Diversity of yeast-like Symbiotaphrina symbionts in the stored product pests Lasioderma serricorne and Stegobium paniceum

preprint OA: closed
Full text JSON View at publisher
Full text 158,405 characters · extracted from preprint-html · click to expand
Diversity of yeast-like Symbiotaphrina symbionts in the stored product pests Lasioderma serricorne and Stegobium paniceum | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Diversity of yeast-like Symbiotaphrina symbionts in the stored product pests Lasioderma serricorne and Stegobium paniceum Alina Nick, René Schellenberg, Christos G. Athanassiou, Cornel Adler, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7759551/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 08 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract The stored product pests Lasioderma serricorne and Stegobium paniceum were described to harbour Symbiotaphrina kochii and Symbiotaphrina buchneri yeast-like symbionts (YLS) respectively, based on axenic cultivation from symbiotic organs. Here we investigate the diversity and stability of the symbiosis in multiple populations. Amplicon sequencing of the fungal internal transcribed spacer (ITS) region from collected and lab-reared populations revealed that the beetle-yeast associations were stable during rearing and populations from different origins were associated with similar yeast strains. However, only one L. serricorne population was associated with Sy. kochii , the others were associated with Sy. buchneri . Further, most S. paniceum samples were associated with a Symbiotaphrina species that could neither be identified as Sy. buchneri , nor Sy. kochii. Yeasts cultivated from both insects were phylogenetically analysed using longer fragments of the rRNA operon (partial 18S rRNA, ITS and 23S rRNA gene) revealing three Symbiotaphrina clades: Sy. kochii , Sy. buchneri and a novel clade. Diagnostic polymerase chain reaction confirmed the exclusive association with Sy. buchneri, Sy. kochii or the novel Symbiotaphrina strain in the individual beetle samples. Our results suggest another, so far overlooked Symbiotaphrina strain or species and a more flexible symbiont association of L. serricorne and St. paniceum . Biological sciences/Ecology Earth and environmental sciences/Ecology Biological sciences/Evolution Biological sciences/Microbiology Biological sciences/Molecular biology Biological sciences/Zoology Anobiidae symbiosis Symbiotaphrina yeast-like symbiont stored-product insects Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Microbes are omnipresent in the environment: they surround, impact and interact with every organism forming diverse associations, communities, and ecosystems [ 1 ]. The highly diverse associations between insects and microbes can be major drivers of evolution [ 2 ]. Besides antagonistic microbes including competitors, parasites and pathogens, mutualistic microbial symbionts contribute often crucially to their host’s metabolism enabling the insects to adapt to new ecological niches [ 3 ]. The supplementation of essential amino acids, vitamins or sterols by microbial mutualists enables various insects to feed on nutrient poor or unbalanced diets [ 4 , 5 ]. Many nutritional mutualisms are highly stable and conserved across taxonomic groups while defensive or detoxifying ones can be more flexible and thereby exhibit higher variation within the microbial partners [ 4 , 6 ]. Symbiont localization might also influence the stability of a symbiosis. Endosymbionts living inside the host’s body are isolated from the environment while ectosymbionts living outside of the host’s body cavity (including the gut) encounter other microbes more frequently [ 7 ]. Accordingly, exchange of microbes and/or genetic material encoding metabolic functions can occur more frequently for these ectosymbionts. Symbiont harbouring tissues can have various degrees of complexity ranging from gut invaginations or crypts to distinct organs called bacteriomes or mycetomes (depending on whether they house bacteria or fungi) where microbes can occur intra- and/or extracellularly [ 6 ]. Examples of both types of symbiont harbouring organs can be found in anobiid beetles (Coleoptera: Ptinidae, also known as Anobiidae) which are associated with yeast-like symbionts (YLS) [ 8 – 10 ]. Larvae and adults harbour the YLS intracellularly in specialized epithelial cells (mycetocytes) located in evaginations of the midgut (mycetomes) [ 11 ]. Additionally, female adults harbour extracellular YLS in intersegmental tubules that are connected to the reproductive organs [ 11 ]. During oviposition, the egg surface is smeared with YLS, the newly hatched larvae consume a part of the eggshell and YLS can colonise the mycetocytes [ 8 , 11 ]. In contrast to most other symbioses, these dual microbe harbouring organs represent an intermediate stage between strictly extracellular and intracellular symbioses while the intermittent intracellular life stage is likely a strong selection pressure for specific microbes capable of invading but not overexploiting this host environment. Although, the presence of YLS has been described in many anobiids [ 8 , 12 ] cultivation and characterization were only successful from five anobiid species [ 13 ]. Out of these five species, only the symbiosis of the tabaco beetle Lasioderma serricorne and the drugstore beetle Stegobium paniceum with their YLS are relatively well studied. L. serricorne was described to be associated with Symbiotaphrina kochii [ 14 ] and St. paniceum was described to be associated with Symbiotaphrina buchneri [ 15 ] (Ascomycota: Symbiotaphrinales: Symbiotaphrinaceae [ 16 ]. Remarkably, neither L. serricorne nor St. paniceum feed on (dead) wood like other anobiids but have diverged to be stored product pests. Both beetles feed on a variety of stored products, mainly dead plant material, making them economically important pests [ 17 , 18 ]. Since the transmission of YLS happens via the egg surface, egg surface sterilization can yield symbiont-free beetles (aposymbiotic). Experiments with symbiotic and aposymbiotic insects inferred that Sy. kochii and Sy. buchneri supplement L. serricorne and St. paniceum with B -vitamins [ 12 , 19 ], sterols [ 20 , 21 ] and amino acids [ 22 , 23 ]. Interestingly, aposymbiotic insects can also acquire YLS from the environment, for example from faeces of conspecifics [ 20 , 24 ]. Reinfection experiments with L. serricorne and St. paniceum and Sy. kochii and Sy. buchneri showed that the symbionts are exchangeable between the beetles with no or little difference in their development [ 24 ]. Similarly, experimental infections with a related yeast-like fungus established intracellularly, however with a strongly exaggerated, seemingly pathogenic infection spread into gut epithelial tissues beyond the mycetome [ 25 ]. Despite the specific requirements for the intracellular life stage this system seems to be able to maintain a certain flexibility regarding the microbial partner. However, the diversity of beetle and yeast association has only been studied by culture dependent methods and without a focus on variability in the infecting species or strains of yeasts. The necessity for more sensitive approaches, e.g. offered by molecular methods is even more imperative, since Baral et al . [ 16 ] found Symbiotaphrina species closely related to Sy. buchneri and Sy. kochii on decaying wood – an ecological niche shared with many Anobiid beetles. They suggest that Sy. buchneri and Sy. kochii have an undiscovered free- living, sexual morph and that the newfound species might have an undiscovered symbiotic relationship with arthropods. This study aims to investigate the diversity and stability of the symbiosis between L. serricorne/ St. paniceum and yeast symbionts between and within multiple populations in Germany. The fungal community of whole beetles was analysed in different populations collected from various sources and in subsequent generations in laboratory cultures. This allowed the comparison of the fungal community in between populations but also in between generations of single populations, giving insight into the diversity of the community, as well as its stability during lab rearing. In a further approach to resolve the putative Symbiotaphrina strains better, the major yeasts of two populations of L. serricorne and two populations of St. paniceum were isolated and phylogenetically classified based on longer amplicons spanning the rRNA operon. Results Fungal community analysis The fungal communities of multiple anobiid populations were analysed using ITS MiSeq amplicon sequencing. For the populations that were newly established in the lab, L. serricorne ‘chickpea’, L. serricorne ‘greece’, St. paniceum ‘chili’ and St. paniceum ‘cornflakes’, two generations were considered to detect possible changes in the community during lab rearing. Furthermore, the identified and isolated Symbiotaphrina strains were phylogenetically classified. The fungal community was more divers in wild anobiids compared to lab-reared beetles. The fungal communities of lab-reared populations were mostly stable over time (Fig. 1 ). Only in L. serricorne ‘greece’ the relative abundances changed upon establishment in the lab: the relative abundance of environmental fungi reduced and the relative abundance of symbiotic Symbiotaphrina increased. Symbiotaphrina could be identified on genus level in all populations of L. serricorne and St. paniceum as well as in Ernobius . Symbiotaphrina buchneri could be identified throughout the different lab generations of L. serricorne ‘chickpea’ and ‘greece’, L. serricorne ‘JKI’, L. serricorne ‘forest’ and in St. paniceum ‘JKI’, while Sy. kochii was only found in L. serricorne ‘chili’. The Symbiotaphrina species in St. paniceum ‘chili’, St. paniceum ‘ginger’ and Ernobius was identified as Sy. lignicola based on the fungal community analysis. However further data base comparison revealed higher identity with Sy. microtheca . We could not assign the Symbiotaphrina species in St. paniceum ‘cornflakes’ to Sy. buchneri nor Sy. kochii based on the fungal community analysis alone. We therefore refer to this strain as “novel Symbiotaphrina ”. The sequence from this “novel Symbiotaphrina ” ASV (ASV 4) was later compared to sequences of isolated Symbiotaphrina strains obtained by sanger sequencing to resolve its phylogenetic placement (see below ‘Phylogenetic placement of Symbiotaphrina isolates & yeasts of wild anobiids’). Several fungal ASVs that could not be identified further than were highly abundant in St. paniceum samples and in Ernobius . The principal coordinate analysis (Fig. 2 ) showed high similarity between samples of the same genus for both L. serricorne and St. paniceum . L. serricorne ‘chickpea’, St. paniceum ‘chili’ and St. paniceum ‘cornflakes’ were similar within a generation but distinct between populations. Only the fungal community of L. serricorne ‘greece’ had changed during lab rearing, being very close to L. serricorne ‘chickpea’ after rearing. Phylogenetic placement of Symbiotaphrina isolates & yeasts of wild anobiids Axenic cultivation attempts yielded colonies from most examined species with colony and cell phenotypes similar to Sy. buchneri and kochii , although with slight deviation in colony coloration ranging from pale white to light beige as well as cell morphology (Supplementary Fig. 1). Sy. buchneri and kochii displayed almost perfectly spherical cells, with only infrequent elongated variations, the isolates clustering with Sy. buchneri cell were round to slightly oval, the novel Symbiotaphrina clade isolates oval (up to twice as long as wide), whereas the Sy. kochii clade isolate exhibited a pronounced conical cell morphology. The Partial rRNA operons of all Symbiotaphrina strains isolated in axenic cultures (Table 2 ) and from the Ernobius , L. serricorne ‘forest’ and St. paniceum ‘ginger’ specimen were amplified from DNA extracts, purified, sanger sequenced and analysed to complete a phylogenetic classification of Symbiotaphrina isolates. The resulting trees from Maximum Likelihood and Bayesian analysis showed the same topology and were thus combined (Fig. 3 ; individual, unedited trees Supplementary Figs. 2 + 3). All Stegobium ‘JKI’ isolates and Lasioderma ‘JKI’ isolates clustered together with the isolates from Stegobium ‘greece’ and Lasioderma ‘chickpea’ as well as the L. serricorne ‘forest’ symbiont. They formed a sister clade to sequences of the Sy. buchneri type strain NBRC10845 cultivated in the lab and those previously deposited in databases (pp:1; bs: 100; Fig. 3 : orange box: “ Sy. buchneri clade”). The Stegobium ‘chili’ and Stegobium ‘cornflakes’ isolate clustered together with the Ernobius and St. paniceum ‘ginger’ symbionts in a sister clade of the Sy./T. microtheca sequences (pp: 99; bs: 82; Fig. 3 yellow box: “novel Symbiotaphrina clade”). The Lasioderma ‘chili’ isolate and lab culture of Sy. kochii CBS250.77 clustered with deposited Sy. kochii sequences (pp: 1; bs: 100; Fig. 3 : red box: “ Sy. kochii clade”). To link the phylogenetic placement of Symbiotaphrina isolates and symbionts to the results of our community analysis we extracted the Symbiotaphrina sequences from the top 30 ASVs (ASV2, ASV4, ASV9, ASV14, ASV17 and ASV22) and run a phylogenetic analysis (RAxML in Geneious, 1000 bootstraps, Fig. 4 ). ASV9, ASV14 and ASV17 clustered with the “ Sy. buchneri clade” (orange box) and ASV22 clustered with “ Sy. kochii clade” (red box) fitting with the previous identification. ASV4 clustered with St. paniceum ‘cornflakes’ isolate and ASV2 with St. paniceum ‘ginger’ symbiont, St. paniceum ‘chili’ isolate and Ernobius symbiont, both in the “novel Symbiotaphrina clade” (yellow box). ASV2 had been assigned as Sy. microtheca in the community analysis but here it is clearly positioned within the “novel Symbiotaphrina clade” which shows supported separation from the other Sy. microtheca sequences. Diagnostic polymerase chain reaction Based on the phylogenetic position of Stegobium ‘greece’ isolate, Stegobium ‘chili’ isolate, Lasioderma ‘chickpea’ isolate and Stegobium ‘cornflakes’ isolate diagnostic primers for the distinction of the two groups (Fig. 3 : orange box buch& yellow box nov) as well as Sy. kochii were designed. The in silico specificity of the new primers was confirmed by counting mismatches: Sym_buch_classic had 100% identity to the sequences of Sy. buchneri , Stegobium ‘greece’ isolate, Lasioderma ‘chickpea’ isolate (17/17 bases) with 4 mismatches to the sequences of Stegobium ‘chili’ isolate and Stegobium ‘cornflakes’ isolate and seven mismatches to Sy. kochii sequence. Sym_novel had 100% identity to the sequences of Stegobium ‘chili’ isolate and Stegobium ‘cornflakes’ isolate (19/19 bases) with 6 mismatches to the sequences of Sy. buchneri , Stegobium ‘greece’ isolate, Lasioderma ‘chickpea’ isolate and 9 mismatches to Sy. kochii sequence. They were applied to all individual samples used in the pooled fungal community analysis (DNA extracts of whole beetles, Fig. 1 ) to confirm the infection with the different Symbiotaphrina strains. For each individual sample, PCR was either successful with primer Sym_buch_classic or with Sym_novel or with neither one (Fig. 5 a). No sample had PCR success with both primers. Successful PCRs yielded products of expected 500 bp length. In F0 and Fx generations of L. serricorne ‘chickpea’ and ‘greece’, in L. serricorne ‘JKI’, St. paniceum ‘JKI’ as well as in L. serricorne ‘forest’ the occurring Symbiotaphrina species could be confirmed to belong to the “ Sy. buchneri” clade (Fig. 3 orange box, Fig. 1 ). The Symbiotaphrina species in populations of St. paniceum ‘chili’ and ‘cornflakes’ as well as Ernobius and St. paniceum ‘ginger’ belong to the “novel Symbiotaphrina isolate” clade (Fig. 3 : yellow box, Fig. 1 ). A diagnostic PCR using Sy. kochii specific primers was successful for L. serricorne ‘chili’ beetles and yielded products of ~ 100 bp length (Fig. 5 b), confirming their phylogenetic position (Fig. 3 : red box) Discussion In this study we investigated the diversity and stability of anobiid – yeast symbiosis, focusing on the interaction between Lasioderma serricorne and Stegobium paniceum with Symbiotaphrina yeasts. To account for the complete fungal community in the beetles before and after lab rearing, individuals from each population were pooled and analysed by amplicon sequencing. In addition, the yeast-like symbionts were cultivated and single isolates classified by Sanger sequencing of the rRNA operon. Additionally, we analysed some wild anobiids and L. serricorne & St. paniceum populations, that were not reared in the lab. We found Symbiotaphrina yeasts in all populations of St. paniceum and L. serricorne. While only one L. serricorne population was associated with Sy. kochii , most carried a strain with a highly similar rRNA operon as Sy. buchneri . The freshly collected St. paniceum populations all carried a strain that formed a novel cluster in between Sy. buchneri and Sy. microtheca based on phylogenies of the rRNA operon. While short term cultivation in the lab did not alter the association with the Symbiotaphrina species or strain, long term cultures of L. serricorne and St. paniceum maintained in the same lab were both infected with Sy. buchneri strains that could not be differentiated by the rRNA operon sequences. These findings contradict the commonly assumed stable association of L. serricorne with Sy. kochii and St. paniceum with Sy. buchneri [ 10 , 14 , 15 ], revealing not only flexibility between both so far recognized Symbiotaphrina species, but also indicating a potentially novel species. In the phylogenetic analysis of Symbiotaphrina isolates, three clades of Symbiotaphrina could be distinguished. Symbiotaphrina isolates from both L. serricorne ‘JKI’ and St. paniceum ‘JKI’ clustered with Stegobium ‘ greece’ and Lasioderma ‘chickpea’ isolates as a sister group to Sy. buchneri type strain and lab culture (“ Symbiotaphrina buchneri clade”, Fig. 3 : orange box). Stegobium ‘chili’ isolate and Stegobium ‘cornflakes’ isolate formed a clade with the Ernobius symbiont and St. paniceum ‘ginger’ symbiont (“novel Symbiotaphrina clade”, yellow box Fig. 3 ), forming a sister group to the canonical Sy. buchneri clade. Only the L. serricorne ‘chili’ isolate clustered with Sy. kochii (Fig. 3 : red box). The comparison of freshly collected populations upon arrival in the lab (F0) and subsequently reared beetles (Fx) revealed that beetles harboured stable associations and did not exchange Symbiotaphrina species or strains within the observation period of this study. However, the relative abundance changed in some cases, e.g. Sy. buchneri abundance was much higher in Fx beetles of L. serricorne ‘chickpea’ and ‘greece’ than in F0 beetles. We established the L. serricorne ‘chickpea’ lab population from a wild population, while L. serricorne ‘greece’ was obtained from the University of Thessaly in Greece (Table 1 ). The clean environment in lab rearing might have reduced the abundance of environmental fungi in the community of L. serricorne ‘chickpea’, leading to the increase of relative abundance of Sy. buchneri . In L. serricorne ‘greece’ the transfer between labs might have led to the high relative abundance of opportunistic environmental fungi like Aspergillus . Since we did not surface sterilise beetles before DNA extraction, fungal remains or spores from their surroundings could also appear in the community analyses. For example, in the sample of L. serricorne ‘forest’ we found mould fungi like Alternaria and Cladosporium . In St. paniceum populations the Symbiotaphrina species could not be identified on species level based on the fungal community analysis. We included the obtained sequences of the corresponding ASVs in a phylogenetic analysis with the previously analysed Symbiotaphrina isolates. The ASVs clustered with the Stegobium ‘chili’ and Stegobium ‘cornflakes’ symbionts (Fig. 4 ). We observed almost no differences in the relative abundance of Symbiotaphrina between F0 and Fx in St. paniceum populations. We confirmed the identity of these yeasts as Sy. buchneri and a novel Symbiotaphrina isolate using diagnostic primers in the individuals that were pooled for the fungal analysis. The association of Sy. buchneri and “novel Symbiotaphrina ” with L. serricorne and St. paniceum respectively was stable during lab rearing. The fungal community of lab reared beetles in F0 and Fx are very similar (Fig. 2 ) with the before mentioned exception of L. serricorne ‘greece’. Generation Fx of L. serricorne ‘greece’ clusters with both generations of L. serricorne ‘chickpea’ in the PCoA which can be evidence for a loss of unspecific opportunistic fungi. Since the yeasts have an extracellular life phase during transmission from mother to offspring, the exchange with free-living Symbiotaphrina species might be possible in nature. Pant and Fraenkel [ 20 ] described that sterilized larvae were able to acquire the yeasts either by feeding on a diet supplemented with them or by feeding on a diet supplemented with faeces of normal insects. Experimentally, the yeasts could be exchanged between host beetles [ 24 ]. However, the association of host beetle and yeast species seems to be rather stable in nature. The populations of L. serricorne and St. paniceum that we analysed here originated from different sources but were all associated with similar yeasts strains although not always the previously reported ones. While this finding indicates more flexible associations than previously assumed, exchanges with other yeast species might still not happened too frequently in nature. Otherwise, an even higher yeast diversity between populations of the same beetle species would be expected. Other anobiids are also associated with yeast-like symbionts [ 8 ], for example yeasts of Ernobius abietis , Ernobius mollis and Xestobium plumbeum were isolated [ 13 ] and described as Candida karawaiewii , C. ernobii and C. xestobii respectively [ 26 ]. However, in our fungal community analysis we also identified the novel Symbiotaphrina isolate in the Ernobius sample. A phylogenetic classification placed the yeasts of other anobiids within the Saccharomycetales and clearly discriminated them from Symbiotaphrina [ 26 ]. The identification of Symbiotaphrina in this Ernobius sample suggests that other anobiids might also be associated with Symbiotaphrina species. However, the analysis of a single beetle sample is not representative and deeper research with more anobiid species is necessary. Since other anobiids feed on wood [ 8 ], it is likely that the symbiosis between L. serricorne and St. paniceum with Symbiotaphrina arose from a common wood associated ancestor [ 10 ]. In conclusion, our findings challenge the literature view of a strict and stable one on one symbiosis of anobiids and Symbiotaphrina yeasts with the commonly accepted association of L. serricorne – Sy. kochii and St. paniceum – Sy. buchneri . Most of the L. serricorne samples tested were associated with Sy. buchneri instead of Sy. kochii , while St. paniceum was consistently associated with a Symbiotaphrina strain that formed a distinct clade within our phylogenetic analysis, suggesting a more flexible association of anobiids and Symbiotaphrina yeasts. However, the symbiosis in the lab-reared populations was stable with no exchanges happening between the beetle species, correspondingly populations of different origins were mostly associated with similar yeast strains. Whether the novel strain represents a new Symbiotaphrina species with a unique metabolic repertoire or only a variant of the rRNA operon requires further genomic and phylogenetic analyses. Similarly, a wider screening is needed to reveal the precise dynamics of this association across habitats and the entire Anobiidae family. Phylogenetic Placement of Symbiotaphrina isolates Methods Beetle strains In this study several strains of Lasioderma serricorne and Stegobium paniceum were used partially obtained from long-term laboratory reared populations, partially collected from natural habitats and infested kitchen supplies and subsequent laboratory cultivation (Table 1 ). All populations from kitchen supplies were derived from independent households. Table 1 Anobiid species, strains, their origin and status upon receiving the samples. F0: beetle samples directly frozen after receiving them in the lab “F0 generation”; Fx: current generation of living beetles species strain origin Sampling status Ernobius sp. Forest (Tegernheim, Germany) Fresh frozen Lasioderma serricorne chickpea chickpea flour (Mainz, Germany) F0 fresh frozen, Fx 2-year lab culture Lasioderma serricorne chili chili spice (Mainz, Germany) 2-year lab culture Lasioderma serricorne forest Gonsenheim forest, (Mainz, Germany) Fresh frozen Lasioderma serricorne Greece Laboratory population, Greece (Professor Dr. Christos Athanassiou, University of Thessaly, Volos, Greece) F0 fresh frozen, Fx 2-year lab culture Lasioderma serricorne JKI Laboratory population, (Dr. Cornel Adler, Julius Kühn Institute Berlin, Germany) Permanent lab culture Stegobium paniceum chili chili spice (Rüsselsheim, Germany) F0 fresh frozen, Fx 2-year lab culture Stegobium paniceum cornflakes cornflakes (Mainz, Germany) F0 fresh frozen, Fx 2-year lab culture Stegobium paniceum ginger dried ginger root (Mainz, Germany) Fresh frozen Stegobium paniceum JKI Laboratory population (Dr. Cornel Adler, Julius Kühn Institute, Berlin, Germany) Permanent lab culture Beetle rearing Stegobium paniceum cultures ‘JKI’, ‘chili’ and ‘cornflakes’ as well as L. serricorne cultures ‘JKI’, ‘chickpea’, ‘chili’ and ‘greece’ were reared at 26°C and 60–70% relative humidity and a 16/8h light/dark cycle. Beetles were fed with equal parts by volume of oats, wheat bran and wheat germ with the addition of half a bread roll for S. paniceum respectively another volume of dried tobacco L. serricorne . Some specimens of each beetle population were frozen upon receiving them to conserve the information on their associated community before the attempt to establish lab rearing with the remaining specimen. Yeast isolation Yeasts were isolated from the currently reared beetle cultures St. paniceum ‘JKI’, ‘cornflakes’ & ‘chili’ as well as L. serricorne ‘JKI’, ‘greece’, ‘chickpea’ & ‘chili’ (Table 1 ). Entire individuals (adults or larvae) were surface sterilized in 70% ethanol for 1 min, twice washed in sterile cultivation medium for 30 seconds each. Subsequently, mycetomes were dissected, homogenized with a pipette tip in 100 µL of cultivation medium and spread on agar plates. Hansen’s broth or agar was prepared following Pant & Fraenkel [ 20 ]: 50g/L glucose, 10g/L peptone from soy, 3g/L KH2PO4, 3g/L MgSO4 and 15g/L agar-agar. Agar plates were supplemented with 15 mg/L tetracycline hydrochloride, 15 mg/L nalidixic acid and 25mg/L chloramphenicol to suppress growth of bacteria. Growth of yeast colonies could be observed within three to twelve weeks, whereafter single colonies were transferred twice to agar plates described above and were afterwards maintained on Hansen’s agar or potato-dextrose agar containing 4g/L potato infusion, 20g/L glucose, 15 g/L agar-agar without the addition of antibacterial supplements. Cultures plates were incubated within loosely closed, sterile plastic bags at 25°C in the dark. Thereby we obtained seven strains of Symbiotaphrina in addition to two strains purchased from culture collections (Table 2 ). Table 2 Isolated yeast- like symbiont strains and their origin YLS species strain origin Symbiotaphrina buchneri Symbiotaphrina buchneri NBRC 10845 Institute for Fermentation, Osaka (ISO Japan); originally isolated at the National Institute of Sericulture and Entomological Science from gut cecum of Stegobium paniceum Symbiotaphrina kochii Symbiotaphrina kochii CBS 250.77 Westerdijk Fungal Biodiversity Institute (CBS, Netherlands) originally isolated from Lasioderma serricorne (Jurzitza 1964) Stegobium ‘chili’ symbiont Symbiotaphrina sp. chili-Sp Stegobium paniceum ‘chili’ Stegobium ‘cornflakes’ symbiont Symbiotaphrina sp. cornflakes Stegobium paniceum ‘cornflakes’ Stegobium ‘greece’ symbiont Symbiotaphrina sp. greece Stegobium paniceum ‘greece’ Lasioderma ‘chickpea’ symbiont Symbiotaphrina sp. chickpea Lasioderma serricorne ‘chickpea’ Lasioderma ‘chili’ symbiont Symbiotaphrina sp. chili-Ls Lasioderma serricorne ‘chili’ Stegobium ‘JKI’ symbiont Symbiotaphrina sp. JKI-Sp Stegobium paniceum ‘JKI’ Lasioderma ‘JKI’ symbiont Symbiotaphrina sp. JKI-Ls Lasioderma serricorne ‘JKI’ DNA- Extraction Beetle samples (Table 1 ) were either frozen (-20°C) or freshly collected from lab reared cultures. They were homogenised individually using glass beads and a bead mill at 30 Hz for 1 minute. Yeast isolates were scraped off the agar plates and suspended in 300 µL Tissue and Cell Lysis Solution. DNA was extracted using the Epicenter MasterPure Complete DNA and RNA Purification kit (Lucigen, Wisconsin, USA) following the user’s instructions with the following modifications: 25 U zymolyase was added to the homogenised samples with Tissue and Cell Lysis Solution and samples were incubated at 35°C for 30 minutes before proceeding with the protocol. DNA pellets were resuspended in 50 µL LOW TE buffer (10 mM Tris-HCl (pH 8.0) + 0.1 mM EDTA) and stored at -20°C. DNA concentration and purity were measured using NanoDrop 1000 (Peqlab/ Thermo Scientific, Wilmington, USA). Purification of DNA extracts DNA extracts of bad quality were further purified with a phenol chloroform modification of the extraction kit to improve the removal of interfering compounds beyond the usual protein precipitation based on the addition of acetic acid. 250 µL Tissue and Cell Lysis Solution was added to the extracts. They were kept on ice for 3 to 5 minutes and 600 µL phenol/chloroform/isoamylalcohol was added. Samples were vigorously vortexed and incubated for 10 minutes at room temperature. After centrifuging at 8000 rpm for 5 minutes, the upper phase was carefully transferred into a new tube and the organic phase was discarded. 500 µL isopropanol were added to the samples, they were inverted for 30–40 times and stored at -20°C for about 3 hours. Samples were centrifuged for 10 minutes at 14000 rpm and the supernatant was discarded. The pellet was washed with 200 µL of cold ethanol (70%) and centrifuged for 5 minutes at 14000 rpm. The supernatant was discarded, the pellet was dried using a SpeedVac (Thermo Scientific, Waltham, MA, USA) and resuspended in 50 µL Low TE. Samples were stored at – 20°C. Fungal community analysis The fungal community of adult beetles of L. serricorne populations ‘chickpea’ and ‘greece’, as well as St. paniceum populations ‘chili’ and ‘cornflakes’ were analysed in two generations. Therefore, beetle samples were immediately frozen upon receiving the populations to conserve their microbial composition before rearing in the lab (F0 generation). The remaining populations were reared and established as lab cultures. Out of each of the four beetle cultures ten living beetles were collected (Fx generation). In addition, a wild caught Ernobius sp , a L. serricorne ‘forest’ and a St. paniceum ‘ginger’ beetle and individuals from lab cultures L. serricorne ‘JKI’, ‘chili’ as well as St. paniceum ‘JKI’ were analysed. DNA was extracted individually for all samples (see above). For each of the described populations, 2–10 individual DNA extracts were pooled. The individual DNA concentrations were considered and an equal amount of DNA from each individual was used to contribute to a total DNA amount of circa 200 ng in each pool. Pools were sent for paired end Illumina MiSeq sequencing of fungal ITS region at StarSEQ (Mainz, Germany) using a primer pair that yields sequences of circa 300 bp length (forward 5’-CTTGGTCATTTAGAGGAAGTAA- 3’; reverse 5’ – GCTGCGTTCTTCATCGATGC- 3’). Untrimmed Illumina MiSeq reads were obtained from StarSEQ. Primers at the 3’ ends were trimmed using cutadapt [ 27 ] in miniconda. Reads were quality filtered with a threshold of 20 for quality scores and further trimmed using RStudio (2024.04.2). Forward and reverse reads were merged. Sequences smaller than 50 nucleotides were discarded and error rates were determined. Because dada2 package version 1.1. was used, dereplicating was necessary. Afterwards Amplicon Sequence Variants (ASVs) were inferred. Data from two sequencing runs were combined and the previously inferred ASVs were assigned to a taxonomy using the UNITE ITS fungal databank general release dynamics [ 28 ]. The FASTA sequences for all top 30 ASVs were extracted and manually checked in NCBI with BLASTn and UNITE. Wrong classifications were corrected and unclassified ASVs were determined if possible. Principal coordinate analysis based on Bray-Curtis dissimilarity was generated in RStudio (2024.04.2) using the “phyloseq” package. The yeasts isolated from L. serricorne and St. paniceum beetles (Table 2 ) were phylogenetically classified based on the partial rRNA operon. The partial rRNA operons of St. paniceum ‘chili’ symbiont, St. paniceum ‘cornflakes’ symbiont, St. paniceum ‘greece’ symbiont, L. serricorne ‘chickpea’ symbiont, L. serricorne ‘chili’ symbiont, L. serricorne ‘JKI’ symbiont (isolates H4 & C1) and lab cultures of Sy. buchneri (NBRC 10845) and Sy. kochii (CBS 250.77) were amplified using a LongAmp polymerase (New England Biolabs, Ipswich, USA) with different primer combinations (Table 3 ). Amplification settings consisted of an initial denaturation at 94°C for 3 minutes, 30 cycles of denaturation at 94°C for 30 seconds, annealing at 48°C for 60 seconds and elongation at 65°C for 7 minutes, followed by final elongation step at 65°C for 10 minutes. To amplify the partial rRNA operon from yeasts from Ernobius and St. paniceum ginger the beetle gDNA extracts were used. Additionally, parts of the rRNA operons of St. paniceum ‘JKI’ symbiont (isolates B4, E5, F3, G3, G5, H4, H5) and L. serricorne ‘JKI’ symbiont (isolate F3) were amplified with a peqlab Taq polymerase (VWR, Darmstadt, Germany): initial denaturation at 94°C for 3 minutes, 30 cycles of denaturation at 94°C for 30 seconds, annealing at 48°C for 60 seconds and elongation at 72°C for 120 seconds, final elongation step at 72°C for 10 minutes. PCR- products were purified using the innuPREP PCRpure Kit (AnalyticJena, Jena, Germany) following the manufacturer’s instructions with the following modifications: first 100 µL binding buffer were added to the PCR products, samples were added to the spin filter and centrifuged for 2 minutes at 12000 rpm. The PCR products were washed twice with 100 µL binding buffer firstly centrifuging for 2 minutes and secondly for 5 minutes at 12000 rpm. The filter was dried open for 10–15 minutes. For elution of pure PCR-products 10 µL dH 2 0 were used. Purified PCR products were Sanger sequenced by StarSEQ (Mainz, Germany). Sequences were edited using BioEdit 7.2.5 [ 29 ]. Sequences for each sample were aligned. If alignment was not possible due to lacking overlap, Sy. buchneri (DQ248313.1) or Sy. kochii (DQ248314) sequences were used as a query. Consensus sequences were created for each sample, in total 20 consensus sequences were used. Table 3 Primer for amplification and sequencing of fungal rRNA operon. primer direction Sequence 5‘ ->3‘ target reference LR5 reverse ATCCTGAGGGAAACTTC Fungal 28 S rRNA Fungal 28 S rRNA 30 Fungi_LS1 forward TACCCGCTGAACTTAAG 31,32 ITS1 forward TCCGTAGGTGAACCTGCGG ITS region between 18 S and 28 S rRNA of fungi 33 ITS4 reverse TCCTCCGCTTATTGATATGC ITS5 forward GGAAGTAAAAGTCGTAACAGG S_buchneri_fwd1 forward CTGCAGTTGATCAACCGGT Sy. buchneri 28 S This study S_buchneri_fwd2 forward CGGTGCACTCTTCTGCAGA S_buchneri_rev2 reverse GCCTTTATCCAACCACCCAAACT S_kochii_rev1 reverse CCCGACCTTTATCCAGCCG Sy. kochii 28S S_kochii_rev2 reverse CCGAAGAGAGCTACATTCCC S_kochii_fwd2 forward GCTCAGCCGTGGTTCTCC Sym_buch_classic forward GCCGATGTTCGTTCTCG ITS region of Sy. buchneri type strains, Stegobium ‘greece’ symbiont & Lasioderma ‘chickpea’ symbiont Sym_novel forward CGTTGTCTGCTCTCACGAG ITS region of Stegobium ‘chili’ symbiont & Stegobium ‘cornflakes’ symbiont Additionally, 20 sequences of closely related Symbiotaphrina species were obtained from NCBI, based on Baral et al. [ 16 ]. The final alignment of the 40 sequences was created in Geneious prime (2023.0.3, Auckland, New Zealand) using MAFFT (v7.490) [ 34 , 35 ]. Sequences of Sy. buchneri DQ248313.1 and Sy. kochii DQ248314 were cut to fit the general length of the other sequences. A Maximum likelihood tree was calculated using RAxML (8.2.11) [ 36 ] in Geneious with GTR + G as substitution model and 10000 bootstrapping replicates. A Bayesian inference tree was calculated using MrBayes (3.2.6) [ 37 ] implemented in Geneious using the GTR + G substitution model and Deltopyxis trianulispora as the outgroup. MCMCs were set to 1100000 with 100000 burn-in and 200 subsampling. Resulting trees were rooted to the outgroup. Diagnostic PCR Based on the phylogenetic placement of Symbiotaphrina isolates and the underlying alignment, diagnostic primers for distinction of Symbiotaphrina isolate groups were designed. The first group, containing the sequences of Stegobium ‘greece’ symbiont, Lasioderma ‘chickpea’ symbiont, Lasioderma ‘JKI’ symbiont and Stegobium ‘JKI’ symbiont clustered with Sy. buchneri type strains. The second group containing Stegobium ‘chili’ symbiont and Stegobium ‘cornflakes’ symbiont clustered as a sister group to the fist group. One forward primer was designed for each group: Sym_buch_classic (5’ –GCCGATGTTCGTTCTCG – 3’) targeting the ITS region of Sy. buchneri type strains, Stegobium ‘greece’ symbiont and Lasioderma ‘chickpea’ symbiont and Sym_novel (5’ – CGTTGTCTGCTCTCACGAG – 3’) targeting the ITS region of Stegobium ‘chili’ symbiont and Stegobium ‘cornflakes’ symbiont. The online tool Primer3 (v.1.4.1) [ 38 – 40 ] was used to optimise primer length and to avoid self-complementarity. Paired with ITS4 (Table 3 ) as a reverse primer, they should yield PCR-products of circa 500 bp length. PCR conditions were optimized with a gradient of annealing temperatures. The best conditions for Sym_buch_classic were an initial denaturation at 94°C for 3 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 57,5°C for 60 seconds and elongation at 72°C for 120 seconds, and final elongation at 72°C for 10 minutes. The best conditions for Sym_novel were an initial denaturation at 94°C for 3 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 63°C for 60 seconds and elongation at 72°C for 120 seconds, and final elongation at 72°C for 10 minutes. To distinguish both Symbiotaphrina sp. strain groups in the samples that were used in the fungal community analysis, PCRs with both primers were run with the individual DNA extracts of L. serricorne ‘chickpea’ F0 & Fx, L. serricorne ‘greece’ F0 & Fx, L. serricorne ‘JKI’, L. serricorne ‘forest’, L. serricorne ‘chili’, St. paniceum ‘chili’ F0 & Fx, St. paniceum ‘cornflakes’ F0 & Fx, St. paniceum ‘JKI’, St. paniceum ‘ginger’ and Ernobius . Since the L. serricorne ‘chili’ symbiont clustered with Sy. kochii and PCRs using Sym_buch_classic and Sym_novel were negative, a diagnostic PCR for Sy. kochii was performed. The primer pair S_kochii_fwd2 (5’ –GCTCAGCCGTGGTTCTCC– 3’) and S_kochii_rev2 (5’ –CCGAAGAGAGCTACATTCCC– 3’) targeting the 28S region of Sy. kochii was used with an initial denaturation at 95°C for 3 minutes, 40 cycles of denaturation at 95°C for 30 seconds, annealing at 62°C for 30 seconds and elongation at 72°C for 30 seconds, and final elongation at 72°C for 3 minutes. Amplicons were analysed on an 1,6% agarose gel running for 30–40 minutes at 130 V using 3 µL PCR product mixed with 2 µL loading buffer. Declarations Author contributions T.E conceptualization, supervision, methodology, investigation, writing A.N. investigation, visualization, writing R.S. investigation T.E., C.A. & C.G.A. collected, maintained and provided insect cultures All authors revised and approve the manuscript. Data availability statement Sequence data is deposited on under Bioproject PRJNA1210556, Genbank PX406542-PX406559 and Edmond [41]. Additional Information Competing interests The authors declare no competing interest. References McFall-Ngai, M. et al. Animals in a bacterial world, a new imperative for the life sciences. Proc. Natl. Acad. Sci. U. S. A. 110, 3229–3236 (2013). Klepzig, K., Adams, D., Handelsman, A. S., Raffa, K., Symbioses, F. & J. &, A Key Driver of Insect Physiological Processes, Ecological Interactions, Evolutionary Diversification, and Impacts on Humans. Environ. Entomol. 38 , 67–77 (2009). Sudakaran, S., Kost, C. & Kaltenpoth, M. Symbiont Acquisition and Replacement as a Source of Ecological Innovation. Trends Microbiol. 25 , 375–390 (2017). Akman Gündüz, E. & Douglas, A. E. Symbiotic bacteria enable insect to use a nutritionally inadequate diet. Proc. Biol. Sci. 276, 987–991 (2009). Hansen, A. K. & Moran, N. A. Aphid genome expression reveals host-symbiont cooperation in the production of amino acids. Proc. Natl. Acad. Sci. U. S. A. 108, 2849–2854 (2011). Engel, P. & Moran, N. The gut microbiota of insects - diversity in structure and function. FEMS Microbiol. Rev. 37 , 699–735 (2013). Douglas, A. Multiorganismal insects: diversity and function of resident microorganisms. Annu. Rev. Entomol. 60 , 17–34 (2015). Buchner, P. Endosymbiosis of Animals with Plant Microorganisms (John Whily & Sons, Inc, 1965). Jurzitza, G. Die Symbiose der Anobiiden und Cerambyciden mit hefeartigen Pilzen. Arch. Mikrobiol . 43 , 412–424 (1962). Martinson, V. G. Rediscovering a Forgotten System of Symbiosis: Historical Perspective and Future Potential. Genes 11 (2020). Breitsprecher, E. Beiträge zur Kenntnis der Anobiidensymbiose. Z. Morphol. Oekol Tiere . 11 , 495–538 (1928). Jurzitza, G. Der Vitaminbedarf normaler und aposymbiontischer Lasioderma serricorne F. (Coleoptera, Anobiidae) und die Bedeutung der symbiontischen Pilze als Vitaminquelle fiir ihre Wirte. Oecologia 3, 70–83 (1969). Jurzitza, G. Über Isolierung, Kultur und Taxonomieb einiger Anobiidensymbionten (Insecta, Coleoptera). Arch. Mikrobiol . 72 , 203–222 (1970). Jurzitza, G. Studien an der Symbiose der Anobiiden II. Physiologische Studien am Symbionten von Lasioderma serricorne F. Arch. Mikrobiol . 49 , 331–340 (1964). Kühlwein, H. & Jurzitza, G. Studien an der Symbiose der Anobiiden. Arch. Mikrobiol . 40 , 247–260 (1961). Baral, H., Weber, O., Marson, E., Quijada, L. & G. & A new connection between wood saprobism and beetle endosymbiosis: the rarely reported saprobic discomycete Tromeropsis is congeneric with the symbiotic yeast Symbiotaphrina (Symbiotaphrinales, Xylonomycetes) and two asexual morphs misplaced in Hyphozyma. Mycol. Prog . 17 , 215–254 (2017). Ashworth, J. The Biology of Lasioderma serricorne . J. Stored Prod. Res. 29 , 291–303 (1993). Howe, R. W. A Laboratory study of the cigarette beetle, Lasioderma serricorne (F.) (Col., Anobiidae) with a critical review of the literature on its biology. Bull. Entomol. Res. 48, 9–56 (1957). Blewett, M. & Fraenkel, G. Intracellular symbiosis and vitamin requirements of two insects, Lasioderma serricorne and Sitodrepa panicea . Proc. R. Soc. Lond. B Biol. Sci. 132, 212–221 (1944). Pant, N. & Fraenkel, G. C Studies on the Symbiotic Yeasts of Two Insect Species, Lasioderma serricorne F. and Stegobium paniceum L. Biol. Bull. 107, 420–432 (1954). Jurzitza, G. Über die Lieferung von Sterinen durch die hefeartigen Endosymbionten von L. serricorne (Coleoptera, Anobiidae) und die ökologische Bedeutung dieser Leistung für den Wirt. Oecologia 16 , 163–172 (1974). Pant, N., Gupta, C., Nayar, J. & P. & Physology of intercellular Symbionts of Stegobium paniceum L. with Special Reference to Amino Acid Requirements of the Host. Experientia 15 , 311–312 (1959). Jurzitza, G. Die Rolle der hefeartigen Symbionten von L. serricorne (Coleoptera, Anobiidae) im Proteinmetabolismus ihrer Wirte. Z. für vergleichende Physiologie . 63 , 165–181 (1969). Pant, N. & Fraenkel, G. C The Function of the Symbiotic Yeasts of Two Insect Species, Lasioderma serricorne F. and Stegobium ( Sitodrepa ) paniceum L. Science 112, 498–500 (1950). Foeckler, F. Reinfektionsversuche steriler Larven von Stegobium paniceum L. mit Fremdhefen und die Beziehungen zwischen der Entwicklungsdauer der Larven und dem Vitamin-B Gehalt des Futters und der Hefen. Zeit Morphol. Oekol Tiere . 50 , 119–162 (1961). Jones, K. G., Dowd, P. F. & Blackwell, M. Polyphyletic origins of yeast-like endocytobionts from anobiid and cerambycid beetles. Mycol. Res. 103 , 542–546 (1999). Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 17 , 10–12 (2011). Abarenkov, K. et al. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: sequences, taxa and classifications reconsidered. Nucleic Acids Res. 52 , D791–D797 (2024). Hall, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic acid symposium series 41, 91–98 (1999). Vilgalys, R. & Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172 , 4238–4246 (1990). Hausner, G., Reid, J. & Klassen, G. R. On the phylogeny of Ophiostoma , Ceratocystis s.s. , and Microascus , and relationships within Ophiostoma based on partial ribosomal DNA sequences. Can. J. Bot. 71, 1249–1265 (1993). Gibson, C. M. & Hunter, M. S. Inherited fungal and bacterial endosymbionts of a parasitic wasp and its cockroach host. Microb. Ecol. 57 , 542–549 (2009). White, T., Burns, J., Lee, T. D., Taylor, J. & S., B & W. in PCR - Protocols and Applications - A Laboratory Manual 315–322 (Academic, 1990). Katoh, K., Misawa, K., Kuma, K. & Miyata, T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30 , 3059–3066 (2002). Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30 , 772–780 (2013). Stamatakis, A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30 , 1312–1313 (2014). Huelsenbeck, J., Ronquist, F. & P & MRBAYES: Bayesian inference ofphylogenetic trees. Bioinf. Application Note . 17 , 754–755 (2001). Koressaar, T. et al. Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics 34 , 1937–1938 (2018). Koressaar, T. & Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 23 , 1289–1291 (2007). Untergasser, A. et al. Primer3-new capabilities and interfaces. Nucleic Acids Res. 40 , e115 (2012). Engl, T., Nick, A. & Alignment_Symbiotaphrina_partial_rRNA_operon Edmond doi: 10.17617/3.5MAW2Z . (2025). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 08 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 07 Nov, 2025 Reviews received at journal 05 Nov, 2025 Reviews received at journal 22 Oct, 2025 Reviewers agreed at journal 17 Oct, 2025 Reviewers agreed at journal 13 Oct, 2025 Reviewers invited by journal 13 Oct, 2025 Editor invited by journal 06 Oct, 2025 Editor assigned by journal 04 Oct, 2025 Submission checks completed at journal 03 Oct, 2025 First submitted to journal 01 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7759551","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":533539717,"identity":"df7277a6-b4d7-456a-b6d9-18e75f150874","order_by":0,"name":"Alina Nick","email":"","orcid":"","institution":"Max Planck Institute for Chemical Ecology","correspondingAuthor":false,"prefix":"","firstName":"Alina","middleName":"","lastName":"Nick","suffix":""},{"id":533539718,"identity":"3ca1c505-166c-47b3-aefc-bb2f8d1066ea","order_by":1,"name":"René Schellenberg","email":"","orcid":"","institution":"Johannes Gutenberg University Mainz","correspondingAuthor":false,"prefix":"","firstName":"René","middleName":"","lastName":"Schellenberg","suffix":""},{"id":533539719,"identity":"b6f813f8-3cc7-4aa6-bcea-e53aefb37280","order_by":2,"name":"Christos G. Athanassiou","email":"","orcid":"","institution":"University of Thessaly","correspondingAuthor":false,"prefix":"","firstName":"Christos","middleName":"G.","lastName":"Athanassiou","suffix":""},{"id":533539720,"identity":"a59145b3-e129-47f2-9e79-a17e14996285","order_by":3,"name":"Cornel Adler","email":"","orcid":"","institution":"Julius Kühn-Institut","correspondingAuthor":false,"prefix":"","firstName":"Cornel","middleName":"","lastName":"Adler","suffix":""},{"id":533539721,"identity":"28aea958-249f-4b33-858d-df80251dc87f","order_by":4,"name":"Tobias Engl","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYLCCBxUSMCYzYdU8ICLhDMlaEtvgfCK02LP3Hn6ROM9Cnp+BO+3hFwZrOcK28JxLs0jcJmE4s4F3u7EMQ7oxYS0SOWYGQC0JBgd4t0lLMBxObCCoRf4NUMsciQR7qJZ6wlokeIwfJDYAbWHg3Sb5geFwAmGHnckxY0g4JmE44zDQLwwG6YYEbWFvP2P84UNNnTx/e++2hz8qrOUJ2gIEbJB4ZGZgY+YxIEYDUO0HmF7GH8TpGAWjYBSMghEGAGO5NEHf84n+AAAAAElFTkSuQmCC","orcid":"","institution":"Max Planck Institute for Chemical Ecology","correspondingAuthor":true,"prefix":"","firstName":"Tobias","middleName":"","lastName":"Engl","suffix":""}],"badges":[],"createdAt":"2025-10-01 12:38:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7759551/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7759551/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-34676-y","type":"published","date":"2026-01-08T15:57:13+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94471648,"identity":"c0ceb8a9-2fec-4dc0-a60f-04ca7c4f8e62","added_by":"auto","created_at":"2025-10-27 15:39:03","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1357930,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscriptanobiidaeyeastsreferencesedited.docx","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/e217e094a05bf0d8aa791537.docx"},{"id":94471700,"identity":"42dddea8-5052-4a97-93da-323db0e175c6","added_by":"auto","created_at":"2025-10-27 15:39:17","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6488,"visible":true,"origin":"","legend":"","description":"","filename":"76b81e3a8c514251802fbb79bfed51e0.json","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/64e13d317f1dfd84ecce94be.json"},{"id":94472285,"identity":"fc98d602-3985-4953-add9-2f702f1751eb","added_by":"auto","created_at":"2025-10-27 15:41:12","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128980,"visible":true,"origin":"","legend":"","description":"","filename":"76b81e3a8c514251802fbb79bfed51e01enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/e5d79486b5202b6bf0a0dbe6.xml"},{"id":94472257,"identity":"123cf44d-18d0-4ef9-8799-0acf2651445b","added_by":"auto","created_at":"2025-10-27 15:41:04","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130004,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/f0dc621b57f1bfa81b47c78c.png"},{"id":94472127,"identity":"c1fe3280-20f8-460c-a579-bc1a3abdbaa8","added_by":"auto","created_at":"2025-10-27 15:40:50","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":73298,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/b1c7879f44577fe46055a47f.png"},{"id":94471941,"identity":"7dc8b332-9f19-40f7-83d3-cb3d1fdf5094","added_by":"auto","created_at":"2025-10-27 15:40:26","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":302176,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/09e4f333cdd1e0754e96a3e6.png"},{"id":94471902,"identity":"b473d59c-9d69-4ce8-9bef-bef7ffba6ffb","added_by":"auto","created_at":"2025-10-27 15:40:16","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":258800,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/3b8fa55e6aab90be45adc881.png"},{"id":94472170,"identity":"fe4aa241-bf65-414e-bb28-fe5bbf84c8eb","added_by":"auto","created_at":"2025-10-27 15:40:54","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":703777,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/c15f4358de859c27348e8202.jpeg"},{"id":94472116,"identity":"307f3af4-ee08-4929-b556-bc5d71d75694","added_by":"auto","created_at":"2025-10-27 15:40:48","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":40732,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/2904f2fe8e8a40f977d1ac17.png"},{"id":94471992,"identity":"c070c698-e021-4c43-bb43-9ccbe841a6e2","added_by":"auto","created_at":"2025-10-27 15:40:38","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46021,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/39a47fffd0c899df009ddb65.png"},{"id":94472117,"identity":"bd0179d6-7fac-46a4-82ec-beea3af054b1","added_by":"auto","created_at":"2025-10-27 15:40:48","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51680,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/d8ebd59f58d95e1f9533975c.png"},{"id":94471903,"identity":"d7a1e8f7-4aa2-4102-82a5-01da026d9113","added_by":"auto","created_at":"2025-10-27 15:40:17","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66537,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/4f4d09bb231fc441864f4ade.png"},{"id":94471627,"identity":"e11818c5-44ad-4d83-9846-13701411479c","added_by":"auto","created_at":"2025-10-27 15:38:43","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":248220,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/82b9878dbe23519a837ddadf.png"},{"id":94471650,"identity":"a56086fe-e26a-4c0f-83a9-06982622e940","added_by":"auto","created_at":"2025-10-27 15:39:03","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130197,"visible":true,"origin":"","legend":"","description":"","filename":"76b81e3a8c514251802fbb79bfed51e01structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/1e6abf201f19c026008efa50.xml"},{"id":94471802,"identity":"00e7a90b-6e83-486d-ba5e-8a3361e6a490","added_by":"auto","created_at":"2025-10-27 15:39:54","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150449,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/7c50791048441cdb289b2612.html"},{"id":94471897,"identity":"1c353ba7-a8e2-4b21-a500-470d64100041","added_by":"auto","created_at":"2025-10-27 15:40:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":184277,"visible":true,"origin":"","legend":"\u003cp\u003eComposition and relative abundance of fungal genera in anobiid beetles. Amplicon Sequence Variants (ASVs) were inferred from merged forward and reverse reads of ITS Illumina paired end sequencing, top 30 ASVs named, remaining summarized as “other”; undetermined fungal ASVs are summarised as fungi. ASV_1, ASV_3 \u0026amp; ASV_21 could not be assigned to fungi and are labelled as NA; JKI= Julius Kühn Institute, F0 = native beetles (“generation 0”), Fx = lab reared beetles (“generation x”); negative 1 = negative control run 1; negative 2 = negative control run 2\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/8ac653b86499c16a49b8942f.png"},{"id":94471651,"identity":"8d1903b5-3fbc-4e27-9596-9aa049e1a086","added_by":"auto","created_at":"2025-10-27 15:39:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":174745,"visible":true,"origin":"","legend":"\u003cp\u003ePrincipal Coordinate Analysis of fungal communities from anobiid beetles based on Bray-Curtis dissimilarity.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/0a00338a9e58f393de0c8b08.png"},{"id":94471738,"identity":"14013f36-fd68-4b97-8eb7-c6ecf3dbdfab","added_by":"auto","created_at":"2025-10-27 15:39:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":497064,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic placement of yeast isolates and uncultured anobiid symbionts. Combined gene tree of MrBayes \u0026amp; RAxML phylogenies (individual trees in Supplementary figures 2 + 3). Posterior probabilities (left) \u0026amp; bootstrap support values (right) are given on branches, values with weak support (posterior probabilities \u0026lt;0,9, bootstraps \u0026lt;70) are not shown. Orange box: \u003cem\u003eSy. buchneri\u003c/em\u003e clade; yellow box: novel \u003cem\u003eSymbiotaphrina\u003c/em\u003eclade; red box: \u003cem\u003eSy. kochii\u003c/em\u003e clade.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/0d6f6c2a1a85f27fdf3b4bcf.png"},{"id":94472264,"identity":"dd7205f2-8e5a-4fb1-a214-ae00a611774c","added_by":"auto","created_at":"2025-10-27 15:41:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":518441,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic placement of \u003cem\u003eSymbiotaphrina\u003c/em\u003e ASVs within yeast phylogeny. Phylogenetic tree based on RAxML phylogeny containing bootstrap support values are given on branches. Orange box: \u003cem\u003eSy. buchneri\u003c/em\u003e clade; yellow box: novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e clade; red box: \u003cem\u003eSy. kochii\u003c/em\u003e clade.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/14467abe1322a4aa7fee3eae.png"},{"id":94471991,"identity":"8316bab9-4f6f-46d2-abdd-e804afd08200","added_by":"auto","created_at":"2025-10-27 15:40:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":411906,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of diagnostic polymerase chain reaction amplicons. A) Diagnostic primer combinations Sym_buch_classic \u0026amp; Sym_novel are suitable to differentiate \u003cem\u003eSymbiotaphrina \u003c/em\u003estrains in DNA extracts of whole beetles. Amplification of partial rRNA operon of the \u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e strains (ca. 500 bp) from DNA extracts of whole beetles was either successful with Sym_buch_classic or Sym_novel, no sample had PCR success with both primers. PCR using Sym_buch_classic was successful for \u003cem\u003eL. serricorne\u003c/em\u003e‘chickpea’ (F0 \u0026amp; Fx), \u003cem\u003eL. serricorne\u003c/em\u003e ‘greece’ (F0 \u0026amp; Fx), \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’ and \u003cem\u003eL. serricorne\u003c/em\u003e ‘forest’ (Lf), as well as \u003cem\u003eSt. paniceum\u003c/em\u003e JKI beetle extracts. PCR using Sym_novel was successful for \u003cem\u003eSt. paniceum\u003c/em\u003e ‘chili’ (F0 \u0026amp; Fx), \u003cem\u003eSt. paniceum\u003c/em\u003e ‘cornflakes’ (F0 \u0026amp; Fx), \u003cem\u003eSt. paniceum\u003c/em\u003e ‘ginger’ (Sg) and \u003cem\u003eErnobius\u003c/em\u003e sp. (E) beetle extracts. For \u003cem\u003eL. serricorne\u003c/em\u003e ‘chili’ neither PCR was successful. Ls= \u003cem\u003eL. serricorne\u003c/em\u003e, Sp= \u003cem\u003eSt. paniceum\u003c/em\u003e, Lf= \u003cem\u003eL. serricorne\u003c/em\u003e forest, JKI = Julius Kühn Institute, E= \u003cem\u003eErnobius\u003c/em\u003e, Sg= \u003cem\u003eSt. paniceum\u003c/em\u003e ginger, F0 = extracts from native beetles (“generation 0”), Fx = lab reared beetles (“generation x”), x= empty slot, +=positive control, - =negative control. original gels are presented in Supplementary Figure 4. B) Diagnostic primers for \u003cem\u003eSy. kochii\u003c/em\u003e successfully amplified symbionts of \u003cem\u003eL. serricorne\u003c/em\u003e‘chili’. Amplification of partial rRNA operon of the \u003cem\u003eSymbiotaphrina kochii\u003c/em\u003estrain (ca. 100 bp) from DNA extracts of whole beetles and the yeast isolated from \u003cem\u003eL. serricorne\u003c/em\u003e ‘chili’; x=empty slot; original gel in Supplementary Figure 4\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/7c1fba2abd34c638c3ae3fb2.png"},{"id":100069662,"identity":"f952518a-52a5-40f5-9434-47a4e4afaef7","added_by":"auto","created_at":"2026-01-12 16:15:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2503679,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7759551/v1/fc2a773b-f3bb-48ab-88cd-f63979ef9ab6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eDiversity of yeast-like \u003cem\u003eSymbiotaphrina \u003c/em\u003esymbionts in the stored product pests \u003cem\u003eLasioderma serricorne\u003c/em\u003e and \u003cem\u003eStegobium paniceum\u003c/em\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMicrobes are omnipresent in the environment: they surround, impact and interact with every organism forming diverse associations, communities, and ecosystems [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The highly diverse associations between insects and microbes can be major drivers of evolution [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Besides antagonistic microbes including competitors, parasites and pathogens, mutualistic microbial symbionts contribute often crucially to their host\u0026rsquo;s metabolism enabling the insects to adapt to new ecological niches [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The supplementation of essential amino acids, vitamins or sterols by microbial mutualists enables various insects to feed on nutrient poor or unbalanced diets [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Many nutritional mutualisms are highly stable and conserved across taxonomic groups while defensive or detoxifying ones can be more flexible and thereby exhibit higher variation within the microbial partners [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Symbiont localization might also influence the stability of a symbiosis. Endosymbionts living inside the host\u0026rsquo;s body are isolated from the environment while ectosymbionts living outside of the host\u0026rsquo;s body cavity (including the gut) encounter other microbes more frequently [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Accordingly, exchange of microbes and/or genetic material encoding metabolic functions can occur more frequently for these ectosymbionts.\u003c/p\u003e\u003cp\u003eSymbiont harbouring tissues can have various degrees of complexity ranging from gut invaginations or crypts to distinct organs called bacteriomes or mycetomes (depending on whether they house bacteria or fungi) where microbes can occur intra- and/or extracellularly [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Examples of both types of symbiont harbouring organs can be found in anobiid beetles (Coleoptera: Ptinidae, also known as Anobiidae) which are associated with yeast-like symbionts (YLS) [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Larvae and adults harbour the YLS intracellularly in specialized epithelial cells (mycetocytes) located in evaginations of the midgut (mycetomes) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Additionally, female adults harbour extracellular YLS in intersegmental tubules that are connected to the reproductive organs [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. During oviposition, the egg surface is smeared with YLS, the newly hatched larvae consume a part of the eggshell and YLS can colonise the mycetocytes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In contrast to most other symbioses, these dual microbe harbouring organs represent an intermediate stage between strictly extracellular and intracellular symbioses while the intermittent intracellular life stage is likely a strong selection pressure for specific microbes capable of invading but not overexploiting this host environment.\u003c/p\u003e\u003cp\u003eAlthough, the presence of YLS has been described in many anobiids [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] cultivation and characterization were only successful from five anobiid species [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Out of these five species, only the symbiosis of the tabaco beetle \u003cem\u003eLasioderma serricorne\u003c/em\u003e and the drugstore beetle \u003cem\u003eStegobium paniceum\u003c/em\u003e with their YLS are relatively well studied. \u003cem\u003eL. serricorne\u003c/em\u003e was described to be associated with \u003cem\u003eSymbiotaphrina kochii\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and \u003cem\u003eSt. paniceum\u003c/em\u003e was described to be associated with \u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] (Ascomycota: Symbiotaphrinales: Symbiotaphrinaceae [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Remarkably, neither \u003cem\u003eL. serricorne\u003c/em\u003e nor \u003cem\u003eSt. paniceum\u003c/em\u003e feed on (dead) wood like other anobiids but have diverged to be stored product pests. Both beetles feed on a variety of stored products, mainly dead plant material, making them economically important pests [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSince the transmission of YLS happens via the egg surface, egg surface sterilization can yield symbiont-free beetles (aposymbiotic). Experiments with symbiotic and aposymbiotic insects inferred that \u003cem\u003eSy. kochii\u003c/em\u003e and \u003cem\u003eSy. buchneri\u003c/em\u003e supplement \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e with B -vitamins [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], sterols [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and amino acids [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Interestingly, aposymbiotic insects can also acquire YLS from the environment, for example from faeces of conspecifics [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Reinfection experiments with \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e and \u003cem\u003eSy. kochii\u003c/em\u003e and \u003cem\u003eSy. buchneri\u003c/em\u003e showed that the symbionts are exchangeable between the beetles with no or little difference in their development [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Similarly, experimental infections with a related yeast-like fungus established intracellularly, however with a strongly exaggerated, seemingly pathogenic infection spread into gut epithelial tissues beyond the mycetome [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Despite the specific requirements for the intracellular life stage this system seems to be able to maintain a certain flexibility regarding the microbial partner. However, the diversity of beetle and yeast association has only been studied by culture dependent methods and without a focus on variability in the infecting species or strains of yeasts. The necessity for more sensitive approaches, e.g. offered by molecular methods is even more imperative, since Baral \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] found \u003cem\u003eSymbiotaphrina\u003c/em\u003e species closely related to \u003cem\u003eSy. buchneri\u003c/em\u003e and \u003cem\u003eSy. kochii\u003c/em\u003e on decaying wood \u0026ndash; an ecological niche shared with many Anobiid beetles. They suggest that \u003cem\u003eSy. buchneri\u003c/em\u003e and \u003cem\u003eSy. kochii\u003c/em\u003e have an undiscovered free- living, sexual morph and that the newfound species might have an undiscovered symbiotic relationship with arthropods.\u003c/p\u003e\u003cp\u003eThis study aims to investigate the diversity and stability of the symbiosis between \u003cem\u003eL. serricorne/ St. paniceum\u003c/em\u003e and yeast symbionts between and within multiple populations in Germany. The fungal community of whole beetles was analysed in different populations collected from various sources and in subsequent generations in laboratory cultures. This allowed the comparison of the fungal community in between populations but also in between generations of single populations, giving insight into the diversity of the community, as well as its stability during lab rearing. In a further approach to resolve the putative \u003cem\u003eSymbiotaphrina\u003c/em\u003e strains better, the major yeasts of two populations of \u003cem\u003eL. serricorne\u003c/em\u003e and two populations of \u003cem\u003eSt. paniceum\u003c/em\u003e were isolated and phylogenetically classified based on longer amplicons spanning the rRNA operon.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eFungal community analysis\u003c/p\u003e\u003cp\u003eThe fungal communities of multiple anobiid populations were analysed using ITS MiSeq amplicon sequencing. For the populations that were newly established in the lab, \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo;, \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;greece\u0026rsquo;, \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; and \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo;, two generations were considered to detect possible changes in the community during lab rearing. Furthermore, the identified and isolated \u003cem\u003eSymbiotaphrina\u003c/em\u003e strains were phylogenetically classified.\u003c/p\u003e\u003cp\u003eThe fungal community was more divers in wild anobiids compared to lab-reared beetles. The fungal communities of lab-reared populations were mostly stable over time (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Only in \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;greece\u0026rsquo; the relative abundances changed upon establishment in the lab: the relative abundance of environmental fungi reduced and the relative abundance of symbiotic \u003cem\u003eSymbiotaphrina\u003c/em\u003e increased.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e could be identified on genus level in all populations of \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e as well as in \u003cem\u003eErnobius\u003c/em\u003e. \u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e could be identified throughout the different lab generations of \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; and \u0026lsquo;greece\u0026rsquo;, \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;JKI\u0026rsquo;, \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;forest\u0026rsquo; and in \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;JKI\u0026rsquo;, while \u003cem\u003eSy. kochii\u003c/em\u003e was only found in \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chili\u0026rsquo;. The \u003cem\u003eSymbiotaphrina\u003c/em\u003e species in \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;chili\u0026rsquo;, \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;ginger\u0026rsquo; and \u003cem\u003eErnobius\u003c/em\u003e was identified as \u003cem\u003eSy. lignicola\u003c/em\u003e based on the fungal community analysis. However further data base comparison revealed higher identity with \u003cem\u003eSy. microtheca\u003c/em\u003e. We could not assign the \u003cem\u003eSymbiotaphrina\u003c/em\u003e species in \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; to \u003cem\u003eSy. buchneri\u003c/em\u003e nor \u003cem\u003eSy. kochii\u003c/em\u003e based on the fungal community analysis alone. We therefore refer to this strain as \u0026ldquo;novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e\u0026rdquo;. The sequence from this \u0026ldquo;novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e\u0026rdquo; ASV (ASV 4) was later compared to sequences of isolated \u003cem\u003eSymbiotaphrina\u003c/em\u003e strains obtained by sanger sequencing to resolve its phylogenetic placement (see below \u0026lsquo;Phylogenetic placement of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates \u0026amp; yeasts of wild anobiids\u0026rsquo;). Several fungal ASVs that could not be identified further than were highly abundant in \u003cem\u003eSt. paniceum\u003c/em\u003e samples and in \u003cem\u003eErnobius\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eThe principal coordinate analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) showed high similarity between samples of the same genus for both \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e. \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo;, \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; and \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; were similar within a generation but distinct between populations. Only the fungal community of \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;greece\u0026rsquo; had changed during lab rearing, being very close to \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; after rearing.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003ePhylogenetic placement of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates \u0026amp; yeasts of wild anobiids\u003c/p\u003e\u003cp\u003eAxenic cultivation attempts yielded colonies from most examined species with colony and cell phenotypes similar to \u003cem\u003eSy. buchneri\u003c/em\u003e and \u003cem\u003ekochii\u003c/em\u003e, although with slight deviation in colony coloration ranging from pale white to light beige as well as cell morphology (Supplementary Fig.\u0026nbsp;1). \u003cem\u003eSy. buchneri\u003c/em\u003e and \u003cem\u003ekochii\u003c/em\u003e displayed almost perfectly spherical cells, with only infrequent elongated variations, the isolates clustering with \u003cem\u003eSy. buchneri\u003c/em\u003e cell were round to slightly oval, the novel Symbiotaphrina clade isolates oval (up to twice as long as wide), whereas the \u003cem\u003eSy. kochii\u003c/em\u003e clade isolate exhibited a pronounced conical cell morphology. The Partial rRNA operons of all \u003cem\u003eSymbiotaphrina\u003c/em\u003e strains isolated in axenic cultures (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and from the \u003cem\u003eErnobius\u003c/em\u003e, \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;forest\u0026rsquo; and \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;ginger\u0026rsquo; specimen were amplified from DNA extracts, purified, sanger sequenced and analysed to complete a phylogenetic classification of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates. The resulting trees from Maximum Likelihood and Bayesian analysis showed the same topology and were thus combined (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e; individual, unedited trees Supplementary Figs.\u0026nbsp;2\u0026thinsp;+\u0026thinsp;3).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAll \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;JKI\u0026rsquo; isolates and \u003cem\u003eLasioderma\u003c/em\u003e \u0026lsquo;JKI\u0026rsquo; isolates clustered together with the isolates from \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;greece\u0026rsquo; and \u003cem\u003eLasioderma\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; as well as the \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;forest\u0026rsquo; symbiont. They formed a sister clade to sequences of the \u003cem\u003eSy. buchneri\u003c/em\u003e type strain NBRC10845 cultivated in the lab and those previously deposited in databases (pp:1; bs: 100; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: orange box: \u0026ldquo;\u003cem\u003eSy. buchneri\u003c/em\u003e clade\u0026rdquo;). The \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; and \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; isolate clustered together with the \u003cem\u003eErnobius\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;ginger\u0026rsquo; symbionts in a sister clade of the \u003cem\u003eSy./T. microtheca\u003c/em\u003e sequences (pp: 99; bs: 82; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e yellow box: \u0026ldquo;novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e clade\u0026rdquo;). The \u003cem\u003eLasioderma\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; isolate and lab culture of \u003cem\u003eSy. kochii\u003c/em\u003e CBS250.77 clustered with deposited \u003cem\u003eSy. kochii\u003c/em\u003e sequences (pp: 1; bs: 100; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: red box: \u0026ldquo;\u003cem\u003eSy. kochii\u003c/em\u003e clade\u0026rdquo;).\u003c/p\u003e\u003cp\u003eTo link the phylogenetic placement of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates and symbionts to the results of our community analysis we extracted the \u003cem\u003eSymbiotaphrina\u003c/em\u003e sequences from the top 30 ASVs (ASV2, ASV4, ASV9, ASV14, ASV17 and ASV22) and run a phylogenetic analysis (RAxML in Geneious, 1000 bootstraps, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). ASV9, ASV14 and ASV17 clustered with the \u0026ldquo;\u003cem\u003eSy. buchneri\u003c/em\u003e clade\u0026rdquo; (orange box) and ASV22 clustered with \u0026ldquo;\u003cem\u003eSy. kochii\u003c/em\u003e clade\u0026rdquo; (red box) fitting with the previous identification. ASV4 clustered with \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; isolate and ASV2 with \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;ginger\u0026rsquo; symbiont, \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; isolate and \u003cem\u003eErnobius\u003c/em\u003e symbiont, both in the \u0026ldquo;novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e clade\u0026rdquo; (yellow box). ASV2 had been assigned as \u003cem\u003eSy. microtheca\u003c/em\u003e in the community analysis but here it is clearly positioned within the \u0026ldquo;novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e clade\u0026rdquo; which shows supported separation from the other \u003cem\u003eSy. microtheca\u003c/em\u003e sequences.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDiagnostic polymerase chain reaction\u003c/p\u003e\u003cp\u003eBased on the phylogenetic position of \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;greece\u0026rsquo; isolate, \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; isolate, \u003cem\u003eLasioderma\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; isolate and \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; isolate diagnostic primers for the distinction of the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: orange box buch\u0026amp; yellow box nov) as well as \u003cem\u003eSy. kochii\u003c/em\u003e were designed.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003ein silico\u003c/em\u003e specificity of the new primers was confirmed by counting mismatches: Sym_buch_classic had 100% identity to the sequences of \u003cem\u003eSy. buchneri\u003c/em\u003e, \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;greece\u0026rsquo; isolate, \u003cem\u003eLasioderma\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; isolate (17/17 bases) with 4 mismatches to the sequences of \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; isolate and \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; isolate and seven mismatches to \u003cem\u003eSy. kochii\u003c/em\u003e sequence. Sym_novel had 100% identity to the sequences of \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; isolate and \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;cornflakes\u0026rsquo; isolate (19/19 bases) with 6 mismatches to the sequences of \u003cem\u003eSy. buchneri\u003c/em\u003e, \u003cem\u003eStegobium\u003c/em\u003e \u0026lsquo;greece\u0026rsquo; isolate, \u003cem\u003eLasioderma\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; isolate and 9 mismatches to \u003cem\u003eSy. kochii\u003c/em\u003e sequence.\u003c/p\u003e\u003cp\u003eThey were applied to all individual samples used in the pooled fungal community analysis (DNA extracts of whole beetles, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) to confirm the infection with the different \u003cem\u003eSymbiotaphrina\u003c/em\u003e strains. For each individual sample, PCR was either successful with primer Sym_buch_classic or with Sym_novel or with neither one (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). No sample had PCR success with both primers. Successful PCRs yielded products of expected 500 bp length. In F0 and Fx generations of \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chickpea\u0026rsquo; and \u0026lsquo;greece\u0026rsquo;, in \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;JKI\u0026rsquo;, \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;JKI\u0026rsquo; as well as in \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;forest\u0026rsquo; the occurring \u003cem\u003eSymbiotaphrina\u003c/em\u003e species could be confirmed to belong to the \u0026ldquo;\u003cem\u003eSy. buchneri\u0026rdquo;\u003c/em\u003e clade (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e orange box, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The \u003cem\u003eSymbiotaphrina\u003c/em\u003e species in populations of \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; and \u0026lsquo;cornflakes\u0026rsquo; as well as \u003cem\u003eErnobius\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e \u0026lsquo;ginger\u0026rsquo; belong to the \u0026ldquo;novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolate\u0026rdquo; clade (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: yellow box, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eA diagnostic PCR using \u003cem\u003eSy. kochii\u003c/em\u003e specific primers was successful for \u003cem\u003eL. serricorne\u003c/em\u003e \u0026lsquo;chili\u0026rsquo; beetles and yielded products of ~\u0026thinsp;100 bp length (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb), confirming their phylogenetic position (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: red box)\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study we investigated the diversity and stability of anobiid – yeast symbiosis, focusing on the interaction between \u003cem\u003eLasioderma serricorne\u003c/em\u003e and \u003cem\u003eStegobium paniceum\u003c/em\u003e with \u003cem\u003eSymbiotaphrina\u003c/em\u003e yeasts. To account for the complete fungal community in the beetles before and after lab rearing, individuals from each population were pooled and analysed by amplicon sequencing. In addition, the yeast-like symbionts were cultivated and single isolates classified by Sanger sequencing of the rRNA operon. Additionally, we analysed some wild anobiids and \u003cem\u003eL. serricorne\u003c/em\u003e \u0026amp; \u003cem\u003eSt. paniceum\u003c/em\u003e populations, that were not reared in the lab. We found \u003cem\u003eSymbiotaphrina\u003c/em\u003e yeasts in all populations of \u003cem\u003eSt. paniceum\u003c/em\u003e and \u003cem\u003eL. serricorne.\u003c/em\u003e While only one \u003cem\u003eL. serricorne\u003c/em\u003e population was associated with \u003cem\u003eSy. kochii\u003c/em\u003e, most carried a strain with a highly similar rRNA operon as \u003cem\u003eSy. buchneri\u003c/em\u003e. The freshly collected \u003cem\u003eSt. paniceum\u003c/em\u003e populations all carried a strain that formed a novel cluster in between \u003cem\u003eSy. buchneri\u003c/em\u003e and \u003cem\u003eSy. microtheca\u003c/em\u003e based on phylogenies of the rRNA operon. While short term cultivation in the lab did not alter the association with the \u003cem\u003eSymbiotaphrina\u003c/em\u003e species or strain, long term cultures of \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e maintained in the same lab were both infected with \u003cem\u003eSy. buchneri\u003c/em\u003e strains that could not be differentiated by the rRNA operon sequences. These findings contradict the commonly assumed stable association of \u003cem\u003eL. serricorne\u003c/em\u003e with \u003cem\u003eSy. kochii\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e with \u003cem\u003eSy. buchneri\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], revealing not only flexibility between both so far recognized \u003cem\u003eSymbiotaphrina\u003c/em\u003e species, but also indicating a potentially novel species.\u003c/p\u003e\u003cp\u003eIn the phylogenetic analysis of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates, three clades of \u003cem\u003eSymbiotaphrina\u003c/em\u003e could be distinguished. \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates from both \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’ and \u003cem\u003eSt. paniceum\u003c/em\u003e ‘JKI’ clustered with \u003cem\u003eStegobium ‘\u003c/em\u003egreece’ and \u003cem\u003eLasioderma\u003c/em\u003e ‘chickpea’ isolates as a sister group to \u003cem\u003eSy. buchneri\u003c/em\u003e type strain and lab culture (“\u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e clade”, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: orange box). \u003cem\u003eStegobium\u003c/em\u003e ‘chili’ isolate and \u003cem\u003eStegobium\u003c/em\u003e ‘cornflakes’ isolate formed a clade with the \u003cem\u003eErnobius\u003c/em\u003e symbiont and \u003cem\u003eSt. paniceum\u003c/em\u003e ‘ginger’ symbiont (“novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e clade”, yellow box Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), forming a sister group to the canonical \u003cem\u003eSy. buchneri\u003c/em\u003e clade. Only the \u003cem\u003eL. serricorne\u003c/em\u003e ‘chili’ isolate clustered with \u003cem\u003eSy. kochii\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e: red box).\u003c/p\u003e\u003cp\u003eThe comparison of freshly collected populations upon arrival in the lab (F0) and subsequently reared beetles (Fx) revealed that beetles harboured stable associations and did not exchange \u003cem\u003eSymbiotaphrina\u003c/em\u003e species or strains within the observation period of this study. However, the relative abundance changed in some cases, e.g. \u003cem\u003eSy. buchneri\u003c/em\u003e abundance was much higher in Fx beetles of \u003cem\u003eL. serricorne\u003c/em\u003e ‘chickpea’ and ‘greece’ than in F0 beetles. We established the \u003cem\u003eL. serricorne\u003c/em\u003e ‘chickpea’ lab population from a wild population, while \u003cem\u003eL. serricorne\u003c/em\u003e ‘greece’ was obtained from the University of Thessaly in Greece (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The clean environment in lab rearing might have reduced the abundance of environmental fungi in the community of \u003cem\u003eL. serricorne\u003c/em\u003e ‘chickpea’, leading to the increase of relative abundance of \u003cem\u003eSy. buchneri\u003c/em\u003e. In \u003cem\u003eL. serricorne\u003c/em\u003e ‘greece’ the transfer between labs might have led to the high relative abundance of opportunistic environmental fungi like \u003cem\u003eAspergillus\u003c/em\u003e. Since we did not surface sterilise beetles before DNA extraction, fungal remains or spores from their surroundings could also appear in the community analyses. For example, in the sample of \u003cem\u003eL. serricorne\u003c/em\u003e ‘forest’ we found mould fungi like \u003cem\u003eAlternaria\u003c/em\u003e and \u003cem\u003eCladosporium\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eIn \u003cem\u003eSt. paniceum\u003c/em\u003e populations the \u003cem\u003eSymbiotaphrina\u003c/em\u003e species could not be identified on species level based on the fungal community analysis. We included the obtained sequences of the corresponding ASVs in a phylogenetic analysis with the previously analysed \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates. The ASVs clustered with the \u003cem\u003eStegobium\u003c/em\u003e ‘chili’ and \u003cem\u003eStegobium\u003c/em\u003e ‘cornflakes’ symbionts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). We observed almost no differences in the relative abundance of \u003cem\u003eSymbiotaphrina\u003c/em\u003e between F0 and Fx in \u003cem\u003eSt. paniceum\u003c/em\u003e populations. We confirmed the identity of these yeasts as \u003cem\u003eSy. buchneri\u003c/em\u003e and a novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolate using diagnostic primers in the individuals that were pooled for the fungal analysis.\u003c/p\u003e\u003cp\u003eThe association of \u003cem\u003eSy. buchneri\u003c/em\u003e and “novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e” with \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e respectively was stable during lab rearing. The fungal community of lab reared beetles in F0 and Fx are very similar (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) with the before mentioned exception of \u003cem\u003eL. serricorne\u003c/em\u003e ‘greece’. Generation Fx of \u003cem\u003eL. serricorne\u003c/em\u003e ‘greece’ clusters with both generations of \u003cem\u003eL. serricorne\u003c/em\u003e ‘chickpea’ in the PCoA which can be evidence for a loss of unspecific opportunistic fungi. Since the yeasts have an extracellular life phase during transmission from mother to offspring, the exchange with free-living \u003cem\u003eSymbiotaphrina\u003c/em\u003e species might be possible in nature. Pant and Fraenkel [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] described that sterilized larvae were able to acquire the yeasts either by feeding on a diet supplemented with them or by feeding on a diet supplemented with faeces of normal insects. Experimentally, the yeasts could be exchanged between host beetles [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, the association of host beetle and yeast species seems to be rather stable in nature. The populations of \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e that we analysed here originated from different sources but were all associated with similar yeasts strains although not always the previously reported ones. While this finding indicates more flexible associations than previously assumed, exchanges with other yeast species might still not happened too frequently in nature. Otherwise, an even higher yeast diversity between populations of the same beetle species would be expected.\u003c/p\u003e\u003cp\u003eOther anobiids are also associated with yeast-like symbionts [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], for example yeasts of \u003cem\u003eErnobius abietis\u003c/em\u003e, \u003cem\u003eErnobius mollis\u003c/em\u003e and \u003cem\u003eXestobium plumbeum\u003c/em\u003e were isolated [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and described as \u003cem\u003eCandida karawaiewii\u003c/em\u003e, \u003cem\u003eC. ernobii\u003c/em\u003e and \u003cem\u003eC. xestobii\u003c/em\u003e respectively [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. However, in our fungal community analysis we also identified the novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolate in the \u003cem\u003eErnobius\u003c/em\u003e sample. A phylogenetic classification placed the yeasts of other anobiids within the Saccharomycetales and clearly discriminated them from \u003cem\u003eSymbiotaphrina\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The identification of \u003cem\u003eSymbiotaphrina\u003c/em\u003e in this \u003cem\u003eErnobius\u003c/em\u003e sample suggests that other anobiids might also be associated with \u003cem\u003eSymbiotaphrina\u003c/em\u003e species. However, the analysis of a single beetle sample is not representative and deeper research with more anobiid species is necessary. Since other anobiids feed on wood [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], it is likely that the symbiosis between \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e with \u003cem\u003eSymbiotaphrina\u003c/em\u003e arose from a common wood associated ancestor [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn conclusion, our findings challenge the literature view of a strict and stable one on one symbiosis of anobiids and \u003cem\u003eSymbiotaphrina\u003c/em\u003e yeasts with the commonly accepted association of \u003cem\u003eL. serricorne\u003c/em\u003e – \u003cem\u003eSy. kochii\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e – \u003cem\u003eSy. buchneri\u003c/em\u003e. Most of the \u003cem\u003eL. serricorne\u003c/em\u003e samples tested were associated with \u003cem\u003eSy. buchneri\u003c/em\u003e instead of \u003cem\u003eSy. kochii\u003c/em\u003e, while \u003cem\u003eSt. paniceum\u003c/em\u003e was consistently associated with a \u003cem\u003eSymbiotaphrina\u003c/em\u003e strain that formed a distinct clade within our phylogenetic analysis, suggesting a more flexible association of anobiids and \u003cem\u003eSymbiotaphrina\u003c/em\u003e yeasts. However, the symbiosis in the lab-reared populations was stable with no exchanges happening between the beetle species, correspondingly populations of different origins were mostly associated with similar yeast strains. Whether the novel strain represents a new \u003cem\u003eSymbiotaphrina\u003c/em\u003e species with a unique metabolic repertoire or only a variant of the rRNA operon requires further genomic and phylogenetic analyses. Similarly, a wider screening is needed to reveal the precise dynamics of this association across habitats and the entire Anobiidae family.\u003c/p\u003e\u003cp\u003ePhylogenetic Placement of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eBeetle strains\u003c/p\u003e\u003cp\u003eIn this study several strains of \u003cem\u003eLasioderma serricorne\u003c/em\u003e and \u003cem\u003eStegobium paniceum\u003c/em\u003e were used partially obtained from long-term laboratory reared populations, partially collected from natural habitats and infested kitchen supplies and subsequent laboratory cultivation (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All populations from kitchen supplies were derived from independent households.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eAnobiid species, strains, their origin and status upon receiving the samples.\u003c/b\u003e F0: beetle samples directly frozen after receiving them in the lab “F0 generation”; Fx: current generation of living beetles\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003especies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003estrain\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eorigin\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSampling status\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eErnobius sp.\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForest (Tegernheim, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFresh frozen\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003echickpea\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003echickpea flour (Mainz, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF0 fresh frozen, Fx 2-year lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003echili\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003echili spice (Mainz, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2-year lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforest\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGonsenheim forest, (Mainz, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFresh frozen\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGreece\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLaboratory population, Greece (Professor Dr. Christos Athanassiou, University of Thessaly, Volos, Greece)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF0 fresh frozen, Fx 2-year lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eJKI\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLaboratory population, (Dr. Cornel Adler, Julius Kühn Institute Berlin, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePermanent lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003echili\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003echili spice (Rüsselsheim, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF0 fresh frozen, Fx 2-year lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecornflakes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ecornflakes (Mainz, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eF0 fresh frozen, Fx 2-year lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eginger\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003edried ginger root (Mainz, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFresh frozen\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eJKI\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLaboratory population (Dr. Cornel Adler, Julius Kühn Institute, Berlin, Germany)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePermanent lab culture\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eBeetle rearing\u003c/p\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e cultures ‘JKI’, ‘chili’ and ‘cornflakes’ as well as \u003cem\u003eL. serricorne\u003c/em\u003e cultures ‘JKI’, ‘chickpea’, ‘chili’ and ‘greece’ were reared at 26°C and 60–70% relative humidity and a 16/8h light/dark cycle. Beetles were fed with equal parts by volume of oats, wheat bran and wheat germ with the addition of half a bread roll for \u003cem\u003eS. paniceum\u003c/em\u003e respectively another volume of dried tobacco \u003cem\u003eL. serricorne\u003c/em\u003e. Some specimens of each beetle population were frozen upon receiving them to conserve the information on their associated community before the attempt to establish lab rearing with the remaining specimen.\u003c/p\u003e\u003cp\u003eYeast isolation\u003c/p\u003e\u003cp\u003eYeasts were isolated from the currently reared beetle cultures \u003cem\u003eSt. paniceum\u003c/em\u003e ‘JKI’, ‘cornflakes’ \u0026amp; ‘chili’ as well as \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’, ‘greece’, ‘chickpea’ \u0026amp; ‘chili’ (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Entire individuals (adults or larvae) were surface sterilized in 70% ethanol for 1 min, twice washed in sterile cultivation medium for 30 seconds each. Subsequently, mycetomes were dissected, homogenized with a pipette tip in 100 µL of cultivation medium and spread on agar plates. Hansen’s broth or agar was prepared following Pant \u0026amp; Fraenkel [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]: 50g/L glucose, 10g/L peptone from soy, 3g/L KH2PO4, 3g/L MgSO4 and 15g/L agar-agar. Agar plates were supplemented with 15 mg/L tetracycline hydrochloride, 15 mg/L nalidixic acid and 25mg/L chloramphenicol to suppress growth of bacteria. Growth of yeast colonies could be observed within three to twelve weeks, whereafter single colonies were transferred twice to agar plates described above and were afterwards maintained on Hansen’s agar or potato-dextrose agar containing 4g/L potato infusion, 20g/L glucose, 15 g/L agar-agar without the addition of antibacterial supplements. Cultures plates were incubated within loosely closed, sterile plastic bags at 25°C in the dark. Thereby we obtained seven strains of \u003cem\u003eSymbiotaphrina\u003c/em\u003e in addition to two strains purchased from culture collections (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003eIsolated yeast- like symbiont strains and their origin\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eYLS\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003especies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003estrain\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eorigin\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNBRC 10845\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eInstitute for Fermentation, Osaka (ISO Japan); originally isolated at the National Institute of Sericulture and Entomological Science from gut cecum of \u003cem\u003eStegobium paniceum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina kochii\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina kochii\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCBS 250.77\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eWesterdijk Fungal Biodiversity Institute (CBS, Netherlands) originally isolated from \u003cem\u003eLasioderma serricorne\u003c/em\u003e (Jurzitza 1964)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium\u003c/em\u003e ‘chili’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003echili-Sp\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e ‘chili’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium\u003c/em\u003e ‘cornflakes’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ecornflakes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e ‘cornflakes’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium\u003c/em\u003e ‘greece’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003egreece\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e ‘greece’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma\u003c/em\u003e ‘chickpea’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003echickpea\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e ‘chickpea’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma\u003c/em\u003e ‘chili’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003echili-Ls\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e ‘chili’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eStegobium\u003c/em\u003e ‘JKI’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eJKI-Sp\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eStegobium paniceum\u003c/em\u003e ‘JKI’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLasioderma\u003c/em\u003e ‘JKI’ symbiont\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eSymbiotaphrina\u003c/em\u003e sp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eJKI-Ls\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eLasioderma serricorne\u003c/em\u003e ‘JKI’\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDNA- Extraction\u003c/p\u003e\u003cp\u003eBeetle samples (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were either frozen (-20°C) or freshly collected from lab reared cultures. They were homogenised individually using glass beads and a bead mill at 30 Hz for 1 minute. Yeast isolates were scraped off the agar plates and suspended in 300 µL Tissue and Cell Lysis Solution. DNA was extracted using the Epicenter MasterPure Complete DNA and RNA Purification kit (Lucigen, Wisconsin, USA) following the user’s instructions with the following modifications: 25 U zymolyase was added to the homogenised samples with Tissue and Cell Lysis Solution and samples were incubated at 35°C for 30 minutes before proceeding with the protocol. DNA pellets were resuspended in 50 µL LOW TE buffer (10 mM Tris-HCl (pH 8.0) + 0.1 mM EDTA) and stored at -20°C. DNA concentration and purity were measured using NanoDrop 1000 (Peqlab/ Thermo Scientific, Wilmington, USA).\u003c/p\u003e\u003cp\u003ePurification of DNA extracts\u003c/p\u003e\u003cp\u003eDNA extracts of bad quality were further purified with a phenol chloroform modification of the extraction kit to improve the removal of interfering compounds beyond the usual protein precipitation based on the addition of acetic acid. 250 µL Tissue and Cell Lysis Solution was added to the extracts. They were kept on ice for 3 to 5 minutes and 600 µL phenol/chloroform/isoamylalcohol was added. Samples were vigorously vortexed and incubated for 10 minutes at room temperature. After centrifuging at 8000 rpm for 5 minutes, the upper phase was carefully transferred into a new tube and the organic phase was discarded. 500 µL isopropanol were added to the samples, they were inverted for 30–40 times and stored at -20°C for about 3 hours. Samples were centrifuged for 10 minutes at 14000 rpm and the supernatant was discarded. The pellet was washed with 200 µL of cold ethanol (70%) and centrifuged for 5 minutes at 14000 rpm. The supernatant was discarded, the pellet was dried using a SpeedVac (Thermo Scientific, Waltham, MA, USA) and resuspended in 50 µL Low TE. Samples were stored at – 20°C.\u003c/p\u003e\u003cp\u003eFungal community analysis\u003c/p\u003e\u003cp\u003eThe fungal community of adult beetles of \u003cem\u003eL. serricorne\u003c/em\u003e populations ‘chickpea’ and ‘greece’, as well as \u003cem\u003eSt. paniceum\u003c/em\u003e populations ‘chili’ and ‘cornflakes’ were analysed in two generations. Therefore, beetle samples were immediately frozen upon receiving the populations to conserve their microbial composition before rearing in the lab (F0 generation). The remaining populations were reared and established as lab cultures. Out of each of the four beetle cultures ten living beetles were collected (Fx generation). In addition, a wild caught \u003cem\u003eErnobius sp\u003c/em\u003e, a \u003cem\u003eL. serricorne\u003c/em\u003e ‘forest’ and a \u003cem\u003eSt. paniceum\u003c/em\u003e ‘ginger’ beetle and individuals from lab cultures \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’, ‘chili’ as well as \u003cem\u003eSt. paniceum\u003c/em\u003e ‘JKI’ were analysed. DNA was extracted individually for all samples (see above). For each of the described populations, 2–10 individual DNA extracts were pooled. The individual DNA concentrations were considered and an equal amount of DNA from each individual was used to contribute to a total DNA amount of circa 200 ng in each pool. Pools were sent for paired end Illumina MiSeq sequencing of fungal ITS region at StarSEQ (Mainz, Germany) using a primer pair that yields sequences of circa 300 bp length (forward 5’-CTTGGTCATTTAGAGGAAGTAA- 3’; reverse 5’ – GCTGCGTTCTTCATCGATGC- 3’).\u003c/p\u003e\u003cp\u003eUntrimmed Illumina MiSeq reads were obtained from StarSEQ. Primers at the 3’ ends were trimmed using cutadapt [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] in miniconda. Reads were quality filtered with a threshold of 20 for quality scores and further trimmed using RStudio (2024.04.2). Forward and reverse reads were merged. Sequences smaller than 50 nucleotides were discarded and error rates were determined. Because dada2 package version 1.1. was used, dereplicating was necessary. Afterwards Amplicon Sequence Variants (ASVs) were inferred. Data from two sequencing runs were combined and the previously inferred ASVs were assigned to a taxonomy using the UNITE ITS fungal databank general release dynamics [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The FASTA sequences for all top 30 ASVs were extracted and manually checked in NCBI with BLASTn and UNITE. Wrong classifications were corrected and unclassified ASVs were determined if possible. Principal coordinate analysis based on Bray-Curtis dissimilarity was generated in RStudio (2024.04.2) using the “phyloseq” package.\u003c/p\u003e\u003cp\u003eThe yeasts isolated from \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e beetles (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) were phylogenetically classified based on the partial rRNA operon. The partial rRNA operons of \u003cem\u003eSt. paniceum\u003c/em\u003e ‘chili’ symbiont, \u003cem\u003eSt. paniceum\u003c/em\u003e ‘cornflakes’ symbiont, \u003cem\u003eSt. paniceum\u003c/em\u003e ‘greece’ symbiont, \u003cem\u003eL. serricorne\u003c/em\u003e ‘chickpea’ symbiont, \u003cem\u003eL. serricorne\u003c/em\u003e ‘chili’ symbiont, \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’ symbiont (isolates H4 \u0026amp; C1) and lab cultures of \u003cem\u003eSy. buchneri\u003c/em\u003e (NBRC 10845) and \u003cem\u003eSy. kochii\u003c/em\u003e (CBS 250.77) were amplified using a LongAmp polymerase (New England Biolabs, Ipswich, USA) with different primer combinations (Table \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Amplification settings consisted of an initial denaturation at 94°C for 3 minutes, 30 cycles of denaturation at 94°C for 30 seconds, annealing at 48°C for 60 seconds and elongation at 65°C for 7 minutes, followed by final elongation step at 65°C for 10 minutes. To amplify the partial rRNA operon from yeasts from \u003cem\u003eErnobius\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e ginger the beetle gDNA extracts were used. Additionally, parts of the rRNA operons of \u003cem\u003eSt. paniceum\u003c/em\u003e ‘JKI’ symbiont (isolates B4, E5, F3, G3, G5, H4, H5) and \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’ symbiont (isolate F3) were amplified with a peqlab Taq polymerase (VWR, Darmstadt, Germany): initial denaturation at 94°C for 3 minutes, 30 cycles of denaturation at 94°C for 30 seconds, annealing at 48°C for 60 seconds and elongation at 72°C for 120 seconds, final elongation step at 72°C for 10 minutes.\u003c/p\u003e\u003cp\u003ePCR- products were purified using the innuPREP PCRpure Kit (AnalyticJena, Jena, Germany) following the manufacturer’s instructions with the following modifications: first 100 µL binding buffer were added to the PCR products, samples were added to the spin filter and centrifuged for 2 minutes at 12000 rpm. The PCR products were washed twice with 100 µL binding buffer firstly centrifuging for 2 minutes and secondly for 5 minutes at 12000 rpm. The filter was dried open for 10–15 minutes. For elution of pure PCR-products 10 µL dH\u003csub\u003e2\u003c/sub\u003e0 were used.\u003c/p\u003e\u003cp\u003ePurified PCR products were Sanger sequenced by StarSEQ (Mainz, Germany). Sequences were edited using BioEdit 7.2.5 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Sequences for each sample were aligned. If alignment was not possible due to lacking overlap, \u003cem\u003eSy. buchneri\u003c/em\u003e (DQ248313.1) or \u003cem\u003eSy. kochii\u003c/em\u003e (DQ248314) sequences were used as a query. Consensus sequences were created for each sample, in total 20 consensus sequences were used.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003e\u003cb\u003ePrimer for amplification and sequencing of fungal rRNA operon.\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eprimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003edirection\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence 5‘ -\u0026gt;3‘\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003etarget\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003ereference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLR5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ereverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCCTGAGGGAAACTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eFungal 28 S rRNA\u003c/p\u003e\u003cp\u003eFungal 28 S rRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFungi_LS1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTACCCGCTGAACTTAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e31,32\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eITS1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCGTAGGTGAACCTGCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eITS region between 18 S and 28 S rRNA of fungi\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eITS4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ereverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCTCCGCTTATTGATATGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eITS5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGAAGTAAAAGTCGTAACAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS_buchneri_fwd1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCAGTTGATCAACCGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eSy. buchneri\u003c/em\u003e 28 S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"7\" rowspan=\"8\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS_buchneri_fwd2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGGTGCACTCTTCTGCAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS_buchneri_rev2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ereverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCTTTATCCAACCACCCAAACT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS_kochii_rev1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ereverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCCGACCTTTATCCAGCCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003e\u003cem\u003eSy. kochii\u003c/em\u003e 28S\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS_kochii_rev2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ereverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCGAAGAGAGCTACATTCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS_kochii_fwd2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTCAGCCGTGGTTCTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSym_buch_classic\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCGATGTTCGTTCTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eITS region of \u003cem\u003eSy. buchneri\u003c/em\u003e type strains, \u003cem\u003eStegobium\u003c/em\u003e ‘greece’ symbiont \u0026amp; \u003cem\u003eLasioderma\u003c/em\u003e ‘chickpea’ symbiont\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSym_novel\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eforward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTTGTCTGCTCTCACGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eITS region of \u003cem\u003eStegobium\u003c/em\u003e ‘chili’ symbiont \u0026amp; \u003cem\u003eStegobium\u003c/em\u003e ‘cornflakes’ symbiont\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAdditionally, 20 sequences of closely related \u003cem\u003eSymbiotaphrina\u003c/em\u003e species were obtained from NCBI, based on Baral et al. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The final alignment of the 40 sequences was created in Geneious prime (2023.0.3, Auckland, New Zealand) using MAFFT (v7.490) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Sequences of \u003cem\u003eSy. buchneri\u003c/em\u003e DQ248313.1 and \u003cem\u003eSy. kochii\u003c/em\u003e DQ248314 were cut to fit the general length of the other sequences.\u003c/p\u003e\u003cp\u003eA Maximum likelihood tree was calculated using RAxML (8.2.11) [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] in Geneious with GTR + G as substitution model and 10000 bootstrapping replicates. A Bayesian inference tree was calculated using MrBayes (3.2.6) [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] implemented in Geneious using the GTR + G substitution model and \u003cem\u003eDeltopyxis trianulispora\u003c/em\u003e as the outgroup. MCMCs were set to 1100000 with 100000 burn-in and 200 subsampling. Resulting trees were rooted to the outgroup.\u003c/p\u003e\u003cp\u003eDiagnostic PCR\u003c/p\u003e\u003cp\u003eBased on the phylogenetic placement of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolates and the underlying alignment, diagnostic primers for distinction of \u003cem\u003eSymbiotaphrina\u003c/em\u003e isolate groups were designed.\u003c/p\u003e\u003cp\u003eThe first group, containing the sequences of \u003cem\u003eStegobium\u003c/em\u003e ‘greece’ symbiont, \u003cem\u003eLasioderma\u003c/em\u003e ‘chickpea’ symbiont, \u003cem\u003eLasioderma\u003c/em\u003e ‘JKI’ symbiont and \u003cem\u003eStegobium\u003c/em\u003e ‘JKI’ symbiont clustered with \u003cem\u003eSy. buchneri\u003c/em\u003e type strains. The second group containing \u003cem\u003eStegobium\u003c/em\u003e ‘chili’ symbiont and \u003cem\u003eStegobium\u003c/em\u003e ‘cornflakes’ symbiont clustered as a sister group to the fist group. One forward primer was designed for each group: Sym_buch_classic (5’ –GCCGATGTTCGTTCTCG – 3’) targeting the ITS region of \u003cem\u003eSy. buchneri\u003c/em\u003e type strains, \u003cem\u003eStegobium\u003c/em\u003e ‘greece’ symbiont and \u003cem\u003eLasioderma\u003c/em\u003e ‘chickpea’ symbiont and Sym_novel (5’ – CGTTGTCTGCTCTCACGAG – 3’) targeting the ITS region of \u003cem\u003eStegobium\u003c/em\u003e ‘chili’ symbiont and \u003cem\u003eStegobium\u003c/em\u003e ‘cornflakes’ symbiont. The online tool Primer3 (v.1.4.1) [\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e–\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] was used to optimise primer length and to avoid self-complementarity. Paired with ITS4 (Table \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) as a reverse primer, they should yield PCR-products of circa 500 bp length. PCR conditions were optimized with a gradient of annealing temperatures. The best conditions for Sym_buch_classic were an initial denaturation at 94°C for 3 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 57,5°C for 60 seconds and elongation at 72°C for 120 seconds, and final elongation at 72°C for 10 minutes. The best conditions for Sym_novel were an initial denaturation at 94°C for 3 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 63°C for 60 seconds and elongation at 72°C for 120 seconds, and final elongation at 72°C for 10 minutes.\u003c/p\u003e\u003cp\u003eTo distinguish both \u003cem\u003eSymbiotaphrina\u003c/em\u003e sp. strain groups in the samples that were used in the fungal community analysis, PCRs with both primers were run with the individual DNA extracts of \u003cem\u003eL. serricorne\u003c/em\u003e ‘chickpea’ F0 \u0026amp; Fx, \u003cem\u003eL. serricorne\u003c/em\u003e ‘greece’ F0 \u0026amp; Fx, \u003cem\u003eL. serricorne\u003c/em\u003e ‘JKI’, \u003cem\u003eL. serricorne\u003c/em\u003e ‘forest’, \u003cem\u003eL. serricorne\u003c/em\u003e ‘chili’, \u003cem\u003eSt. paniceum\u003c/em\u003e ‘chili’ F0 \u0026amp; Fx, \u003cem\u003eSt. paniceum\u003c/em\u003e ‘cornflakes’ F0 \u0026amp; Fx, \u003cem\u003eSt. paniceum\u003c/em\u003e ‘JKI’, \u003cem\u003eSt. paniceum\u003c/em\u003e ‘ginger’ and \u003cem\u003eErnobius\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eSince the \u003cem\u003eL. serricorne\u003c/em\u003e ‘chili’ symbiont clustered with \u003cem\u003eSy. kochii\u003c/em\u003e and PCRs using Sym_buch_classic and Sym_novel were negative, a diagnostic PCR for \u003cem\u003eSy. kochii\u003c/em\u003e was performed. The primer pair S_kochii_fwd2 (5’ –GCTCAGCCGTGGTTCTCC– 3’) and S_kochii_rev2 (5’ –CCGAAGAGAGCTACATTCCC– 3’) targeting the 28S region of \u003cem\u003eSy. kochii\u003c/em\u003e was used with an initial denaturation at 95°C for 3 minutes, 40 cycles of denaturation at 95°C for 30 seconds, annealing at 62°C for 30 seconds and elongation at 72°C for 30 seconds, and final elongation at 72°C for 3 minutes.\u003c/p\u003e\u003cp\u003eAmplicons were analysed on an 1,6% agarose gel running for 30–40 minutes at 130 V using 3 µL PCR product mixed with 2 µL loading buffer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor contributions\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eT.E conceptualization, supervision, methodology, investigation, writing \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA.N. investigation, visualization, writing\u003c/p\u003e\n\u003cp\u003eR.S. investigation\u003c/p\u003e\n\u003cp\u003eT.E., C.A. \u0026amp; C.G.A. collected, maintained and provided insect cultures\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll authors revised and approve the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eData availability statement\u003c/h2\u003e\n\u003cp\u003eSequence data is deposited on under Bioproject PRJNA1210556, Genbank PX406542-PX406559 and Edmond [41].\u003c/p\u003e\n\u003cp\u003eAdditional Information\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The authors declare no competing interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMcFall-Ngai, M. et al. Animals in a bacterial world, a new imperative for the life sciences. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 110, 3229\u0026ndash;3236 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKlepzig, K., Adams, D., Handelsman, A. S., Raffa, K., Symbioses, F. \u0026amp; J. \u0026amp;, A Key Driver of Insect Physiological Processes, Ecological Interactions, Evolutionary Diversification, and Impacts on Humans. \u003cem\u003eEnviron. Entomol.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, 67\u0026ndash;77 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSudakaran, S., Kost, C. \u0026amp; Kaltenpoth, M. Symbiont Acquisition and Replacement as a Source of Ecological Innovation. \u003cem\u003eTrends Microbiol.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 375\u0026ndash;390 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAkman G\u0026uuml;nd\u0026uuml;z, E. \u0026amp; Douglas, A. E. Symbiotic bacteria enable insect to use a nutritionally inadequate diet. \u003cem\u003eProc. Biol. Sci.\u003c/em\u003e 276, 987\u0026ndash;991 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHansen, A. K. \u0026amp; Moran, N. A. Aphid genome expression reveals host-symbiont cooperation in the production of amino acids. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 108, 2849\u0026ndash;2854 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEngel, P. \u0026amp; Moran, N. The gut microbiota of insects - diversity in structure and function. \u003cem\u003eFEMS Microbiol. Rev.\u003c/em\u003e \u003cb\u003e37\u003c/b\u003e, 699\u0026ndash;735 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDouglas, A. Multiorganismal insects: diversity and function of resident microorganisms. \u003cem\u003eAnnu. Rev. Entomol.\u003c/em\u003e \u003cb\u003e60\u003c/b\u003e, 17\u0026ndash;34 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBuchner, P. \u003cem\u003eEndosymbiosis of Animals with Plant Microorganisms\u003c/em\u003e (John Whily \u0026amp; Sons, Inc, 1965).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJurzitza, G. Die Symbiose der Anobiiden und Cerambyciden mit hefeartigen Pilzen. \u003cem\u003eArch. Mikrobiol\u003c/em\u003e. \u003cb\u003e43\u003c/b\u003e, 412\u0026ndash;424 (1962).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMartinson, V. G. Rediscovering a Forgotten System of Symbiosis: Historical Perspective and Future Potential. \u003cem\u003eGenes\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBreitsprecher, E. Beitr\u0026auml;ge zur Kenntnis der Anobiidensymbiose. \u003cem\u003eZ. Morphol. Oekol Tiere\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e, 495\u0026ndash;538 (1928).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJurzitza, G. Der Vitaminbedarf normaler und aposymbiontischer \u003cem\u003eLasioderma serricorne\u003c/em\u003e F. (Coleoptera, Anobiidae) und die Bedeutung der symbiontischen Pilze als Vitaminquelle fiir ihre Wirte. \u003cem\u003eOecologia\u003c/em\u003e 3, 70\u0026ndash;83 (1969).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJurzitza, G. \u0026Uuml;ber Isolierung, Kultur und Taxonomieb einiger Anobiidensymbionten (Insecta, Coleoptera). \u003cem\u003eArch. Mikrobiol\u003c/em\u003e. \u003cb\u003e72\u003c/b\u003e, 203\u0026ndash;222 (1970).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJurzitza, G. Studien an der Symbiose der Anobiiden II. Physiologische Studien am Symbionten von \u003cem\u003eLasioderma serricorne\u003c/em\u003e F. \u003cem\u003eArch. Mikrobiol\u003c/em\u003e. \u003cb\u003e49\u003c/b\u003e, 331\u0026ndash;340 (1964).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK\u0026uuml;hlwein, H. \u0026amp; Jurzitza, G. Studien an der Symbiose der Anobiiden. \u003cem\u003eArch. Mikrobiol\u003c/em\u003e. \u003cb\u003e40\u003c/b\u003e, 247\u0026ndash;260 (1961).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaral, H., Weber, O., Marson, E., Quijada, L. \u0026amp; G. \u0026amp; A new connection between wood saprobism and beetle endosymbiosis: the rarely reported saprobic discomycete \u003cem\u003eTromeropsis\u003c/em\u003e is congeneric with the symbiotic yeast \u003cem\u003eSymbiotaphrina\u003c/em\u003e (Symbiotaphrinales, Xylonomycetes) and two asexual morphs misplaced in Hyphozyma. \u003cem\u003eMycol. Prog\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e, 215\u0026ndash;254 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAshworth, J. The Biology of \u003cem\u003eLasioderma serricorne\u003c/em\u003e. \u003cem\u003eJ. Stored Prod. Res.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 291\u0026ndash;303 (1993).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHowe, R. W. A Laboratory study of the cigarette beetle, \u003cem\u003eLasioderma serricorne\u003c/em\u003e (F.) (Col., Anobiidae) with a critical review of the literature on its biology. \u003cem\u003eBull. Entomol. Res.\u003c/em\u003e 48, 9\u0026ndash;56 (1957).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlewett, M. \u0026amp; Fraenkel, G. Intracellular symbiosis and vitamin requirements of two insects, \u003cem\u003eLasioderma serricorne\u003c/em\u003e and \u003cem\u003eSitodrepa panicea\u003c/em\u003e. \u003cem\u003eProc. R. Soc. Lond. B Biol. Sci.\u003c/em\u003e 132, 212\u0026ndash;221 (1944).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePant, N. \u0026amp; Fraenkel, G. C Studies on the Symbiotic Yeasts of Two Insect Species, \u003cem\u003eLasioderma serricorne\u003c/em\u003e F. and \u003cem\u003eStegobium paniceum\u003c/em\u003e L. \u003cem\u003eBiol. Bull.\u003c/em\u003e 107, 420\u0026ndash;432 (1954).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJurzitza, G. \u0026Uuml;ber die Lieferung von Sterinen durch die hefeartigen Endosymbionten von \u003cem\u003eL. serricorne\u003c/em\u003e (Coleoptera, Anobiidae) und die \u0026ouml;kologische Bedeutung dieser Leistung f\u0026uuml;r den Wirt. \u003cem\u003eOecologia\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 163\u0026ndash;172 (1974).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePant, N., Gupta, C., Nayar, J. \u0026amp; P. \u0026amp; Physology of intercellular Symbionts of \u003cem\u003eStegobium paniceum\u003c/em\u003e L. with Special Reference to Amino Acid Requirements of the Host. \u003cem\u003eExperientia\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 311\u0026ndash;312 (1959).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJurzitza, G. Die Rolle der hefeartigen Symbionten von \u003cem\u003eL. serricorne\u003c/em\u003e (Coleoptera, Anobiidae) im Proteinmetabolismus ihrer Wirte. \u003cem\u003eZ. f\u0026uuml;r vergleichende Physiologie\u003c/em\u003e. \u003cb\u003e63\u003c/b\u003e, 165\u0026ndash;181 (1969).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePant, N. \u0026amp; Fraenkel, G. C The Function of the Symbiotic Yeasts of Two Insect Species, \u003cem\u003eLasioderma serricorne\u003c/em\u003e F. and \u003cem\u003eStegobium\u003c/em\u003e (\u003cem\u003eSitodrepa\u003c/em\u003e) \u003cem\u003epaniceum\u003c/em\u003e L. \u003cem\u003eScience\u003c/em\u003e 112, 498\u0026ndash;500 (1950).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFoeckler, F. Reinfektionsversuche steriler Larven von \u003cem\u003eStegobium paniceum\u003c/em\u003e L. mit Fremdhefen und die Beziehungen zwischen der Entwicklungsdauer der Larven und dem Vitamin-B Gehalt des Futters und der Hefen. \u003cem\u003eZeit Morphol. Oekol Tiere\u003c/em\u003e. \u003cb\u003e50\u003c/b\u003e, 119\u0026ndash;162 (1961).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJones, K. G., Dowd, P. F. \u0026amp; Blackwell, M. Polyphyletic origins of yeast-like endocytobionts from anobiid and cerambycid beetles. \u003cem\u003eMycol. Res.\u003c/em\u003e \u003cb\u003e103\u003c/b\u003e, 542\u0026ndash;546 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMartin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. \u003cem\u003eEMBnet J.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 10\u0026ndash;12 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbarenkov, K. et al. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: sequences, taxa and classifications reconsidered. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e52\u003c/b\u003e, D791\u0026ndash;D797 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHall, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. \u003cem\u003eNucleic acid symposium series\u003c/em\u003e 41, 91\u0026ndash;98 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVilgalys, R. \u0026amp; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several \u003cem\u003eCryptococcus\u003c/em\u003e species. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cb\u003e172\u003c/b\u003e, 4238\u0026ndash;4246 (1990).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHausner, G., Reid, J. \u0026amp; Klassen, G. R. On the phylogeny of \u003cem\u003eOphiostoma\u003c/em\u003e, \u003cem\u003eCeratocystis s.s.\u003c/em\u003e, and \u003cem\u003eMicroascus\u003c/em\u003e, and relationships within \u003cem\u003eOphiostoma\u003c/em\u003e based on partial ribosomal DNA sequences. \u003cem\u003eCan. J. Bot.\u003c/em\u003e 71, 1249\u0026ndash;1265 (1993).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGibson, C. M. \u0026amp; Hunter, M. S. Inherited fungal and bacterial endosymbionts of a parasitic wasp and its cockroach host. \u003cem\u003eMicrob. Ecol.\u003c/em\u003e \u003cb\u003e57\u003c/b\u003e, 542\u0026ndash;549 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWhite, T., Burns, J., Lee, T. D., Taylor, J. \u0026amp; S., B \u0026amp; \u003cem\u003eW. in PCR - Protocols and Applications - A Laboratory Manual\u003c/em\u003e315\u0026ndash;322 (Academic, 1990).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatoh, K., Misawa, K., Kuma, K. \u0026amp; Miyata, T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, 3059\u0026ndash;3066 (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatoh, K. \u0026amp; Standley, D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, 772\u0026ndash;780 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStamatakis, A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, 1312\u0026ndash;1313 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuelsenbeck, J., Ronquist, F. \u0026amp; P \u0026amp; MRBAYES: Bayesian inference ofphylogenetic trees. \u003cem\u003eBioinf. Application Note\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e, 754\u0026ndash;755 (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKoressaar, T. et al. Primer3_masker: integrating masking of template sequence with primer design software. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e34\u003c/b\u003e, 1937\u0026ndash;1938 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKoressaar, T. \u0026amp; Remm, M. Enhancements and modifications of primer design program Primer3. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 1289\u0026ndash;1291 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUntergasser, A. et al. Primer3-new capabilities and interfaces. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e40\u003c/b\u003e, e115 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEngl, T., Nick, A. \u0026amp; Alignment_Symbiotaphrina_partial_rRNA_operon \u003cem\u003eEdmond\u003c/em\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.17617/3.5MAW2Z\u003c/span\u003e\u003cspan address=\"10.17617/3.5MAW2Z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. (2025).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Anobiidae, symbiosis, Symbiotaphrina, yeast-like symbiont, stored-product insects","lastPublishedDoi":"10.21203/rs.3.rs-7759551/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7759551/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe stored product pests \u003cem\u003eLasioderma serricorne\u003c/em\u003e and \u003cem\u003eStegobium paniceum\u003c/em\u003e were described to harbour \u003cem\u003eSymbiotaphrina kochii\u003c/em\u003e and \u003cem\u003eSymbiotaphrina buchneri\u003c/em\u003e yeast-like symbionts (YLS) respectively, based on axenic cultivation from symbiotic organs. Here we investigate the diversity and stability of the symbiosis in multiple populations.\u003c/p\u003e\u003cp\u003eAmplicon sequencing of the fungal internal transcribed spacer (ITS) region from collected and lab-reared populations revealed that the beetle-yeast associations were stable during rearing and populations from different origins were associated with similar yeast strains. However, only one \u003cem\u003eL. serricorne\u003c/em\u003e population was associated with \u003cem\u003eSy. kochii\u003c/em\u003e, the others were associated with \u003cem\u003eSy. buchneri\u003c/em\u003e. Further, most \u003cem\u003eS. paniceum\u003c/em\u003e samples were associated with a \u003cem\u003eSymbiotaphrina\u003c/em\u003e species that could neither be identified as \u003cem\u003eSy. buchneri\u003c/em\u003e, nor \u003cem\u003eSy. kochii.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eYeasts cultivated from both insects were phylogenetically analysed using longer fragments of the rRNA operon (partial 18S rRNA, ITS and 23S rRNA gene) revealing three \u003cem\u003eSymbiotaphrina\u003c/em\u003e clades: \u003cem\u003eSy. kochii\u003c/em\u003e, \u003cem\u003eSy. buchneri\u003c/em\u003e and a novel clade. Diagnostic polymerase chain reaction confirmed the exclusive association with \u003cem\u003eSy. buchneri, Sy. kochii\u003c/em\u003e or the novel \u003cem\u003eSymbiotaphrina\u003c/em\u003e strain in the individual beetle samples.\u003c/p\u003e\u003cp\u003eOur results suggest another, so far overlooked \u003cem\u003eSymbiotaphrina\u003c/em\u003e strain or species and a more flexible symbiont association of \u003cem\u003eL. serricorne\u003c/em\u003e and \u003cem\u003eSt. paniceum\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Diversity of yeast-like Symbiotaphrina symbionts in the stored product pests Lasioderma serricorne and Stegobium paniceum","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-27 14:18:33","doi":"10.21203/rs.3.rs-7759551/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-07T07:45:30+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-05T17:46:31+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-22T17:10:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"313466503347349479199050888814416611154","date":"2025-10-17T14:19:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"24206875074216932547361638103609141914","date":"2025-10-13T14:17:03+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-13T12:14:58+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-10-06T16:44:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-04T08:11:05+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-03T05:14:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-10-01T12:30:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4a0f40ae-7d67-41cb-ba1c-172e9f9a9fc7","owner":[],"postedDate":"October 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":56950774,"name":"Biological sciences/Ecology"},{"id":56950775,"name":"Earth and environmental sciences/Ecology"},{"id":56950776,"name":"Biological sciences/Evolution"},{"id":56950777,"name":"Biological sciences/Microbiology"},{"id":56950778,"name":"Biological sciences/Molecular biology"},{"id":56950779,"name":"Biological sciences/Zoology"}],"tags":[],"updatedAt":"2026-01-12T16:07:56+00:00","versionOfRecord":{"articleIdentity":"rs-7759551","link":"https://doi.org/10.1038/s41598-025-34676-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-01-08 15:57:13","publishedOnDateReadable":"January 8th, 2026"},"versionCreatedAt":"2025-10-27 14:18:33","video":"","vorDoi":"10.1038/s41598-025-34676-y","vorDoiUrl":"https://doi.org/10.1038/s41598-025-34676-y","workflowStages":[]},"version":"v1","identity":"rs-7759551","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7759551","identity":"rs-7759551","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00