Cellular DNAJBs are selectively associated with proteotoxic stress and underlying mechanisms in neurodegenerative conditions

preprint OA: closed
Full text JSON View at publisher
Full text 176,515 characters · extracted from preprint-html · click to expand
Cellular DNAJBs are selectively associated with proteotoxic stress and underlying mechanisms in neurodegenerative conditions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cellular DNAJBs are selectively associated with proteotoxic stress and underlying mechanisms in neurodegenerative conditions Siraj Fatima, Anurag Gupta, Smriti Priya This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6870464/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Jan, 2026 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted 9 You are reading this latest preprint version Abstract Molecular chaperones are an integral part of protein quality control systems and are induced by various environmental, chemical, heat and genetic stress factors. In neurodegenerative diseases, where protein misfolding and aggregation are the hallmark features, several stress factors are involved in the initiation of disease pathogenesis; however, the response of molecular chaperones under these conditions is not well understood. In the present study, the expression profile of major chaperone HSPA and its co-chaperone DNAJ proteins are analysed under oxidative, proteotoxic and heat stress conditions to provide a comparative profile of their expression. Different stress inducers resulted in dynamic and selective expression of HSPA and DNAJ proteins. A unique molecular imprint of HSPA1 (HSP70), HSPA8 (HSC70) and HSPH1(HSP110) was observed for proteotoxic conditions. Similarly, the DNAJB1 protein was upregulated in all stress conditions, while the specificity of DNAJB8 was observed for proteotoxic stress. The dynamic expression of chaperones was regulated by HSF1 and NRF2 transcriptional regulators. HSF1 expression was increased in all conditions, while NRF2 activation was selective for oxidative and heat stress. The results suggested molecular imprints of chaperones for specific stress conditions may assist in selecting the appropriate targets for modifications in protein aggregation-associated diseases. Neurodegenerative disease molecular chaperone HSPA DNAJB proteotoxicity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Molecular chaperones are heat shock proteins that maintain cellular protein homeostasis by regulating de novo protein folding, refolding of unfolded protein, degradation of irreversibly misfolded proteins and prevention of protein aggregation [ 1 ]. The molecular chaperones and co-chaperones are constitutive and stress-inducible, with cellular compartment and tissue specificity [ 2 , 3 ]. The induction of molecular chaperone expression by various stress factors, including environmental, chemical, heat and genetic factors and is mediated by the heat shock response (HSR) [ 4 – 6 ]. The cellular HSR is a highly conserved molecular response for stress-induced disruption of protein homeostasis and is initiated by activation of transcription factor, heat shock factor 1 (HSF1) [ 6 ]. The stress-induced disturbance in protein homeostasis leads to misfolding and aggregation of specific proteins such as α-synuclein (α-syn), tau, amyloid β (Aβ), huntingtin (HTT), superoxide dismutase (SOD), prion protein and amylin, linked with several neurodegenerative diseases and lifestyle disorders, where the accumulation of protein aggregates is a pathological hallmark [ 3 , 7 ]. In neurodegenerative diseases, the initiation of disease and protein aggregation is associated with oxidative stress, neuroinflammation, mitochondrial dysfunction, protein misfolding and proteotoxic stress [ 8 ]. Among these varied cellular stress conditions associated with neurodegenerative diseases, the response of molecular chaperones and their co-chaperones has not been properly understood. Most of the studies on molecular chaperones are focused on their mechanism of action, substrate specificity, refolding, disaggregation and aggregation prevention [ 9 – 11 ]. Several overexpression studies of molecular chaperones and co-chaperones in vitro and in vivo models of neurodegenerative conditions showed protective effect against protein aggregation [ 12 , 13 ]. The transcriptomic and omics studies of patient samples of neurodegenerative diseases showed dysregulated patterns of chaperones under disease conditions [ 14 – 16 ]. These studies serve as a reference to understand the multicellular functions of molecular chaperones such as HSPA and DNAJ in neurodegenerative diseases. The HSPA or HSP70 is a major molecular chaperone class having 13 members in humans that maintain organelle-specific proteostasis by assisting protein folding, promoting refolding of unfolded proteins, halting/sequestering protein misfolding and aggregation, disaggregation of amyloid fibrils and targeting protein aggregates for degradation [ 11 , 17 ]. The HSPA chaperone functions are coordinated and regulated by co-chaperones DNAJ proteins, where DNAJBs are specifically associated with the prevention of protein aggregation, disaggregation and degradation of protein aggregates in neurodegenerative diseases [ 18 , 19 ]. The chaperone cycle and disaggregation activity of HSPA are coordinated by HSP110 (HSPH), which acts as a nucleotide exchange factor (NEF) of HSPA [ 20 , 21 ]. In the present study, we analysed the expression profile of the HSPA and DNAJ family of molecular chaperones under different cellular stress conditions associated with neurodegenerative diseases to provide a comparative profile of molecular chaperone expressions. The selected stress conditions refer to cellular oxidative stress and proteotoxic stress, where each stress condition disrupts cellular proteostasis through unique pathways in neurodegenerative diseases. We have investigated oxidative stress through rotenone exposure, which is epidemiologically associated with Parkinsonian symptoms and α-syn aggregation [ 22 , 23 ]. Proteotoxicity mediated by α-syn seeds-induced protein aggregation and MG132-mediated proteasome disruption [ 24 ]. Heat shock was used as a positive control to stimulate molecular chaperone expression [ 25 , 26 ]. Under the selected stress conditions, a variable gene and protein expression of HSPA and DNAJ proteins was studied. A unique molecular signature of HSPA1A (HSP70), HSPA8 (HSC70) and HSPH1 (HSP110) was observed in proteotoxic conditions. Co-chaperone DNAJB8 was specific to proteotoxic stress, whereas DNAJB1 was responsive to all stress conditions. The heat shock response was mediated by HSF1 in all stress conditions studied here, while NRF2 was also involved in oxidative and heat stress. The prior knowledge of the comparative expression profile of DNAJB proteins under oxidative and proteotoxic conditions emphasises the selectivity of DNAJBs toward stress response and can be useful for selecting targets for the prevention of protein misfolding and aggregation without hampering other cellular functions. The study will enhance our understanding of dynamic chaperone networking and regulation in neurodegenerative conditions. 2. Methodology 2.1 α-Synuclein (α-syn) purification . To purify WT α-syn, the BL21 cells were transformed with pT7-7 α-syn WT plasmid, a gift from Hilal Lashuel (Addgene plasmid # 36046 ; http://n2t.net/addgene:36046 ; RRID:Addgene_36046). The protein was overexpressed and purified via the precipitation-based method described [27-29]. The purified and lyophilized protein was stored at −80 °C. 2.2 Aggregation kinetics . The characterization of purified α-syn is based on its aggregation propensity and measured by the thioflavin T (ThT) fluorescence assay [27]. Briefly, a 70 µM solution of α-syn was prepared by dissolving lyophilized α-syn in sterile 1X phosphate buffer saline (1X PBS), pH-7.4 (Sigma-Aldrich, P5368). For aggregation kinetics, the α-syn (70 µM) was incubated with 20 µM ThT dye (Sigma-Aldrich, T3516-5G) at 37 °C for 48 h in a 96-well plate with black-clear bottom (Corning, 3603) while being continuously stirred linearly with sterile glass beads. ThT fluorescence was measured using an Infinite M200 PRO multimode plate reader (TECAN, Switzerland) with excitation/ emission wavelengths of 450/480 nm. 2.3 Preparation of α-syn seeds. The α-syn-seeds were prepared following standard protocol [27, 30]. Briefly, monomeric α-syn solution (140 µM) in 1X PBS was agitated with a sterilized glass bead at 600 rpm at 37 °C for 48 h on ThermoMixer C (Eppendorf, Germany). The fibrils were centrifuged 13,000 rpm for 15 min and washed to remove monomers and fibrils aliquots were stored at −80°C for one-time use. 2.3 Circular dichroism spectroscopy . The secondary structure characterization of the purified monomeric and fibrillar α-syn was performed using circular dichroism (CD) spectroscopy. Both monomeric and fibrillar α-syn, at a concentration of 10 µM, were placed separately in a quartz cell of path length 1 mm, and the spectra from 260 to 190 nm wavelength were recorded using a Chirascan V100 Circular dichroism Spectrometer (Applied Photophysics, UK) at 25 °C. The representative CD spectrum was the average of three consecutive scans. 2.4 Transmission electron microscopy. The morphological analysis of 48 h α-syn fibrils was done using transmission electron microscopy (TEM) as per the previous protocol [27]. Briefly, the fibril sample was diluted to 5 µM and negatively stained with uranyl formate acetate (Electron Microscopy Sciences, 541-09-3), placed on the formvar-coated copper grids (Sigma-Aldrich, TEM-FCF300CUUA) and air-dried at room temperature. The images were captured through Gatan digital micrograph software using an FEI transmission electron microscope (Tecnai G2 Spirit, Netherlands) at 80 kV, available at the Advanced Imaging Facility, CSIR-IITR. 2.5 Cell culture . Human SH-SY5Y neuroblastoma cells (ATCC, CRL-2266) were grown in a 1:1 mixture of F-12 Nutrient Mixture (Gibco, 21700-075) and Minimum Essential Medium (Gibco, 61100-053) growth media supplemented with 10% foetal bovine serum (FBS) (Gibco, 10270106) and 1% antibiotic-antimycotic (Gibco, 15240-062) in a humidified atmosphere containing 5% CO 2 at 37 °C and a maximum of 25 passages. The cell line is not listed as a commonly misidentified cell line by the International Cell Line Authentication Committee (ICLAC; http://iclac.org/databases/cross-contaminations/). 2. 6 Stress conditions and treatment. 2.6.1 Rotenone: Rotenone (Sigma-Aldrich, R8875) was prepared in culture-grade dimethyl sulfoxide (DMSO) (Sigma-Aldrich, D2650) at a concentration of 10 mM, aliquoted as one-time use vials and stored at -80 o C. SH-SY5Y cells were seeded and grown in 6-well plates (5,00,000 cells/well) till 70% confluency was reached. Cells were treated with different concentrations (0.1, 1.0 and 10 µM) of rotenone and harvested after 24 h for western blot and real-time analysis. 2.6.2 α-syn-seeds : SH-SY5Y cells were treated with indicated concentrations of α-syn-seeds using XfectTM protein transfection reagent following the manufacturer's protocol (Clontech, 631327). Briefly, the transfection reagent was incubated with the α-syn-seeds for 30 min prior to treatment, which were generated by pulse sonication (5 sec on, 15 sec off, 30% amplitude) [27, 30]. The cells were washed with sterile 1X PBS and with serum-free media and treated with the α-syn-seeds for 6 h. The media was replaced with complete media having 10% FBS 6h after transfection. After treatment, the cells were grown for 24 h and harvested for further experimental investigations. 2.6.3 MG132 : MG132 (Sigma-Aldrich, M7449), a ready-to-use stock solution (10 mM), was used to prepare the working solution of 1 mM concentration in culture-grade DMSO (Sigma-Aldrich, D2650) to treat SH-SY5Y cells. The working solution was aliquoted and stored at -80 o C as one-time use. At 70% confluency, cells were treated with different concentrations (1.0 and 2 µM) of MG132 for 24 h and harvested for western blot and real-time analysis. 2.6.4 Heat Shock Treatment : SH-SY5Y cells were subjected to heat stress by replacing the old media with fresh pre-warmed media at 42 o C. Cell-seeded plates were sealed with parafilm and heated by immersing the plates in the pre-heated circulatory water bath at 42 o C for 1 h. The media was then replaced with growth media at 37 o C, and incubated in a 37 o C incubator for the indicated recovery time points [25, 26]. 2.7 Cell viability assay . The effect of rotenone, MG132, and α-syn-seeds on the cell viability of SH-SY5Y cells was observed by MTT [3-(4, 5-501 dimethyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] (Sigma-Aldrich, M2128) assay. Briefly, the SH-SY5Y cells were seeded on a 96-well plate (20,000 cells/well) in 100 µl fresh medium. When the cells were 70% confluent, the old media was replaced by the 100 µl fresh media containing specified treatments and 0.1% SDS (negative control). After treatment, the cells were further grown for 24 h. After 24 h post-treatment, MTT (0.5 µg/µl) was added to each well and incubated for 2-4 h until purple formazan crystals were formed. The formazan crystals were dissolved in DMSO (Sigma-Aldrich, D2650) (100 µl/wells) by removing the entire media. The amount of formazan produced was measured by spectrometry by absorbance at 570 nm using the Infinite M200 PRO multimode plate reader (TECAN, Switzerland) for cell viability. 2.8 Protein extraction and quantification . The treated and control SH-SY5Y cells were lysed in cell lysis buffer containing RIPA (Sigma-Aldrich, R0278), 1 mM dithiothreitol (DTT) (Sigma-Aldrich, D9779), and 1X protease inhibitor cocktail (Sigma-Aldrich, P8340), through the freeze-thaw cycle for 30 min. Following lysis, the cell lysate was centrifuged at 13000 rpm, 4 O C for 30 min. The Bicinchoninic acid (BCA) kit (Thermo Scientific, 23225) was used to measure the protein concentrations in the supernatants, with bovine serum albumin (BSA) (Sigma-Aldrich, A7906) as the standard. 2.9 Immunoblotting. Equal amounts of protein (20-30 μg) from control and treated cell lysate were separated on the 10-12% SDS PAGE gel and transferred onto the activated PVDF membrane (Merck Millipore, IPVH00010) by wet electrotransfer for 1.5 h at a constant current of 200 mA using Mini Trans-Blot® Cell (Bio-Rad, USA). After transfer, the membrane was blocked with 5% (w/v) BSA (Sigma-Aldrich, A7906) in 1X TBST for 2 h at room temperature. The membrane was incubated with primary antibody specific for respective target such as HSPA1A (Abcam, ab2787) (1:1000), HSPA8 (Abcam, ab51052) (1:1000), HSPA5 (R&D Systems, AF4846-SP) (1:1000), HSPH1 (Abcam, ab109624) (1:1000), DNAJB1 (Cell Signaling Technology, #4868s) (1:1000), DNAJB6 (Abcam, ab198995) (1:1000), DNAJB8 (Abcam, ab235546) (1:1000), HSF1 (Cell Signaling Technology, #12972) (1:1000), NRF2 (Cell Signaling Technology, #33649) (1:1000), GAPDH (Cell Signaling Technology, #971668) (1:8000) and β-actin (Abcam, ab8224) (1:8000) overnight at 4 o C. Immunoblots were washed with 1X TBST for at least six times (5 min each). After washing, the immunoblots were incubated with HRP-conjugated anti-rabbit (Invitrogen, 656120) (1:10000), anti-mouse (Invitrogen, 626520) (1:10000) and anti-goat (Sigma Aldrich, A8919) (1:5000) secondary antibody in 1X TBST for 2 h at room temperature and washed again with 1X TBST for six-times (5 min each). Enhanced chemiluminescence detection was performed using the Immobilon western chemiluminescent HRP substrate (Millipore, WBKLS0500) and protein bands were recorded by Amersham Imager 600 (GE Healthcare Life Sciences, USA) or ChemiDoc TM MP Imaging System (Bio-Rad, USA). Quantity One (Bio-Rad Technical Service Department, USA) was used for densitometry analysis of the protein bands and target bands normalized to the relative bands of GAPDH or β-actin. 2.10 RNA isolation and cDNA synthesis . Total RNA was isolated from control and treated cells using RNAzol RT (Molecular Research Center, RN190) as described in the manufacturer's protocol. RNA integrity and yield were analyzed and quantified using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). 2.5 µg of the total RNA was transcribed into cDNA by RT2 first strand kit (Qiagen, 330401) using the manufacturer's protocol for customized PCR array. For real-time PCR analysis, 1 µg RNA was used to synthesise cDNA using High-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814), as per the manufacturer's protocol. 2.11 Real-time PCR. The real-time gene expression of 42 heat shock protein genes was monitored by using the customize PCR array, RT² Profiler™ PCR Array of Human Heat Shock Proteins & Chaperones (Qiagen, CLAH47524A) (Fig. S6) and RT² SYBER Green Mastermix (Qiagen, 330522) by Quant Studio 5 flex (Thermo Fisher Scientific, USA) as manufacture protocol. The baselines and thresholds were set manually in all experiments to avoid plate-to-plate variation and to increase the precision and comparability of data. The PCR array contained three housekeeping genes: GAPDH, β-ACTIN and β-2-MICROGLOBIN. The normalization of the gene was selected based on the coefficient of variation (CV) analysis that estimates the variation in the linearized Ct value of the housekeeping gene across all samples. The housekeeping gene having the lowest CV with higher stability was selected as the normalization gene [31]. The change in the target gene expression was calculated by Schmittgen & Livak’s ΔΔCt method [32]. Fold difference = (2−ΔCT)treatment / (2−ΔCT)control Where, ΔCT = CT (target) − CT (GAPDH) The ≥ 1.5-fold change increase and ≤ 0.5-fold change decrease in gene expression were considered as upregulated and downregulated gene expression, respectively, where the fold change between 0.5 and 1.5 was considered as no change. The RT-PCR of HSP70, HSF1 and NRF2 of the same cDNA was performed using SYBR Green Master Mix (Puregene, PGK022A) and primers specific to targets and quantified in the QuantStudio 6 Real-Time PCR (Thermo Fisher Scientific, USA). The relative gene expression was calculated using the gene GAPDH as a housekeeping control. The primer sequences used are listed table. Target gene Forward primer (5'->3') Reverse primer (5'->3') HSP70 CGACCTGAACAAGAGCATCA AAGATCTGCGTCTGCTTGGT GAPDH TCGGAGTCAACGGATTTGGT TTCCCGTTCTCAGCCTTGAC NRF2 CAGCTTTTGGCGCAGACATT AGCTCCTCCCAAACTTGCTC HSF1 CAAGCAACAGAAAGTCGTCA TTCAGCATCAGGGGGATCTTT 2.12 Statistical Analysis. All the statistical analysis was done by GraphPad Prism 8.0 software. For the statistical analysis of two groups, Student's t-test (two-tailed, unpaired) was used, for multiple genes/proteins between two groups, multiple t-test, followed by Holm–Šídák correction of multiple comparisons was applied. For multiple groups comparison, one-way ANOVA, followed by Dunnett’s multiple comparison test, was used. The Shapiro-Wilk test was used to determine the normality of the distribution. The data is represented as Mean ± SEM of at least three individual experiments. The significance is represented as ns (P>0.05), *(P≤0.05), **(P≤0.01), ***(P≤0.001), ****(P≤0.0001). 3. Results HSP70 expression and cell viability are stress markers To optimize the stress factors for this study, multiple variations among concentrations and time of treatment were standardised for each stress condition (Fig S1, S3) and measured based on the effect on the cell viability of SH-SY5Y cells and protein expression of stress-inducible chaperone HSP70 (Fig. 1A). In rotenone-induced oxidative stress, 0.1, 1.0 and 10 µM rotenone showed reduction in cell viability of SH-SY5Y cells and significantly increased the protein expression of HSP70 after 24 h (Fig. S1, 1B). Specifically, 1 µM rotenone decreased the cell viability to 25.67% and sufficiently induced a 1.47 fold change in HSP70 expression. For proteotoxic stress, α-syn-seeds were prepared as per the standard protocol [22] and characterized by secondary structure having a negative peak around 216 nm and a positive peak around 193 nm, representing anti-parallel β-sheet-structure (Fig. S2). These α-syn-seeds [27, 30] exhibited a concentration-dependent decrease in cell viability with increasing concentrations of α-syn-seeds (Fig. S3). The α-syn-seeds at 4 µM concentrations lead to about 36.08% decreases in cell viability and 1.49 fold upregulation in HSP70 protein expression (Fig. 1C, S3A). Further, MG132, a proteosomal inhibitor, resulted in a 37.99% decline in cell viability and a 3.15 fold increase in HSP70 expression compared to the control at 1 µM concentration (Fig. 1D, S3B). As the heat shock has been associated with overexpression of molecular chaperones [25, 26]. A significant upregulation (2.07 fold) of HSP70 protein level was observed in SH-SY5Y cells incubated in a preheated water bath at 42°C for 1 h, followed by 6 h of recovery period at 37°C (Fig. 1E). Based on these observations and the parameters of cell viability and HSP70 expression, 1 µM rotenone, 4 µM α-syn-seeds, 1 µM MG132 and heat shock of 42°C for 1 h, followed by 6 h recovery at 37°C were selected for further comparative profiling of molecular chaperones. HSPA8 and HSPH1 as differential protein markers for specific cellular stress. HSPA or HSP70 is a major chaperone class that is associated with the folding of a large number of protein substrates in the cellular system and is involved in several other cellular processes [33, 34]. Here, the gene expressions of HSPA family proteins (HSPA1A, HSPA1L, HSPA2, HSPA4, HSPA5, HSPA8, HSPA9 and HSPA12A) and HSPH1 were evaluated under stress conditions using a customized PCR array for Human Heat Shock Proteins & Chaperones (Fig. 2A, S6) and collectively represented via heatmap (Fig. 2B). Differential gene expression represented in heat map is based on fold change where the fold changes greater or equal to 1.5 is selected for upregulation and below or equal to 0.5 as downregulation. The genes screened out from the cutoff were further analyzed using appropriate statistical analysis for significance and comparisons. In rotenone-induced oxidative stress, no change was observed in HSPA4, HSPA5, HSPA8 and HSPA9 genes as compared to the control (Fig. 2Ci). The α-syn-seeds-induced proteotoxicity in vitro resulted in the significant downregulation of both HSPA1A (0.45 fold) and HSPA8 (0.52 fold) genes (Fig. 2Di) while upregulating HSPA5 (2.05 fold). Similarly, apart from several HSPA genes upregulation (HSPA1A (118.51 fold), HSPA1L (3.81 fold), HSPA4 (3.00 fold), HSPA5 (5.59 fold), HSPA8 (3.98 fold), HSPA9 (3.61 fold) and HSPA12A (2.14 fold)), HSPA2 was 0.44 fold downregulated after MG132 treatment (Fig. 2Ei). Heat shock resulted in several fold changes in the gene expression of HSPA1A (86.05 fold), HSPA1L (12.95 fold), HSPA4 (2.85 fold) and HSPA5 (3.18 fold), respectively (Fig. 2Fi). Further, the results of the PCR array were validated using a different set of primers and a real-time PCR assay for the HSPA1A gene and similar results in the gene expression were observed across all experimental conditions (Fig. S4). Further, the changes in protein expression of HSPA1A (HSP70), HSPA5 (Bip/Grp78) and HSPA8 (HSC70) under stress conditions were studied. A significant upregulation in the protein level of HSPA1A (HSP70) was observed across all stress conditions (Fig. 1B-E), while HSPA5 and HSPA8 were significantly upregulated by MG132 and heat stress (Fig. 2E-F ii-iii). However, HSPA5 protein was apparently altered in oxidative and α-syn-seeds-induced stress while HSPA8 protein remained unaltered (Fig. 2C-D ii-iii). The protein expression of HSPH1, commonly known as HSP110, was also performed, as it plays a significant role in protein folding and disaggregation in association with HSP70 [20, 35]. The gene expression of HSPH1 was significantly upregulated in MG132-induced proteotoxic stress and heat stress (Fig. 2E-Fi). In rotenone-induced oxidative stress, the change in the gene expression of HSPH1 was non-significant (Fig. 2C i) and downregulated in α-syn-seeds-induced proteotoxic stress (Fig. 2D i). Interestingly, the protein expression of HSPH1 in vitro remained upregulated in all stress conditions (Fig. 2C-F ii-iii). DNAJB8 are selective for cellular stress associated with neurodegenerative diseases The DNAJ proteins act as co-chaperones of HSPA in protein folding, disaggregation and degradation, and regulate the multifunctionality and substrate specificity of the HSPA chaperones [19, 34]. Here we studied the variation in gene expression of twenty-two different members of the DNAJ family (4 DNAJA, 9 DNAJB and 9 DNAJC) that are known to have a significant role in cellular protein homeostasis maintenance. A selective alteration in the expression profiles of DNAJ proteins was observed for different stress conditions (Fig. 2B). The rotenone-induced oxidative stress apparently altered the gene expression of DNAJA2, DNAJB4, and ER-specific DNAJs, DNAJC1, DNAJC7, DNAJC9 and DNAJC10; however, the changes were statistically significant for DNAJC1 (1.93 fold) (Fig. 3C i). The gene expression of DNAJB1 (0.41 fold) was significantly downregulated in α-syn-seeds induced proteotoxic stress (Fig. 3D i). Inhibition of the proteasome through MG132 leads to gene expression alteration in several DNAJ proteins. DNAJA1 (1.87 fold), DNAJA3 (1.91 fold), and DNAJA4 (1.74 fold), DNAJB1 (43.95 fold), DNAJB11 (1.81 fold), DNAJB12 (1.51 fold), DNAJB2 (4.78 fold), DNAJB4 (3.32 fold), DNAJB5 (1.63 fold), DNAJB6 (2.00 fold), and DNAJC7 (2.13 fold) were upregulated, ER-specific DNAJs, DNAJC9 (0.50 fold), and DNAJC10 (0.49 fold) were significantly downregulated (Fig. 3E i). Heat shock also has a specific expression pattern, where a significant increase in the gene expression of DNAJA1 (2.21 fold), DNAJB1 (37.17 fold), DNAJB4 (3.86 fold) and DNAJB6 (2.63 fold) was observed in vitro (Fig. 3F i). Further, the alterations in protein levels of DNAJBs (DNAJB1, DNAJB6 (a,b) and DNAJB8), which have a proven role in regulating the aggregation of amyloid proteins and association with neurodegenerative diseases through mechanistic involvement in protein folding, disaggregation and aggregation prevention [9, 36-38] were done. Interestingly, a significantly upregulated protein expression of DNAJB1 (1.19 fold) was observed in oxidative stress by rotenone, while DNAJB6 and DNAJB8 were unaltered (Fig. 3C ii-iii). Expression of both DNAJB1 and DNAJB8 were significantly enhanced in α-syn-seeds and MG132 treatment, whereas the protein expression of DNAJB6 (both a and b isoforms) remained unchanged (Fig. 3D-E ii-iii). The heat shock significantly induced the protein expression of DNAJB1 (3.82 fold) (Fig. 3F ii-iii). In summary, the study indicates highly specific overexpression of co-chaperone DNAJB8 in proteotoxic conditions as induced by α-syn-seeds and MG132 and DNAJB1 for all kinds of stress conditions used in this study. Transcriptional regulation of molecular chaperones by HSF-1 and NRF2: Next, we addressed the regulatory factors of chaperone expression, the heat shock factor 1 (HSF1), which controls cellular proteostasis under heat stress and proteotoxic stress by regulating the expression of majority of chaperones, and nuclear factor erythroid 2-related factor 2 (NRF2) that controls the cellular redox potential under oxidative stress [39-41]. HSF1 protein was over-expressed (1.5 to 1.8 fold) in all four stress conditions (Fig. 4A i-iv). Interestingly, the change in the protein expression of NRF2 was selective for stress conditions. The protein expression of NRF2 was upregulated in rotenone-induced oxidative stress (1.30 fold), MG132-induced proteotoxic stress (15.39 fold) and heat stress (1.18 fold) (Fig. 4B ii, iii-iv) compared to control, whereas the α-syn-seeds decreased the NRF2 protein expression by 0.65 fold (Fig. 4 ii). In contrast to the protein expression, the gene expression of HSF1 and NRF2 (Fig. S5 A- B) also deviated from their protein levels. A significantly increased gene expression of HSF1 was observed in rotenone and MG132 treatments, whereas heat stress and α-syn-seeds treatment resulted in an unaltered change in the gene expression of HSF-1, which was consistent with previous reports [42]. The gene expression of NRF2 was upregulated in all stress conditions except the α-syn-seeds, where no alteration in NRF2 gene expression was observed. 4. Discussion The human genome encodes more than 100 different molecular chaperones that are grouped according to their molecular weight as HSPH (HSP110), HSPC (HSP90), HSPA (HSP70), DNAJ (HSP40), human chaperonins HSPD/E (HSP60/HSP10 & CCT (TRiC)) and HSPB (sHSP) [ 43 ]. These chaperones are complemented by a number of regulatory proteins that help in networking with cellular processes [ 44 ]. The dysregulation of molecular chaperones is related to several protein aggregation-associated diseases, including neurodegenerative, metabolic diseases and cancers [ 2 , 14 – 16 , 45 , 46 ]. In each disease condition, the cellular environment varies, and expression profiling of molecular chaperones is subsequently altered, probably with a unique molecular imprint. However, limited literature and reports are focused on the expression analysis of the unique molecular imprint of the molecular chaperones and co-chaperones in protein aggregation-associated neurodegenerative diseases and associated stress factors. Therefore, it is necessary to understand the selectivity of molecular chaperones and co-chaperones toward different stress conditions. Herein, we investigated the in vitro expression pattern of molecular chaperones HSPA and DNAJ under oxidative and proteotoxic conditions as commonly associated with the initiation and propagation of neurodegenerative diseases. The variation in gene expression profile of eight different members of the HSPA family, HSPA1A, HSPA1L, HSPA2, HSPA5, HSPA8, HSPA4, HSPA9 and HSPA12A under different stress conditions was studied. HSPA1A, also known as HSP70, is a stress-inducible protein was upregulated at the protein level in all stress conditions studied (Fig. 1 C-E). The gene/transcriptomic levels of HSPA1A were selectively affected, where upregulation was observed under heat and proteasomal inhibition conditions and downregulation in the presence of α-syn seeds in vitro. The oxidative stress did not affect the HSP70 gene levels. The difference in the gene expression pattern of HSPA1A might be due to differences in the mechanism of stress and subsequent effect on the stability of the respective mRNA [ 47 ]. HSPA5, also known as GRP78 (glucose-regulated protein 78) or BiP (binding immunoglobulin protein), is a constitutively expressed HSP70 associated with the ER, the quality control organelle for cellular proteostasis [ 48 ]. HSPA5 is upregulated at gene expression (Fig. 2 C-F i) and protein expression (Fig. 2 C-F ii-iii) under all stress conditions studied, where upregulation was statistically significant for proteasome inhibition and heat stress (2E-F i-iii). HSPA5 regulates ER-associated protein folding of newly synthesised peptide, refolding of misfolded proteins and proteasomal degradation. HSPA5 maintains ER calcium homeostasis, also senses misfolded protein load in ER and activates the unfolded protein response (UPR) to restore protein homeostasis [ 48 ]. The stress-induced proteostasis imbalance affects ER homeostasis, which induces HSPA5 expression. Therefore, we observed a uniformly upregulated expression of HSPA5 under stress conditions and can be considered as a marker of proteostasis dysfunction. HSPA8 (HSC70) is the constitutively expressed chaperone that has several protein quality control functions, including regulating chaperone-mediated autophagy, protein folding and transportation and protein disaggregation to efficiently disassemble amyloid fibrils [ 9 , 49 ]. The gene and protein level expression of HSPA8 was upregulated in MG132 (Fig. 2Ei-iii), heat stress resulted in increased protein expression of HSPA8 (Fig. 2Fii-iii), while both the gene and protein remained unaltered by rotenone-induced oxidative stress (Fig. 2Ci-iii). The unaltered gene and protein expression of HSPA8 due to rotenone exposure was consistent with our previous report, where HSPA8 was unchanged in the dopaminergic neurons of a rotenone-induced Parkinsonian rat model [ 50 ]. Interestingly, in α-syn seeds-induced toxicity, HSPA8 was down-regulated at the gene level (Fig. 2Di). The protein expression of HSPA8 was also unchanged in α-syn seeds-induced toxicity (Fig. 2Dii-iii), which is consistent with a previous report showing a significant role of HSPA8 in the pathogenesis of Alzheimer's disease (AD) [ 51 , 52 ]. The down-regulation of HSPA8 gene is associated with reduced cell proliferation, increased aggregation of α-syn, tau, and SOD and increased cell apoptosis in HSPA8 knockdown in vitro [ 53 , 54 ]. Thus, downregulated gene expression of HSPA8 due to α-syn-seeds-toxicity may be associated with compromised chaperone capacity in terms of hampered cell proliferation, disaggregation and degradation. While the upregulated expression of HSPA8 due to proteasome inhibition may be due to the compensatory role of HSPA8 in autophagy to clear the hampered protein load [ 55 , 56 ]. HSPA4, also known as APG-2, has a significant role in clathrin-mediated endocytosis and protein disaggregation [ 9 , 57 ]. We observed significant upregulation in the gene expression of HSPA4 in MG132 treatment and heat shock (Fig. 2 E-Fi), whereas no alteration in rotenone and α-syn-seeds-induced stress, similar to previous observations for HSPA8 (Fig. 2 C-Di). As a crucial part of HSC70 disaggregation machinery, APG2 recruits dense clusters of HSC70 on amyloid fibrils, necessary for the disaggregation reaction and regulate the kinetics of the disaggregation reaction [ 9 , 58 ]. The reduced level of HSPA4 and HSPA8 indicated the compromised cellular disaggregation machinery in stress. Other proteins significant to neurodegenerative disease, such as HSPA1L, a pathogenesis and prognosis biomarker of PD and glioma [ 59 ], was upregulated by MG132 treatment and heat shock (Fig. 2 E-Fi). The proteasomal inhibition by MG132 further upregulated the genes of mitochondrial-specific HSP70, HSPA9 (also known as Mortalin, Grp75), and HSPA12A (Fig. 2 Ei), consistent with previous reports [ 60 ]. We also observed a decrease in HSPA2 gene expression due to proteasome inhibition (Fig. 2 Ei), similar to other reports and is associated with reduced ER stress and cell proliferation [ 61 , 62 ]. Similar to HSPA4, HSPH1 (HSP110) is another chaperone that has mechanistically important role in HSP70-mediated protein folding and disaggregation as NEF [ 20 , 35 ]. We observed significant upregulated gene expression of HSPH1 in MG132 treatment and heat shock (Fig. 2 E-Fi). The protein expression of HSPH1 in SH-SY5Y cells was upregulated in all stress conditions (Fig. 2 C-Fii-iii). The upregulated HSPH1 protein expression is consistent with other/our previous in vivo reports, in which HSP105 (homologue of HSP110 in rat) was upregulated in dopaminergic neurons of a rotenone-induced Parkinsonian rat model [ 50 ] and thus can be effective against protein aggregation by increasing the chaperone capacity and disaggregase activity [ 63 ]. The HSPA family chaperones have DNAJ as co-chaperones that regulate the multifunctionality and substrate specificity of the HSPA [ 34 ]. Here we have studied the molecular expression signatures of twenty-two DNAJ proteins, DNAJA1, DNAJA2, DNAJA3, DNAJA4, DNAJB1, DNAJB2, DNAJB4, DNAJB5, DNAJB6, DNAJB8, DNAJB9, DNAJB11, DNAJB12, DNAJC1, DNAJC4, DNAJC5, DNAJC6, DNAJC7, DNAJC8, DNAJC9, DNAJC10 and DNAJC16 that are associated with proteostasis maintenance (Fig. 3 ). Out of 22 DNAJs, DNAJB1, DNAJB6, and DNAJB8 have been known for mechanistic role in regulating protein aggregation and associated neurodegenerative disease [ 9 , 19 , 37 , 38 ]. We observed significant gene imprint for each protein under the specified stress conditions, clearly distinguishing the stress response and handling by the cellular system. DNAJB1, a critical part of protein disaggregation machinery (HSP(C)70/DNAJB1/HSP110), binds to the amyloid fibrils of α-syn, tau and HTT proteins linked to neurodegenerative diseases and recruits HSP70/HSC70 for disaggregation [ 9 , 64 ]. The α-syn-seeds-induced proteotoxicity resulted in the downregulation of the DNAJB1 gene (Fig. 3 Di), whereas proteasomal inhibition and heat stress caused its upregulation (Fig. 3 E-Fi). Rotenone exerted no effect on the gene expression of DNAJB1 (Fig. 3 C). The unaltered gene expression of the DNAJB1 gene in rotenone-treated cells is consistent with our previous report [ 50 ]. We also checked the protein level of DNAJB1 under stated stress conditions and observed a significant increase in the protein expression of DNAJB1, where the level of upregulation varied with stress conditions. Our results indicate that neither HSPH1 nor DNAJB1 are the limiting factor for the activity of disaggregation machinery in vitro under stress conditions, where unaltered expression of HSC70 may limit the action of the constitutive HSC70 disaggregation system in stress conditions. DNAJB6 can prevent the aggregation of tau, Aβ and polyQ through the HSP70-independent mechanism and also regulates HSP70 activity in tau folding [ 36 , 37 , 65 ]. We did not observe significant changes in DNAJB6 gene expression in rotenone or α-syn-seeds treatment. However, DNAJB6 gene expression was upregulated by proteasomal inhibition and heat shock (Fig. 3 E-Fi). DNAJB6 protein has two isoforms (DNAJB6a and DNAJB6b) that showed differential protein expression under stress, both DNAJB6a and DNAJB6b were apparently upregulated by proteasomal inhibition and heat shock, however not validated statistically. Similarly, DNAJB8 prevents protein aggregation through its HSP70-independent mechanism [ 38 ]. We observed significant upregulation in the protein expression of DNAJB8 in proteotoxic stress induced by α-syn-seeds and MG132 (Fig. 3 D-Eii-iii) however; changes in the gene expression were not consistent. Due to its selective protein expression profile, DNAJB8 can be an indicative marker for proteotoxic stress. The gene expression of DNAJB4 was upregulated MG132 and heat stress conditions (Fig. 3 E-Fi). The proteasome inhibition resulted in the upregulation of gene expression of DNAJB5, DNAJB11 and DNAJB12 (Fig. 3 CEi) that are associated with clearance of protein aggregate by preventing of protein aggregates, promoting the refolding and lysosomal degradation [ 19 , 66 ]. The gene expression of DNAJA and DNAJCs was also altered according to their response to specific stress and cellular compartment specificity. DNAJA1, DNAJA3 and DNAJA4 were upregulated in proteotoxic stress induced by proteasome inhibition. DNAJA1 was upregulated in heat stress (Fig. 3 C-Fi). The upregulation of DNAJAs in response to different stress conditions is due to their consistent association in protein folding and degradation [ 10 , 67 ]. Among the DNAJCs, the gene levels of DNAJC1 was upregulated in oxidative stress (Fig. 3 Ci). The gene expression of DNAJC7 was upregulated while DANJC9 and DNAJC10 were downregulated in MG132 treatment. These altered DNAJCs were associated with ER-associated degradation (ERAD) and chromatin integrity [ 68 – 71 ]. To understand the regulation of molecular chaperone expression, HSF1 and NRF2 profiles were analysed under the different stress conditions. The expression of molecular chaperones is regulated by HSF1 through activation of HSR [ 44 ]. However, not all chaperones are stress-inducible; some are constitutively expressed and inducible under stress [ 3 ], indicating that the expression of chaperones might not be a part of the HSR alone. A cross-talk between HSF1 and NRF2 exists in cellular conditions that plays a considerable role in the regulation of HSP70 expression and maintenance of cellular homeostasis [ 39 – 41 ]. Therefore, we have analysed the expression of both HSF1 and NRF2 under stated different stress conditions. An increased expression of HSF1 in all stress conditions was observed (Fig. 4 A), whereas the protein expression of NRF2 varied with stress conditions (Fig. 4 B). The expression of NRF2 was increased in rotenone, MG132 and heat shock-induced stress, while decreased in α-syn seeds-induced stress condition. The gene expression of HSF1 and NRF2 (Fig. S5) showed deviation from their protein levels. The altered chaperones and co-chaperones expressions exhibit their specificity toward stress conditions to meet the stress-induced cellular response (Fig. 5 ). Oxidative stress-induced cellular damage mainly affects the endoplasmic reticulum and mitochondria, where molecular chaperones HSPA1A, HSPA8, HSPA5, HSPA9 and HSPA4 associated with the cytosol, ER and mitochondria were altered. Further, the altered co-chaperones DNAJB1, DNAJB4, DNAJB6, DNAJC7, DNAJC1, DNAJC9, DNAJC10 and DNAJA2 regulate the protein refolding, disaggregation, and degradation in the cytosol, ER and mitochondria. Proteotoxicity induced by α-syn-seeds results in the upregulation of HSP1A, HSPA5, HSPH1, DNAJB1 and DNAJB8, associated with stress-induced aggregation prevention, refolding and disaggregation. While unaltered protein levels and downregulated gene levels of HSPA8 and HSPA4 correlate with compromised chaperone capacity. Proteasome inhibition has a negative impact on the cellular proteostasis, which results in upregulation of the battery of chaperones and co-chaperones HSPA1A, HSPA1L, HSPA4, HSPA5, HSPA8, HSPA9, HSPA12A, DNAJA1, DNAJA3, and DNAJA4, DNAJB1, DNAJB11, DNAJB12, DNAJB2, DNAJB4, DNAJB5, DNAJB6, and DNAJC7 while HSPA2, DNAJC9 and DNAJC10 were downregulated. These altered chaperones are associated with refolding, disaggregation, autophagy and chromatin integrity to help the cell to cope the stress by combating the cellular load of non-functional/toxic proteins. 5. Conclusion The study defines the heat shock response through expression of HSPA and DNAJ in different cellular stress conditions associated with neurodegenerative diseases, and underlies their crucial role in maintaining proteostasis. The differential expression of HSPA and DNAJ reflects the cellular adaptive mechanisms to address protein aggregation and maintain cellular functioning. Further, the stress-dependent involvement of transcription factors HSF1 and NRF2 indicates the involvement of other cellular pathways to acquire cellular stress response. Understanding these molecular responses could define the approach for developing treatments to restore proteostasis and prevent disease progression. The work has been performed in vitro using neuronal cell lines, further validation through the primary cell culture of different brain regions affected in neurodegenerative diseases, experimental animals or patient samples could be helpful. Comprehensive mapping of molecular chaperones under healthy and stressed conditions may help researchers working in several areas of biology to accurately determine targets for applications in research and therapeutics. Abbreviations α-syn, Alpha-synuclein; Aβ, amyloid β; AD, Alzheimer's disease; BCA, Bicinchoninic acid; BSA, Bovine serum albumin; CD, Circular dichroism; DMSO, Dimethyle sulfoxide; DTT, Dithiothreitol; ER, Endoplasmic reticulum; ERAD, endoplasmic reticulum associated degradation; FBS, Foetal bovine serum; HSR, Heat shock response; HSF1, Heat shock factor 1; HTT, Huntingtin; MTT, [3-(4, 5-501 dimethyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide]; NRF2, Nuclear factor erythroid 2-related factor 2; NEF, Nucleotide exchange factor; PBS, Phosphate buffer saline; PD, Parkinson’s disease; SOD, Superoxide dismutase; TBS, Tris buffer saline; TEM, Transmission electron microscopy; ThT, Thioflavin T; UPR, Unfolded protein response; WT, wild type Declarations Acknowledgements The author acknowledges the support of the Council of Scientific and Industrial Research, India. CSIR-IITR manuscript communication number is IITR/SECC-PME/MSS/2025/026. We thank Mr. Jai Shankar for his assistance in the transmission electron microscopy imaging and Dr Amita Jain, Department of Microbiology, KGMU, for the Quant Studio 5 flex facility. Funding SP is supported by SERB POWER Grant, SPG/2021/003283, SF received fellowship from the University Grants Commission, India and AG received fellowship from SERB. Competing Interests Authors declare no competing financial interests Authors contribution SF did investigation, formal analysis, data curation, validation and wrote original draft, review & edited. AG performed the investigation and data curation. SP did conceptualization, supervision, validation, resources, project administration, funding acquisition and writing, review & editing of the manuscript. All authors reviewed the manuscript. Data Availability Statement Data is provided within the manuscript or supplementary information files. Conflict of Interest The authors declare no conflict of interest. Ethics approval The study was performed in cell lines, and ethical approval was not applicable References Mayer MP, Bukau B (2005) Hsp70 chaperones: cellular functions and molecular mechanism. Cell Mol Life Sci 62:670–684. 10.1007/s00018-004-4464-6 Shemesh N, Jubran J, Dror S, Simonovsky E, Basha O, Argov C, Hekselman I, Abu-Qarn M, Vinogradov E, Mauer O, Tiago T, Carra S, Ben-Zvi A, Yeger-Lotem E (2021) The landscape of molecular chaperones across human tissues reveals a layered architecture of core and variable chaperones. Nat Commun 12:2180. 10.1038/s41467-021-22369-9 Morimoto RI (2008) Proteotoxic stress and inducible chaperone networks in neurodegenerative disease and aging. Genes Dev 22:1427–1438. 10.1101/gad.1657108 Stetler RA, Gan Y, Zhang W, Liou AK, Gao Y, Cao G, Chen J (2010) Heat shock proteins: cellular and molecular mechanisms in the central nervous system. Prog Neurobiol 92:184–211. 10.1016/j.pneurobio.2010.05.002 Singh MK, Shin Y, Ju S, Han S, Choe W, Yoon KS, Kim SS, Kang I (2024) Heat Shock Response and Heat Shock Proteins: Current Understanding and Future Opportunities in Human Diseases. Int J Mol Sci 25. 10.3390/ijms25084209 Gidalevitz T, Prahlad V, Morimoto RI (2011) The stress of protein misfolding: from single cells to multicellular organisms. Cold Spring Harb Perspect Biol 3. 10.1101/cshperspect.a009704 Lippi A, Krisko A (2024) Protein aggregation: A detrimental symptom or an adaptation mechanism? J Neurochem 168:1426–1441. 10.1111/jnc.15955 Gadhave DG, Sugandhi VV, Jha SK, Nangare SN, Gupta G, Singh SK, Dua K, Cho H, Hansbro PM, Paudel KR (2024) Neurodegenerative disorders: Mechanisms of degeneration and therapeutic approaches with their clinical relevance. Ageing Res Rev 99:102357. 10.1016/j.arr.2024.102357 Schneider MM, Gautam S, Herling TW, Andrzejewska E, Krainer G, Miller AM, Trinkaus VA, Peter QAE, Ruggeri FS, Vendruscolo M, Bracher A, Dobson CM, Hartl FU, Knowles TPJ (2021) The Hsc70 disaggregation machinery removes monomer units directly from alpha-synuclein fibril ends. Nat Commun 12:5999. 10.1038/s41467-021-25966-w Baaklini I, Goncalves CC, Lukacs GL, Young JC (2020) Selective Binding of HSC70 and its Co-Chaperones to Structural Hotspots on CFTR. Sci Rep 10:4176. 10.1038/s41598-020-61107-x Mayer MP, Gierasch LM (2019) Recent advances in the structural and mechanistic aspects of Hsp70 molecular chaperones. J Biol Chem 294:2085–2097. 10.1074/jbc.REV118.002810 Kilpatrick K, Novoa JA, Hancock T, Guerriero CJ, Wipf P, Brodsky JL, Segatori L (2013) Chemical induction of Hsp70 reduces alpha-synuclein aggregation in neuroglioma cells. ACS Chem Biol 8:1460–1468. 10.1021/cb400017h Klucken J, Shin Y, Masliah E, Hyman BT, McLean PJ (2004) Hsp70 Reduces alpha-Synuclein Aggregation and Toxicity. J Biol Chem 279:25497–25502. 10.1074/jbc.M400255200 Brehme M, Voisine C, Rolland T, Wachi S, Soper JH, Zhu Y, Orton K, Villella A, Garza D, Vidal M, Ge H, Morimoto RI (2014) A chaperome subnetwork safeguards proteostasis in aging and neurodegenerative disease. Cell Rep 9:1135–1150. 10.1016/j.celrep.2014.09.042 Borrageiro G, Haylett W, Seedat S, Kuivaniemi H, Bardien S (2018) A review of genome-wide transcriptomics studies in Parkinson's disease. Eur J Neurosci 47:1–16. 10.1111/ejn.13760 Sun H, Zou HY, Cai XY, Zhou HF, Li XQ, Xie WJ, Xie WM, Du ZP, Xu LY, Li EM, Wu BL (2020) Network Analyses of the Differential Expression of Heat Shock Proteins in Glioma. DNA Cell Biol 39:1228–1242. 10.1089/dna.2020.5425 Rosenzweig R, Nillegoda NB, Mayer MP, Bukau B (2019) The Hsp70 chaperone network. Nat Rev Mol Cell Biol 20:665–680. 10.1038/s41580-019-0133-3 Marszalek J, De Los Rios P, Cyr D, Mayer MP, Adupa V, Andreasson C, Blatch GL, Braun JEA, Brodsky JL, Bukau B, Chapple JP, Conz C, Dementin S, Genevaux P, Genest O, Goloubinoff P, Gestwicki J, Hammond CM, Hines JK, Ishikawa K, Joachimiak LA, Kirstein J, Liberek K, Mokranjac D, Nillegoda N, Ramos CHI, Rebeaud M, Ron D, Rospert S, Sahi C, Shalgi R, Tomiczek B, Ushioda R, Ustyantseva E, Ye Y, Zylicz M, Kampinga HH (2024) J-domain proteins: From molecular mechanisms to diseases. Cell Stress Chaperones 29:21–33. 10.1016/j.cstres.2023.12.002 Fatima S, Pandey P, Sharma SK, Priya S (2025) Structural-functional relevance of DNAJBs in protein aggregation and associated neurodegenerative diseases. Biochim Biophys Acta Proteins Proteom 1873:141074. 10.1016/j.bbapap.2025.141074 Mattoo RUH, Sharma SK, Priya S, Finka A, Goloubinoff P (2013) Hsp110 is a bona fide chaperone using ATP to unfold stable misfolded polypeptides and reciprocally collaborate with Hsp70 to solubilize protein aggregates. J Biol Chem 288:21399–21411. 10.1074/jbc.M113.479253 Wentink A, Rosenzweig R (2023) Protein disaggregation machineries in the human cytosol. Curr Opin Struct Biol 83:102735. 10.1016/j.sbi.2023.102735 Srivastava T, Raj R, Dubey A, Kumar D, Chaturvedi RK, Sharma SK, Priya S (2020) Fast kinetics of environmentally induced alpha-synuclein aggregation mediated by structural alteration in NAC region and result in structure dependent cytotoxicity. Sci Rep 10:18412. 10.1038/s41598-020-75361-6 Betarbet R, Canet-Aviles RM, Sherer TB, Mastroberardino PG, McLendon C, Kim JH, Lund S, Na HM, Taylor G, Bence NF, Kopito R, Seo BB, Yagi T, Yagi A, Klinefelter G, Cookson MR, Greenamyre JT (2006) Intersecting pathways to neurodegeneration in Parkinson's disease: effects of the pesticide rotenone on DJ-1, alpha-synuclein, and the ubiquitin-proteasome system. Neurobiol Dis 22:404–420. 10.1016/j.nbd.2005.12.003 Romero-Granados R, Fontan-Lozano A, Aguilar-Montilla FJ, Carrion AM (2011) Postnatal proteasome inhibition induces neurodegeneration and cognitive deficiencies in adult mice: a new model of neurodevelopment syndrome. PLoS ONE 6:e28927. 10.1371/journal.pone.0028927 Cheng L, Smith DJ, Anderson RL, Nagley P (2011) Human neuroblastoma SH-SY5Y cells show increased resistance to hyperthermic stress after differentiation, associated with elevated levels of Hsp72. Int J Hyperth 27:415–426. 10.3109/02656736.2010.531075 Lang BJ, Nguyen L, Nguyen HC, Vieusseux JL, Chai RC, Christophi C, Fifis T, Kouspou MM, Price JT (2012) Heat stress induces epithelial plasticity and cell migration independent of heat shock factor 1. Cell Stress Chaperones 17:765–778. 10.1007/s12192-012-0349-z Srivastava T, Tyagi D, Fatima S, Sathyan MTV, Raj R, Sharma A, Chaturvedi M, Sinha M, Shishodia SK, Kumar D, Sharma SK, Shankar J, Satish A, Priya S (2024) A natural small molecule-mediated inhibition of alpha-synuclein aggregation leads to neuroprotection in Caenorhabditis elegans. J Neurochem 168:1640–1654. 10.1111/jnc.15907 Volles MJ, Lansbury PT Jr. (2007) Relationships between the sequence of alpha-synuclein and its membrane affinity, fibrillization propensity, and yeast toxicity. J Mol Biol 366:1510–1522. 10.1016/j.jmb.2006.12.044 Paleologou KE, Schmid AW, Rospigliosi CC, Kim HY, Lamberto GR, Fredenburg RA, Lansbury PT Jr., Fernandez CO, Eliezer D, Zweckstetter M, Lashuel HA (2008) Phosphorylation at Ser-129 but not the phosphomimics S129E/D inhibits the fibrillation of alpha-synuclein. J Biol Chem 283:16895–16905. 10.1074/jbc.M800747200 Chaturvedi M, Raj R, Yadav SK, Srivastava T, Devi S, Dharmadana D, Valery C, Sharma SK, Kumar D, Priya S (2023) Implications of In Vitro Multi-Serine Phosphorylation of Alpha-Synuclein in Aggregation and Cytotoxicity. ACS Chem Neurosci 14:3103–3112. 10.1021/acschemneuro.3c00234 Sundaram VK, Sampathkumar NK, Massaad C, Grenier J (2019) Optimal use of statistical methods to validate reference gene stability in longitudinal studies. PLoS ONE 14:e0219440. 10.1371/journal.pone.0219440 Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108. 10.1038/nprot.2008.73 Vos MJ, Hageman J, Carra S, Kampinga HH (2008) Structural and functional diversities between members of the human HSPB, HSPH, HSPA, and DNAJ chaperone families. Biochemistry 47:7001–7011. 10.1021/bi800639z Kampinga HH, Craig EA (2010) The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nat Rev Mol Cell Biol 11:579–592. 10.1038/nrm2941 Wentink AS, Nillegoda NB, Feufel J, Ubartaite G, Schneider CP, De Los Rios P, Hennig J, Barducci A, Bukau B (2020) Molecular dissection of amyloid disaggregation by human HSP70. Nature 587:483–488. 10.1038/s41586-020-2904-6 Chang YL, Yang CC, Huang YY, Chen YA, Yang CW, Liao CY, Li H, Wu CS, Lin CH, Teng SC (2023) The HSP40 family chaperone isoform DNAJB6b prevents neuronal cells from tau aggregation. BMC Biol 21:293. 10.1186/s12915-023-01798-6 Osterlund N, Frankel R, Carlsson A, Thacker D, Karlsson M, Matus V, Graslund A, Emanuelsson C, Linse S (2023) The C-terminal domain of the antiamyloid chaperone DNAJB6 binds to amyloid-beta peptide fibrils and inhibits secondary nucleation. J Biol Chem 299:105317. 10.1016/j.jbc.2023.105317 Ryder BD, Ustyantseva E, Boyer DR, Mendoza-Oliva A, Kuska MI, Wydorski PM, Macierzynska P, Morgan N, Sawaya MR, Diamond MI, Kampinga HH, Joachimiak LA (2024) DNAJB8 oligomerization is mediated by an aromatic-rich motif that is dispensable for substrate activity. Structure 32:662–678e8. 10.1016/j.str.2024.02.015 Dayalan Naidu S, Kostov RV, Dinkova-Kostova AT (2015) Transcription factors Hsf1 and Nrf2 engage in crosstalk for cytoprotection. Trends Pharmacol Sci 36:6–14. 10.1016/j.tips.2014.10.011 Cyran AM, Zhitkovich A (2022) HIF1, HSF1, and NRF2: Oxidant-Responsive Trio Raising Cellular Defenses and Engaging Immune System. Chem Res Toxicol 35:1690–1700. 10.1021/acs.chemrestox.2c00131 Swan CL, Sistonen L (2015) Cellular stress response cross talk maintains protein and energy homeostasis. EMBO J 34:267–269. 10.15252/embj.201490757 Neueder A, Gipson TA, Batterton S, Lazell HJ, Farshim PP, Paganetti P, Housman DE, Bates GP (2017) HSF1-dependent and -independent regulation of the mammalian in vivo heat shock response and its impairment in Huntington's disease mouse models. Sci Rep 7:12556. 10.1038/s41598-017-12897-0 Kampinga HH, Hageman J, Vos MJ, Kubota H, Tanguay RM, Bruford EA, Cheetham ME, Chen B, Hightower LE (2009) Guidelines for the nomenclature of the human heat shock proteins. Cell Stress Chaperones 14:105–111. 10.1007/s12192-008-0068-7 Kakkar V, Meister-Broekema M, Minoia M, Carra S, Kampinga HH (2014) Barcoding heat shock proteins to human diseases: looking beyond the heat shock response. Dis Model Mech 7:421–434. 10.1242/dmm.014563 Chand K, Iyer K, Mitra D (2021) Comparative analysis of differential gene expression of HSP40 and HSP70 family isoforms during heat stress and HIV-1 infection in T-cells. Cell Stress Chaperones 26:403–416. 10.1007/s12192-020-01185-y Chen W, Li G, Peng J, Dai W, Su Q, He Y (2020) Transcriptomic analysis reveals that heat shock protein 90alpha is a potential diagnostic and prognostic biomarker for cancer. Eur J Cancer Prev 29:357–364. 10.1097/CEJ.0000000000000549 Liu Y, Beyer A, Aebersold R (2016) On the Dependency of Cellular Protein Levels on mRNA Abundance. Cell 165:535–550. 10.1016/j.cell.2016.03.014 Pobre KFR, Poet GJ, Hendershot LM (2019) The endoplasmic reticulum (ER) chaperone BiP is a master regulator of ER functions: Getting by with a little help from ERdj friends. J Biol Chem 294:2098–2108. 10.1074/jbc.REV118.002804 Dou J, Su P, Xu C, Wen Z, Mao Z, Li W (2020) Targeting Hsc70-based autophagy to eliminate amyloid beta oligomers. Biochem Biophys Res Commun 524:923–928. 10.1016/j.bbrc.2020.02.016 Tanu, Chaturvedi M, Fatima S, Yadav SS, Padhy PK, Tiwari S, Seth K, Chaturvedi RK, Priya S (2025) Expression analysis of molecular chaperones associated with disaggregation complex in rotenone-induced Parkinsonian rat model. Int J Biochem Cell Biol 181:106752. 10.1016/j.biocel.2025.106752 Dong Y, Li T, Ma Z, Zhou C, Wang X, Li J (2022) HSPA1A, HSPA2, and HSPA8 Are Potential Molecular Biomarkers for Prognosis among HSP70 Family in Alzheimer's Disease. Dis Markers 2022:9480398. 10.1155/2022/9480398 Silva PN, Furuya TK, Braga IL, Rasmussen LT, Labio RW, Bertolucci PH, Chen ES, Turecki G, Mechawar N, Payao SL, Mill J, Smith MC (2014) Analysis of HSPA8 and HSPA9 mRNA expression and promoter methylation in the brain and blood of Alzheimer's disease patients. J Alzheimers Dis 38:165–170. 10.3233/JAD-130428 Sun G, Cao Y, Dai X, Li M, Guo J (2019) Hsc70 Interacts with beta4GalT5 to Regulate the Growth of Gliomas. Neuromolecular Med 21:33–41. 10.1007/s12017-018-08520-8 Sirtori R, Riva C, Ferrarese C, Sala G (2020) HSPA8 knock-down induces the accumulation of neurodegenerative disorder-associated proteins. Neurosci Lett 736:135272. 10.1016/j.neulet.2020.135272 Korolchuk VI, Menzies FM, Rubinsztein DC (2010) Mechanisms of cross-talk between the ubiquitin-proteasome and autophagy-lysosome systems. FEBS Lett 584:1393–1398. 10.1016/j.febslet.2009.12.047 Harhouri K, Navarro C, Depetris D, Mattei MG, Nissan X, Cau P, De Sandre-Giovannoli A, Levy N (2017) MG132-induced progerin clearance is mediated by autophagy activation and splicing regulation. EMBO Mol Med 9:1294–1313. 10.15252/emmm.201607315 Liu Y, Li Q, Shao S, Ji X, Gao W, Fan Y, Liu M, Wang Y, Bai J (2024) HSPA4 Enhances BRSV Entry via Clathrin-Mediated Endocytosis Through Regulating the PI3K-Akt Signaling Pathway and ATPase Activity of HSC70. Viruses 16. 10.3390/v16111784 Beton JG, Monistrol J, Wentink A, Johnston EC, Roberts AJ, Bukau BG, Hoogenboom BW, Saibil HR (2022) Cooperative amyloid fibre binding and disassembly by the Hsp70 disaggregase. EMBO J 41:e110410. 10.15252/embj.2021110410 Cheng H, Wang J, Zhao Y, Hou X, Ling F, Wang Y, Cao Y (2024) Deciphering the role of heat shock protein HSPA1L: biomarker discovery and prognostic insights in Parkinson's disease and glioma. SLAS Technol 29:100212. 10.1016/j.slast.2024.100212 Ferre CA, Thouard A, Betourne A, Le Dorze AL, Belenguer P, Miquel MC, Peyrin JM, Gonzalez-Dunia D, Szelechowski M (2021) HSPA9/Mortalin mediates axo-protection and modulates mitochondrial dynamics in neurons. Sci Rep 11:17705. 10.1038/s41598-021-97162-1 Sojka DR, Abramowicz A, Adamiec-Organisciok M, Karnas E, Mielanczyk L, Kania D, Blamek S, Telka E, Scieglinska D (2023) Heat shock protein A2 is a novel extracellular vesicle-associated protein. Sci Rep 13:4734. 10.1038/s41598-023-31962-5 Cao L, Yuan X, Bao F, Lv W, He Z, Tang J, Han J, Hu J (2019) Downregulation of HSPA2 inhibits proliferation via ERK1/2 pathway and endoplasmic reticular stress in lung adenocarcinoma. Ann Transl Med 7:540. 10.21037/atm.2019.10.16 Montresor S, Pigazzini ML, Baskaran S, Sleiman M, Adhikari G, Basilicata L, Secker L, Jacob N, Ehlert Y, Kelkar A, Kalsi GK, Kulkarni N, Spellerberg P, Kirstein J (2025) HSP110 is a modulator of amyloid beta (Abeta) aggregation and proteotoxicity. J Neurochem 169:e16214. 10.1111/jnc.16214 Nachman E, Wentink AS, Madiona K, Bousset L, Katsinelos T, Allinson K, Kampinga H, McEwan WA, Jahn TR, Melki R, Mogk A, Bukau B, Nussbaum-Krammer C (2020) Disassembly of Tau fibrils by the human Hsp70 disaggregation machinery generates small seeding-competent species. J Biol Chem 295:9676–9690. 10.1074/jbc.RA120.013478 Abayev-Avraham M, Salzberg Y, Gliksberg D, Oren-Suissa M, Rosenzweig R (2023) DNAJB6 mutants display toxic gain of function through unregulated interaction with Hsp70 chaperones. Nat Commun 14:7066. 10.1038/s41467-023-42735-z McMahon S, Bergink S, Kampinga HH, Ecroyd H (2021) DNAJB chaperones suppress destabilised protein aggregation via a region distinct from that used to inhibit amyloidogenesis. J Cell Sci 134. 10.1242/jcs.255596 Baker HA, Bernardini JP, Csizmok V, Madero A, Kamat S, Eng H, Lacoste J, Yeung FA, Comyn S, Hui E, Calabrese G, Raught B, Taipale M, Mayor T (2025) The co-chaperone DNAJA2 buffers proteasomal degradation of cytosolic proteins with missense mutations. J Cell Sci 138. 10.1242/jcs.262019 Wang D, Wang YS, Zhao HM, Lu P, Li M, Li W, Cui HT, Zhang ZY, Lv SQ (2025) Plantamajoside improves type 2 diabetes mellitus pancreatic beta-cell damage by inhibiting endoplasmic reticulum stress through Dnajc1 up-regulation. World J Diabetes 16:99053. 10.4239/wjd.v16.i2.99053 Perez VA, Sanders DW, Mendoza-Oliva A, Stopschinski BE, Mullapudi V, White CL, Joachimiak LA, Diamond MI (2023) DnaJC7 specifically regulates tau seeding. Elife 12. 10.7554/eLife.86936 Hammond CM, Bao H, Hendriks IA, Carraro M, Garcia-Nieto A, Liu Y, Reveron-Gomez N, Spanos C, Chen L, Rappsilber J, Nielsen ML, Patel DJ, Huang H, Groth A (2021) DNAJC9 integrates heat shock molecular chaperones into the histone chaperone network. Mol Cell 81:2533–2548e9. 10.1016/j.molcel.2021.03.041 Yuan L, Song Z, Deng X, Zheng W, Guo Y, Yang Z, Deng H (2016) Systematic analysis of genetic variants in Han Chinese patients with sporadic Parkinson's disease. Sci Rep 6:33850. 10.1038/srep33850 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Published Journal Publication published 29 Jan, 2026 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted Editorial decision: Revision requested 17 Sep, 2025 Reviews received at journal 05 Sep, 2025 Reviews received at journal 08 Aug, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers invited by journal 29 Jul, 2025 Editor assigned by journal 17 Jul, 2025 Submission checks completed at journal 12 Jun, 2025 First submitted to journal 11 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6870464","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492834552,"identity":"827f34e3-6b2c-49fb-9822-3f9f8263f6e1","order_by":0,"name":"Siraj Fatima","email":"","orcid":"","institution":"CSIR- Indian Institute of Toxicology Research","correspondingAuthor":false,"prefix":"","firstName":"Siraj","middleName":"","lastName":"Fatima","suffix":""},{"id":492834553,"identity":"2a36223f-e96d-4210-b365-2ef004bafc44","order_by":1,"name":"Anurag Gupta","email":"","orcid":"","institution":"CSIR- Indian Institute of Toxicology Research","correspondingAuthor":false,"prefix":"","firstName":"Anurag","middleName":"","lastName":"Gupta","suffix":""},{"id":492834555,"identity":"f75168e4-88c6-4403-8d89-0b9d4c99eb04","order_by":2,"name":"Smriti Priya","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIie2OMQrCMBhG/1iIS+xcsJgr5ACiVxGEnqFDKRGhW52F4l1SAnEpugp2sLuDkzgVU2jRqekomAeB/PAefAAWy48iAOYEdxfuMb+TgOBOHZRo5HAVaJZWkkRn36XpzQnDGNwp709YeWSSqKseNmaoKCRgXxgSLwBJcJNgQJtEAPZWhmH7JqlPbVLH5gQuOpkkok24Y05YqSA/7NY6CSDnSo80DssS53F/LpZ0q1DFo3hG96ZhHsCItH+hH+lxPwl6mTWLxWL5Z95QkDa+6uq/dgAAAABJRU5ErkJggg==","orcid":"","institution":"CSIR- Indian Institute of Toxicology Research","correspondingAuthor":true,"prefix":"","firstName":"Smriti","middleName":"","lastName":"Priya","suffix":""}],"badges":[],"createdAt":"2025-06-11 09:53:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6870464/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6870464/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11010-026-05484-3","type":"published","date":"2026-01-29T15:58:08+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":88040611,"identity":"9eb47ba2-2559-44d1-8527-db62b6bd1239","added_by":"auto","created_at":"2025-07-31 17:05:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1091320,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResponse of HSP70 to cellular stress conditions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e(A) A Schematic representation of the experimental plan for selecting different stress conditions. Immunoblots and densitometry quantification of HSP70 of cells treated with (B) vehicle control DMSO, 0.1 µM rotenone, 1.0 µM rotenone and 10 µM rotenone; (C) vehicle control PBS, 2 µM and 4 µM α-syn-seeds; (D) vehicle control DMSO, 1 µM and 2 µM MG132; (E) control and heat-stressed at 42 \u003c/em\u003e\u003csup\u003e\u003cem\u003eo\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eC for 1 h after 2 h and 6 h recovery at 37 \u003c/em\u003e\u003csup\u003e\u003cem\u003eo\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eC.\u003c/em\u003e The Shapiro-Wilk test was done to determine the normality of the distribution.\u003cem\u003e The one-way ANOVA followed by Dunnett’s multiple comparison test was used to calculate the statistical significance, and data were expressed as means +/− SEM (N=3; N = number of independent experiments)\u003c/em\u003e, ns (P\u0026gt;0.05), *(P≤0.05), **(P≤0.01), ***(P≤0.001).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/2a9a3e34775c6eabb782b82e.png"},{"id":88040612,"identity":"b5335796-8648-4d3e-bede-b52f6c7d6d75","added_by":"auto","created_at":"2025-07-31 17:05:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":647678,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHSPA chaperones were differentially expressed in oxidative, proteotoxic and heat conditions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Experimental plan for evaluating the expression of HSP70 family members under stress conditions. (B) The gene expression pattern of HSPA members under different stress conditions was shown as a heat map using fold change median values of N = 3 independent experiments (red color representing \u0026gt;6 fold change). Different stress conditions (C) 1 µM rotenone induced oxidative stress, (D) 4 µM a-syn-seeds induced proteotoxic stress, (E) 1 µM MG132 induced proteotoxic stress, and (F) 1 h heat shock at 42 \u003csup\u003eo\u003c/sup\u003eC and 6 h recovery at 37 \u003csup\u003eo\u003c/sup\u003eC are studied for gene and protein expression analysis. \u0026nbsp;The gene expression analysis of HSPA family members (C-F i) and protein expression analysis of HSPA5, HSPA8 and HSPH1 proteins through (C-Fii) western blots and (C-F iii) densitometry, supplementary material (Fig. S7). The Shapiro-Wilk test was done to determine the normality of the distribution. Each protein and gene was compared to its respective control and represented as superimposed scatter plots. Statistical analysis between treatment and control groups was performed using multiple t-tests and Holm–Šídák correction for multiple comparisons. The data expressed as means and +/− SEM (N=3; N = number of biologically independent experiments with sufficient replicates), ns (P\u0026gt;0.05), *(P≤0.05), **(P≤0.01), ***(P≤0.001), ****(P≤0.0001) as analysed using GraphPad Prism 8.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/f6a4384c48e330cdfa1cb556.png"},{"id":88041639,"identity":"a7c3e972-51bf-4a6f-b711-efde5c7fcbe8","added_by":"auto","created_at":"2025-07-31 17:13:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2071019,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential gene expression profiling of co-chaperone DNAJ\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e(A) Experimental plan for evaluating the expression of DNAJs under selected stress conditions. (B) The gene expression pattern of different DNAJs under selected stress conditions is shown as a heat map using fold change median values (red colour representing \u0026gt;4 fold change). The gene expression of DNAJs under (Ci) 1 uM rotenone, (Di) 4 uM a-syn-seeds, (Ei) 1 uM MG132 treatment and (Fi) 6 h recovery at 37 \u003csup\u003eo\u003c/sup\u003eC after 1 h heat shock at 42 \u003csup\u003eo\u003c/sup\u003eC, respectively. Under the same conditions, (C-Fii) the western blots and (C-Fiii) their densitometric analysis of DNAJB1, DNAJB6a, DNAJB6 b and DNAJB8 proteins, supplementary material (Fig. S8). The Shapiro-Wilk test was done to determine the normality of the distribution. The statistical analysis of each gene/protein was done using multiple t-test and Holm–Šídák correction for multiple comparison was applied using GraphPad Prism 8. The data was expressed as means and +/− SEM (N=3; N = number of biologically independent experiments with sufficient replicates), ns (P\u0026gt;0.05), *(P≤0.05), **(P≤0.01), ***(P≤0.001), ****(P≤0.0001) and represented by the superimposed scatter plot.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/155310b675955f03f81205c5.png"},{"id":88040616,"identity":"0144507a-6ccf-454e-9828-64f6e670b817","added_by":"auto","created_at":"2025-07-31 17:05:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":637305,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptional regulation of HSR through chaperones and co-chaperones.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWestern blots and their densitometric analysis of (A) HSF1 and (B) NRF2 under (i) rotenone, (ii) α-syn-seeds, (iii) MG132 and (iv) heat shock conditions, respectively, supplementary material (Fig. S9). The Shapiro-Wilk test was done to determine the normality of the distribution. The statistical significance was calculated by the Student-t test using Graph Pad Prism 8, and data was expressed as means and +/− SEM (N=3; N = number of independent experiments) as ns *(P≤0.05), **(P≤0.01), ***(P≤0.001).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/29a898ed1298a3badb4d6d74.png"},{"id":88040614,"identity":"29ae75fe-1b2f-4cb2-93c3-53b53f619764","added_by":"auto","created_at":"2025-07-31 17:05:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":792887,"visible":true,"origin":"","legend":"\u003cp\u003eThe interactions of HSPA and DNAJ molecular chaperones with cellular processes to maintain proteostasis. Stress conditions, such as oxidative stress and proteotoxic stress, provoke protein misfolding and aggregation in neurodegenerative diseases and alteration of molecular chaperones acts as a potential molecular imprint for therapeutic intervention in protein aggregation-associated diseases.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/8d3c8ace0fea81c0da60ca98.png"},{"id":101691145,"identity":"ee294de8-8598-4669-8647-bedd82206db5","added_by":"auto","created_at":"2026-02-02 16:12:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6214719,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/bdc8d6c2-209a-488b-b9e3-3fc5e6310185.pdf"},{"id":88040620,"identity":"969e3028-18d6-477d-9942-236e9847ed85","added_by":"auto","created_at":"2025-07-31 17:05:20","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":4196428,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-6870464/v1/17b4e910494e1652642e92f8.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cellular DNAJBs are selectively associated with proteotoxic stress and underlying mechanisms in neurodegenerative conditions","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eMolecular chaperones are heat shock proteins that maintain cellular protein homeostasis by regulating de novo protein folding, refolding of unfolded protein, degradation of irreversibly misfolded proteins and prevention of protein aggregation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The molecular chaperones and co-chaperones are constitutive and stress-inducible, with cellular compartment and tissue specificity [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The induction of molecular chaperone expression by various stress factors, including environmental, chemical, heat and genetic factors and is mediated by the heat shock response (HSR) [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The cellular HSR is a highly conserved molecular response for stress-induced disruption of protein homeostasis and is initiated by activation of transcription factor, heat shock factor 1 (HSF1) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The stress-induced disturbance in protein homeostasis leads to misfolding and aggregation of specific proteins such as α-synuclein (α-syn), tau, amyloid β (Aβ), huntingtin (HTT), superoxide dismutase (SOD), prion protein and amylin, linked with several neurodegenerative diseases and lifestyle disorders, where the accumulation of protein aggregates is a pathological hallmark [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In neurodegenerative diseases, the initiation of disease and protein aggregation is associated with oxidative stress, neuroinflammation, mitochondrial dysfunction, protein misfolding and proteotoxic stress [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among these varied cellular stress conditions associated with neurodegenerative diseases, the response of molecular chaperones and their co-chaperones has not been properly understood. Most of the studies on molecular chaperones are focused on their mechanism of action, substrate specificity, refolding, disaggregation and aggregation prevention [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Several overexpression studies of molecular chaperones and co-chaperones in vitro and in vivo models of neurodegenerative conditions showed protective effect against protein aggregation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The transcriptomic and omics studies of patient samples of neurodegenerative diseases showed dysregulated patterns of chaperones under disease conditions [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. These studies serve as a reference to understand the multicellular functions of molecular chaperones such as HSPA and DNAJ in neurodegenerative diseases. The HSPA or HSP70 is a major molecular chaperone class having 13 members in humans that maintain organelle-specific proteostasis by assisting protein folding, promoting refolding of unfolded proteins, halting/sequestering protein misfolding and aggregation, disaggregation of amyloid fibrils and targeting protein aggregates for degradation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The HSPA chaperone functions are coordinated and regulated by co-chaperones DNAJ proteins, where DNAJBs are specifically associated with the prevention of protein aggregation, disaggregation and degradation of protein aggregates in neurodegenerative diseases [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The chaperone cycle and disaggregation activity of HSPA are coordinated by HSP110 (HSPH), which acts as a nucleotide exchange factor (NEF) of HSPA [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn the present study, we analysed the expression profile of the HSPA and DNAJ family of molecular chaperones under different cellular stress conditions associated with neurodegenerative diseases to provide a comparative profile of molecular chaperone expressions. The selected stress conditions refer to cellular oxidative stress and proteotoxic stress, where each stress condition disrupts cellular proteostasis through unique pathways in neurodegenerative diseases. We have investigated oxidative stress through rotenone exposure, which is epidemiologically associated with Parkinsonian symptoms and α-syn aggregation [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Proteotoxicity mediated by α-syn seeds-induced protein aggregation and MG132-mediated proteasome disruption [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Heat shock was used as a positive control to stimulate molecular chaperone expression [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Under the selected stress conditions, a variable gene and protein expression of HSPA and DNAJ proteins was studied. A unique molecular signature of HSPA1A (HSP70), HSPA8 (HSC70) and HSPH1 (HSP110) was observed in proteotoxic conditions. Co-chaperone DNAJB8 was specific to proteotoxic stress, whereas DNAJB1 was responsive to all stress conditions. The heat shock response was mediated by HSF1 in all stress conditions studied here, while NRF2 was also involved in oxidative and heat stress. The prior knowledge of the comparative expression profile of DNAJB proteins under oxidative and proteotoxic conditions emphasises the selectivity of DNAJBs toward stress response and can be useful for selecting targets for the prevention of protein misfolding and aggregation without hampering other cellular functions. The study will enhance our understanding of dynamic chaperone networking and regulation in neurodegenerative conditions.\u003c/p\u003e"},{"header":"2. Methodology","content":"\u003cp\u003e2.1 \u003cstrong\u003e\u0026alpha;-Synuclein (\u0026alpha;-syn) purification\u003c/strong\u003e. To purify WT \u0026alpha;-syn, the BL21 cells were transformed with pT7-7 \u0026alpha;-syn WT plasmid, a gift from Hilal Lashuel (Addgene plasmid # 36046 ; http://n2t.net/addgene:36046 ; RRID:Addgene_36046). The protein was overexpressed and purified via the precipitation-based method described [27-29].\u0026nbsp;The purified and lyophilized protein was stored at \u0026minus;80 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003e2.2 \u003cstrong\u003eAggregation kinetics\u003c/strong\u003e. The characterization of purified \u0026alpha;-syn is based on its aggregation propensity and measured by the thioflavin T (ThT) fluorescence assay [27]. Briefly, a\u0026nbsp;70 \u0026micro;M solution of \u0026alpha;-syn was prepared by dissolving lyophilized \u0026alpha;-syn in sterile 1X phosphate buffer saline (1X PBS), pH-7.4 (Sigma-Aldrich, P5368). For aggregation kinetics, the \u0026alpha;-syn (70 \u0026micro;M) was incubated with 20 \u0026micro;M ThT dye (Sigma-Aldrich, T3516-5G) at 37 \u0026deg;C for 48 h in a 96-well plate with black-clear bottom (Corning, 3603) while being continuously stirred linearly with sterile glass beads. ThT fluorescence was measured using an Infinite M200 PRO multimode plate reader (TECAN, Switzerland) with excitation/ emission wavelengths of 450/480 nm.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.3 \u003cstrong\u003ePreparation of \u0026alpha;-syn seeds.\u003c/strong\u003e The \u0026alpha;-syn-seeds were prepared following standard protocol [27, 30]. Briefly, monomeric \u0026alpha;-syn solution (140 \u0026micro;M) in 1X PBS was agitated with a sterilized glass bead at 600 rpm at 37 \u0026deg;C for 48 h on ThermoMixer C (Eppendorf, Germany). The fibrils were centrifuged 13,000 rpm for 15 min and washed to remove monomers and fibrils aliquots were stored at \u0026minus;80\u0026deg;C for one-time use.\u003c/p\u003e\n\u003cp\u003e2.3 \u003cstrong\u003eCircular dichroism spectroscopy\u003c/strong\u003e. The secondary structure characterization of the purified monomeric and fibrillar \u0026alpha;-syn was performed using circular dichroism (CD) spectroscopy. Both monomeric and fibrillar \u0026alpha;-syn, at a concentration of 10 \u0026micro;M, were placed separately in a quartz cell of path length 1 mm, and the spectra from 260 to 190 nm wavelength were recorded using a Chirascan V100 Circular dichroism Spectrometer (Applied Photophysics, UK) at 25 \u0026deg;C. The representative CD spectrum was the average of three consecutive scans.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Transmission electron microscopy.\u0026nbsp;\u003c/strong\u003eThe morphological analysis of 48 h \u0026alpha;-syn fibrils was done using transmission electron microscopy (TEM) as per the previous protocol [27]. Briefly, the fibril sample was diluted to 5 \u0026micro;M and negatively stained with uranyl formate acetate (Electron Microscopy Sciences, 541-09-3), placed on the formvar-coated copper grids (Sigma-Aldrich, TEM-FCF300CUUA) and air-dried at room temperature. The images were captured through Gatan digital micrograph software using an FEI transmission electron microscope (Tecnai G2 Spirit, Netherlands) at 80 kV, available at the Advanced Imaging Facility, CSIR-IITR.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.5 \u003cstrong\u003eCell culture\u003c/strong\u003e. Human SH-SY5Y neuroblastoma cells (ATCC, CRL-2266) were grown in a 1:1 mixture of F-12 Nutrient Mixture (Gibco, 21700-075) and Minimum Essential Medium (Gibco, 61100-053) growth media supplemented with 10% foetal bovine serum (FBS) (Gibco, 10270106) and 1% antibiotic-antimycotic (Gibco, 15240-062) in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37 \u0026deg;C and a maximum of 25 passages. The cell line is not listed as a commonly misidentified cell line by the International Cell Line Authentication Committee (ICLAC; http://iclac.org/databases/cross-contaminations/). \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.\u003cstrong\u003e6 Stress conditions and treatment.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.6.1 \u003cstrong\u003eRotenone:\u0026nbsp;\u003c/strong\u003eRotenone (Sigma-Aldrich, R8875) was prepared in culture-grade dimethyl sulfoxide (DMSO) (Sigma-Aldrich, D2650) at a concentration of 10 mM, aliquoted as one-time use vials and stored at -80 \u003csup\u003eo\u003c/sup\u003eC. SH-SY5Y cells were seeded and grown in 6-well plates (5,00,000 cells/well) till 70% confluency was reached. \u0026nbsp;Cells were treated with different concentrations (0.1, 1.0 and 10 \u0026micro;M) of rotenone and harvested after 24 h for western\u0026nbsp;blot and real-time analysis.\u003c/p\u003e\n\u003cp\u003e2.6.2 \u003cstrong\u003e\u0026alpha;-syn-seeds\u003c/strong\u003e: SH-SY5Y cells were treated with indicated concentrations of \u0026alpha;-syn-seeds using XfectTM protein transfection reagent following the manufacturer\u0026apos;s protocol (Clontech, 631327). Briefly, the transfection reagent was incubated with the \u0026alpha;-syn-seeds for 30 min prior to treatment, which were generated by pulse sonication (5 sec on, 15 sec off, 30% amplitude) [27, 30]. The cells were washed with sterile 1X PBS and with serum-free media and treated with the \u0026alpha;-syn-seeds for 6 h. The media was replaced with complete media having 10% FBS 6h after transfection. After treatment, the cells were grown for 24 h and harvested for further experimental investigations.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.6.3 \u003cstrong\u003eMG132\u003c/strong\u003e: MG132 (Sigma-Aldrich, M7449), a ready-to-use stock solution (10 mM), was used to prepare the working solution of 1 mM concentration in culture-grade DMSO (Sigma-Aldrich, D2650) to treat SH-SY5Y cells. The working solution was aliquoted and stored at -80 \u003csup\u003eo\u003c/sup\u003eC as one-time use. At 70% confluency, cells were treated with different concentrations (1.0 and 2 \u0026micro;M) of MG132 for 24 h and harvested for western blot and real-time analysis.\u003c/p\u003e\n\u003cp\u003e2.6.4 \u003cstrong\u003eHeat Shock Treatment\u003c/strong\u003e: SH-SY5Y cells were subjected to heat stress by replacing the old media with fresh pre-warmed media at 42 \u003csup\u003eo\u003c/sup\u003eC. Cell-seeded plates were sealed with parafilm and heated by immersing the plates in the pre-heated circulatory water bath at 42 \u003csup\u003eo\u003c/sup\u003eC for 1 h. The media was then replaced with growth media at 37 \u003csup\u003eo\u003c/sup\u003eC, and incubated in a 37 \u003csup\u003eo\u003c/sup\u003eC incubator for the indicated recovery time points [25, 26].\u003c/p\u003e\n\u003cp\u003e2.7 \u003cstrong\u003eCell viability assay\u003c/strong\u003e. The effect of rotenone, MG132, and \u0026alpha;-syn-seeds on the cell viability of SH-SY5Y cells was observed by MTT [3-(4, 5-501 dimethyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] (Sigma-Aldrich, M2128) assay. Briefly, the SH-SY5Y cells were seeded on a 96-well plate (20,000 cells/well) in 100 \u0026micro;l fresh medium. When the cells were 70% confluent, the old media was replaced by the 100 \u0026micro;l fresh media containing specified treatments and 0.1% SDS (negative control). After treatment, the cells were further grown for 24 h. After 24 h post-treatment, MTT (0.5 \u0026micro;g/\u0026micro;l) was added to each well and incubated for 2-4 h until purple formazan crystals were formed. The formazan crystals were dissolved in DMSO (Sigma-Aldrich, D2650) (100 \u0026micro;l/wells) by removing the entire media. The amount of formazan produced was measured by spectrometry by absorbance at 570 nm using the Infinite M200 PRO multimode plate reader\u0026nbsp;(TECAN, Switzerland) for cell viability.\u003c/p\u003e\n\u003cp\u003e2.8 \u003cstrong\u003eProtein extraction and quantification\u003c/strong\u003e. The treated and control SH-SY5Y cells were lysed in cell lysis buffer containing RIPA (Sigma-Aldrich,\u0026nbsp;R0278), 1 mM dithiothreitol (DTT) (Sigma-Aldrich, D9779), and 1X protease inhibitor cocktail (Sigma-Aldrich, P8340), through the freeze-thaw cycle for 30 min. Following lysis, the cell lysate was centrifuged at 13000 rpm, 4 \u003csup\u003eO\u003c/sup\u003eC for 30 min. The Bicinchoninic acid (BCA) kit (Thermo Scientific, 23225) was used to measure the protein concentrations in the supernatants, with bovine serum albumin (BSA) (Sigma-Aldrich, A7906) as the standard. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.9\u0026nbsp;\u003cstrong\u003eImmunoblotting.\u003c/strong\u003e Equal amounts of protein (20-30 \u0026mu;g) from control and treated cell lysate were separated on the 10-12% SDS PAGE gel and transferred onto the activated PVDF membrane (Merck Millipore, IPVH00010) by wet electrotransfer for 1.5 h at a constant current of 200 mA using Mini Trans-Blot\u0026reg; Cell (Bio-Rad, USA). After transfer, the membrane was blocked with 5% (w/v) BSA (Sigma-Aldrich, A7906) in 1X TBST for 2 h at room temperature. The membrane was incubated with primary antibody specific for respective target such as HSPA1A (Abcam, ab2787) (1:1000),\u0026nbsp;HSPA8 (Abcam,\u0026nbsp;ab51052)\u0026nbsp;(1:1000),\u0026nbsp;HSPA5 (R\u0026amp;D Systems, AF4846-SP) (1:1000), HSPH1 (Abcam, ab109624) (1:1000), DNAJB1 (Cell Signaling Technology,\u0026nbsp;#4868s)\u0026nbsp;(1:1000),\u0026nbsp;DNAJB6 (Abcam, ab198995) (1:1000),\u0026nbsp;DNAJB8 (Abcam,\u0026nbsp;ab235546)\u0026nbsp;(1:1000), HSF1 (Cell Signaling Technology, #12972)\u0026nbsp;(1:1000), NRF2 (Cell Signaling Technology, #33649)\u0026nbsp;(1:1000), GAPDH (Cell Signaling Technology, #971668)\u0026nbsp;(1:8000)\u0026nbsp;and \u0026beta;-actin (Abcam,\u0026nbsp;ab8224)\u0026nbsp;(1:8000)\u0026nbsp;overnight at 4 \u003csup\u003eo\u003c/sup\u003eC. Immunoblots were\u0026nbsp;washed with 1X TBST for at least six times (5 min each). After washing, the immunoblots were incubated with HRP-conjugated anti-rabbit (Invitrogen, 656120) (1:10000), anti-mouse (Invitrogen, 626520) (1:10000) and anti-goat (Sigma Aldrich, A8919) (1:5000) secondary antibody in 1X TBST for 2 h at room temperature and washed again with 1X TBST for six-times (5 min each). Enhanced chemiluminescence detection was performed using the Immobilon western chemiluminescent HRP substrate (Millipore, WBKLS0500) and protein bands were recorded by Amersham Imager 600 (GE Healthcare Life Sciences, USA) or ChemiDoc\u003csup\u003eTM\u003c/sup\u003e MP Imaging System (Bio-Rad, USA). Quantity One (Bio-Rad Technical Service Department, USA) was used for densitometry analysis of the protein bands and target bands normalized to the relative bands of GAPDH or \u0026beta;-actin.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e2.10 \u003cstrong\u003eRNA isolation and cDNA synthesis\u003c/strong\u003e. Total RNA was isolated from control and treated cells using RNAzol RT (Molecular Research Center, RN190) as described in the manufacturer\u0026apos;s protocol. RNA integrity and yield were analyzed and quantified using the\u0026nbsp;NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). 2.5 \u0026micro;g of the total RNA was transcribed into cDNA by RT2 first strand kit (Qiagen, 330401) using the manufacturer\u0026apos;s protocol for customized PCR array.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor real-time PCR analysis,\u0026nbsp;1 \u0026micro;g RNA\u0026nbsp;was used to synthesise\u0026nbsp;cDNA using High-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814), as per the manufacturer\u0026apos;s protocol.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;2.11\u003cstrong\u003e\u0026nbsp;Real-time PCR.\u003c/strong\u003e The real-time gene expression of 42 heat shock protein genes was monitored by using the customize PCR array, RT\u0026sup2; Profiler\u0026trade; PCR Array of Human Heat Shock Proteins \u0026amp; Chaperones (Qiagen, CLAH47524A) (Fig. S6) and RT\u0026sup2; SYBER Green Mastermix (Qiagen, 330522) by Quant Studio 5 flex\u0026nbsp;(Thermo Fisher Scientific, USA)\u0026nbsp;as manufacture protocol. The baselines and thresholds were set manually in all experiments to avoid plate-to-plate variation and to increase the precision and comparability of data. The PCR array contained three housekeeping genes: GAPDH, \u0026beta;-ACTIN and \u0026beta;-2-MICROGLOBIN. The normalization of the gene was selected based on the coefficient of variation (CV) analysis that estimates the variation in the linearized Ct value of the housekeeping gene across all samples. The housekeeping gene having the lowest CV with higher stability was selected as the normalization gene [31]. The change in the target gene expression was calculated by Schmittgen \u0026amp; Livak\u0026rsquo;s \u0026nbsp;\u0026Delta;\u0026Delta;Ct method\u0026nbsp;[32].\u003c/p\u003e\n\u003cp\u003eFold difference = (2\u0026minus;\u0026Delta;CT)treatment\u0026nbsp;/ (2\u0026minus;\u0026Delta;CT)control\u003c/p\u003e\n\u003cp\u003eWhere, \u0026Delta;CT = CT (target) \u0026minus; CT (GAPDH)\u003c/p\u003e\n\u003cp\u003eThe \u0026ge; 1.5-fold change increase and \u0026le; 0.5-fold change decrease in gene expression were considered as upregulated and downregulated gene expression, respectively, where the fold change between 0.5 and 1.5 was considered as no change.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe RT-PCR of HSP70, HSF1 and NRF2 of the same cDNA was performed using\u0026nbsp;SYBR Green Master Mix (Puregene, PGK022A) and primers specific to targets and quantified in the\u0026nbsp;QuantStudio 6 Real-Time PCR\u0026nbsp;(Thermo Fisher Scientific, USA).\u0026nbsp;The relative gene expression was calculated using the gene GAPDH as a housekeeping control. The primer sequences used are listed table.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eTarget gene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 264px;\"\u003e\n \u003cp\u003eForward primer \u003cstrong\u003e(5\u0026apos;-\u0026gt;3\u0026apos;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 237px;\"\u003e\n \u003cp\u003e\u0026nbsp;Reverse primer \u003cstrong\u003e(5\u0026apos;-\u0026gt;3\u0026apos;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eHSP70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 264px;\"\u003e\n \u003cp\u003eCGACCTGAACAAGAGCATCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 237px;\"\u003e\n \u003cp\u003eAAGATCTGCGTCTGCTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 264px;\"\u003e\n \u003cp\u003eTCGGAGTCAACGGATTTGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 237px;\"\u003e\n \u003cp\u003eTTCCCGTTCTCAGCCTTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eNRF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 264px;\"\u003e\n \u003cp\u003eCAGCTTTTGGCGCAGACATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 237px;\"\u003e\n \u003cp\u003eAGCTCCTCCCAAACTTGCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eHSF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 264px;\"\u003e\n \u003cp\u003eCAAGCAACAGAAAGTCGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 237px;\"\u003e\n \u003cp\u003eTTCAGCATCAGGGGGATCTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e2.12 \u003cstrong\u003eStatistical Analysis.\u0026nbsp;\u003c/strong\u003eAll the statistical analysis was done by GraphPad Prism 8.0 software. For the statistical analysis of two groups, Student\u0026apos;s t-test (two-tailed, unpaired) was used, for multiple genes/proteins between two groups, multiple t-test, followed by Holm\u0026ndash;\u0026Scaron;\u0026iacute;d\u0026aacute;k correction of multiple comparisons was applied. For multiple groups comparison, one-way ANOVA, followed by Dunnett\u0026rsquo;s multiple comparison test, was used. The Shapiro-Wilk test was used to determine the normality of the distribution. The data is represented as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM of at least three individual experiments. The significance is represented as ns (P\u0026gt;0.05), *(P\u0026le;0.05), **(P\u0026le;0.01), ***(P\u0026le;0.001), ****(P\u0026le;0.0001).\u0026nbsp;\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003eHSP70 expression and cell viability are stress markers\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo optimize the stress factors for this study, multiple variations among concentrations and time of treatment were standardised for each stress condition (Fig S1, S3) and measured based on the effect on the cell viability of SH-SY5Y cells and protein expression of stress-inducible chaperone HSP70 (Fig. 1A). In rotenone-induced oxidative stress, 0.1, 1.0 and 10 \u0026micro;M rotenone showed reduction in cell viability of SH-SY5Y cells and significantly increased the protein expression of HSP70 after 24 h (Fig. S1, 1B). Specifically, 1 \u0026micro;M rotenone decreased the cell viability to 25.67% and sufficiently induced a 1.47 fold change in HSP70 expression. For proteotoxic stress, \u0026alpha;-syn-seeds were prepared as per the standard protocol [22] and characterized by secondary structure having a negative peak around 216 nm and a positive peak around 193 nm, representing anti-parallel \u0026beta;-sheet-structure (Fig. S2). These \u0026alpha;-syn-seeds [27, 30] exhibited a concentration-dependent decrease in cell viability with increasing concentrations of \u0026alpha;-syn-seeds (Fig. S3). The \u0026alpha;-syn-seeds at 4 \u0026micro;M concentrations lead to about 36.08% decreases in cell viability and 1.49 fold upregulation in HSP70 protein expression (Fig. 1C, S3A). Further, MG132, a proteosomal inhibitor, resulted in a 37.99% decline in cell viability and a 3.15 fold increase in HSP70 expression compared to the control at 1 \u0026micro;M concentration (Fig. 1D, S3B). As the heat shock has been associated with overexpression of molecular chaperones [25, 26]. A significant upregulation (2.07 fold) of HSP70 protein level was observed in SH-SY5Y cells incubated in a preheated water bath at 42\u0026deg;C for 1 h, followed by 6 h of recovery period at 37\u0026deg;C (Fig. 1E). Based on these observations and the parameters of cell viability and HSP70 expression, 1 \u0026micro;M rotenone, 4 \u0026micro;M \u0026alpha;-syn-seeds, 1 \u0026micro;M MG132 and heat shock of 42\u0026deg;C for 1 h, followed by 6 h recovery at 37\u0026deg;C were selected for further comparative profiling of molecular chaperones.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHSPA8 and HSPH1 as differential protein markers for specific cellular stress.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHSPA or HSP70 is a major chaperone class that is associated with the folding of a large number of protein substrates in the cellular system and is involved in several other cellular processes [33, 34]. Here, the gene expressions of HSPA family proteins (HSPA1A, HSPA1L, HSPA2, HSPA4, HSPA5, HSPA8, HSPA9 and HSPA12A) and HSPH1 were evaluated under stress conditions using a customized PCR array for Human Heat Shock Proteins \u0026amp; Chaperones (Fig. 2A, S6) and collectively represented via heatmap (Fig. 2B). Differential gene expression represented in heat map is based on fold change where the \u003cem\u003efold changes greater or equal to 1.5 is selected for upregulation and below or equal to 0.5 as downregulation. The genes screened out from the cutoff were further analyzed using appropriate statistical analysis for significance and comparisons.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn rotenone-induced oxidative stress, no change was observed in HSPA4, HSPA5, HSPA8 and HSPA9 genes as compared to the control (Fig. 2Ci). The \u0026alpha;-syn-seeds-induced proteotoxicity in vitro resulted in the significant downregulation of both HSPA1A (0.45 fold) and HSPA8 (0.52 fold) genes (Fig. 2Di) while upregulating HSPA5 (2.05 fold). Similarly, apart from several HSPA genes upregulation (HSPA1A (118.51 fold), HSPA1L (3.81 fold), HSPA4 (3.00 fold), HSPA5 (5.59 fold), HSPA8 (3.98 fold), HSPA9 (3.61 fold) and HSPA12A (2.14 fold)), HSPA2 was 0.44 fold downregulated after MG132 treatment (Fig. 2Ei). Heat shock resulted in several fold changes in the gene expression of HSPA1A (86.05 fold), HSPA1L (12.95 fold), HSPA4 (2.85 fold) and HSPA5 (3.18 fold), respectively (Fig. 2Fi). Further, the results of the PCR array were validated using a different set of primers and a real-time PCR assay for the HSPA1A gene and similar results in the gene expression were observed across all experimental conditions (Fig. S4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther, the changes in protein expression of HSPA1A (HSP70), HSPA5 (Bip/Grp78) and HSPA8 (HSC70) under stress conditions were studied. A significant upregulation in the protein level of HSPA1A (HSP70) was observed across all stress conditions (Fig. 1B-E), while HSPA5 and HSPA8 were significantly upregulated by MG132 and heat stress (Fig. 2E-F ii-iii). However, HSPA5 protein was apparently altered in oxidative and \u0026alpha;-syn-seeds-induced stress while HSPA8 protein remained unaltered (Fig. \u0026nbsp;2C-D ii-iii).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe protein expression of HSPH1, commonly known as HSP110, was also performed, as it plays a significant role in protein folding and disaggregation in association with HSP70 [20, 35]. The gene expression of HSPH1 was significantly upregulated in MG132-induced proteotoxic stress and heat stress (Fig. 2E-Fi). In rotenone-induced oxidative stress, the change in the gene expression of HSPH1 was non-significant (Fig. 2C i) and downregulated in \u0026alpha;-syn-seeds-induced proteotoxic stress (Fig. 2D i). Interestingly, the protein expression of HSPH1 in vitro remained upregulated in all stress conditions (Fig. 2C-F ii-iii).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNAJB8 are selective for cellular stress associated with neurodegenerative diseases\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DNAJ proteins act as co-chaperones of HSPA in protein folding, disaggregation and degradation, and regulate the multifunctionality and substrate specificity of the HSPA chaperones [19, 34]. Here we studied the variation in gene expression of twenty-two different members of the DNAJ family (4 DNAJA, 9 DNAJB and 9 DNAJC) that are known to have a significant role in cellular protein homeostasis maintenance. A selective alteration in the expression profiles of DNAJ proteins was observed for different stress conditions (Fig. 2B).\u003c/p\u003e\n\u003cp\u003eThe rotenone-induced oxidative stress apparently altered the gene expression of DNAJA2, DNAJB4, and ER-specific DNAJs, DNAJC1, DNAJC7, DNAJC9 and DNAJC10; however, the changes were statistically significant for DNAJC1 (1.93 fold) (Fig. 3C i). The gene expression of DNAJB1 (0.41 fold) was significantly downregulated in \u0026alpha;-syn-seeds induced proteotoxic stress (Fig. 3D i). Inhibition of the proteasome through MG132 leads to gene expression alteration in several DNAJ proteins. DNAJA1 (1.87 fold), DNAJA3 (1.91 fold), and DNAJA4 (1.74 fold), DNAJB1 (43.95 fold), DNAJB11 (1.81 fold), DNAJB12 (1.51 fold), DNAJB2 (4.78 fold), DNAJB4 (3.32 fold), DNAJB5 (1.63 fold), DNAJB6 (2.00 fold), and DNAJC7 (2.13 fold) were upregulated, ER-specific DNAJs, DNAJC9 (0.50 fold), and DNAJC10 (0.49 fold) were significantly downregulated (Fig. 3E i). Heat shock also has a specific expression pattern, where a significant increase in the gene expression of DNAJA1 (2.21 fold), DNAJB1 (37.17 fold), DNAJB4 (3.86 fold) and DNAJB6 (2.63 fold) was observed in vitro (Fig. 3F i).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFurther, the alterations in protein levels of DNAJBs (DNAJB1, DNAJB6 (a,b) and DNAJB8), which have a proven role in regulating the aggregation of amyloid proteins and association with neurodegenerative diseases through mechanistic involvement in protein folding, disaggregation and aggregation prevention [9, 36-38] were done. Interestingly, a significantly upregulated protein expression of DNAJB1 (1.19 fold) was observed in oxidative stress by rotenone, while DNAJB6 and DNAJB8 were unaltered (Fig. 3C ii-iii). Expression of both DNAJB1\u0026nbsp;and DNAJB8 were significantly enhanced in \u0026alpha;-syn-seeds and MG132 treatment, whereas the protein expression of DNAJB6 (both a and b isoforms) remained unchanged (Fig. 3D-E ii-iii). The heat shock significantly induced the protein expression of DNAJB1 (3.82 fold) (Fig. 3F ii-iii).\u003c/p\u003e\n\u003cp\u003eIn summary, the study indicates highly specific overexpression of co-chaperone DNAJB8 in proteotoxic conditions as induced by \u0026alpha;-syn-seeds and MG132 and DNAJB1 for all kinds of stress conditions used in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptional regulation of molecular chaperones by HSF-1 and NRF2:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext, we addressed the regulatory factors of chaperone expression, the heat shock factor 1 (HSF1), which controls cellular proteostasis under heat stress and proteotoxic stress by regulating the expression of majority of chaperones, and nuclear factor erythroid 2-related factor 2 (NRF2) that controls the cellular redox potential under oxidative stress [39-41]. HSF1 protein was over-expressed (1.5 to 1.8 fold) in all four stress conditions (Fig. 4A i-iv). Interestingly, the change in the protein expression of NRF2 was selective for stress conditions. The protein expression of NRF2 was upregulated in rotenone-induced oxidative stress (1.30 fold), MG132-induced proteotoxic stress (15.39 fold) and heat stress (1.18 fold) (Fig. 4B ii, iii-iv) compared to control, whereas the \u0026alpha;-syn-seeds decreased the NRF2 protein expression by 0.65 fold (Fig. 4 ii). In contrast to the protein expression, the gene expression of HSF1 and NRF2 (Fig. S5 A- B) also deviated from their protein levels. A significantly increased gene expression of HSF1 was observed in rotenone and MG132 treatments, whereas heat stress and \u0026alpha;-syn-seeds treatment resulted in an unaltered change in the gene expression of HSF-1, which was consistent with previous reports [42]. The gene expression of NRF2 was upregulated in all stress conditions except the \u0026alpha;-syn-seeds, where no alteration in NRF2 gene expression was observed.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe human genome encodes more than 100 different molecular chaperones that are grouped according to their molecular weight as HSPH (HSP110), HSPC (HSP90), HSPA (HSP70), DNAJ (HSP40), human chaperonins HSPD/E (HSP60/HSP10 \u0026amp; CCT (TRiC)) and HSPB (sHSP) [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These chaperones are complemented by a number of regulatory proteins that help in networking with cellular processes [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The dysregulation of molecular chaperones is related to several protein aggregation-associated diseases, including neurodegenerative, metabolic diseases and cancers [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In each disease condition, the cellular environment varies, and expression profiling of molecular chaperones is subsequently altered, probably with a unique molecular imprint. However, limited literature and reports are focused on the expression analysis of the unique molecular imprint of the molecular chaperones and co-chaperones in protein aggregation-associated neurodegenerative diseases and associated stress factors. Therefore, it is necessary to understand the selectivity of molecular chaperones and co-chaperones toward different stress conditions. Herein, we investigated the in vitro expression pattern of molecular chaperones HSPA and DNAJ under oxidative and proteotoxic conditions as commonly associated with the initiation and propagation of neurodegenerative diseases.\u003c/p\u003e\u003cp\u003eThe variation in gene expression profile of eight different members of the HSPA family, HSPA1A, HSPA1L, HSPA2, HSPA5, HSPA8, HSPA4, HSPA9 and HSPA12A under different stress conditions was studied. HSPA1A, also known as HSP70, is a stress-inducible protein was upregulated at the protein level in all stress conditions studied (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-E). The gene/transcriptomic levels of HSPA1A were selectively affected, where upregulation was observed under heat and proteasomal inhibition conditions and downregulation in the presence of α-syn seeds in vitro. The oxidative stress did not affect the HSP70 gene levels. The difference in the gene expression pattern of HSPA1A might be due to differences in the mechanism of stress and subsequent effect on the stability of the respective mRNA [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHSPA5, also known as GRP78 (glucose-regulated protein 78) or BiP (binding immunoglobulin protein), is a constitutively expressed HSP70 associated with the ER, the quality control organelle for cellular proteostasis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. HSPA5 is upregulated at gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-F i) and protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-F ii-iii) under all stress conditions studied, where upregulation was statistically significant for proteasome inhibition and heat stress (2E-F i-iii). HSPA5 regulates ER-associated protein folding of newly synthesised peptide, refolding of misfolded proteins and proteasomal degradation. HSPA5 maintains ER calcium homeostasis, also senses misfolded protein load in ER and activates the unfolded protein response (UPR) to restore protein homeostasis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The stress-induced proteostasis imbalance affects ER homeostasis, which induces HSPA5 expression. Therefore, we observed a uniformly upregulated expression of HSPA5 under stress conditions and can be considered as a marker of proteostasis dysfunction.\u003c/p\u003e\u003cp\u003eHSPA8 (HSC70) is the constitutively expressed chaperone that has several protein quality control functions, including regulating chaperone-mediated autophagy, protein folding and transportation and protein disaggregation to efficiently disassemble amyloid fibrils [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The gene and protein level expression of HSPA8 was upregulated in MG132 (Fig.\u0026nbsp;2Ei-iii), heat stress resulted in increased protein expression of HSPA8 (Fig.\u0026nbsp;2Fii-iii), while both the gene and protein remained unaltered by rotenone-induced oxidative stress (Fig.\u0026nbsp;2Ci-iii). The unaltered gene and protein expression of HSPA8 due to rotenone exposure was consistent with our previous report, where HSPA8 was unchanged in the dopaminergic neurons of a rotenone-induced Parkinsonian rat model [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Interestingly, in α-syn seeds-induced toxicity, HSPA8 was down-regulated at the gene level (Fig.\u0026nbsp;2Di). The protein expression of HSPA8 was also unchanged in α-syn seeds-induced toxicity (Fig.\u0026nbsp;2Dii-iii), which is consistent with a previous report showing a significant role of HSPA8 in the pathogenesis of Alzheimer's disease (AD) [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. The down-regulation of HSPA8 gene is associated with reduced cell proliferation, increased aggregation of α-syn, tau, and SOD and increased cell apoptosis in HSPA8 knockdown in vitro [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Thus, downregulated gene expression of HSPA8 due to α-syn-seeds-toxicity may be associated with compromised chaperone capacity in terms of hampered cell proliferation, disaggregation and degradation. While the upregulated expression of HSPA8 due to proteasome inhibition may be due to the compensatory role of HSPA8 in autophagy to clear the hampered protein load [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHSPA4, also known as APG-2, has a significant role in clathrin-mediated endocytosis and protein disaggregation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. We observed significant upregulation in the gene expression of HSPA4 in MG132 treatment and heat shock (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-Fi), whereas no alteration in rotenone and α-syn-seeds-induced stress, similar to previous observations for HSPA8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-Di). As a crucial part of HSC70 disaggregation machinery, APG2 recruits dense clusters of HSC70 on amyloid fibrils, necessary for the disaggregation reaction and regulate the kinetics of the disaggregation reaction [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. The reduced level of HSPA4 and HSPA8 indicated the compromised cellular disaggregation machinery in stress.\u003c/p\u003e\u003cp\u003eOther proteins significant to neurodegenerative disease, such as HSPA1L, a pathogenesis and prognosis biomarker of PD and glioma [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], was upregulated by MG132 treatment and heat shock (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-Fi). The proteasomal inhibition by MG132 further upregulated the genes of mitochondrial-specific HSP70, HSPA9 (also known as Mortalin, Grp75), and HSPA12A (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eEi), consistent with previous reports [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. We also observed a decrease in HSPA2 gene expression due to proteasome inhibition (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eEi), similar to other reports and is associated with reduced ER stress and cell proliferation [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSimilar to HSPA4, HSPH1 (HSP110) is another chaperone that has mechanistically important role in HSP70-mediated protein folding and disaggregation as NEF [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. We observed significant upregulated gene expression of HSPH1 in MG132 treatment and heat shock (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-Fi). The protein expression of HSPH1 in SH-SY5Y cells was upregulated in all stress conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-Fii-iii). The upregulated HSPH1 protein expression is consistent with other/our previous in vivo reports, in which HSP105 (homologue of HSP110 in rat) was upregulated in dopaminergic neurons of a rotenone-induced Parkinsonian rat model [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and thus can be effective against protein aggregation by increasing the chaperone capacity and disaggregase activity [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe HSPA family chaperones have DNAJ as co-chaperones that regulate the multifunctionality and substrate specificity of the HSPA [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Here we have studied the molecular expression signatures of twenty-two DNAJ proteins, DNAJA1, DNAJA2, DNAJA3, DNAJA4, DNAJB1, DNAJB2, DNAJB4, DNAJB5, DNAJB6, DNAJB8, DNAJB9, DNAJB11, DNAJB12, DNAJC1, DNAJC4, DNAJC5, DNAJC6, DNAJC7, DNAJC8, DNAJC9, DNAJC10 and DNAJC16 that are associated with proteostasis maintenance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Out of 22 DNAJs, DNAJB1, DNAJB6, and DNAJB8 have been known for mechanistic role in regulating protein aggregation and associated neurodegenerative disease [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. We observed significant gene imprint for each protein under the specified stress conditions, clearly distinguishing the stress response and handling by the cellular system. DNAJB1, a critical part of protein disaggregation machinery (HSP(C)70/DNAJB1/HSP110), binds to the amyloid fibrils of α-syn, tau and HTT proteins linked to neurodegenerative diseases and recruits HSP70/HSC70 for disaggregation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. The α-syn-seeds-induced proteotoxicity resulted in the downregulation of the DNAJB1 gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eDi), whereas proteasomal inhibition and heat stress caused its upregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-Fi). Rotenone exerted no effect on the gene expression of DNAJB1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The unaltered gene expression of the DNAJB1 gene in rotenone-treated cells is consistent with our previous report [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. We also checked the protein level of DNAJB1 under stated stress conditions and observed a significant increase in the protein expression of DNAJB1, where the level of upregulation varied with stress conditions. Our results indicate that neither HSPH1 nor DNAJB1 are the limiting factor for the activity of disaggregation machinery in vitro under stress conditions, where unaltered expression of HSC70 may limit the action of the constitutive HSC70 disaggregation system in stress conditions.\u003c/p\u003e\u003cp\u003eDNAJB6 can prevent the aggregation of tau, Aβ and polyQ through the HSP70-independent mechanism and also regulates HSP70 activity in tau folding [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. We did not observe significant changes in DNAJB6 gene expression in rotenone or α-syn-seeds treatment. However, DNAJB6 gene expression was upregulated by proteasomal inhibition and heat shock (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-Fi). DNAJB6 protein has two isoforms (DNAJB6a and DNAJB6b) that showed differential protein expression under stress, both DNAJB6a and DNAJB6b were apparently upregulated by proteasomal inhibition and heat shock, however not validated statistically.\u003c/p\u003e\u003cp\u003eSimilarly, DNAJB8 prevents protein aggregation through its HSP70-independent mechanism [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. We observed significant upregulation in the protein expression of DNAJB8 in proteotoxic stress induced by α-syn-seeds and MG132 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-Eii-iii) however; changes in the gene expression were not consistent. Due to its selective protein expression profile, DNAJB8 can be an indicative marker for proteotoxic stress.\u003c/p\u003e\u003cp\u003eThe gene expression of DNAJB4 was upregulated MG132 and heat stress conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-Fi). The proteasome inhibition resulted in the upregulation of gene expression of DNAJB5, DNAJB11 and DNAJB12 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eCEi) that are associated with clearance of protein aggregate by preventing of protein aggregates, promoting the refolding and lysosomal degradation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. The gene expression of DNAJA and DNAJCs was also altered according to their response to specific stress and cellular compartment specificity. DNAJA1, DNAJA3 and DNAJA4 were upregulated in proteotoxic stress induced by proteasome inhibition. DNAJA1 was upregulated in heat stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-Fi). The upregulation of DNAJAs in response to different stress conditions is due to their consistent association in protein folding and degradation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Among the DNAJCs, the gene levels of DNAJC1 was upregulated in oxidative stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eCi). The gene expression of DNAJC7 was upregulated while DANJC9 and DNAJC10 were downregulated in MG132 treatment. These altered DNAJCs were associated with ER-associated degradation (ERAD) and chromatin integrity [\u003cspan additionalcitationids=\"CR69 CR70\" citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo understand the regulation of molecular chaperone expression, HSF1 and NRF2 profiles were analysed under the different stress conditions. The expression of molecular chaperones is regulated by HSF1 through activation of HSR [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. However, not all chaperones are stress-inducible; some are constitutively expressed and inducible under stress [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], indicating that the expression of chaperones might not be a part of the HSR alone. A cross-talk between HSF1 and NRF2 exists in cellular conditions that plays a considerable role in the regulation of HSP70 expression and maintenance of cellular homeostasis [\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Therefore, we have analysed the expression of both HSF1 and NRF2 under stated different stress conditions. An increased expression of HSF1 in all stress conditions was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), whereas the protein expression of NRF2 varied with stress conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The expression of NRF2 was increased in rotenone, MG132 and heat shock-induced stress, while decreased in α-syn seeds-induced stress condition. The gene expression of HSF1 and NRF2 (Fig. S5) showed deviation from their protein levels.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe altered chaperones and co-chaperones expressions exhibit their specificity toward stress conditions to meet the stress-induced cellular response (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Oxidative stress-induced cellular damage mainly affects the endoplasmic reticulum and mitochondria, where molecular chaperones HSPA1A, HSPA8, HSPA5, HSPA9 and HSPA4 associated with the cytosol, ER and mitochondria were altered. Further, the altered co-chaperones DNAJB1, DNAJB4, DNAJB6, DNAJC7, DNAJC1, DNAJC9, DNAJC10 and DNAJA2 regulate the protein refolding, disaggregation, and degradation in the cytosol, ER and mitochondria. Proteotoxicity induced by α-syn-seeds results in the upregulation of HSP1A, HSPA5, HSPH1, DNAJB1 and DNAJB8, associated with stress-induced aggregation prevention, refolding and disaggregation. While unaltered protein levels and downregulated gene levels of HSPA8 and HSPA4 correlate with compromised chaperone capacity. Proteasome inhibition has a negative impact on the cellular proteostasis, which results in upregulation of the battery of chaperones and co-chaperones HSPA1A, HSPA1L, HSPA4, HSPA5, HSPA8, HSPA9, HSPA12A, DNAJA1, DNAJA3, and DNAJA4, DNAJB1, DNAJB11, DNAJB12, DNAJB2, DNAJB4, DNAJB5, DNAJB6, and DNAJC7 while HSPA2, DNAJC9 and DNAJC10 were downregulated. These altered chaperones are associated with refolding, disaggregation, autophagy and chromatin integrity to help the cell to cope the stress by combating the cellular load of non-functional/toxic proteins.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe study defines the heat shock response through expression of HSPA and DNAJ in different cellular stress conditions associated with neurodegenerative diseases, and underlies their crucial role in maintaining proteostasis. The differential expression of HSPA and DNAJ reflects the cellular adaptive mechanisms to address protein aggregation and maintain cellular functioning. Further, the stress-dependent involvement of transcription factors HSF1 and NRF2 indicates the involvement of other cellular pathways to acquire cellular stress response. Understanding these molecular responses could define the approach for developing treatments to restore proteostasis and prevent disease progression. The work has been performed in vitro using neuronal cell lines, further validation through the primary cell culture of different brain regions affected in neurodegenerative diseases, experimental animals or patient samples could be helpful. Comprehensive mapping of molecular chaperones under healthy and stressed conditions may help researchers working in several areas of biology to accurately determine targets for applications in research and therapeutics.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eα-syn, Alpha-synuclein;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAβ, amyloid β; AD,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlzheimer's disease; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBCA, Bicinchoninic acid;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBSA, Bovine serum albumin;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCD, Circular dichroism;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDMSO, Dimethyle sulfoxide;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDTT, Dithiothreitol;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eER, Endoplasmic reticulum;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eERAD, endoplasmic reticulum associated degradation;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFBS, Foetal bovine serum;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHSR, Heat shock response;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHSF1, Heat shock factor 1;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHTT, Huntingtin;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMTT, [3-(4, 5-501 dimethyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide];\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNRF2, Nuclear factor erythroid 2-related factor 2;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNEF, Nucleotide exchange factor;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePBS, Phosphate buffer saline;\u003c/p\u003e\n\u003cp\u003ePD, Parkinson’s disease;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSOD, Superoxide dismutase;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTBS, Tris buffer saline;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTEM, Transmission electron microscopy;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThT, Thioflavin T;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eUPR, Unfolded protein response;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWT, wild type\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author acknowledges the support of the Council of Scientific and Industrial Research, India. CSIR-IITR manuscript communication number is IITR/SECC-PME/MSS/2025/026. We thank Mr. Jai Shankar for his assistance in the transmission electron microscopy imaging and Dr Amita Jain, Department of Microbiology, KGMU, for the Quant Studio 5 flex facility.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSP is supported by SERB POWER Grant, SPG/2021/003283, SF received fellowship from the University Grants Commission, India and AG received fellowship from SERB.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors declare no competing financial interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contribution\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSF\u003c/strong\u003e did investigation, formal analysis, data curation, validation and wrote original draft, review \u0026amp; edited. \u003cstrong\u003eAG\u003c/strong\u003e performed the investigation and data curation. \u003cstrong\u003eSP\u003c/strong\u003e did conceptualization, supervision, validation, resources, project administration, funding acquisition and writing, review \u0026amp; editing of the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript or supplementary information files.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was performed in cell lines, and ethical approval was not applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMayer MP, Bukau B (2005) Hsp70 chaperones: cellular functions and molecular mechanism. Cell Mol Life Sci 62:670\u0026ndash;684. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00018-004-4464-6\u003c/span\u003e\u003cspan address=\"10.1007/s00018-004-4464-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShemesh N, Jubran J, Dror S, Simonovsky E, Basha O, Argov C, Hekselman I, Abu-Qarn M, Vinogradov E, Mauer O, Tiago T, Carra S, Ben-Zvi A, Yeger-Lotem E (2021) The landscape of molecular chaperones across human tissues reveals a layered architecture of core and variable chaperones. Nat Commun 12:2180. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-021-22369-9\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-22369-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorimoto RI (2008) Proteotoxic stress and inducible chaperone networks in neurodegenerative disease and aging. Genes Dev 22:1427\u0026ndash;1438. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gad.1657108\u003c/span\u003e\u003cspan address=\"10.1101/gad.1657108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStetler RA, Gan Y, Zhang W, Liou AK, Gao Y, Cao G, Chen J (2010) Heat shock proteins: cellular and molecular mechanisms in the central nervous system. Prog Neurobiol 92:184\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pneurobio.2010.05.002\u003c/span\u003e\u003cspan address=\"10.1016/j.pneurobio.2010.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh MK, Shin Y, Ju S, Han S, Choe W, Yoon KS, Kim SS, Kang I (2024) Heat Shock Response and Heat Shock Proteins: Current Understanding and Future Opportunities in Human Diseases. Int J Mol Sci 25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25084209\u003c/span\u003e\u003cspan address=\"10.3390/ijms25084209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGidalevitz T, Prahlad V, Morimoto RI (2011) The stress of protein misfolding: from single cells to multicellular organisms. Cold Spring Harb Perspect Biol 3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a009704\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a009704\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLippi A, Krisko A (2024) Protein aggregation: A detrimental symptom or an adaptation mechanism? J Neurochem 168:1426\u0026ndash;1441. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jnc.15955\u003c/span\u003e\u003cspan address=\"10.1111/jnc.15955\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGadhave DG, Sugandhi VV, Jha SK, Nangare SN, Gupta G, Singh SK, Dua K, Cho H, Hansbro PM, Paudel KR (2024) Neurodegenerative disorders: Mechanisms of degeneration and therapeutic approaches with their clinical relevance. Ageing Res Rev 99:102357. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.arr.2024.102357\u003c/span\u003e\u003cspan address=\"10.1016/j.arr.2024.102357\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchneider MM, Gautam S, Herling TW, Andrzejewska E, Krainer G, Miller AM, Trinkaus VA, Peter QAE, Ruggeri FS, Vendruscolo M, Bracher A, Dobson CM, Hartl FU, Knowles TPJ (2021) The Hsc70 disaggregation machinery removes monomer units directly from alpha-synuclein fibril ends. Nat Commun 12:5999. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-021-25966-w\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-25966-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaaklini I, Goncalves CC, Lukacs GL, Young JC (2020) Selective Binding of HSC70 and its Co-Chaperones to Structural Hotspots on CFTR. Sci Rep 10:4176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-020-61107-x\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-61107-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMayer MP, Gierasch LM (2019) Recent advances in the structural and mechanistic aspects of Hsp70 molecular chaperones. J Biol Chem 294:2085\u0026ndash;2097. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.REV118.002810\u003c/span\u003e\u003cspan address=\"10.1074/jbc.REV118.002810\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKilpatrick K, Novoa JA, Hancock T, Guerriero CJ, Wipf P, Brodsky JL, Segatori L (2013) Chemical induction of Hsp70 reduces alpha-synuclein aggregation in neuroglioma cells. ACS Chem Biol 8:1460\u0026ndash;1468. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/cb400017h\u003c/span\u003e\u003cspan address=\"10.1021/cb400017h\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKlucken J, Shin Y, Masliah E, Hyman BT, McLean PJ (2004) Hsp70 Reduces alpha-Synuclein Aggregation and Toxicity. J Biol Chem 279:25497\u0026ndash;25502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M400255200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M400255200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrehme M, Voisine C, Rolland T, Wachi S, Soper JH, Zhu Y, Orton K, Villella A, Garza D, Vidal M, Ge H, Morimoto RI (2014) A chaperome subnetwork safeguards proteostasis in aging and neurodegenerative disease. Cell Rep 9:1135\u0026ndash;1150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2014.09.042\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2014.09.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBorrageiro G, Haylett W, Seedat S, Kuivaniemi H, Bardien S (2018) A review of genome-wide transcriptomics studies in Parkinson's disease. Eur J Neurosci 47:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ejn.13760\u003c/span\u003e\u003cspan address=\"10.1111/ejn.13760\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun H, Zou HY, Cai XY, Zhou HF, Li XQ, Xie WJ, Xie WM, Du ZP, Xu LY, Li EM, Wu BL (2020) Network Analyses of the Differential Expression of Heat Shock Proteins in Glioma. DNA Cell Biol 39:1228\u0026ndash;1242. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/dna.2020.5425\u003c/span\u003e\u003cspan address=\"10.1089/dna.2020.5425\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosenzweig R, Nillegoda NB, Mayer MP, Bukau B (2019) The Hsp70 chaperone network. Nat Rev Mol Cell Biol 20:665\u0026ndash;680. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41580-019-0133-3\u003c/span\u003e\u003cspan address=\"10.1038/s41580-019-0133-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarszalek J, De Los Rios P, Cyr D, Mayer MP, Adupa V, Andreasson C, Blatch GL, Braun JEA, Brodsky JL, Bukau B, Chapple JP, Conz C, Dementin S, Genevaux P, Genest O, Goloubinoff P, Gestwicki J, Hammond CM, Hines JK, Ishikawa K, Joachimiak LA, Kirstein J, Liberek K, Mokranjac D, Nillegoda N, Ramos CHI, Rebeaud M, Ron D, Rospert S, Sahi C, Shalgi R, Tomiczek B, Ushioda R, Ustyantseva E, Ye Y, Zylicz M, Kampinga HH (2024) J-domain proteins: From molecular mechanisms to diseases. Cell Stress Chaperones 29:21\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cstres.2023.12.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cstres.2023.12.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFatima S, Pandey P, Sharma SK, Priya S (2025) Structural-functional relevance of DNAJBs in protein aggregation and associated neurodegenerative diseases. Biochim Biophys Acta Proteins Proteom 1873:141074. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbapap.2025.141074\u003c/span\u003e\u003cspan address=\"10.1016/j.bbapap.2025.141074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMattoo RUH, Sharma SK, Priya S, Finka A, Goloubinoff P (2013) Hsp110 is a bona fide chaperone using ATP to unfold stable misfolded polypeptides and reciprocally collaborate with Hsp70 to solubilize protein aggregates. J Biol Chem 288:21399\u0026ndash;21411. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M113.479253\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M113.479253\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWentink A, Rosenzweig R (2023) Protein disaggregation machineries in the human cytosol. Curr Opin Struct Biol 83:102735. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.sbi.2023.102735\u003c/span\u003e\u003cspan address=\"10.1016/j.sbi.2023.102735\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSrivastava T, Raj R, Dubey A, Kumar D, Chaturvedi RK, Sharma SK, Priya S (2020) Fast kinetics of environmentally induced alpha-synuclein aggregation mediated by structural alteration in NAC region and result in structure dependent cytotoxicity. Sci Rep 10:18412. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-020-75361-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-75361-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBetarbet R, Canet-Aviles RM, Sherer TB, Mastroberardino PG, McLendon C, Kim JH, Lund S, Na HM, Taylor G, Bence NF, Kopito R, Seo BB, Yagi T, Yagi A, Klinefelter G, Cookson MR, Greenamyre JT (2006) Intersecting pathways to neurodegeneration in Parkinson's disease: effects of the pesticide rotenone on DJ-1, alpha-synuclein, and the ubiquitin-proteasome system. Neurobiol Dis 22:404\u0026ndash;420. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.nbd.2005.12.003\u003c/span\u003e\u003cspan address=\"10.1016/j.nbd.2005.12.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRomero-Granados R, Fontan-Lozano A, Aguilar-Montilla FJ, Carrion AM (2011) Postnatal proteasome inhibition induces neurodegeneration and cognitive deficiencies in adult mice: a new model of neurodevelopment syndrome. PLoS ONE 6:e28927. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0028927\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0028927\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng L, Smith DJ, Anderson RL, Nagley P (2011) Human neuroblastoma SH-SY5Y cells show increased resistance to hyperthermic stress after differentiation, associated with elevated levels of Hsp72. Int J Hyperth 27:415\u0026ndash;426. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3109/02656736.2010.531075\u003c/span\u003e\u003cspan address=\"10.3109/02656736.2010.531075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLang BJ, Nguyen L, Nguyen HC, Vieusseux JL, Chai RC, Christophi C, Fifis T, Kouspou MM, Price JT (2012) Heat stress induces epithelial plasticity and cell migration independent of heat shock factor 1. Cell Stress Chaperones 17:765\u0026ndash;778. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12192-012-0349-z\u003c/span\u003e\u003cspan address=\"10.1007/s12192-012-0349-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSrivastava T, Tyagi D, Fatima S, Sathyan MTV, Raj R, Sharma A, Chaturvedi M, Sinha M, Shishodia SK, Kumar D, Sharma SK, Shankar J, Satish A, Priya S (2024) A natural small molecule-mediated inhibition of alpha-synuclein aggregation leads to neuroprotection in Caenorhabditis elegans. J Neurochem 168:1640\u0026ndash;1654. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jnc.15907\u003c/span\u003e\u003cspan address=\"10.1111/jnc.15907\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVolles MJ, Lansbury PT Jr. (2007) Relationships between the sequence of alpha-synuclein and its membrane affinity, fibrillization propensity, and yeast toxicity. J Mol Biol 366:1510\u0026ndash;1522. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jmb.2006.12.044\u003c/span\u003e\u003cspan address=\"10.1016/j.jmb.2006.12.044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePaleologou KE, Schmid AW, Rospigliosi CC, Kim HY, Lamberto GR, Fredenburg RA, Lansbury PT Jr., Fernandez CO, Eliezer D, Zweckstetter M, Lashuel HA (2008) Phosphorylation at Ser-129 but not the phosphomimics S129E/D inhibits the fibrillation of alpha-synuclein. J Biol Chem 283:16895\u0026ndash;16905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M800747200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M800747200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaturvedi M, Raj R, Yadav SK, Srivastava T, Devi S, Dharmadana D, Valery C, Sharma SK, Kumar D, Priya S (2023) Implications of In Vitro Multi-Serine Phosphorylation of Alpha-Synuclein in Aggregation and Cytotoxicity. ACS Chem Neurosci 14:3103\u0026ndash;3112. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acschemneuro.3c00234\u003c/span\u003e\u003cspan address=\"10.1021/acschemneuro.3c00234\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSundaram VK, Sampathkumar NK, Massaad C, Grenier J (2019) Optimal use of statistical methods to validate reference gene stability in longitudinal studies. PLoS ONE 14:e0219440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0219440\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0219440\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101\u0026ndash;1108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nprot.2008.73\u003c/span\u003e\u003cspan address=\"10.1038/nprot.2008.73\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVos MJ, Hageman J, Carra S, Kampinga HH (2008) Structural and functional diversities between members of the human HSPB, HSPH, HSPA, and DNAJ chaperone families. Biochemistry 47:7001\u0026ndash;7011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/bi800639z\u003c/span\u003e\u003cspan address=\"10.1021/bi800639z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKampinga HH, Craig EA (2010) The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nat Rev Mol Cell Biol 11:579\u0026ndash;592. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrm2941\u003c/span\u003e\u003cspan address=\"10.1038/nrm2941\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWentink AS, Nillegoda NB, Feufel J, Ubartaite G, Schneider CP, De Los Rios P, Hennig J, Barducci A, Bukau B (2020) Molecular dissection of amyloid disaggregation by human HSP70. Nature 587:483\u0026ndash;488. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-020-2904-6\u003c/span\u003e\u003cspan address=\"10.1038/s41586-020-2904-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang YL, Yang CC, Huang YY, Chen YA, Yang CW, Liao CY, Li H, Wu CS, Lin CH, Teng SC (2023) The HSP40 family chaperone isoform DNAJB6b prevents neuronal cells from tau aggregation. BMC Biol 21:293. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12915-023-01798-6\u003c/span\u003e\u003cspan address=\"10.1186/s12915-023-01798-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOsterlund N, Frankel R, Carlsson A, Thacker D, Karlsson M, Matus V, Graslund A, Emanuelsson C, Linse S (2023) The C-terminal domain of the antiamyloid chaperone DNAJB6 binds to amyloid-beta peptide fibrils and inhibits secondary nucleation. J Biol Chem 299:105317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbc.2023.105317\u003c/span\u003e\u003cspan address=\"10.1016/j.jbc.2023.105317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRyder BD, Ustyantseva E, Boyer DR, Mendoza-Oliva A, Kuska MI, Wydorski PM, Macierzynska P, Morgan N, Sawaya MR, Diamond MI, Kampinga HH, Joachimiak LA (2024) DNAJB8 oligomerization is mediated by an aromatic-rich motif that is dispensable for substrate activity. Structure 32:662\u0026ndash;678e8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.str.2024.02.015\u003c/span\u003e\u003cspan address=\"10.1016/j.str.2024.02.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDayalan Naidu S, Kostov RV, Dinkova-Kostova AT (2015) Transcription factors Hsf1 and Nrf2 engage in crosstalk for cytoprotection. Trends Pharmacol Sci 36:6\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tips.2014.10.011\u003c/span\u003e\u003cspan address=\"10.1016/j.tips.2014.10.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCyran AM, Zhitkovich A (2022) HIF1, HSF1, and NRF2: Oxidant-Responsive Trio Raising Cellular Defenses and Engaging Immune System. Chem Res Toxicol 35:1690\u0026ndash;1700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.chemrestox.2c00131\u003c/span\u003e\u003cspan address=\"10.1021/acs.chemrestox.2c00131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSwan CL, Sistonen L (2015) Cellular stress response cross talk maintains protein and energy homeostasis. EMBO J 34:267\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/embj.201490757\u003c/span\u003e\u003cspan address=\"10.15252/embj.201490757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNeueder A, Gipson TA, Batterton S, Lazell HJ, Farshim PP, Paganetti P, Housman DE, Bates GP (2017) HSF1-dependent and -independent regulation of the mammalian in vivo heat shock response and its impairment in Huntington's disease mouse models. Sci Rep 7:12556. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-017-12897-0\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-12897-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKampinga HH, Hageman J, Vos MJ, Kubota H, Tanguay RM, Bruford EA, Cheetham ME, Chen B, Hightower LE (2009) Guidelines for the nomenclature of the human heat shock proteins. Cell Stress Chaperones 14:105\u0026ndash;111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12192-008-0068-7\u003c/span\u003e\u003cspan address=\"10.1007/s12192-008-0068-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKakkar V, Meister-Broekema M, Minoia M, Carra S, Kampinga HH (2014) Barcoding heat shock proteins to human diseases: looking beyond the heat shock response. Dis Model Mech 7:421\u0026ndash;434. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/dmm.014563\u003c/span\u003e\u003cspan address=\"10.1242/dmm.014563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChand K, Iyer K, Mitra D (2021) Comparative analysis of differential gene expression of HSP40 and HSP70 family isoforms during heat stress and HIV-1 infection in T-cells. Cell Stress Chaperones 26:403\u0026ndash;416. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12192-020-01185-y\u003c/span\u003e\u003cspan address=\"10.1007/s12192-020-01185-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen W, Li G, Peng J, Dai W, Su Q, He Y (2020) Transcriptomic analysis reveals that heat shock protein 90alpha is a potential diagnostic and prognostic biomarker for cancer. Eur J Cancer Prev 29:357\u0026ndash;364. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/CEJ.0000000000000549\u003c/span\u003e\u003cspan address=\"10.1097/CEJ.0000000000000549\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Beyer A, Aebersold R (2016) On the Dependency of Cellular Protein Levels on mRNA Abundance. Cell 165:535\u0026ndash;550. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2016.03.014\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2016.03.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePobre KFR, Poet GJ, Hendershot LM (2019) The endoplasmic reticulum (ER) chaperone BiP is a master regulator of ER functions: Getting by with a little help from ERdj friends. J Biol Chem 294:2098\u0026ndash;2108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.REV118.002804\u003c/span\u003e\u003cspan address=\"10.1074/jbc.REV118.002804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDou J, Su P, Xu C, Wen Z, Mao Z, Li W (2020) Targeting Hsc70-based autophagy to eliminate amyloid beta oligomers. Biochem Biophys Res Commun 524:923\u0026ndash;928. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2020.02.016\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2020.02.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTanu, Chaturvedi M, Fatima S, Yadav SS, Padhy PK, Tiwari S, Seth K, Chaturvedi RK, Priya S (2025) Expression analysis of molecular chaperones associated with disaggregation complex in rotenone-induced Parkinsonian rat model. Int J Biochem Cell Biol 181:106752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biocel.2025.106752\u003c/span\u003e\u003cspan address=\"10.1016/j.biocel.2025.106752\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong Y, Li T, Ma Z, Zhou C, Wang X, Li J (2022) HSPA1A, HSPA2, and HSPA8 Are Potential Molecular Biomarkers for Prognosis among HSP70 Family in Alzheimer's Disease. Dis Markers 2022:9480398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/9480398\u003c/span\u003e\u003cspan address=\"10.1155/2022/9480398\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSilva PN, Furuya TK, Braga IL, Rasmussen LT, Labio RW, Bertolucci PH, Chen ES, Turecki G, Mechawar N, Payao SL, Mill J, Smith MC (2014) Analysis of HSPA8 and HSPA9 mRNA expression and promoter methylation in the brain and blood of Alzheimer's disease patients. J Alzheimers Dis 38:165\u0026ndash;170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3233/JAD-130428\u003c/span\u003e\u003cspan address=\"10.3233/JAD-130428\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun G, Cao Y, Dai X, Li M, Guo J (2019) Hsc70 Interacts with beta4GalT5 to Regulate the Growth of Gliomas. Neuromolecular Med 21:33\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12017-018-08520-8\u003c/span\u003e\u003cspan address=\"10.1007/s12017-018-08520-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSirtori R, Riva C, Ferrarese C, Sala G (2020) HSPA8 knock-down induces the accumulation of neurodegenerative disorder-associated proteins. Neurosci Lett 736:135272. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neulet.2020.135272\u003c/span\u003e\u003cspan address=\"10.1016/j.neulet.2020.135272\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKorolchuk VI, Menzies FM, Rubinsztein DC (2010) Mechanisms of cross-talk between the ubiquitin-proteasome and autophagy-lysosome systems. FEBS Lett 584:1393\u0026ndash;1398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.febslet.2009.12.047\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2009.12.047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarhouri K, Navarro C, Depetris D, Mattei MG, Nissan X, Cau P, De Sandre-Giovannoli A, Levy N (2017) MG132-induced progerin clearance is mediated by autophagy activation and splicing regulation. EMBO Mol Med 9:1294\u0026ndash;1313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/emmm.201607315\u003c/span\u003e\u003cspan address=\"10.15252/emmm.201607315\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Li Q, Shao S, Ji X, Gao W, Fan Y, Liu M, Wang Y, Bai J (2024) HSPA4 Enhances BRSV Entry via Clathrin-Mediated Endocytosis Through Regulating the PI3K-Akt Signaling Pathway and ATPase Activity of HSC70. Viruses 16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v16111784\u003c/span\u003e\u003cspan address=\"10.3390/v16111784\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeton JG, Monistrol J, Wentink A, Johnston EC, Roberts AJ, Bukau BG, Hoogenboom BW, Saibil HR (2022) Cooperative amyloid fibre binding and disassembly by the Hsp70 disaggregase. EMBO J 41:e110410. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/embj.2021110410\u003c/span\u003e\u003cspan address=\"10.15252/embj.2021110410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng H, Wang J, Zhao Y, Hou X, Ling F, Wang Y, Cao Y (2024) Deciphering the role of heat shock protein HSPA1L: biomarker discovery and prognostic insights in Parkinson's disease and glioma. SLAS Technol 29:100212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.slast.2024.100212\u003c/span\u003e\u003cspan address=\"10.1016/j.slast.2024.100212\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFerre CA, Thouard A, Betourne A, Le Dorze AL, Belenguer P, Miquel MC, Peyrin JM, Gonzalez-Dunia D, Szelechowski M (2021) HSPA9/Mortalin mediates axo-protection and modulates mitochondrial dynamics in neurons. Sci Rep 11:17705. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-021-97162-1\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-97162-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSojka DR, Abramowicz A, Adamiec-Organisciok M, Karnas E, Mielanczyk L, Kania D, Blamek S, Telka E, Scieglinska D (2023) Heat shock protein A2 is a novel extracellular vesicle-associated protein. Sci Rep 13:4734. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-023-31962-5\u003c/span\u003e\u003cspan address=\"10.1038/s41598-023-31962-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCao L, Yuan X, Bao F, Lv W, He Z, Tang J, Han J, Hu J (2019) Downregulation of HSPA2 inhibits proliferation via ERK1/2 pathway and endoplasmic reticular stress in lung adenocarcinoma. Ann Transl Med 7:540. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21037/atm.2019.10.16\u003c/span\u003e\u003cspan address=\"10.21037/atm.2019.10.16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMontresor S, Pigazzini ML, Baskaran S, Sleiman M, Adhikari G, Basilicata L, Secker L, Jacob N, Ehlert Y, Kelkar A, Kalsi GK, Kulkarni N, Spellerberg P, Kirstein J (2025) HSP110 is a modulator of amyloid beta (Abeta) aggregation and proteotoxicity. J Neurochem 169:e16214. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jnc.16214\u003c/span\u003e\u003cspan address=\"10.1111/jnc.16214\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNachman E, Wentink AS, Madiona K, Bousset L, Katsinelos T, Allinson K, Kampinga H, McEwan WA, Jahn TR, Melki R, Mogk A, Bukau B, Nussbaum-Krammer C (2020) Disassembly of Tau fibrils by the human Hsp70 disaggregation machinery generates small seeding-competent species. J Biol Chem 295:9676\u0026ndash;9690. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.RA120.013478\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA120.013478\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbayev-Avraham M, Salzberg Y, Gliksberg D, Oren-Suissa M, Rosenzweig R (2023) DNAJB6 mutants display toxic gain of function through unregulated interaction with Hsp70 chaperones. Nat Commun 14:7066. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-023-42735-z\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-42735-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcMahon S, Bergink S, Kampinga HH, Ecroyd H (2021) DNAJB chaperones suppress destabilised protein aggregation via a region distinct from that used to inhibit amyloidogenesis. J Cell Sci 134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/jcs.255596\u003c/span\u003e\u003cspan address=\"10.1242/jcs.255596\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaker HA, Bernardini JP, Csizmok V, Madero A, Kamat S, Eng H, Lacoste J, Yeung FA, Comyn S, Hui E, Calabrese G, Raught B, Taipale M, Mayor T (2025) The co-chaperone DNAJA2 buffers proteasomal degradation of cytosolic proteins with missense mutations. J Cell Sci 138. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/jcs.262019\u003c/span\u003e\u003cspan address=\"10.1242/jcs.262019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang D, Wang YS, Zhao HM, Lu P, Li M, Li W, Cui HT, Zhang ZY, Lv SQ (2025) Plantamajoside improves type 2 diabetes mellitus pancreatic beta-cell damage by inhibiting endoplasmic reticulum stress through Dnajc1 up-regulation. World J Diabetes 16:99053. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4239/wjd.v16.i2.99053\u003c/span\u003e\u003cspan address=\"10.4239/wjd.v16.i2.99053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePerez VA, Sanders DW, Mendoza-Oliva A, Stopschinski BE, Mullapudi V, White CL, Joachimiak LA, Diamond MI (2023) DnaJC7 specifically regulates tau seeding. Elife 12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7554/eLife.86936\u003c/span\u003e\u003cspan address=\"10.7554/eLife.86936\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHammond CM, Bao H, Hendriks IA, Carraro M, Garcia-Nieto A, Liu Y, Reveron-Gomez N, Spanos C, Chen L, Rappsilber J, Nielsen ML, Patel DJ, Huang H, Groth A (2021) DNAJC9 integrates heat shock molecular chaperones into the histone chaperone network. Mol Cell 81:2533\u0026ndash;2548e9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2021.03.041\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2021.03.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan L, Song Z, Deng X, Zheng W, Guo Y, Yang Z, Deng H (2016) Systematic analysis of genetic variants in Han Chinese patients with sporadic Parkinson's disease. Sci Rep 6:33850. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep33850\u003c/span\u003e\u003cspan address=\"10.1038/srep33850\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Neurodegenerative disease, molecular chaperone, HSPA, DNAJB, proteotoxicity","lastPublishedDoi":"10.21203/rs.3.rs-6870464/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6870464/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMolecular chaperones are an integral part of protein quality control systems and are induced by various environmental, chemical, heat and genetic stress factors. In neurodegenerative diseases, where protein misfolding and aggregation are the hallmark features, several stress factors are involved in the initiation of disease pathogenesis; however, the response of molecular chaperones under these conditions is not well understood. In the present study, the expression profile of major chaperone HSPA and its co-chaperone DNAJ proteins are analysed under oxidative, proteotoxic and heat stress conditions to provide a comparative profile of their expression. Different stress inducers resulted in dynamic and selective expression of HSPA and DNAJ proteins. A unique molecular imprint of HSPA1 (HSP70), HSPA8 (HSC70) and HSPH1(HSP110) was observed for proteotoxic conditions. Similarly, the DNAJB1 protein was upregulated in all stress conditions, while the specificity of DNAJB8 was observed for proteotoxic stress. The dynamic expression of chaperones was regulated by HSF1 and NRF2 transcriptional regulators. HSF1 expression was increased in all conditions, while NRF2 activation was selective for oxidative and heat stress. The results suggested molecular imprints of chaperones for specific stress conditions may assist in selecting the appropriate targets for modifications in protein aggregation-associated diseases.\u003c/p\u003e","manuscriptTitle":"Cellular DNAJBs are selectively associated with proteotoxic stress and underlying mechanisms in neurodegenerative conditions","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-31 17:05:15","doi":"10.21203/rs.3.rs-6870464/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-17T20:59:25+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-05T10:50:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-09T00:56:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"100297684077786807174806103105859478710","date":"2025-07-29T23:31:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"306975693115672125228113172208647557299","date":"2025-07-29T19:39:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-29T18:47:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-17T20:20:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-12T04:23:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular and Cellular Biochemistry","date":"2025-06-11T09:50:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"253b1072-941a-419b-bf61-0e63cf189658","owner":[],"postedDate":"July 31st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-02T16:09:04+00:00","versionOfRecord":{"articleIdentity":"rs-6870464","link":"https://doi.org/10.1007/s11010-026-05484-3","journal":{"identity":"molecular-and-cellular-biochemistry","isVorOnly":false,"title":"Molecular and Cellular Biochemistry"},"publishedOn":"2026-01-29 15:58:08","publishedOnDateReadable":"January 29th, 2026"},"versionCreatedAt":"2025-07-31 17:05:15","video":"","vorDoi":"10.1007/s11010-026-05484-3","vorDoiUrl":"https://doi.org/10.1007/s11010-026-05484-3","workflowStages":[]},"version":"v1","identity":"rs-6870464","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6870464","identity":"rs-6870464","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00