390/ncrna3020016 Böhme, Karen, et al . "The Arabidopsis COW1 gene encodes a phosphatidylinositol transfer protein essential for root hair tip growth." The Plant Journal 40.5 (2004): 686-698. DOI: 10.1111/j.1365-313X.2004.02245.x Broughton, W. J., and Dilworth, M. J. "Control of leghaemoglobin synthesis in snake beans." Biochemical journal 125.4 (1971): 1075-1080. DOI: 10.1042/bj1251075 Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., & Madden, T. L. (2009). BLAST+: architecture and applications. BMC bioinformatics , 10 (1), 421. DOI: 10.1186/1471-2105-10-421 Chand Jha, U., Nayyar, H., Mantri, N., & Siddique, K. H. (2021). Non-coding RNAs in legumes: their emerging roles in regulating biotic/abiotic stress responses and plant growth and development. Cells , 10 (7), 1674. doi: 10.3390/cells10071674 Charon, C., Johansson, C., Kondorosi, E., Kondorosi, A., and Crespi, M . 1997. enod40 induces dedifferentiation and division of root cortical cells in legumes. Proceedings of the NationalAcademy of Sciences 94:8901-8906. doi: 10.1073/pnas.94.16.8901 Charon, C., Sousa, C., Crespi, M., and Kondorosi, A.J.T.P.C. 1999. Alteration of enod40 expression modifiesMedicagotruncatularoot nodule development induced by Sinorhizobiummeliloti 11:1953-1965. DOI: 10.1105/tpc.11.10.1953 Chekanova J. A. (2015). Long non-coding RNAs and their functions in plants. Current opinion in plant biology , 27 , 207–216. https://doi.org/10.1016/j.pbi.2015.08.003 Cleves, A.E., McGee, T.P., and Bankaitis, V.A. (1991). Phospholipid transfer proteins: A biological debut. Trends Cell Biol. 1, 30–34. DOI: 10.1016/0962-8924(91)90067-j Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic acids research , 16 (22), 10881-10890. DOI: 10.1093/nar/16.22.10881 Ding, J., Lu, Q., Ouyang, Y., Mao, H., Zhang, P., Yao, J., ... & Zhang, Q. (2012). A long noncoding RNA regulates photoperiod-sensitive male sterility, an essential component of hybrid rice. Proceedings of the National Academy of Sciences , 109 (7), 2654-2659. https://doi.org/10.1073/pnas.1121374109 Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., ... &Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics , 29 (1), 15-21. DOI: 10.1093/bioinformatics/bts635 Ganguly, P., Roy, D., Das, T., Kundu, A., Cartieaux, F., Ghosh, Z., & DasGupta, M. (2021). The natural antisense transcript DONE40 derived from the lncRNA ENOD40 locus interacts with SET domain protein ASHR3 during inception of symbiosis in Arachishypogaea. Molecular Plant-Microbe Interactions , 34 (9), 1057-1070. DOI: 10.1094/MPMI-12-20-0357-R Ghosh, A., Das, A., Ashrafi, M. A., Saha, S., Molla, F., DasGupta, M., & Siddhanta, A. (2022). Nodulin 16 of Lotus japonicus (Nlj16) regulates the recruitment of Leghemoglobin (LegH) to the infected nodule cell membrane during symbiotic nitrogen fixation. bioRxiv , 2022-07. doi: https://doi.org/10.1101/2022.07.21.500945 Ghosh, Amit, Kaushik Bhar, and Anirban Siddhanta. "Oxygen sequestration by Leghemoglobin is positively regulated via its interaction with another late nodulin, Nlj16 of Lotus japonicus." Journal of Plant Biochemistry and Biotechnology 28.4 (2019): 414-423. https://doi.org/10.1007/s13562-019-00494-3 Handberg, Kurt, and Jens Stougaard. "Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics." The Plant Journal 2.4 (1992): 487-496. https://doi.org/10.1111/J.1365-313X.1992.00487.X Hoang, N. T., Tóth, K., & Stacey, G. (2020). The role of microRNAs in the legume–Rhizobium nitrogen-fixing symbiosis. Journal of Experimental Botany , 71 (5), 1668-1680. DOI: 10.1093/jxb/eraa018 J. D. Murray , Invasion by invitation: Rhizobial infection in legumes. Mol. Plant Microbe Interact. 24, 631–639 (2011). DOI: 10.1094/MPMI-08-10-0181 Jarvis, B. D. W., C. E. Pankhurst, and J. J. Patel. "Rhizobium loti, a new species of legume root nodule bacteria." International journal of systematic and evolutionary microbiology 32.3 (1982): 378-380. https://doi.org/10.1099/00207713-32-3-378 Kang, Y.J., Yang, D.C., Kong, L., Hou, M., Meng, Y.Q., Wei, L., and Gao, G. 2017. CPC2: a fast and accurate coding potential calculator based on sequence intrinsic features. Nucleic acids research 45:W12-W16. DOI: 10.1093/nar/gkx428 Kapranov, Philipp, et al. "Nodule-specific regulation of phosphatidylinositol transferprotein expression in Lotus japonicus." The Plant Cell 13.6 (2001): 1369-1382. doi: 10.1105/tpc.13.6.1369 Kim, D. H., & Sung, S. (2017). Vernalization-triggered intragenic chromatin loop formation by long noncoding RNAs. Developmental cell , 40 (3), 302-312. DOI: 10.1016/j.devcel.2016.12.021 Li, J., Ma, W., Zeng, P., Wang, J., Geng, B., Yang, J., & Cui, Q. (2015). LncTar: a tool for predicting the RNA targets of long noncoding RNAs. Briefings in bioinformatics , 16 (5), 806–812. https://doi.org/10.1093/bib/bbu048 Mylona, P., Pawlowski, K., and Bisseling, T.J.T.P.C. 1995. Symbiotic nitrogen fixation 7:869. DOI: 10.1105/tpc.7.7.869 Napoli C, Lemieux C, Jorgensen R (1990) Introduction of a chimeric chalcone synthase gene into Petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2: 279–289. DOI: 10.1105/tpc.2.4.279 Panni, S., Lovering, R. C., Porras, P., & Orchard, S. (2020). Non-coding RNA regulatory networks. Biochimica et biophysicaacta. Gene regulatory mechanisms , 1863 (6), 194417. https://doi.org/10.1016/j.bbagrm.2019.194417 Pertea, M., Kim, D., Pertea, G. M., Leek, J. T., &Salzberg, S. L. (2016). Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nature protocols , 11 (9), 1650-1667. DOI: 10.1038/nprot.2016.095 Schultze, M., &Kondorosi, A. (1998). Regulation of symbiotic root nodule development. Annual review of genetics , 32 (1), 33-57. DOI: 10.1146/annurev.genet.32.1.33 St Laurent, G., Wahlestedt, C., & Kapranov, P. (2015). The Landscape of long noncoding RNA classification. Trends in genetics: TIG , 31 (5), 239–251. https://doi.org/10.1016/j.tig.2015.03.007 Stougaard, Jens. "Regulators and regulation of legume root nodule development." Plant physiology 124.2 (2000): 531-540. DOI: 10.1104/pp.124.2.531 Swiezewski, S., Liu, F., Magusin, A., & Dean, C. (2009). Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature , 462 (7274), 799-802. DOI: 10.1038/nature08618 Van de Sande, K., and T. Bisseling. "Signalling in symbiotic root nodule formation. " Essays in biochemistry 32 (1997): 127-142. PMID: 9493016 Van der Krol AR, Mur LA, Beld M, Mol JN, Stuitje AR (1990) Flavonoid genes in petunia: Addition of a limited number of gene copies may lead to a suppression of gene expression. Plant Cell 2: 291–299. DOI: 10.1105/tpc.2.4.291 Wang, H. V., &Chekanova, J. A. (2017). Long Noncoding RNAs in Plants. Advances in experimental medicine and biology , 1008 , 133–154. https://doi.org/10.1007/978-981-10-5203-3_5 Wirtz, K.W.A. (1991). Phospholipid transfer proteins. Annu. Rev. Biochem. 60, 73–99. DOI: 10.1146/annurev.bi.60.070191.000445 Xu, W., Peng, X., Li, Y., Zeng, X., Yan, W., Wang, C., ... & Tang, X. (2024). OsSNDP4, a Sec14-nodulin Domain Protein, is Required for Pollen Development in Rice. Rice , 17 (1), 54. doi: 10.1186/s12284-024-00730-y Additional Declarations No competing interests reported. Supplementary Files SuplementaryFigures.pdf SupplementaryMaterialTableS1..docx SupplementaryDatasheetTableS2.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7551253","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":520956146,"identity":"b3886697-e728-4d79-bc9f-2b75d87de107","order_by":0,"name":"Aniruddho Das","email":"","orcid":"","institution":"Government General Degree College, Narayangarh","correspondingAuthor":false,"prefix":"","firstName":"Aniruddho","middleName":"","lastName":"Das","suffix":""},{"id":520956147,"identity":"d0529666-cf21-4412-bf17-065714adfbfa","order_by":1,"name":"Troyee Das","email":"","orcid":"","institution":"Bose Institute, Unified Academic Campus","correspondingAuthor":false,"prefix":"","firstName":"Troyee","middleName":"","lastName":"Das","suffix":""},{"id":520956148,"identity":"398fa00f-623a-4d97-ade8-c9b945cbfcef","order_by":2,"name":"Zhumur Ghosh","email":"","orcid":"","institution":"Bose Institute, Unified Academic Campus","correspondingAuthor":false,"prefix":"","firstName":"Zhumur","middleName":"","lastName":"Ghosh","suffix":""},{"id":520956149,"identity":"80404861-3cd5-4f34-a117-4e81b7c4b0a3","order_by":3,"name":"Anirban Siddhanta","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYFACHoYDDAw2DAzsQHYCWISxgRgtaQwMzKRoAYLDEC1EAf7+swcPfKg5L8/fzGP24GEbgzx/A3PbA3xaJG7kJRyccey24YzDPOYGiW0MhjMOMLYb4LXmBo/BYd6G2wkMh3nMJBLOMDBuYGBsk8CnQ/78GZCWcwnyUC32BLUYHMgBaTmQYADWUsGQSFCLIcQvyYYbD7OVAbVIJM84TECL3Pmzhz98qLGTlzvevE3yh4GNbX97+zO8WtCBBAkRNApGwSgYBaMAJwAAtD5GOsrpmo4AAAAASUVORK5CYII=","orcid":"","institution":"University of Calcutta","correspondingAuthor":true,"prefix":"","firstName":"Anirban","middleName":"","lastName":"Siddhanta","suffix":""}],"badges":[],"createdAt":"2025-09-06 13:38:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7551253/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7551253/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92979425,"identity":"1c76240f-4356-4a2c-b1c8-f10bbaddced7","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":120242,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIllustration of the gene structure of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLP-IV showing the locations of Real-time PCR primers for different regions of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe exon-intron boundaries of \u003cem\u003eLj\u003c/em\u003ePLP-IV that corresponds to the exonic regions of \u003cem\u003eLj\u003c/em\u003ePLR were chosen for primers designing as these regions will be unique for \u003cem\u003eLj\u003c/em\u003ePLR antisense transcript but will not be present in \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA. Therefore, three sets of primers were designed corresponding to intronic regions - 5, 8 and 9 of \u003cem\u003eLj\u003c/em\u003ePLP-IV and accordingly named as I-5, I-8 and I-9 respectively. Arrows denote the positions of designing the forward and reverse primer.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/4e24841f3358cced639f97b4.png"},{"id":92979729,"identity":"24aa3c9e-1e88-41d2-950a-8d7f97f361fc","added_by":"auto","created_at":"2025-10-07 19:07:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":272677,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScheme of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLP-IV gene organization of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLotus japonicus\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAn intergenic bidirectional promoter (BiP) residing in intronic region 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene plausibly drives the expression of both the antisense RNA transcript and LjNOD16 in opposite direction during root nodule biogenesis. Numbers - 1 to 14 and I to IV denotes the exons of \u003cem\u003eLj\u003c/em\u003ePLP-IV and Nlj16 respectively. However, exon I to IV of Nlj16 (partly coincides with 11th to 14th exon of \u003cem\u003eLj\u003c/em\u003ePLP-IV) is expressed as a separated protein during nodule biogenesis after \u003cem\u003eMesorhizobium sp\u003c/em\u003e infection. (Adopted and modified from Kapranov et al 2001).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/87a161ee36af7f093034dd3f.png"},{"id":92979432,"identity":"a9773c0d-7be8-4dd6-8f92-5ea4f3826fba","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":418539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetermination of coding potential confirms that \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLR as a non-coding RNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePanel A:\u003c/strong\u003e Coding Potential Calculator ver 2 was used to find out that the putative peptide length of the lncRNA region being 67 AA with a coding probability 0.0390744 and \u003cstrong\u003ePanel B:\u003c/strong\u003e the Fickett testcode score of 0.32847 which ascertains that the region produces an lncRNA transcript.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/9336cdebd699965ad6a975ae.png"},{"id":92979730,"identity":"c8f83247-977f-4b6e-b040-e266c3073310","added_by":"auto","created_at":"2025-10-07 19:07:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":269816,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence alignment of lncRNA, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLR and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLPIV nucleotide sequences\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA:\u003c/strong\u003e Dot Plot and \u003cstrong\u003eB:\u003c/strong\u003e Graphical summary reveals two separate regions in \u003cem\u003eLj\u003c/em\u003ePLR coinciding with \u003cem\u003eLj\u003c/em\u003ePLP-IV, one from 1255 bp to 1672 bp (corresponding to exon 5, Intron 5 and 6; probable regions marked by square box) while the other from 1966 bp to 2879 bp (corresponding to exon 8, Intron 8, Exon 9, Intron 9 and exon 10; probable regions are marked by square box) of \u003cem\u003eLj\u003c/em\u003ePLP-IV.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/68dd917b9176366888eabb5b.png"},{"id":92979428,"identity":"5a78a46b-b1b7-4d07-9672-13fb623cc526","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":122911,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReal time PCR analysis demonstrates that the I-8 region of the lncRNA, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLR is maximally expressed at 14 dpi.\u003c/strong\u003e Total RNA and corresponding cDNA from the root nodules of different dpi (as indicated) were prepared following the protocols mentioned in the ‘Methods’ section. Real time PCR was conducted to determine the gene expression profile of different regions (I-5 [blue], I-8 [red] \u0026amp; I-9 [green]) of \u003cem\u003eLj\u003c/em\u003ePLR using respective primers described above (Fig. 1; Methods). The fold changes in expressions were obtained by computing respective 2\u003csup\u003e-DDCt\u003c/sup\u003e values using uninfected sample (0 dpi) and \u003cem\u003eLj\u003c/em\u003ePP2A as internal control. Data are expressed as mean of triplicates ± SD. Statistical significance of the fold change between an infected sample of a given dpi and uninfected sample (0 dpi) was determined using paired t-tests. *, ** \u0026amp; *** denote p-values \u0026lt; 0.05, \u0026lt; 0.01 \u0026amp; \u0026lt; 0.001 respectively.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/48913bbad9a6997c3b79a747.png"},{"id":92979732,"identity":"354b250a-34c3-4a44-8487-5bcbea59e203","added_by":"auto","created_at":"2025-10-07 19:07:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":182495,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLP-IV gene is maximally expressed at 21 dpi and thereafter\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePanel A: Comparative expression profile of the \u003cem\u003eLj\u003c/em\u003ePLP-IV in different dpi was determined following protocol similar that of Fig. 5. Data are expressed as mean of triplicates ± SD. Statistical significance of the fold change between an infected sample of a given dpi and uninfected sample (0 dpi) was determined using paired t-tests. * \u0026amp; ** denote p-values \u0026lt; 0.05 \u0026amp; \u0026lt; 0.01 respectively.\u003c/p\u003e\n\u003cp\u003ePanel B: Expression profiles of I-8 region of \u003cem\u003eLj\u003c/em\u003ePLR (red) and \u003cem\u003eLj\u003c/em\u003ePLP-IV (blue) transcripts show inverse relationship between them. The mean fold changes in expressions of I-8 region and \u003cem\u003eLj\u003c/em\u003ePLP-IV transcripts were plotted. Data are expressed as mean of triplicates ± SD.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/1ec0ec16e4c757b539407c54.png"},{"id":92979435,"identity":"c83ebc03-af9f-4c27-8248-e4bd17352613","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":5713,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA scheme of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLP-IV gene structure of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLotus japonicus\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLj\u003c/em\u003ePLP-IV gene has 14 exons (sky blue) and 13 introns (dash) having an intragenic bidirectional promoter (BiP) located in the intron 10. \u003cem\u003eLj\u003c/em\u003ePLR expression is driven by the BiP in a direction opposite to that of \u003cem\u003eLj\u003c/em\u003ePLP-IV. \u003cem\u003eLj\u003c/em\u003ePLR consists of two exons - one spanning over exon 5 to exon 6 of \u003cem\u003eLj\u003c/em\u003ePLP-IV (417 bp) and another spanning over exon 8 to exon 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV (913 bp). BiP also drives the expression of \u003cem\u003eLj\u003c/em\u003eNOD16 in the same direction as that of \u003cem\u003eLj\u003c/em\u003ePLP-IV during later stage of root nodule biogenesis. (Adopted and modified from Kapranov .et. al 2001).\u003c/p\u003e","description":"","filename":"placeholderimage.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/a9e77a67f223f6171ed44e94.png"},{"id":92979433,"identity":"4b6d3088-13d4-4ab5-bedc-c60c06692757","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":329636,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePredicted model for \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLj\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePLR function\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePanel A: \u003c/strong\u003eThe intron 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene has a bidirectional promoter (BiP). This promoter drives expression of a novel lncRNA, \u003cem\u003eLj\u003c/em\u003ePLR (green) (this report) and a late nodulin, Nlj16 (Kapranov et al. 2001, Ghosh et al. 2019 and Ghosh et al. 2022) in the opposite direction of each other. Root-nodule cells start producing the \u003cem\u003eLj\u003c/em\u003ePLR from 9th dpi till 14th when it reaches maximum level. During this time, \u003cem\u003eLj\u003c/em\u003ePLR down regulates \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA (red), its sole target as predicted by lncTar. \u003cstrong\u003ePanel B \u0026amp; C:\u003c/strong\u003e From 14th dpi onwards, \u003cem\u003eLj\u003c/em\u003ePLR (green) expression goes down by a yet-to-be-known mechanism (???) with a concomitant and obvious increase in the production of \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA (red) and the protein.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/e653ee28ee3d586f7c295f64.png"},{"id":92980126,"identity":"f3db3b87-33ce-4e42-ac37-9b71cf0bc6e7","added_by":"auto","created_at":"2025-10-07 19:15:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3978656,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/cad8bef3-0d39-46c6-b21c-97c80811f341.pdf"},{"id":92979426,"identity":"df1f67b2-d7ab-44e7-a6a3-83b69e8093ef","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":652158,"visible":true,"origin":"","legend":"","description":"","filename":"SuplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/f29af67cd168a8edc62f42d9.pdf"},{"id":92979430,"identity":"c984e55f-5d49-4e30-92ec-3b422313b722","added_by":"auto","created_at":"2025-10-07 18:59:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15251,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterialTableS1..docx","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/9e1918d390f92e5eb0675bce.docx"},{"id":92979731,"identity":"7d1dca2c-9ea3-4a4d-a05b-a719a818c738","added_by":"auto","created_at":"2025-10-07 19:07:13","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":787268,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryDatasheetTableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7551253/v1/33a2b52180e3d9fb35c99519.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":" An intergenic bidirectional promoter driven novel lncRNA (LjPLR) modulates the gene expression of a late nodulin in Lotus japonicus","fulltext":[{"header":"Key message","content":"\u003cp\u003eThe study identifies and characterizes a novel long non-coding RNA, \u003cstrong\u003e\u003cem\u003eLj\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003ePLR\u003c/strong\u003e, in \u003cem\u003eLotus japonicus\u003c/em\u003e, which is an antisense transcript of the \u003cstrong\u003e\u003cem\u003eLj\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003ePLP-IV\u003c/strong\u003e gene presumably involved in membrane biogenesis. The inverse expression patterns of \u003cstrong\u003e\u003cem\u003eLj\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003ePLP-IV\u003c/strong\u003e and \u003cstrong\u003e\u003cem\u003eLj\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003ePLR\u003c/strong\u003e during nodule development offer new insights into the regulatory mechanisms governing symbiotic nitrogen\u0026nbsp;fixation in \u003cem\u003eLotus japonicus\u003c/em\u003e.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eSymbiotic nitrogen fixation (SNF) involves cascade of gene expression which have been traditionally classified as early and late nodulins, reflecting the developmental time points of their expression \u003cb\u003e(J. D.\u003c/b\u003e Murray \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Early nodulins are triggered within a few hours of perception of Nod factors and are responsible for some important morphogenetic processes such as pre-infection, infection, and cortical cell division etc. Some comprehensive reviews have extensively discussed about the early nodulins \u003cb\u003e(\u003c/b\u003eMylona et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Schultze and Kondorosi \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1998\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. After the successful induction of early nodulins, another set of genes are expressed which are known as late nodulins like carbonic anhydrase, sucrose synthase and Leghemoglobin \u003cb\u003e(\u003c/b\u003eStougaard \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Van De Sande and Bisseling \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1997\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eThese early and late nodulin gene expressions are tightly regulated by both intra-cellular and extra-cellular factors. Recently, non-coding RNAs(ncRNA) are emerging as a potent candidate of intra-cellular regulators of gene expression in physiological processes. ncRNAs comprise of multiple subcategories in which long non-coding RNAs (lncRNA) that consist of more than 200 nucleotides (nts) in length, find a place in almost all eukaryotic life processes (St Laurent et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Regulatory action of lncRNA in varied physiological processes in plants has been extensively reviewed by \u003cb\u003eChekanova J. A. (2015)\u003c/b\u003e, Bhatia, G et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), \u003cb\u003eWang, H. V etal. (2017)\u003c/b\u003e. Although the role of ncRNA in legume is extensively characterized, however the lncRNAs in SNF remains largely unexplored (Chand Jha et al, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Notably, ENOD40, a well-studied early nodulin, was the only lncRNA reported to possess a role in the initiation of nodule biogenesis during SNF (Mylona et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Charon et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Charon et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Recent report showed that ENOD40 is regulated by its novel natural antisense transcript DONE40 in \u003cem\u003eMedicago trancatula\u003c/em\u003e (Ganguly, P. et al \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIntriguingly, a high level of antisense RNA transcript was discovered by Kapranov et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2001\u003c/span\u003e in the cDNA library \u003cem\u003eLotus japonicus\u003c/em\u003e nodules. However, the antisense RNA transcript was not fully characterized. While screening the cDNA library, they reported a novel gene family known as \u003cem\u003eLj\u003c/em\u003ePLPs (isoforms I-IV) that code for \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003eL\u003c/span\u003e\u003cem\u003eotus\u003c/em\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003ej\u003c/span\u003e\u003cem\u003eaponicus\u003c/em\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eP\u003c/span\u003eITP like \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eP\u003c/span\u003eroteins (\u003cem\u003eLj\u003c/em\u003ePLP) N-terminal of which shares considerable homology with mammalian PITP (\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eP\u003c/span\u003ehosphatidyl \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eI\u003c/span\u003enositol \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eT\u003c/span\u003eransfer \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eP\u003c/span\u003erotein) and Sec14p of \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e proteins. Notably, the synthesis of the antisense RNA was described to be driven from an intergenic promoter in the DNA strand complimentary to that of \u003cem\u003eLj\u003c/em\u003ePLP-IV isoform. Plants like rice and \u003cem\u003eArabidopsis thaliana\u003c/em\u003e contain similar proteins supposedly involved in membrane biogenesis during organ development (B\u0026ouml;hme et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eHere, using \u003cem\u003ein-silico\u003c/em\u003e approaches, we have identified the antisense RNA transcript mentioned above as a novel lncRNA (\u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003eL\u003c/span\u003e\u003cem\u003eotus\u003c/em\u003e \u003cspan type=\"BoldItalicUnderline\" class=\"BoldItalicUnderline\" name=\"Emphasis\"\u003ej\u003c/span\u003e\u003cem\u003eaponicus\u003c/em\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eP\u003c/span\u003eLP-IV \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eL\u003c/span\u003eong non-coding \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eR\u003c/span\u003eNA; \u003cb\u003eLj\u003c/b\u003e\u003cb\u003ePLR\u003c/b\u003e). We also identified its putative target gene and its temporal expression pattern during nodule biogenesis.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cstrong\u003eTranscriptome analysis and filtering out novel antisense long non-coding RNAs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cstrong\u003eTable 1:\u0026nbsp;\u003c/strong\u003eList of SRA files containing RNA transcriptome data from infected nodule samples (5 wpi) of \u003cem\u003eLotus japonicus\u003c/em\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"386\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSamples\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG136 Infected, rep 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675111\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG79 Infected, rep 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675114\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG136 Infected, rep 5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675119\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG79 Infected, rep 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675121\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG70 Infected, rep 6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675122\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG70 Infected, rep 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG79 Infected, rep 6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG136 Infected, rep 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG136 Infected, rep 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG70 Infected, rep 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG136 Infected, rep 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675129\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG79 Infected, rep 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675133\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG79 Infected, rep 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675134\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG70 Infected, rep 5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675137\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG79 Infected, rep 5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675138\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG70 Infected, rep 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675140\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG136 Infected, rep 6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 115px;\"\u003e\n \u003cp\u003eGSM6675141\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 271px;\"\u003e\n \u003cp\u003eroot nodules, MG70 Infected, rep 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eLotus japonicus\u003c/em\u003e Gifu v1.2 assemblyfasta and genome annotation files have been downloaded from Lotus Base (https://lotus.au.dk). Moreover, previously published GEO (Gene Expression Omnibus) dataset of \u003cem\u003eLotus japonicus\u0026nbsp;\u003c/em\u003estrand specific transcriptome (\u003cstrong\u003eVenado, R. E. et al. 2022\u003c/strong\u003e; https://doi.org/10.1073/pnas.2206291119) having accession id GSE216502 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE216502) were utilized for analysis. Among 36 datasets of GEO data, we have selected 18 samples containing RNAseq data of infected nodules of 5 wpi (weeks post infection) (\u003cstrong\u003eTable 1\u003c/strong\u003e). Rest was not considered as those were from non-infected nodules. \u0026nbsp;Qualities of the reads were checked with FastQC v0.11.7 (\u003cstrong\u003eAndrews, S. 2010\u003c/strong\u003e), Reads were aligned to the reference genome using STAR aligner tool (\u003cstrong\u003eDobin, A., et al. 2013\u003c/strong\u003e). StringTie v1.3.4 (\u003cstrong\u003ePertea, M., et al. 2016\u003c/strong\u003e) has been used to assemble the transcripts followed by the use of custom awk scripts to detect novel antisense transcripts (\u003cstrong\u003eSupplementary Table S1\u003c/strong\u003e). \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCoding Potential of lncRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCoding potential score of the detected antisense lncRNA have been calculated using CPC v2.0 (\u003cstrong\u003eKang et al., 2017\u003c/strong\u003e) (http://cpc2.cbi.pku.edu.cn).The non-coding transcript coming from the opposite strand of the \u003cem\u003eLj\u003c/em\u003ePLP-IV gene has been finally selected for validation. This lncRNA has a length of 1330 nt having two exons and have been named as \u003cstrong\u003e\u003cem\u003e\u003cu\u003eL\u003c/u\u003e\u003c/em\u003e\u003c/strong\u003e\u003cem\u003eotus \u003cstrong\u003e\u003cu\u003ej\u003c/u\u003e\u003c/strong\u003eaponicus\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e\u003cu\u003eP\u003c/u\u003e\u003c/strong\u003eLP-IV \u003cstrong\u003e\u003cu\u003eL\u003c/u\u003e\u003c/strong\u003eong non-coding \u003cstrong\u003e\u003cu\u003eR\u003c/u\u003e\u003c/strong\u003eNA (\u003cem\u003eLj\u003c/em\u003ePLR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eIn-silico\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003elncRNA target prediction of \u003cem\u003eLj\u003c/em\u003ePLR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe retrieved lncRNA sequence of \u003cem\u003eLj\u003c/em\u003ePLR was analysed \u003cem\u003ein-silico\u003c/em\u003e using LncTar tool (\u003cstrong\u003eLi, J. et. al. 2015\u003c/strong\u003e) (https://doi.org/10.1093/bib/bbu048) for its possible mRNA targets during nodulation (taking a normalized deltaG (ndG) cutoff = - 0.1). Various early and late nodulins were chosen as possible targets of \u003cem\u003eLj\u003c/em\u003ePLR like \u003cem\u003eLj\u003c/em\u003eNFR1, \u003cem\u003eLj\u003c/em\u003eNIN, \u003cem\u003eLj\u003c/em\u003eENOD40, \u003cem\u003eLj\u003c/em\u003ePLP-IV, \u003cem\u003eLjNOD16\u0026nbsp;\u003c/em\u003eand all the variants of Leghemoglobins i.e. \u003cem\u003eLjlb, Ljlb2\u003c/em\u003eand \u003cem\u003eLjlb3\u0026nbsp;\u003c/em\u003emRNA. NCBI GenBank Accession ID of the targeted genes were provided in the \u003cstrong\u003esupplementary datasheet Table S1\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequence alignments and primer design for lncRNA validation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor primer design, the nucleotide sequence of lncRNA \u003cem\u003eLjPLR\u0026nbsp;\u003c/em\u003ewas subjected to sequence alignment with \u003cem\u003eLj\u003c/em\u003ePLPIV complete cds using NCBI blastn suite (\u003cstrong\u003eCamacho, C. et al. 2009\u003c/strong\u003e) (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn\u0026amp;PAGE_TYPE=BlastSearch\u0026amp;LINK_LOC=blasthome) and MultAlin (\u003cstrong\u003eCorpet, F. 1988\u003c/strong\u003e) (http://multalin.toulouse.inra.fr/multalin/) tool. The exon 1 and exon 2 of the lncRNA \u003cem\u003eLj\u003c/em\u003ePLR aligns with the exonic region 5 to 6 and exonic region 8 to 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV cds respectively (details of the sequence alignment have been stated in results section). Thus, the exon - intron boundary of \u003cem\u003eLj\u003c/em\u003ePLP-IV was chosen for primer designing as the nucleotide sequence of these regions will be unique for \u003cem\u003eLj\u003c/em\u003ePLR antisense transcript and not for \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA. Therefore, three sets of primers were designed corresponding to intronic region - 5, 8 and 9 of \u003cem\u003eLj\u003c/em\u003ePLP-IV and accordingly named as I-5, I-8 and I-9 respectively (as illustrated in the schematic diagram \u003cstrong\u003eFig.1\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimers for PCR and Real Time-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eI-5_RT_Forward Primer:\u0026nbsp;\u003c/em\u003eTGACAACTACCCAGAGGTGTG\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eI-5_RT_ Reverse Primer:\u0026nbsp;\u003c/em\u003eGTTCAAGGTCTGCAGTGGAGC\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eI-8_RT_Forward Primer:\u0026nbsp;\u003c/em\u003eTACTTAGGGTGGGCCTTCCG\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eI-8_RT_ Reverse Primer:\u0026nbsp;\u003c/em\u003eGTGAGCACCATTCTGAACCATC\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eI-9_RT_Forward Primer:\u0026nbsp;\u003c/em\u003eGCTTCTGTTTGAATTTGCCTCTGC\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eI-9_RT_ Reverse Primer:\u0026nbsp;\u003c/em\u003eCGTCAAACTTGGAAGTCTTGTCC\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLjPLP-IV_RT_Forward Primer:\u003c/em\u003e AGGTCATGTCCGTTGAGATTG\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLjPLP-IV_RT_Reverse Primer:\u0026nbsp;\u003c/em\u003eGGGAGAAGATCGTCCGAAAT\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLjPP2A_RT_Forward Primer:\u0026nbsp;\u003c/em\u003eTGCTCCCTCTGGTTGTAAATG\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLjPP2A_RT_Reverse Primer:\u0026nbsp;\u003c/em\u003eACAGGGACGGATGGTATTCT\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlant material and growth conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eL. japonicus\u0026nbsp;\u003c/em\u003e(Gifu B-129) seeds have been purchased from National Bioresource Project (\u003cem\u003eLotus japonicus\u003c/em\u003e, \u003cem\u003eGlycine max\u003c/em\u003e) University of Miyazaki, Japan. The plants were gown in a controlled environment with a 16-h-day/8-h-night cycle, a 22\u0026ordm;C-day/18\u0026ordm;C-night temperature, and a relative humidity of 70% (\u003cstrong\u003eHandberg and Stougaard 1992\u003c/strong\u003e). Before germination, the seeds were pre-treated for 10 min in conc.H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e for scarification and surface sterilization in 25% commercial bleach (1% hypochlorite) and 0.1% TritonX for 10 min, followed by washing with sterile water for 6 times respectively then soaked in water and kept overnight at room temperature. The soaked submerged seeds were then transferred to 4\u0026deg;C for 24h. After 24h the seeds are transferred to petri dishes, containing 1% solidified 1/4\u003csup\u003eth\u003c/sup\u003e B \u0026amp; D nutrient solution (\u003cstrong\u003eBroughton and Dilworth 1971\u003c/strong\u003e). The inoculation is performed with \u003cem\u003eMesorhizobium loti\u0026nbsp;\u003c/em\u003e(strain NZP2235), and the plants were grown in B \u0026amp; D nutrient solution (\u003cstrong\u003eBroughton and Dilworth 1971\u003c/strong\u003e). For nodulation, the plants were grown in Nitrogen free nutritive media. \u003cstrong\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRhizobial strain, growth conditions and inoculation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eMesorhizobium loti\u0026nbsp;\u003c/em\u003ewild-type strain NZP2235 (\u003cstrong\u003eJarvis et al. 1982\u003c/strong\u003e) was used for \u003cem\u003eLotus japonicus\u0026nbsp;\u003c/em\u003e(Gifu B-129) nodulation. Rhizobia were grown in customized Yeast Mannitol Broth (containing Yeast Extract- 0.1g, K\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e- 0.05g, MgSO\u003csub\u003e4\u003c/sub\u003e- 0.02g, NaCl- 0.01g, Mannitol- 1g and 10% 100 mM CaCl\u003csub\u003e2\u003c/sub\u003e for 100 ml broth with pH- 6.8) for 2 days in the dark at 28\u0026deg;C. Then the plants were flood inoculated with \u003cem\u003eMesorhizobium loti\u0026nbsp;\u003c/em\u003esuspension at OD\u003csub\u003e600\u003c/sub\u003e 0.01-0.02.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTotal RNA Isolation and cDNA Preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from harvested root nodule of \u003cem\u003eLotus japonicus\u0026nbsp;\u003c/em\u003eat different time points (i.e. 0, 9, 14, 21, 28 and 35 dpi) using Macherey-Nagel\u0026trade;NucleoSpin\u0026trade; RNA Plant Kit (Cat.No. 38220090). Following total RNA isolation, cDNA was prepared from 1\u0026micro;g RNA for each time point using random hexamer from Invitrogen\u0026trade; SuperScript\u0026trade; III First-Strand Synthesis System (Cat.No.18080051).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal Time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReal Time-PCR analysis of the cDNAs was done using 15ng cDNA with ThermoScientific\u0026trade;DyNAmoColorFlash SYBR Green qPCR Kit (Cat. No. F-416L) in the presence of uniquely designed primers against specific regions for I-5, I-8, I-9 of \u003cem\u003eLj\u003c/em\u003ePLR and \u003cem\u003eLj\u003c/em\u003ePLP-IV, taking \u003cem\u003eLj\u003c/em\u003ePP2A as an internal control. Experimental setup and execution were conducted using an Applied Biosystems ABI 7500 Fast Real-Time PCR system. Real Time PCR program: 1 cycle at 95\u0026deg;C for 5 mins, 40 cycles at 95\u0026deg;C for 15 secs, 62\u0026deg;C for 30 secs and 72\u0026deg;C for 30 sec. Expression data were obtained from three independent biological repetitions.\u003c/p\u003e\n\u003cp\u003eRelative expressions levels of the respective intronic regions of \u003cem\u003eLjP\u003c/em\u003eLR and \u003cem\u003eLj\u003c/em\u003ePLP-IV were determined by computing 2\u003csup\u003e-∆∆Ct\u0026nbsp;\u003c/sup\u003efrom the output of the Real Time PCR. Comparative 2\u003csup\u003e-∆∆Ct\u0026nbsp;\u003c/sup\u003evalues were used to create a histogram of relative transcript level of different intronic region of \u003cem\u003eLj\u003c/em\u003ePLR and \u003cem\u003eLj\u003c/em\u003ePLP-IV in the root nodules, harvested at different time points i.e. 0, 9, 14, 18, 21, 28 and 35 dpi from \u003cem\u003eLotus japonicus\u0026nbsp;\u003c/em\u003ewas represented.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eArithmetic means and standard deviations (SD) for the data obtained were calculated using Microsoft Excel. Statistical significance of the fold change between an infected sample of a given dpi and uninfected sample (0 dpi) was determined using paired t-tests using GraphPad. *, ** \u0026amp; *** denote p-values \u0026lt; 0.05, \u0026lt; 0.01 \u0026amp; \u0026lt; 0.001 respectively.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eLotus japonicus\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;root nodule (5 wpi) transcriptome contains a novel lncRNA (\u003c/strong\u003e\u003cem\u003eLj\u003c/em\u003ePLR)\u003c/p\u003e\n\u003cp\u003eIt had been shown that high level of antisense transcripts was formed as a result of activation of a tissue-specific internal bidirectional promoter that is localized within intron 10 (\u003cstrong\u003eFig.2\u003c/strong\u003e) of the late nodulin gene, \u003cem\u003eLj\u003c/em\u003ePLP-IV (\u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003e) in \u003cem\u003eLotus japonicus\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHowever, the sequence and function of the antisense transcripts were not clearly elucidated. In an attempt to identify those antisense transcripts from the \u003cem\u003eLotus japonicus\u003c/em\u003e root nodule (5 wpi) transcriptome having strand specific paired end GEO dataset, \u003cem\u003ein-silico\u003c/em\u003e analysis revealed more than 11,000 non-coding RNAs (\u003cstrong\u003eSupplementary data sheet Table S2\u003c/strong\u003e). Further processing of these results found out a novel RNA transcript sequence that is expressed from the loci of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene (Lotus Base Accession ID: LotjaGiC1v0000100.1 and NCBI GenBank Accession ID: AF367434.1) located in the chromosome number 2 (NCBI GenBank Accession ID: AP006643.1). This RNA was found to be transcribed in a direction opposite to that of \u003cem\u003eLj\u003c/em\u003ePLP-IV. This antisense RNA is around 1330 nt long consisting of two exons-913 nt (exon 1) and 417 nt (exon 2) (\u003cstrong\u003esupplementary data sheet Table S2\u003c/strong\u003e). Then based on its length and coding potential it was identified as a putative lncRNA. The coding potential of this lncRNA was determined using CPC v2 (\u003cstrong\u003eKang et al., 2017\u003c/strong\u003e). To our satisfaction, its sequence got a Fickett score 0.32847 with a complete putative ORF 67 AA, a pI6.37542724609, which confirmed it as a non-coding sequence with coding probability 0.0390744 \u003cstrong\u003e(Fig.3)\u003c/strong\u003e. We have named it \u003cem\u003eLj\u003c/em\u003ePLR (\u003cstrong\u003e\u003cem\u003e\u003cu\u003eL\u003c/u\u003e\u003c/em\u003e\u003c/strong\u003e\u003cem\u003eotus \u003cstrong\u003e\u003cu\u003ej\u003c/u\u003e\u003c/strong\u003eaponicus\u003c/em\u003e\u003cstrong\u003e\u003cu\u003eP\u003c/u\u003e\u003c/strong\u003eLP-IV \u003cstrong\u003e\u003cu\u003eL\u003c/u\u003e\u003c/strong\u003eong non-coding \u003cstrong\u003e\u003cu\u003eR\u003c/u\u003e\u003c/strong\u003eNA) and the sequence was deposited in NCBI with the GenBank Accession ID: BK068989.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequence Alignment reveals that \u003cem\u003eLj\u003c/em\u003ePLR is complementary toEx5-Int5-Ex6 and Ex8-Int10 of \u003cem\u003eLj\u003c/em\u003ePLPIV gene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSequence alignments of \u003cem\u003eLj\u003c/em\u003ePLR with \u003cem\u003eLj\u003c/em\u003ePLP-IV gene using NCBI blastn suite (\u003cstrong\u003eFig.4; A\u003c/strong\u003e) and MultAlin (\u003cstrong\u003esupplementary Fig. S1\u003c/strong\u003e) tools show 100 percent sequence identity between them. However, the exon1(913 nt) of \u003cem\u003eLj\u003c/em\u003ePLR transcript aligns with the genic regions of \u003cem\u003eLj\u003c/em\u003ePLP-IV from 2879 bp to 1966 bp which corresponds to Ex8-Int8-Ex9-Int9-Ex10-Int10 (total exonic sequence coverage 91.06%) while the exon 2 (417 nt) of \u003cem\u003eLj\u003c/em\u003ePLR coincides from 1672 bp to 1255 bp corresponds to Ex5-Int5-Ex6 (total exonic sequence coverage 92.22%) of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene (\u003cstrong\u003eFig. 4; B\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLncTar analysis figures out that \u003cem\u003eLj\u003c/em\u003ePLR transcript targets only \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLj\u003c/em\u003ePLR being an antisense transcript of \u003cem\u003eLj\u003c/em\u003ePLP-IV, it is highly likely that it might down regulate the expression level of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene. This is verified from LncTar tool analysis. While many other genes belonging to both early and late nodulins havebeen examined using this tool, but none of them were predicted to interact with \u003cem\u003eLj\u003c/em\u003ePLR transcript. Only the \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA was found out to be the possible target of \u003cem\u003eLj\u003c/em\u003ePLR (\u003cstrong\u003eTable 2\u003c/strong\u003e). Moreover, none of the\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2:\u0026nbsp;\u003c/strong\u003e\u003cem\u003eIn-silico\u003c/em\u003e prediction by LncTar tool shows the only probable target of \u003cem\u003eLj\u003c/em\u003ePLR transcript might be\u003cem\u003e\u0026nbsp;Lj\u003c/em\u003ePLP-IV.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"107%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eQuery\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLength Query (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 19px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTargets\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLength Target (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003edG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003endG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStart\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePosition Query\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEnd Position Query\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStart\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePosition\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTarget\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEnd Position Target\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"22\" style=\"width: 7px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003ePLR\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"22\" style=\"width: 9px;\"\u003e\n \u003cp\u003e1330\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eLj\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003ePLPIV\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e4920\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e-931.23\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 8px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e-0.7158\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e1330\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e2042\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e3371\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e2.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003ePLP-I\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1653\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"6\" rowspan=\"21\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTarget genes from No. (2)- (22) were not predicted to be interacting with lncRNA\u003cem\u003eLj\u003c/em\u003ePLR.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e3.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003ePLP-II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1696\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e4.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003ePLP-III\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1878\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e5.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003eNlj16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e426\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e6.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003elb1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e441\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e7.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003elb2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e441\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e8.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003elb3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e443\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e9.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eCYCLOPS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e2224\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e10.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLotus japonicus\u003c/em\u003e asparagine synthetase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e2183\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e11.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLotus japonicus\u003c/em\u003e POLLUX (ion channel)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e3222\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e12.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLotus japonicus\u003c/em\u003e sucrose synthase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e2825\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e13.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eLjNFR 1a\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1866\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e14.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eLjNFR 1b\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1872\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e15.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003eLjNFR 5\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1788\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e16.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eNIN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e2890\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e17.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eRLK 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1881\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e18.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eRLK2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1875\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e19.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eENOD40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e702\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e20.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eNSP1\u0026nbsp;(nodulation signaling pathway 1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1629\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e21.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eNSP2\u0026nbsp;(nodulation signaling pathway 2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e1500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 4px;\"\u003e\n \u003cp\u003e22.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14px;\"\u003e\n \u003cp\u003e\u003cem\u003eLj\u003c/em\u003eCA1\u0026nbsp;(carbonic anhydrase)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 9px;\"\u003e\n \u003cp\u003e792\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eother members of the \u003cem\u003eLj\u003c/em\u003ePLP family (i.e. \u003cem\u003eLj\u003c/em\u003ePLP-I, \u003cem\u003eLj\u003c/em\u003ePLP-II and \u003cem\u003eLj\u003c/em\u003ePLP-III) came out to be a target of this \u003cem\u003eLj\u003c/em\u003ePLR transcript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-Time PCR validates the expression pattern of \u003cem\u003eLj\u003c/em\u003ePLR transcript in \u003cem\u003eLotus japonicus\u003c/em\u003e root nodule\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur attempt to detect the presence of \u003cem\u003eLj\u003c/em\u003ePLR in the cDNA of the nodule of \u003cem\u003eLotus japonicus\u003c/em\u003e failed since the \u003cem\u003eLj\u003c/em\u003ePLR transcript (1330 nt) could not be amplified. Thus, we decided to amplify exon1 and exon 2 of \u003cem\u003eLj\u003c/em\u003ePLR separately. Since exon 1 of \u003cem\u003eLj\u003c/em\u003ePLR complements with exon 8 to intron 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV, two sets of primers were designed corresponding to the exon-intron boundaries such as Ex8-Int8:Int8-Ex9 (I-8) and Ex9-Int9:Int9-Ex10 (I-9). For Exon 2, single set of primer was designed in the exon-intron boundary such as Ex5-Int5:Int5-Ex6 (I-5). Specific amplicons corresponding to I-5, I-8 \u0026amp; I-9 were obtained (\u003cstrong\u003esupplementary Fig. S2\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eThen, to determine the quantitative expression pattern of those different regions of \u003cem\u003eLj\u003c/em\u003ePLR transcript in the nodule at different dpi, we carried out Real-Time PCR from the cDNA using those primers. The results clearly indicate that all the three regions are maximally expressed at 14\u003csup\u003eth\u003c/sup\u003edpi which corroborates with our PCR results. Notably, the expression of the region I-8 is significantly higher compared to the other two. However, the expression of I-8 region\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eremarkably went down after 14\u003csup\u003eth\u003c/sup\u003e dpi and became more stable from 21\u003csup\u003est\u003c/sup\u003edpi onward still 35\u003csup\u003eth\u003c/sup\u003edpi (\u003cstrong\u003eFig.5 and S2\u003c/strong\u003e). Thus, our results suggest that the 1\u003csup\u003est\u003c/sup\u003e exon segment of \u003cem\u003eLj\u003c/em\u003ePLR\u0026nbsp;complementary to Ex8-Int8-Ex9 (i.e. I-8) of \u003cem\u003eLj\u003c/em\u003ePLP-IV has significant stability as compared to the other regions (viz. I-5 \u0026amp; I-9) (\u003cstrong\u003eFigure 5 and S2\u003c/strong\u003e). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eLj\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003ePLR transcript and \u003cem\u003eLj\u003c/em\u003ePLP-IV mRNA reciprocally expressed during nodule biogenesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNow that we know the only target of \u003cem\u003eLj\u003c/em\u003ePLR transcript is \u003cem\u003eLj\u003c/em\u003ePLP-IV (\u003cstrong\u003eTable 1\u003c/strong\u003e), the expression of the latter was determined. The expression pattern of \u003cem\u003eLj\u003c/em\u003ePLP-IV (\u003cstrong\u003eFig.6A\u003c/strong\u003e) clearly shows that\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eit remained low during the early days of nodule development. However, its expression attained a maximum at 21\u003csup\u003est\u003c/sup\u003e dpi. Our results demonstrate that expression of \u003cem\u003eLj\u003c/em\u003ePLR reached a maximum at 14\u003csup\u003eth\u003c/sup\u003edpi, after which it started to decline. Thus, the reciprocal expression patterns of \u003cem\u003eLj\u003c/em\u003ePLP-IV and \u003cem\u003eLj\u003c/em\u003ePLR clearly indicates that the latter downregulates the former (\u003cstrong\u003eFig. 6B\u003c/strong\u003e).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the past few decades, major regulatory roles of ncRNAs in gene expressions across all eukaryotes have become increasingly evident (\u003cstrong\u003eSt Laurent et al. 2015 and Panni, S et al.2020\u003c/strong\u003e). Seminal work unveiling the role of miRNA in gene-silencing in \u003cem\u003ePetunia hybrida\u003c/em\u003e is one of the pioneers in the discovery of ncRNA (\u003cstrong\u003eNapoli et al. 1990; van der Krol et al. 1990\u003c/strong\u003e). Since then, numerous miRNAs and siRNAs have been found to regulate diverse developmental and physiological processes in plants. Some of the well documented micro-RNAs expressed during nodulation are Mt-miR166 (HD-ZIPIII), Gma-miR171 (NSP2) and Lja-miR2111 (TML) in \u003cem\u003eMedicago trancatula\u003c/em\u003e, \u003cem\u003eGlycine max\u003c/em\u003e and \u003cem\u003eLotus japonicus\u003c/em\u003e respectively (\u003cstrong\u003eHoang, N. T. et al. 2020\u003c/strong\u003e). Interestingly, the diverse roles of lncRNAs have been well documented in other plants like ASCO-lncRNA (regulating in lateral root development) (\u003cstrong\u003eBardou F et al. 2014\u003c/strong\u003e), COOLAIR (\u003cstrong\u003eSwiezewski S et al. 2009\u003c/strong\u003e) \u0026amp; COLDWRAP (\u003cstrong\u003eKim D-H, Sung S 2017\u003c/strong\u003e) (both controlling vernalization and autonomous pathway during flowering) in \u003cem\u003eArabidopsis thaliana\u0026nbsp;\u003c/em\u003ewhile LDMAR regulating photoperiod sensitive male sterility in rice (\u003cstrong\u003eDing J. et al. 2012\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlthough the regulatory functions of miRNAs during nodulation have been extensively studied, the role of lncRNAs during SNF remains very limited barring ENOD40 and DONE40 (\u003cstrong\u003eChand Jha et al. 2021\u003c/strong\u003e). ENOD40 is an early nodulin responsible for the initiation of cortical cell division in nodule primordial for the establishment of the symbiosomes (\u003cstrong\u003eMylona et al. 1995; Charon et al. 1997; Charon et al. 1999\u003c/strong\u003e). Recently another novel lncRNA called DONE40, expressed as an early nodulin which regulates ENOD40 in \u003cem\u003eMedicago trancatula\u0026nbsp;\u003c/em\u003ehas been reported (\u003cstrong\u003eGanguly, P. et al. 2021\u003c/strong\u003e). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurthermore, in the late pathway of nodulation, there is no report of any lncRNA so far. We for the first time identified and partially characterized a novel lncRNA, expressed as a late nodulin within a determinate nodule of the robinoid legume, \u003cem\u003eLotus japonicus\u003c/em\u003e. Although \u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003e reported the existence of a few antisense transcripts in the cDNA library of mature nodules of \u003cem\u003eL. japonicus\u003c/em\u003e, the characterization and its biological functions remained undetermined. Consequently, our investigation of the late nodule transcriptome data conclusively identified those antisense transcripts (\u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003e),which being longer than 200nts (length \u003cem\u003eLj\u003c/em\u003ePLR being 1,330 nt) in length and lacking coding potential (\u003cstrong\u003eFig.2\u003c/strong\u003e)have been identified as a putative lncRNA in chromosome 2. Furthermore, \u003cem\u003eLj\u003c/em\u003ePLR was found to be transcribed in a direction opposite to that of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene in the same loci. Intriguingly, \u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003ealso reported that the antisense transcripts(\u003cem\u003eLj\u003c/em\u003ePLR) are found to be driven by an intergenic promoter located in the Intron 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene (\u003cstrong\u003eFig.2\u003c/strong\u003e). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInterestingly, this promoter was characterized as a bi-directional promoter that drives the expression of another late nodulin, \u003cem\u003eLj\u003c/em\u003eNOD16 (\u003cstrong\u003eFig. 2\u003c/strong\u003e), discovered by\u0026nbsp;\u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003e\u003cem\u003e.\u003c/em\u003eHowever, neither the sub-cellular localization nor the function of Nlj16protein was known. Earlier results from our laboratory for the first time showed that Nlj16 interacts with Leghemoglobin in the root nodule of \u003cem\u003eLotus japonicus\u0026nbsp;\u003c/em\u003eto enhance the ability to sequester oxygen (\u003cstrong\u003eGhosh et al. 2019\u003c/strong\u003e). This interaction leads to membrane localization of Leghemoglobin in the infected cortical cells of the nodules (\u003cstrong\u003eGhosh et al. 2022\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eOur sequence alignment results (\u003cstrong\u003eFig. 4 and S1\u003c/strong\u003e) demonstrate that the two exons of \u003cem\u003eLj\u003c/em\u003ePLR showed very good complementarity with the exon-intronic region of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene (i.e. Exon 5 to Exon 10). To our satisfaction, LncTar analysis also demonstrated that \u003cem\u003eLj\u003c/em\u003ePLP-IV gene is the only target of LjPLR. \u003cem\u003eLj\u003c/em\u003ePLP-IV (\u003cstrong\u003eTable 1\u003c/strong\u003e), late nodulin gene codes for \u003cem\u003eLotus japonicus\u0026nbsp;\u003c/em\u003ePITP like Protein whose N-terminal has significant homology with mammalian PITP (Phosphatidyl Inositol Transfer Protein) and yeast Sec 14p which is crucial for the transfer of membrane lipids like phosphotidylinositol (PtdIns) and phosphotidylcholine (PtdCho) (\u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003e). It is to be noted that the region corresponding to Exon 5 to Exon 10 of \u003cem\u003eLj\u003c/em\u003ePLP-IV gene codes for Sec14-like domain (\u003cstrong\u003eFig.2\u003c/strong\u003e). Orthologs of this protein are found in many eukaryotes including AtSFH/COW1 in \u003cem\u003eArabidopsis\u003c/em\u003e and OsSNDP in rice. These orthologous proteins show activities in root hair tip and in pollen tube developments (\u003cstrong\u003eB\u0026ouml;hme et al. 2004; Xu, W et al. 2024\u003c/strong\u003e). PITP (\u003cstrong\u003eCleves et al. 1991; Wirtz 1991\u003c/strong\u003e) and Sec 14p (\u003cstrong\u003eBankaitis et al., 1989, 1990\u003c/strong\u003e) are shown to be essential for the transfer of membrane lipids like phosphotidylinositol (PtdIns) and phosphotidylcholine (PtdCho). Thus, it is highly likely that \u003cem\u003eLj\u003c/em\u003ePLP-IV protein is responsible for mobilization of phospholipids during nodule biogenesis. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNevertheless, the biological target of \u003cem\u003eLj\u003c/em\u003ePLR was predicted to be \u003cem\u003eLj\u003c/em\u003ePLP-IV only, none of the other isoforms of \u003cem\u003eLj\u003c/em\u003ePLP-IV was found to be its probable target (\u003cstrong\u003eTable 1\u003c/strong\u003e). The primary reason for this could be the significant dissimilarities in their mRNA sequences (\u003cstrong\u003eSupplementary Fig. S3\u003c/strong\u003e). Furthermore, and most interestingly, the expression of \u003cem\u003eLj\u003c/em\u003ePLR was observed to peak at 14 dpi (\u003cstrong\u003eFig.5\u003c/strong\u003e), whereas \u003cem\u003eLj\u003c/em\u003ePLP-IV reached its maximum at 21 dpi (\u003cstrong\u003eFig.6A\u003c/strong\u003e). This strongly suggests that their expressions are negatively correlated (\u003cstrong\u003eFig.6B\u003c/strong\u003e). Moreover, it has already been reported that \u003cem\u003eLj\u003c/em\u003ePLR is exclusively expressed\u0026nbsp;in the nodule and not in any other parts of the plant body (\u003cstrong\u003eKapranov et al. 2001\u003c/strong\u003e). Taken together, \u003cem\u003eLj\u003c/em\u003ePLR, a unique late nodulin lncRNA, has a probable function in down-regulating \u003cem\u003eLj\u003c/em\u003ePLP-IV-induced phospholipid mobilization during SNF (\u003cstrong\u003eFig. 8\u003c/strong\u003e). Further characterization of \u003cem\u003eLj\u003c/em\u003ePLR will throw light into the regulatory events during late phase of nodule development.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAD and AS conceived the working hypothesis for the study. Transcriptomic analysis to identify the lncRNA was performed by TD and ZG. AD maintained the legume plant\u0026nbsp;L. japonicus\u0026nbsp;and the cognate Rhizobium,\u0026nbsp;M. loti. Isolation of RNA from root nodules at different dpi and preparation of corresponding cDNA were done by AD. AD performed Real time PCR, data collection and analyses. The manuscript was written by AD and AS. TD and ZG reviewed and edited the manuscript. The work was supervised by AS \u0026amp; ZG. The work was supported by funding from ANRF, DST, Govt. of India to AS. All authors read and approved the final manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work is funded by Grants from Govt. of India DST SERB (EMR/2017/004234) and DST ANRF (CRG/2023/005319) to AS. AD and TD were supported by PhD research fellowships from the University Grants Commission and Council of Scientific and Industrial Research, India \u0026amp; ZG\u0026rsquo;s research support is funded by Department of Science and Technology, Govt. of India. \u0026nbsp;This research is also supported by DST-FIST (Department of Biochemistry), DBT-Builder and DST-PURSE programs of University of Calcutta, India.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the accession Ids of the genes are provided in the supplementary datasheet.The nucleotide sequence of LjPLR is deposited in NCBI with the GenBank Accession ID: BK068989.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt is declared that there is no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e\u003cstrong\u003eAndrews, S\u003c/strong\u003e., \u003cem\u003eFastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. \u003c/em\u003eAvailable online at:http://www.bioinformatics.babraham.ac.uk/projects/fastqc/, 2010.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBankaitis, V.A., Aitken, J.F., Cleves, A.E., and Dowhan, W. \u003c/strong\u003e(1990). An essential role for a phospholipid transfer protein in yeast Golgi function. Nature 347, 561\u0026ndash;562. DOI: 10.1038/347561a0\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBankaitis, V.A., Malehorn, D.E., Emr, S.D., and Greene, R.\u003c/strong\u003e (1989). The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for transport of secretory proteins from the yeast Golgi complex. J. Cell Biol. 108, 1271\u0026ndash;1281. DOI: 10.1083/jcb.108.4.1271\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBardou, F., Ariel, F., Simpson, C. G., Romero-Barrios, N., Laporte, P., Balzergue, S., ... \u0026amp; Crespi, M. \u003c/strong\u003e(2014). Long noncoding RNA modulates alternative splicing regulators in Arabidopsis. \u003cem\u003eDevelopmental cell\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(2), 166-176. DOI: 10.1016/j.devcel.2014.06.017\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBhatia, G., Goyal, N., Sharma, S., Upadhyay, S. K., \u0026amp; Singh, K.\u003c/strong\u003e (2017). Present Scenario of Long Non-Coding RNAs in Plants. \u003cem\u003eNon-coding RNA\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e(2), 16. https://doi.org/10.3390/ncrna3020016\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eB\u0026ouml;hme, Karen, et al\u003c/strong\u003e. \u0026quot;The Arabidopsis COW1 gene encodes a phosphatidylinositol transfer protein essential for root hair tip growth.\u0026quot; \u003cem\u003eThe Plant Journal \u003c/em\u003e40.5 (2004): 686-698. DOI: 10.1111/j.1365-313X.2004.02245.x\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBroughton, W. J., and Dilworth, M. J. \u003c/strong\u003e\u0026quot;Control of leghaemoglobin synthesis in snake beans.\u0026quot; Biochemical journal 125.4 (1971): 1075-1080. DOI: 10.1042/bj1251075\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eCamacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., \u0026amp; Madden, T. L.\u003c/strong\u003e (2009). BLAST+: architecture and applications. \u003cem\u003eBMC bioinformatics\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(1), 421. DOI: 10.1186/1471-2105-10-421\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eChand Jha, U., Nayyar, H., Mantri, N., \u0026amp; Siddique, K. H. \u003c/strong\u003e(2021). Non-coding RNAs in legumes: their emerging roles in regulating biotic/abiotic stress responses and plant growth and development. \u003cem\u003eCells\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(7), 1674. doi: 10.3390/cells10071674\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eCharon, C., Johansson, C., Kondorosi, E., Kondorosi, A., and Crespi, M\u003c/strong\u003e. 1997. enod40 induces dedifferentiation and division of root cortical cells in legumes. Proceedings of the NationalAcademy of Sciences 94:8901-8906. doi: 10.1073/pnas.94.16.8901\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eCharon, C., Sousa, C., Crespi, M., and Kondorosi, A.J.T.P.C.\u003c/strong\u003e 1999. Alteration of enod40 expression modifiesMedicagotruncatularoot nodule development induced by Sinorhizobiummeliloti 11:1953-1965. DOI: 10.1105/tpc.11.10.1953\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eChekanova J. A.\u003c/strong\u003e (2015). Long non-coding RNAs and their functions in plants. \u003cem\u003eCurrent opinion in plant biology\u003c/em\u003e, \u003cem\u003e27\u003c/em\u003e, 207\u0026ndash;216. https://doi.org/10.1016/j.pbi.2015.08.003\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eCleves, A.E., McGee, T.P., and Bankaitis, V.A.\u003c/strong\u003e (1991). Phospholipid transfer proteins: A biological debut. Trends Cell Biol. 1, 30\u0026ndash;34. DOI: 10.1016/0962-8924(91)90067-j\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eCorpet, F. \u003c/strong\u003e(1988). Multiple sequence alignment with hierarchical clustering. \u003cem\u003eNucleic acids research\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(22), 10881-10890. DOI: 10.1093/nar/16.22.10881\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eDing, J., Lu, Q., Ouyang, Y., Mao, H., Zhang, P., Yao, J., ... \u0026amp; Zhang, Q. \u003c/strong\u003e(2012). A long noncoding RNA regulates photoperiod-sensitive male sterility, an essential component of hybrid rice. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e, \u003cem\u003e109\u003c/em\u003e(7), 2654-2659. https://doi.org/10.1073/pnas.1121374109\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eDobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., ... \u0026amp;Gingeras, T. R.\u003c/strong\u003e (2013). STAR: ultrafast universal RNA-seq aligner. \u003cem\u003eBioinformatics\u003c/em\u003e, \u003cem\u003e29\u003c/em\u003e(1), 15-21. DOI: 10.1093/bioinformatics/bts635\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGanguly, P., Roy, D., Das, T., Kundu, A., Cartieaux, F., Ghosh, Z., \u0026amp; DasGupta, M.\u003c/strong\u003e (2021). The natural antisense transcript DONE40 derived from the lncRNA ENOD40 locus interacts with SET domain protein ASHR3 during inception of symbiosis in Arachishypogaea. \u003cem\u003eMolecular Plant-Microbe Interactions\u003c/em\u003e, \u003cem\u003e34\u003c/em\u003e(9), 1057-1070. DOI: 10.1094/MPMI-12-20-0357-R\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGhosh, A., Das, A., Ashrafi, M. A., Saha, S., Molla, F., DasGupta, M., \u0026amp; Siddhanta, A. \u003c/strong\u003e(2022). Nodulin 16 of Lotus japonicus (Nlj16) regulates the recruitment of Leghemoglobin (LegH) to the infected nodule cell membrane during symbiotic nitrogen fixation. \u003cem\u003ebioRxiv\u003c/em\u003e, 2022-07.\u003cstrong\u003edoi:\u003c/strong\u003e https://doi.org/10.1101/2022.07.21.500945\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGhosh, Amit, Kaushik Bhar, and Anirban Siddhanta.\u003c/strong\u003e\u0026quot;Oxygen sequestration by Leghemoglobin is positively regulated via its interaction with another late nodulin, Nlj16 of Lotus japonicus.\u0026quot; \u003cem\u003eJournal of Plant Biochemistry and Biotechnology \u003c/em\u003e28.4 (2019): 414-423. \u003cu\u003ehttps://doi.org/10.1007/s13562-019-00494-3\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHandberg, Kurt, and Jens Stougaard.\u003c/strong\u003e \u0026quot;Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics.\u0026quot; The Plant Journal 2.4 (1992): 487-496. https://doi.org/10.1111/J.1365-313X.1992.00487.X\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHoang, N. T., T\u0026oacute;th, K., \u0026amp; Stacey, G. \u003c/strong\u003e(2020). The role of microRNAs in the legume\u0026ndash;Rhizobium nitrogen-fixing symbiosis. \u003cem\u003eJournal of Experimental Botany\u003c/em\u003e, \u003cem\u003e71\u003c/em\u003e(5), 1668-1680. DOI: 10.1093/jxb/eraa018\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eJ. D. Murray\u003c/strong\u003e, Invasion by invitation: Rhizobial infection in legumes. Mol. Plant Microbe Interact. 24, 631\u0026ndash;639 (2011). DOI: 10.1094/MPMI-08-10-0181\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eJarvis, B. D. W., C. E. Pankhurst, and J. J. Patel.\u003c/strong\u003e \u0026quot;Rhizobium loti, a new species of legume root nodule bacteria.\u0026quot; International journal of systematic and evolutionary microbiology 32.3 (1982): 378-380. \u003cu\u003ehttps://doi.org/10.1099/00207713-32-3-378\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eKang, Y.J., Yang, D.C., Kong, L., Hou, M., Meng, Y.Q., Wei, L., and Gao, G.\u003c/strong\u003e 2017. CPC2: a fast and accurate coding potential calculator based on sequence intrinsic features. Nucleic acids research 45:W12-W16. DOI: 10.1093/nar/gkx428\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eKapranov, Philipp, et al. \u003c/strong\u003e\u0026quot;Nodule-specific regulation of phosphatidylinositol transferprotein expression in Lotus japonicus.\u0026quot; \u003cem\u003eThe Plant Cell \u003c/em\u003e13.6 (2001): 1369-1382. doi: 10.1105/tpc.13.6.1369\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eKim, D. H., \u0026amp; Sung, S.\u003c/strong\u003e (2017). Vernalization-triggered intragenic chromatin loop formation by long noncoding RNAs. \u003cem\u003eDevelopmental cell\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(3), 302-312. DOI: 10.1016/j.devcel.2016.12.021\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eLi, J., Ma, W., Zeng, P., Wang, J., Geng, B., Yang, J., \u0026amp; Cui, Q.\u003c/strong\u003e (2015). LncTar: a tool for predicting the RNA targets of long noncoding RNAs. \u003cem\u003eBriefings in bioinformatics\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(5), 806\u0026ndash;812. https://doi.org/10.1093/bib/bbu048\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eMylona, P., Pawlowski, K., and Bisseling, T.J.T.P.C. \u003c/strong\u003e1995. Symbiotic nitrogen fixation 7:869. DOI: 10.1105/tpc.7.7.869\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eNapoli C, Lemieux C, Jorgensen R\u003c/strong\u003e (1990) Introduction of a chimeric chalcone synthase gene into \u003cem\u003ePetunia\u003c/em\u003e results in reversible co-suppression of homologous genes in trans. Plant Cell 2: 279\u0026ndash;289. DOI: 10.1105/tpc.2.4.279\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003ePanni, S., Lovering, R. C., Porras, P., \u0026amp; Orchard, S. \u003c/strong\u003e(2020). Non-coding RNA regulatory networks. \u003cem\u003eBiochimica et biophysicaacta. Gene regulatory mechanisms\u003c/em\u003e, \u003cem\u003e1863\u003c/em\u003e(6), 194417. https://doi.org/10.1016/j.bbagrm.2019.194417\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003ePertea, M., Kim, D., Pertea, G. M., Leek, J. T., \u0026amp;Salzberg, S. L.\u003c/strong\u003e (2016). Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. \u003cem\u003eNature protocols\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(9), 1650-1667. DOI: 10.1038/nprot.2016.095\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSchultze, M., \u0026amp;Kondorosi, A.\u003c/strong\u003e (1998). Regulation of symbiotic root nodule development. \u003cem\u003eAnnual review of genetics\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e(1), 33-57. DOI: 10.1146/annurev.genet.32.1.33\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSt Laurent, G., Wahlestedt, C., \u0026amp; Kapranov, P.\u003c/strong\u003e (2015). The Landscape of long noncoding RNA classification. \u003cem\u003eTrends in genetics: TIG\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(5), 239\u0026ndash;251. https://doi.org/10.1016/j.tig.2015.03.007\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eStougaard, Jens. \u003c/strong\u003e\u0026quot;Regulators and regulation of legume root nodule development.\u0026quot; \u003cem\u003ePlant physiology \u003c/em\u003e124.2 (2000): 531-540. DOI: 10.1104/pp.124.2.531\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSwiezewski, S., Liu, F., Magusin, A., \u0026amp; Dean, C. \u003c/strong\u003e(2009). Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. \u003cem\u003eNature\u003c/em\u003e, \u003cem\u003e462\u003c/em\u003e(7274), 799-802. DOI: 10.1038/nature08618\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eVan de Sande, K., and T. Bisseling. \u003c/strong\u003e\u0026quot;Signalling in symbiotic root nodule formation. \u0026quot;\u003cem\u003eEssays in biochemistry \u003c/em\u003e32 (1997): 127-142. PMID: 9493016\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eVan der Krol AR, Mur LA, Beld M, Mol JN, Stuitje AR\u003c/strong\u003e (1990) Flavonoid genes in petunia: Addition of a limited number of gene copies may lead to a suppression of gene expression. Plant Cell 2: 291\u0026ndash;299. DOI: 10.1105/tpc.2.4.291\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eWang, H. V., \u0026amp;Chekanova, J. A.\u003c/strong\u003e (2017). Long Noncoding RNAs in Plants. \u003cem\u003eAdvances in experimental medicine and biology\u003c/em\u003e, \u003cem\u003e1008\u003c/em\u003e, 133\u0026ndash;154. https://doi.org/10.1007/978-981-10-5203-3_5\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eWirtz, K.W.A.\u003c/strong\u003e (1991). Phospholipid transfer proteins. Annu. Rev. Biochem. 60, 73\u0026ndash;99. DOI: 10.1146/annurev.bi.60.070191.000445\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eXu, W., Peng, X., Li, Y., Zeng, X., Yan, W., Wang, C., ... \u0026amp; Tang, X.\u003c/strong\u003e (2024). OsSNDP4, a Sec14-nodulin Domain Protein, is Required for Pollen Development in Rice. \u003cem\u003eRice\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(1), 54. doi: 10.1186/s12284-024-00730-y\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Lotus japonicus, long non-coding RNA (lncRNA), SNF, LjPLP-IV, Bidirectional promoter","lastPublishedDoi":"10.21203/rs.3.rs-7551253/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7551253/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRoot nodules are the only sites for symbiotic nitrogen fixation (SNF) in leguminous plants. The development and functioning of these nodules are governed by a cascade of gene expressions categorized as early and late nodulins. While early nodulins are rapidly induced by Nod factors and involved in infection and cortical cell division, late nodulins support mature nodule function. The regulation of these gene expressions involves several extra- and intracellular factors along withnon-coding RNAs (ncRNAs). Despite extensive studies on ncRNAsinSNF, the role of long ncRNAs (lncRNAs) in it remains largely unexplored excepting the well-characterized early nodulin lncRNA ENOD40 and its natural antisense transcript DONE40. Here, we report the identification and characterization of a novel lncRNA, \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eL\u003c/span\u003e\u003cem\u003eotus\u003c/em\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003ej\u003c/span\u003e\u003cem\u003eaponicus\u003c/em\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eP\u003c/span\u003eLP-IV \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eL\u003c/span\u003eong non-coding \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eR\u003c/span\u003eNA (\u003cem\u003eLj\u003c/em\u003ePLR), discovered through \u003cem\u003ein-silico\u003c/em\u003e transcriptome analysis followed by \u003cem\u003ein-vivo\u003c/em\u003e validation. \u003cem\u003eLj\u003c/em\u003ePLR is an antisense transcript complementary to the \u003cem\u003eLj\u003c/em\u003ePLP-IV gene, which encodes a phosphatidylinositol transfer protein-like protein implicated in membrane biogenesis. We have identified\u003cem\u003eLj\u003c/em\u003ePLP-IV as the only putative target of \u003cem\u003eLj\u003c/em\u003ePLR. The negatively correlated temporal gene expression patterns of \u003cem\u003eLj\u003c/em\u003ePLP-IV and \u003cem\u003eLj\u003c/em\u003ePLR during nodule biogenesis providea new insight into the regulatory landscape of SNF in \u003cem\u003eLotus japonicus\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":" An intergenic bidirectional promoter driven novel lncRNA (LjPLR) modulates the gene expression of a late nodulin in Lotus japonicus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-07 18:59:08","doi":"10.21203/rs.3.rs-7551253/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"43dbb4b7-56d8-43d9-9a8f-15263235d901","owner":[],"postedDate":"October 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-07T18:59:08+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-07 18:59:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7551253","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7551253","identity":"rs-7551253","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}