The effect of intravenous remdesivir on endometrial receptivity in female mice

Pregnant women with coronavirus disease 2019 (COVID-19) are more likely than nonpregnant women to require admission to an intensive care unit, and many may require antiviral therapy. Remdesivir, an antiviral drug used to treat COVID-19, may exert toxic effects on specific tissues and organs. Therefore, this study investigated the effects of remdesivir on endometrial tissue in pregnant female mice.

Thirty female Naval Medical Research Institute (NMRI) mice were divided into five groups. The control group received no treat- ment, and the sham group received the remdesivir solvent, dimethyl sulfoxide. The 2-, 4-, and 8-mg groups received the corresponding doses of remdesivir. Treatment continued for 10 days. After injection and mating, the presence of a vaginal plug was considered to indicate gesta- tional day 1. On gestational day 4.5, uterine tissue damage, pinopode status, serum estradiol levels, and tissue expression of interleukin-6 and interleukin-1β were examined.

Serum estradiol levels and interleukin-6 expression in endometrial tissue decreased in a dose-dependent manner after remdesivir treatment. Remdesivir treatment was also associated with fewer uterine pinopodes and histological evidence of endometrial tissue injury (p<0.05).

In pregnant mice, remdesivir reduced serum estradiol levels, decreased the number of endometrial pinopodes, and suppressed interleukin-6 expression. These findings suggest that remdesivir may adversely affect the endometrium and potentially compromise implan- tation; however, direct functional validation is required.

COVID-19; Endometrial injury; Remdesivir

Coronavirus disease 2019 (COVID-19) can cause severe illness, un- derscoring the need for drug therapies that reduce symptoms, accel- erate recovery, and prevent death [1]. According to the U.S. Centers for Disease Control and Prevention, from January 22 to June 7, 2020, 9% of women with COVID-19 were pregnant, and 9%–14% of these women had severe or critical illness. Pregnant women with COVID-19 are also more likely than nonpregnant women to require admission to an intensive care unit [2]. Remdesivir (RDV) is an antiviral drug that inhibits RNA virus repli- cation by targeting RNA-dependent RNA polymerase. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), an RNA virus, can also be inhibited by RDV [1]. The U.S. Food and Drug Administration approved RDV as the first antiviral drug for COVID-19 [3]. RDV has shown activity against SARS-CoV-2 replication in cultured cells and in animal and human models [4,5]. However, some studies have re- ported that RDV may exert toxic effects on specific tissues and or- gans, indicating the need for further investigation of the underlying mechanisms [3,6,7]. Successful implantation requires bidirectional crosstalk between the embryo and the endometrium [8]. Defects in this communica- tion can lead to implantation failure, a major problem in reproduc- tive medicine and an important cause of infertility. Uterine receptivi- ty is regulated by the ovarian hormones estrogen and progesterone, which also influence cytokines and growth factors involved in em- bryo–uterine interactions during implantation [9]. Factors that affect the embryo, uterus, or these regulatory mediators may therefore im- pair implantation. To date, information on the adverse reproductive effects of RDV, particularly on embryo implantation, remains limited, partly because reproductive toxicity is difficult to assess. Evaluating drug-related adverse effects during pregnancy is especially challeng- ing because pregnant women and women planning pregnancy are typically excluded from human clinical trials [10,11]. In a study evalu- ating the effect of RDV on pregnant mouse embryos during organo- genesis, embryos exposed to RDV showed growth retardation and skeletal abnormalities [12]. In a study of 67 hospitalized pregnant women with COVID-19 who were treated with RDV, 33% experi - enced adverse events, 18% of which were serious and mostly preg- nancy-related [2]. In another study of five pregnant patients, one pa- tient discontinued RDV after six doses because of worsening trans- aminitis [13]. In contrast, a study of six pregnant women with Ebola virus disease who received RDV reported no adverse events [ 14]. Overall, human data on the effects of RDV during pregnancy remain very limited. Available data suggest a lower risk of adverse events during the second and third trimesters, but little is known about ex- posure during the first trimester [15]. As COVID-19 continues to circulate, many women of reproductive age may require antiviral treatment while also wishing to preserve fertility. Therefore, the potential reproductive toxicity of RDV war- rants further investigation. To our knowledge, no study has evaluat- ed the effects of RDV on implantation, and its effects on endometrial function remain poorly understood. This study evaluated the effects of RDV on the endometrium in pregnant mice.

1. Animals and study groups Thirty adult female Naval Medical Research Institute (NMRI) mice, 8 weeks old and weighing 25–35 g, were obtained from the Experi- mental Studies Center at Iran University of Medical Sciences, Tehran, Iran. All experimental procedures followed National Institutes of Health guidelines and were approved by the Research Ethics Com- mittee of Iran University of Medical Sciences (ethics code: IR.IUMS. AEC.1402.036). The animals were maintained under controlled labo- ratory conditions, including a 12-hour light/12-hour dark cycle, a constant temperature of 22–25 °C, and ad libitum access to food and water. 2. Drug preparation and administration RDV (batch No. CB48011; Ronak Daru Pharmaceutical Company) was freshly prepared and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich). After a 3-day acclimatization period, the mice were randomly assigned to five groups of six mice each and treated for 10 days. • Control group: No treatment was administered. • Sham group: DMSO was administered intravenous once daily at a volume similar to that used in the RDV-treated groups. • RDV 1 group: RDV was administered intravenous once daily at a dose of 2 mg. • RDV 2 group: RDV was administered intravenous once daily at a dose of 4 mg. • RDV 3 group: RDV was administered intravenous once daily at a dose of 8 mg. After the treatment period, female mice were paired with repro- ductively active male mice of the same strain. The next morning, the mice were examined for the presence of a vaginal plug, which was considered to indicate gestational day 1 (GD 1). On GD 4.5, mice were euthanized after administration of ketamine and xylazine (100 and 10 mg, respectively; intravenous), and the uterine horns were collected for further examination. All analyses were performed by a skilled technician who was blinded to the experimental groups. 3. Histological studies Uterine specimens were fixed in 10% formalin for 72 hours and then processed for paraffin embedding. Sections were cut at a thick- ness of 5 mg/kg using a microtome (DS8402; Didsabz), stained with hematoxylin and eosin (H&E), and examined under a light micro- scope. 4. Pinopode examination using scanning electron microscopy To examine the luminal surface of the endometrium, tissues were first fixed in 2.5% glutaraldehyde for 2 hours at 4 °C. The samples were then dehydrated using increasing ethanol concentrations of 50%, 70%, 96%, and 100% and dried by the critical-point method. A thin layer of gold was subsequently applied to the sample surfaces. Surface imaging was performed using a scanning electron micro- scope (AIS2100; Seron Technology). https://doi.org/10.5653/cerm.2026.091382 Clin Exp Reprod Med [Epub ahead of print] 5. RNA isolation, cDNA synthesis, and quantitative real-time polymerase chain reaction The expression of genes involved in the inflammatory pathway, including interleukin-6 (IL-6) and IL-1β, was evaluated using quanti- tative real-time polymerase chain reaction (PCR). Technical replicates were performed in triplicate for all samples. Total RNA was extracted from endometrial tissue using TRIzol reagent (Millipore Sigma, Sig- ma-Aldrich), followed by chloroform-mediated phase separation. The quantity and quality of the isolated RNA were evaluated using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.). RNA purity and concentration were determined spectrophotometrically using the A260/A280 ratio. Complementary DNA (cDNA) was then synthesized from the extracted RNA using a Fermentas kit (Thermo Fisher Scientific). Real-time quantitative PCR was conducted using SYBR Green (Takara Bio) on a real-time PCR system (Corbett Re - search). Each 10-µL reaction mixture contained 250 ng of cDNA and 5 pmol of each forward and reverse primer. Relative gene expression was calculated using the 2^−ΔΔCt method, with β-actin as the inter- nal reference gene. The primer sequences are shown in Table 1. 6. Serum hormone and cytokine assays Blood was collected from each mouse by cardiac puncture. Serum was separated by centrifugation at 5,000 ×g for 15 minutes at room temperature and stored at −80 °C. Estradiol, IL-6, and IL-1β concen- trations were measured using enzyme-linked immunosorbent assay kits for estradiol (KGE014; R&D Systems), IL-6 (MLB00C-1; R&D Sys- tems), and IL-1β (M6000B; R&D Systems). Absorbance was measured at 450 nm using a microplate reader (Garni 3200). Cytokine and hor- mone concentrations were calculated from standard curves. 7. Statistical analysis Data were analyzed using GraphPad Prism 8.0 (GraphPad Software Inc.). Normality was assessed using the Kolmogorov–Smirnov test. Differences among groups were evaluated using one-way analysis of variance followed by Tukey’s post hoc test. Results are reported as the mean±standard deviation. Statistical significance was defined as p<0.05.

1. Effects of remdesivir on serum reproductive hormone levels As shown in Figure 1, mean serum estradiol levels were signifi- cantly lower in animals treated with RDV at 2, 4, or 8 mg than in the control group (p<0.05). Serum estradiol levels decreased significant- ly as the RDV dose increased (p<0.05). 2. Endometrial morphology with H&E staining: histological findings in the control and sham groups Examination of tissue sections from the control and sham groups showed that the mucosal epithelium had a uniform, simple colum- nar structure. No vacuoles were observed in the subepithelial layer. The number of lymphocytes was within the expected range, and no significant inflammatory change was observed. The blood vessels in this region did not differ from the normal state in number or dilation. No extravascular red blood cells were observed, indicating the ab- sence of an inflammatory process in the control and sham groups Table 1. Primer sequences for IL-6, IL-1β, and β-actin Gene Subgroup Sequence (5’→3’) Length (nt) Tm (°C) GC% Self-complementarity Self-3’ complementarity IL-6 Forward AGACTTCCATCCAGTTGCCTT 21 59.29 47.62 3.00 0.00 Reverse TTCCACGATTTCCCAGAGAACA 22 59.63 45.45 5.00 3.00 IL-1β Forward TGCCACCTTTTGACAGTGATGA 22 59.38 45.45 5.00 2.00 Reverse TTGATGTGCTGCTGCGAGATT 21 60.42 45.45 3.00 2.00 β-actin Forward CAAGATCATTGCTCCTCCTG 20 60.95 47.62 4.00 2.00 Reverse ATCCACATCTGCTGGAAGG 19 57.3 52.60 6.00 0.00 IL, interleukin; nt, nucleotide; Tm, melting temperature; GC%, guanine–cytosine content. 36. Sequeira K, Espejel-Nunez A, Vega-Hernandez E, Molina-Hernandez A, Grether-Gonzalez P. An increase in IL-1b concentrations in embryo culture-conditioned media obtained by in vitro fertilization on day 3 is related to successful implantation. J Assist Reprod Genet 2015;32:1623-7. Figure 1. Remdesivir at doses of 2, 4, and 8 mg altered serum estradiol (E2) levels in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnotes indicate significant differences compared with the control group: a)p<0.05; b)p<0.001. To 출판사 *, **를 각 a), b) 윗첨자로 수정해주세요 Figure 1. Remdesivir at doses of 2, 4, and 8 mg altered serum estradiol (E2) levels in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnotes indicate significant differences compared with the control group: a) p<0.05; b) p<0.001. a) b) www.eCERM.org 3 JS Mirsanei et al. The effect of remdesivir on endometrial receptivity E2 concentration (pg/mL) Figure 2. Hematoxylin and eosin staining of endometrial tissue. (A) Control group, (B) sham group, (C) 2-mg group, (D) 4-mg group, and (E) 8-mg group. Black arrows indicate lymphocyte accumulation. Black arrowheads mark the epithelial layer. Stars denote multiple blood vessels. Yellow arrowheads indicate vacuoles beneath the epithelium. White arrows indicate red blood cells between tissue cells. (Figure 2A, 2B). In the 2-mg group, slight histological changes were observed compared with the control group. The epithelium main- tained its normal structure, although minor changes were present, including increased lymphocyte numbers and vascular alterations. These findings suggest the onset of an inflammatory process in this group (Figure 2C). In the 4-mg group, histological changes were more pronounced than those in the control and low-dose groups. In some areas, the epithelium had lost its uniformity and normal mor- phology. Vacuoles were observed in the subepithelial layer. Blood vessels in this region were markedly increased in number and showed severe dilation, suggesting exacerbation of the inflammato- ry process in this group (Figure 2D). The most severe tissue changes were observed in the 8-mg group. The number of lymphocytes in the subepithelial region was markedly increased. In some areas, the epithelium was disrupted and separated from the underlying layer. Red blood cells were also observed between tissue cells and outside blood vessels. Together with vascular rupture, these findings suggest severe inflammation and extensive tissue damage in the high-dose group (Figure 2E). 3. Effects of remdesivir on pinopodes Figure 3 shows scanning electron microscopy images of the endo- metrial ultrastructure and the endometrial pinopode score in mice. Endometrial pinopodes were significantly reduced as the RDV dose increased. 4. Effects of remdesivir on IL-1β and IL-6 gene expression As shown in Figure 4, mean IL-1β expression was lower in animals receiving 4 mg RDV than in the control and sham groups; however, this difference was not statistically significant (p<0.05). Mean IL-1β expression was higher in animals receiving 2 and 8 mg RDV than in the control and sham groups, but these differences were also not statistically significant (p<0.05). In contrast, mean IL-6 expression was significantly lower in animals receiving 2, 4, or 8 mg RDV than in the control and sham groups (p<0.05).

This study showed that administration of RDV at doses of 2, 4, and 8 mg for 10 days in adult female mice was associated with a dose-de- pendent reduction in serum estradiol levels. The histological alter- ations observed, including lymphocyte infiltration, vascular dilation, and epithelial disruption, are more consistent with a nonspecific in- flammatory or toxic insult than with selective impairment of the en- dometrial receptivity program. Therefore, the reductions in pinopo- des and IL-6 expression may represent downstream consequences of broader RDV-associated inflammatory injury rather than direct, specific effects on implantation-related pathways. Under the influ- ence of estradiol secreted by the ovaries, the endometrium enters a proliferative state. Estradiol levels and the estradiol-to-progesterone https://doi.org/10.5653/cerm.2026.091384 Clin Exp Reprod Med [Epub ahead of print] AA BB CC DD EE Figure 3. Remdesivir at doses of 2, 4, and 8 mg altered the pinopode score in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnote indicates significant differences compared with the control group: a) p<0.05. Figure 4. Remdesivir at doses of 2, 4, and 8 mg altered (A) interleukin-1β (IL-1β) and (B) interleukin-6 (IL-6) gene expression in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. a) p<0.05; b) p<0.001. Figure 2. Hematoxylin and eosin staining of endometrial tissue. (A) Control group, (B) sham group, (C) 2-mg/kg group, (D) 4-mg/kg group, and (E) 8-mg/kg group. Black arrows indicate lymphocyte accumulation. Black arrowheads mark the epithelial layer. Stars denote multiple blood vessels. Yellow arrowheads indicate vacuoles beneath the epithelium. White arrows indicate red blood cells between tissue cells. Figure 3. Remdesivir at doses of 2, 4, and 8 mg altered the pinopode score in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnote indicates significant differences compared with the control group: a)p<0.05. To 출판사 *를 a) 윗첨자로 수정해주세요 Figure 2. Hematoxylin and eosin staining of endometrial tissue. (A) Control group, (B) sham group, (C) 2-mg/kg group, (D) 4-mg/kg group, and (E) 8-mg/kg group. Black arrows indicate lymphocyte accumulation. Black arrowheads mark the epithelial layer. Stars denote multiple blood vessels. Yellow arrowheads indicate vacuoles beneath the epithelium. White arrows indicate red blood cells between tissue cells. Figure 3. Remdesivir at doses of 2, 4, and 8 mg altered the pinopode score in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. Footnote indicates significant differences compared with the control group: a)p<0.05. To 출판사 *를 a) 윗첨자로 수정해주세요 Figure 4. Remdesivir at doses of 2, 4, and 8 mg altered (A) interleukin-1β (IL-1β) and (B) interleukin-6 (IL-6) gene expression in Naval Medical Research Institute (NMRI) mice. Data are shown as the mean±standard deviation. a)p<0.05; b)p<0.001. To 출판사 *, **를 각 a), b) 윗첨자로 수정해주세요 a) a) a) b) Pinopode score ratio regulate estrogen receptors and progesterone receptors in en- dometrial cells. During the receptive window, estrogen receptor α is downregulated in the endometrial epithelium, reducing responsive- ness to estradiol and preventing blastocyst rejection. Through estro- gen receptors, estradiol induces the expression of genes involved in the cell cycle, tissue remodeling, and signaling, all of which are es- sential for endometrial preparation. Pinopodes are transient protru- sions on the surface of endometrial epithelial cells that appear late in the receptive phase, after initial estradiol exposure and under pro- gesterone dominance. Their appearance is associated with increased progesterone and a relative decrease in estradiol during the recep- tive phase [ 16]. Pinopodes mark the receptive window and are thought to contribute to uterine fluid uptake and close contact with the blastocyst. Through progesterone receptors, progesterone acti- vates pathways such as hedgehog, homeobox A10 (HOXA10), and Indian hedgehog, which are essential for cell differentiation and pinopode formation. At implantation, a local, controlled inflammato- ry response is initiated by endometrial cells and uterine immune www.eCERM.org 5 JS Mirsanei et al. The effect of remdesivir on endometrial receptivity cells, including macrophages and uterine natural killer cells. Leukot- rienes, especially leukotriene B4, and cyclooxygenase-2 are derived from arachidonic acid [17]. Cytokines such as IL-11, leukemia inhibi- tory factor, and transforming growth factor β also contribute to this process. Estradiol and progesterone can increase cyclooxygenase-2 expression and prostaglandin estradiol production, promoting vaso- dilation and increased vascular permeability at the implantation site. This controlled inflammation is essential for extracellular matrix re- modeling, increased blood flow, and blastocyst adhesion and inva- sion. Key genes induced alongside pinopode formation and inflam- mation include leukemia inhibitory factor, which is essential for en- dometrial receptivity and implantation and is upregulated by estra- diol and progesterone. HOXA10 and HOXA11 are progesterone-in- duced transcription factors that are critical for uterine development and endometrial receptivity. Integrins, such as αVβ3, are adhesion molecules expressed on epithelial cell surfaces and contribute to blastocyst adhesion. Insulin-like growth factor-binding protein 1 is secreted by the endometrial stroma and helps regulate trophoblast invasion. Protease inhibitors, such as plasminogen activator inhibitor 1, are important for regulating matrix degradation and controlled blastocyst invasion [18]. Previous studies have indicated that ovarian steroids, including estrogen and progesterone, play a critical regula- tory role by activating molecular modulators and supporting em- bryo implantation [19]. During implantation, ovarian steroids alter endometrial morphology and function, thereby mediating blasto- cyst attachment [20]. Successful implantation therefore depends on both hormone concentrations and receptor expression [21,22]. An elevated estrogen-to-progesterone ratio controls the expres- sion of integrin molecules that are essential for blastocyst attach- ment to the uterine epithelium [23]. Estrogen can also induce endo- metrial angiogenesis [24]. The dose-dependent reduction in estradi- ol observed in this study is consistent with the possibility that higher RDV doses may disrupt hormonal signaling and reduce the expres- sion of endometrial adhesion molecules necessary for endometrial receptivity. During the window of receptivity, balloon-shaped projections called pinopodes form on the uterine surface in humans, rats, and mice. These structures are therefore useful indicators of endometrial receptivity. Studies have shown a direct correlation between pino- pode number and implantation rate, although the biological role of pinopodes remains unclear. During implantation, pinopodes interdigitate with microvilli on the syncytiotrophoblast layer of the blastocyst. These outgrowths can be readily identified using scanning electron microscopy [25]. In mice, pinopodes begin to develop on day 3.5 of pregnancy, 1 day before embryo implantation, and their population peaks by day 8.5 [21]. Therefore, we imaged the endometrium of mice on GD 4.5. Scanning electron microscopy of endometrial ultrastructure showed fewer pinopodes in the RDV-treated groups, a finding that previous studies suggest is associated with a reduced likelihood of implanta- tion. In the present study, endometrial pinopodes decreased sub- stantially as the RDV dose increased. This study showed that mean IL-6 expression was lower in mice treated with all three RDV doses. This finding suggests that RDV may adversely affect endometrial receptivity and, consequently, fertility in NMRI mice. Consistent with our findings, a study of IL-6-deficient mice showed that IL-6 plays an important role during implantation, with reduced IL-6 leading to decreased implantation and fertility. In addition, the presence of IL-6 receptors on the endometrium and blastocyst supports a paracrine and autocrine role for IL-6 during im- plantation in murine species [26]. In humans, IL-6 receptor expres- sion during the menstrual cycle suggests that IL-6 may also influence endometrial receptivity and implantation beyond a strictly spe - cies-specific mechanism [19]. Previous studies have suggested that immunological and inflam- matory responses are elicited during the implantation window. Be- fore blastocyst arrival, endometrial stromal cells release proinflam- matory cytokines, including tumor necrosis factor α and IL-1β, to ini- tiate an inflammatory response [27]. Therefore, detection of these key initiators of inflammatory and immunological reactions may help predict implantation [28]. IL-1β mediates human in vitro decid- ualization and induces uterine natural killer cells to release chemok- ines and other factors required for implantation [29]. Local macro- phages also enhance fucosylated structures by releasing leukemia inhibitory factor and IL-1β, which promotes trophectoderm adhesion to the uterine surface before embryo implantation [30-32]. IL-1β and tumor necrosis factor α also regulate trophoblastic matrix metallo- proteinases 2, 3, and 9, thereby contributing to trophoblast invasion into the endometrium [ 33-35]. Sequeira et al. [ 36] reported that pregnancy after in vitro fertilization was positively correlated with high IL-1β levels in day 3 culture-conditioned medium, supporting a role for embryonic IL-1β in implantation. In the present study, mean IL-1β expression tended to increase in the 2- and 8-mg RDV-treated groups, whereas mean IL-1β expression decreased in the 4-mg RDV-treated group compared with the control and sham groups; however, these differences were not statistically significant (p<0.05). Several factors may explain these findings. First, the relatively small sample size in each group may have limited the statistical power to detect meaningful differences. Second, high within-group variability may have masked true between-group differences. Third, RDV may have only a small biological effect on IL-1β expression, requiring a larger animal sample or more sensitive analytical methods for confir- mation. Therefore, our findings suggest that RDV may have potential biological effects on IL-1β expression, but further studies with larger https://doi.org/10.5653/cerm.2026.091386 Clin Exp Reprod Med [Epub ahead of print] cohorts and reduced variability are required to determine whether these observations are statistically significant. Despite its significant findings, this study had several limitations. Molecular markers of endometrial receptivity, such as leukemia in- hibitory factor, HOXA10, and integrins, were not directly measured because of financial constraints. Therefore, the interpretations re- main correlational and do not establish a direct causal relationship between RDV exposure and impaired endometrial receptivity. The most important limitation is the absence of functional implantation assays, such as counting implantation sites on GD 7–8. Therefore, we cannot definitively conclude that RDV causes implantation failure. This study provides only correlative histological, hormonal, and gene expression data. Conclusions about actual reproductive outcomes require future functional studies. Other important factors involved in endometrial receptivity and related signaling pathways were also not examined. In addition, this study assessed mice only up to day 4.5 after mating. Future studies should include longer follow-up in- tervals to evaluate actual pregnancy outcomes, including implanta- tion rate, ongoing pregnancy, and live birth. Further research on mo- lecular markers and fertility outcomes could improve understanding of the underlying mechanisms and inform appropriate clinical strate- gies. Future studies should consider functional tests, such as mouse im- plantation models; comprehensive hormonal profiling, including progesterone measurement; more extensive immune and stromal analyses, such as immunohistochemistry for macrophages and uter- ine natural killer cells; and rescue experiments using anti-inflamma- tory agents or growth factors. In pregnant mice, RDV reduced serum estradiol levels, decreased the number of endometrial pinopodes, and suppressed IL-6 expres- sion. These findings suggest that RDV may adversely affect endome- trial tissue and impair endometrial receptivity; however, functional implantation studies are required before concluding that RDV causes implantation failure. Conflict of interest No potential conflict of interest relevant to this article was report- ed. Acknowledgments The authors gratefully acknowledge financial support from Iran University of Medical Sciences. ORCID Jamileh Sadat Mirsanei https://orcid.org/0000-0002-7312-3701 Mehdi Mehdizadeh https://orcid.org/0000-0002-9268-7318 Marziyeh Ajdary https://orcid.org/0000-0002-4154-7788 Author contributions Conceptualization: JSM, AG, MM, MA. Formal analysis: ZA, RM, RS. Data curation: ZA, RM, RS. Funding acquisition: MM. Visualization: ZA, RM, RS. Software: ZA, RM, RS. Validation: MM, MA. Investigation: MM, MA. Supervision: MM, MA. Writing-original draft: JSM, AG. Writing-re- view & editing: MM, MA.

1. Kokic G, Hillen HS, Tegunov D, Dienemann C, Seitz F , Schmitzova J, et al. Mechanism of SARS-CoV-2 polymerase stalling by remde- sivir. Nat Commun 2021;12:279. 2. Burwick RM, Yawetz S, Stephenson KE, Collier AY , Sen P , Blackburn BG, et al. Compassionate use of remdesivir in pregnant women with severe coronavirus disease 2019. Clin Infect Dis 2021;73: e3996-4004. 3. Bjork JA, Wallace KB. Remdesivir; molecular and functional mea- sures of mitochondrial safety. Toxicol Appl Pharmacol 2021;433:115783. 4. Goldman JD, Lye DC, Hui DS, Marks KM, Bruno R, Montejano R, et al. Remdesivir for 5 or 10 days in patients with severe COVID-19. N Engl J Med 2020;383:1827-37. 5. Pagliano P , Sellitto C, Scarpati G, Ascione T, Conti V, Franci G, et al. An overview of the preclinical discovery and development of remdesivir for the treatment of coronavirus disease 2019 (COVID-19). Expert Opin Drug Discov 2022;17:9-18. 6. Akinci E, Cha M, Lin L, Yeo G, Hamilton MC, Donahue CJ, et al. Eluci- dation of remdesivir cytotoxicity pathways through genome-wide CRISPR-Cas9 screening and transcriptomics. bioRxiv [Preprint] 2020 Aug 28. https://doi.org/10.1101/2020.08.27.270819 7. Fan Q, Zhang B, Ma J, Zhang S. Safety profile of the antiviral drug remdesivir: an update. Biomed Pharmacother 2020;130:110532. 8. Govahi A, Nasr-Esfahani MH, Amjadi F , Mahdevar M, Mehdizadeh R, Mehdizadeh M. Cutting-edge techniques provide insights re- garding repeated implantation failure patients. Reprod Biomed Online 2023;46:687-96. 9. Hamid HY, Zakaria MZ. Embryo implantation: shedding light on the roles of ovarian hormones, cytokines and growth factors in the implantation process. Afr J Biotechnol 2012;11:16297-304. 10. European Medicines Agency. Summary on compassionate use: www.eCERM.org 7 JS Mirsanei et al. The effect of remdesivir on endometrial receptivity remdesivir gilead [Internet]. EMA; 2020 [cited 2026 Jul 20]. Avail- able from: https://www.ema.europa.eu/en/documents/other/ summary-compassionate-use-remdesivir-gilead_en.pdf 11. Jorgensen SC, Davis MR, Lapinsky SE. A review of remdesivir for COVID-19 in pregnancy and lactation. J Antimicrob Chemother 2021;77:24-30. 12. Atta M, Bakery A, Adel M, Fadl A. Developmental toxicity induced by prenatal exposure to remdesivir in pregnant female rats and their offspring. Egypt Acad J Biol Sci B Zool 2024;16:105-20. 13. McCoy JA, Short WR, Srinivas SK, Levine LD, Hirshberg A. Compas- sionate use of remdesivir for treatment of severe coronavirus dis- ease 2019 in pregnant women at a United States academic cen- ter. Am J Obstet Gynecol MFM 2020;2:100164. 14. Mulangu S, Dodd LE, Davey RT, Tshiani Mbaya O, Proschan M, Mu- kadi D, et al. A randomized, controlled trial of Ebola virus disease therapeutics. N Engl J Med 2019;381:2293-303. 15. Lampejo T. Remdesivir for the treatment of COVID-19 in pregnan- cy. J Med Virol 2021;93:4114-9. 16. Yang Y, Ru H, Zhang S, Wu C, Dong J, Wang X, et al. The effect of granulocyte colony-stimulating factor on endometrial receptivity of implantation failure mouse. Reprod Sci 2025;32:200-17. 17. Karimi S, Baharaghdam S, Danaii S, Yousefi M. Embryo-maternal cross-talk: key players in successful implantation and live birth rates. Reprod Biol Endocrinol 2025;23:136. 18. Li J, Liu H, Lim J, Xing H, Chen Y , Yang S, et al. Molecular and biolog- ical markers for assessing endometrial receptivity in infertile wom- en: a narrative review. J Int Med Res 2025;53:3000605251328893. 19. Singh M, Chaudhry P , Asselin E. Bridging endometrial receptivity and implantation: network of hormones, cytokines, and growth factors. J Endocrinol 2011;210:5-14. 20. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, et al. Molecu- lar cues to implantation. Endocr Rev 2004;25:341-73. 21. Lessey BA. Two pathways of progesterone action in the human endometrium: implications for implantation and contraception. Steroids 2003;68:809-15. 22. Ma WG, Song H, Das SK, Paria BC, Dey SK. Estrogen is a critical de- terminant that specifies the duration of the window of uterine re- ceptivity for implantation. Proc Natl Acad Sci USA 2003;100:2963- 8. 23. Basak S, Dhar R, Das C. Steroids modulate the expression of al- pha4 integrin in mouse blastocysts and uterus during implanta- tion. Biol Reprod 2002;66:1784-9. 24. Demir R, Yaba A, Huppertz B. Vasculogenesis and angiogenesis in the endometrium during menstrual cycle and implantation. Acta Histochem 2010;112:203-14. 25. Abd ElFattah LI. Pinopodes. Egypt J Histol 2012;35:633-9. 26. Robertson SA, O'Connell A, Ramsey A. The effect of interleukin-6 deficiency on implantation, fetal development and parturition in mice. In: Proceeding of the 31st Annual Conference of the Austra- lian Society for Reproductive Biology; 2000 Apr 26-30; Canberra, Australia. 27. Hinduja I, Pathare AD, Zaveri K, Hinduja I. Immunological ap - proach of personalized treatment for recurrent implantation fail- ure patients undergoing IVF . Glob J Reprod Med 2018;5:65-7. 28. Salama KM, Alloush MK, Al Hussini RM. Are the cytokines TNF al- pha and IL 1beta early predictors of embryo implantation?: cross sectional study. J Reprod Immunol 2020;137:102618. 29. Prutsch N, Fock V, Haslinger P , Haider S, Fiala C, Pollheimer J, et al. The role of interleukin-1b in human trophoblast motility. Placenta 2012;33:696-703. 30. Nakamura H, Jasper MJ, Hull ML, Aplin JD, Robertson SA. Macro- phages regulate expression of a1,2-fucosyltransferase genes in hu- man endometrial epithelial cells. Mol Hum Reprod 2012;18:204-15. 31. Jasper MJ, Care AS, Sullivan B, Ingman WV, Aplin JD, Robertson SA. Macrophage-derived LIF and IL1B regulate alpha(1,2)fucosyl- transferase 2 (Fut2) expression in mouse uterine epithelial cells during early pregnancy. Biol Reprod 2011;84:179-88. 32. Robertson SA, Moldenhauer LM. Immunological determinants of implantation success. Int J Dev Biol 2014;58:205-17. 33. Cohen M, Meisser A, Haenggeli L, Bischof P . Involvement of MAPK pathway in TNF-alpha-induced MMP-9 expression in human tro- phoblastic cells. Mol Hum Reprod 2006;12:225-32. 34. Staun-Ram E, Goldman S, Gabarin D, Shalev E. Expression and im- portance of matrix metalloproteinase 2 and 9 (MMP-2 and -9) in human trophoblast invasion. Reprod Biol Endocrinol 2004;2:59. 35. Meisser A, Chardonnens D, Campana A, Bischof P . Effects of tu- mour necrosis factor-alpha, interleukin-1 alpha, macrophage col- ony stimulating factor and transforming growth factor beta on trophoblastic matrix metalloproteinases. Mol Hum Reprod 1999; 5:252-60. 36. Sequeira K, Espejel-Nunez A, Vega-Hernandez E, Molina-Hernan- dez A, Grether-Gonzalez P . An increase in IL-1b concentrations in embryo culture-conditioned media obtained by in vitro fertiliza- tion on day 3 is related to successful implantation. J Assist Reprod Genet 2015;32:1623-7. https://doi.org/10.5653/cerm.2026.091388 Clin Exp Reprod Med [Epub ahead of print]